A DNA Barcode Library of Some Neuroptera from Azerbaijan

Ilhama G. Kerimova1*, Viktor A.Krivokhatsky2, Merve N. Aydemir3 and Lala N. Mamedova4

1Institute of Zoology, Ministry of Science and Education of the Azerbaijan Republic, A. Abbaszadeh Str., 115, passage 1128, Block 504, Baku Az1004 Azerbaijan.

2Zoological Institute of the Russian Academy of Sciences, Universitetskaya Emb., 1, St. Petersburg 199034 Russia.

3Sivas Cumhuriyet University, Faculty of Science, Department of Molecular Biology and Genetics, Sivas, Turkey.

4Baku State University, Biophysics and Molecular Biology, Baku Azerbaijan.

4Institute of Zoology, National Academy of Sciences of Azerbaijan, A. Abbaszadeh str., 115, Passage 1128, Block 504, Baku, Az1004 Azerbaijan.

Abstract | COI sequences were obtained for 25 species of Neuroptera. It is difficult to recognize the immature antlions of Palpares libelluloides (Linnaeus, 1764) and P. turcicus with similar brown rings on the last abdominal segments. The specimen that could not be determined was marked as “Palpares sp. questionable”. The genetic method has finally solved this question; now Palpares sp. questionable (IGK15) is surely assigned to P. turcicus. Myrmecaelurus solaris (Krivokhatsky, 2002) (IGK2) ML. and M. trigrammus (Pallas, 1781) (IGK22) differ from each other in dendrogram by more than 10%. The NJ tree shows that the genus Myrmecaelurus (Costa, 1855) is supported by 97-100%, and it is connected with another close genus Nohoveus (Navás, 1918) (Azerbaijanian N. zigan) and Chinese population of N. atrifrons (Hölzel, 1970). The sequences of Bubopsis hamata (Klug, 1834) (IGK25) and B. andromache (Aspöck et al., 1979) (IGK26) turned to be identical. A genetic approach forces us to synonymize these two names: Ascalaphus hamata (Klug, 1834) Bubopsis andromache (Aspöck et al., 1979) syn. n. A noticeable convergence of the compact cluster of the genus Bubopsis (Mac Lachlan, 1898) with the owlfly Deleproctophylla variegata (Klug, 1845), which, together belongs to the subfamily (Ascalaphinae Lefèbvre, 1842), indicates a characteristic point of embranchment in the genus Libelloides (Schäffer, 1763) inside Libelloidini Pantaleoni, (Loru, 2018). Thus, Libelloidini is a daughter tribe within Ascalaphinae. Although the support between the clades of L. macaronius kolyvanensis – L. hispanicus ustulatus – D. variegata and B. hamata + B. andromache is not so high (44), it organizes the traditional owlflies of the Ascalaphidae family into one cluster, opposed to the cluster that unites all the studied antlions (Myrmeleontidae). Thus, the proposal to merge the Myrmeleontidae and Ascalaphidae into one family as suggested by Machado et al. (2018) is not supported by our data.

Novelty Statement | The article presents the first report on the DNA analysis of the lacewing insects of Azerbaijan. A total of 25 species of antlions, mantidflies and owlflies were DNA barcoded.

Article History

Received: May 10, 2021

Revised: November 20, 2022

Accepted: December 15, 2022

Published: December 24, 2022

Authors’ Contributions

IGK performed the experiments. All auhtors analyzed the data. MAA and IGK prepared figures. IGK prepared the tables. LNM and IGK collected samples. IGK wrote the first draft. VAK and IGK revised and reviewed the paper.

Keywords

Antlion, Owlfly, Mantidfly, COI, DNA

Copyright 2022 by the authors. Licensee ResearchersLinks Ltd, England, UK. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

Corresponding author: Ilhama G. Kerimova

[email protected]

To cite this article: Kerimova, I.G., Krivokhatsky, V.A., Aydemir, M.N., and Mamedova, L.N., 2022. A DNA barcode library of some neuroptera from Azerbaijan. Punjab Univ. J. Zool., 37(2): 169-174. https://dx.doi.org/10.17582/journal.pujz/2022.37.2.169.174

Introduction

To date, up to 6,000 species of net winged insects have been recorded and described worldwide (Engel et al., 2018). However, there is still a lot of confusion in their taxonomy. Machado et al. (2018) recently suggested a new classification for antlions and owlflies united into one family.

Currently, approaches based on DNA sequence have become increasingly important for assessing biodiversity and identifying species (Taberlet et al., 2012). Our objective is to examine the relationships of the Myrmeleontoidea inhabiting Azerbaijan.

The current composition of the fauna of Myrmeleontidae, Ascalaphidae, Mantispidae, and Nemopteridae in Azerbaijan consists of 38 species. Out of the above-mentioned species, 25 belong to antlions, 6 species to owlflies, 4 species to mantidflies, and 3 species to spoontails (Kerimova and Krivokhatsky, 2018; Kerimova, 2020).

We aimed to use Polymerase chain reaction (PCR) technique to study the molecular similarity or difference of some species and subspecific taxa of Azerbaijan’s neuropterans, which belonged to different subfamilies and tribes and were collected in different locations.

A molecular phylogeny of the Neuropterida was proposed by Haring and Aspöck (2004). Michel et al. (2017) presented a time-calibrated phylogeny of antlions. We repeat this work here on the material collected mainly in Transcaucasia with an emphasis on superfamily Myrmeleontoidea.

Material and Methods

The Neuroptera specimens were collected during the period from 2012 to 2017 using hand nets and light traps. The field works were carried out in the in the following territories: Nakhchivan Autonomous Republic districts, Gobustan district, Siazan, and Shabran districts in northeastern Azerbaijan and the Caspian Sea coastal at the foot of Mountain Beshbarmak (Figure 1, Table 1). For comparison, samples collected outside of Azerbaijan were also included. Most specimens were stored in 95% ethanol but some species, particularly the mantispids (Sagittalata perla (Pallas, 1772), Mantispa scabricollis McLachlan, 1875), and owlflies Bubopsis andromache (Aspöck et al., 1979) and B. hamata (Klug, 1834) were used dry. The species were identified using published keys (Aspöck et al., 1980; Krivokhatsky, 2011). Molecular identifications were carried out by sequencing the DNA barcode region of mitochondrial gene COI. All materials are kept in the Institute of Zoology of the Ministry of Science and Education of the Azerbaijan Republic (Baku).

 

Table 1: Locations where Neuroptera species were collected.

Family	Species	Species code	GenBank accession number	Location of collection
Myrmeleontidae	Palpares libelluloides (Linnaeus, 1764)	IGK1	MT621181	Nakhchivan, Ordubad,
	Palpares turcicus Koçak, 1976	IGK 4	MT621190	Nakhchivan, Ordubad
	Palpares sp. questionable	IGK 15	MT621171	Nakhchivan, Ordubad
	Myrmecaelurus solaris Krivokhatsky, 2002	IGK2	MT621178	Lerik, Gosmolian
	Myrmecaelurus trigrammus (Pallas, 1781)	IGK 22	MT621179	Fizuli
	Acanthaclisis occitanica (Villers, 1789)	IGK 5	MT621180	Siazan, Saadan
	Acanthaclisis occitanica (Villers, 1789)	IGK 6	MT621193	Lerik, Gosmolian
	Acanthaclisis occitanica (Villers, 1789)	IGK 7	MT621182	Nakhchivan, Ordubad,
	Nohoveus zigan (Aspöck, Aspöck et Hölzel, 1980)	IGK 8	MT621186	Siazan, Caspian Sea shore
	Creoleon plumbeus (Olivier, 1811)	IGK 9	MT621187	Siazan, Caspian Sea shore
	Myrmeleon hyalinus hyalinus Olivier, 1811	IGK12	MT621174	Turkey
	Myrmeleon hyalinus distinguendus Rambur, 1842	IGK 17	MT621176	Sumgait, Caspian Seashore
	Myrmeleon hyalinus distinguendus Rambur, 1842	IGK 18	MT621177	Turkey
	Neuroleon (Ganussa) tenellus (Klug, 1834)	IGK 13	MT621170	Gobustan
	Distoleon tetragrammicus (Fabricius, 1798)	IGK 19	MT621188	Siazan, Sadaan
	Macronemurus bilineatus Brauer, 1868	IGK 21	MT621194	Nakhchivan, Ordubad
	Euroleon nostras (Geoffroy in Fourcroy, 1785)	IGK 23	MT621191	Siazan, Sadaan
Ascalaphidae	Deleproctophylla variegata (Klug, 1845)	IGK 3	MT621185	Nakhchivan, Ordubad
	Libelloides hispanicus ustulatus (Eversmann, 1850)	IGK 11	MT621173	Shabran, Galaalty
	Libelloides macaronius kolyvanensis (Laxmann,1842)	IGK 10	MT621183	Nakhchivan, Ordubad
	Bubopsis hamatus (Klug, 1834)	IGK 25	MT621192	Siazan, Beshbarmak
	Bubopsis andromache (Aspöck et al., 1979)	IGK 26	MT621184	Gobustan
Mantispidae	Sagittalata perla (Pallas, 1772)	IGK 14	MT621175	Nakhchivan, Ordubad
	Mantispa scabricollis McLachlan, 1875	IGK 24	MT621189	Nakhchivan, Ordubad,
Nemopteridae	Lertha ledereri (Sélys-Longchamps, 1866)	IGK 16	MT621172	Lerik, Gosmolian

 

 

DNA extraction and PCR amplification were performed at the Department of Research and Collections of the University of Oslo; Natural History Museum of Norway. The DNA was isolated from legs using the Qiagen DNeasy Blood and Tissue KitTM, following the protocol for Animal Tissue.

The barcoding fragments were amplified by PCR using the following primers: Forward LCO1490 (5’–GGTCAACAAATCATAAAGATATTGG–3’) and reverse HCO2198 (5’–TAAACTTCAGGGTGACCAAAAAATCA–3’) (Folmer et al., 1994). The PCR amplifications were performed using master cycler gradient- eppendorf (Pro S model, Germany) with 10μM of each primer (LCO 1490F and HCO 2198R), 1, 25 mM dNTPs for each tube, 1.5 mM MgCl2, 1U Taq polymerase, and 2.5 μl of 10x PCR buffer, 200μg of extracted DNA in a final volume of 25 μl. The PCR thermal cycling parameters were: 1 cycle at 94oC for 5 min, followed by 35 cycles at 94oC for 1 min, 1 min annealing at 54oC and extension at 72oC for 1:15 min followed by a final extension of 10 min at 72oC. Labeled PCR strips were kept at -20°C until used. The PCR products were subjected to electrophoresis in 1% agarose gel and stained with gold view (1ng/mL) to confirm amplification (Figure 2). Amplicons were sequenced by StarSEQ GmbH (Mainz, Germany).

 

The final consensus COI sequences were obtained after overlapping both forward and reverse sequences using contig express. All sequences were analyzed using NJ cluster analysis (Saitou and Nei, 1987).

Data assembly and alignment

Forward and reverse DNA sequences were produced as electropherograms (ab1 files). First, low-quality motifs at both ends of the sequences were trimmed, and the sequences were assembled and manually edited in codon code Aligner v8.0.1 (Codon Code Corporation, Dedham, MA, USA); subsequently, consensus sequences (contigs) were generated. Consensus sequences were entered into the BLAST to determine the closest sequence identity in GenBank. The COI sequences obtained by us for 25 species of lacewings of Azerbaijan fauna have been deposited to GenBank with accession numbers presented in Table 1.

Sequences for representatives of myrmeleontidae and ascalaphidae species were aligned and compared to confirm the BLAST results. COI sequences, obtained here, were aligned using the multiple alignment model of Clustal W (Thompson et al., 1994) as implemented in MEGA v 7.0 (Kumar et al., 2016) with their corresponding sequences of Neuroptera and Parainocellia bicolor (Raphidioptera, EU839733), as the outgroup, retrieved from GenBank (species list, retrieved from GenBank and used in constructed phylogenetic trees, was given in Table 1). Additionally, it was confirmed by translating the sequence to the amino acid sequence that it did not have a slipped open reading frame. Sequences were checked, and those containing the premature stop codon were reassembled.

Each sequence was checked, and species names, determined by morphological descriptions, were verified via BOLD system v.3 (http://v3.boldsystems.org/) after characterization of COI.

Phylogenetic tree construction

For phylogenetic analyses, the optimum partitioning scheme and the nucleotide substitution model were estimated in partition finder v1.1.1 (Lanfear et al., 2012) written in Phyton v2.7.14. The analysis was conducted to estimate the best partitioning scheme. The best-fit partitioning scheme with its respective substitution model was selected according to the Akaike Information Criterion (AIC). The final dataset and file containing the inferred partition scheme and model selection results are provided as Supplementary File 1. Phylogenetic trees were generated for maximum likelihood (ML) under the GTR+I+G model (the best-fitting substitution model was a general time-reversible substitution model (Tavaré, 1986) with rate heterogeneity described by a gamma distribution discretized into four bins (Yang, 1993) and a proportion of invariant sites (Fitch and Margoliash, 1967). We determined the number of generations necessary to be run and the burn-in by examining the log-likelihood (lnL) plots through Tracer v1.5 (Rambaut and Drummond, 2007). We ran four Markov chains (one cold and three heated) with 7x106 generations, sampling every 200 generations. Phylogenetic trees were visualized in FigTree v1.4.3 (http://tree.bio.ed.ac.uk/ software/figtree/).

Results and Discussion

There was strong node support the upper branches of the ML tree. The bases of trees were poorly supported. All Azerbaijani neuropteran specimens clustered with congeners where duplicates were present. Three sequences obtained for specimens of Myrmeleon hyalinus (Olivier, 1811) and presented in the ML tree belong to the same species. The genetic difference between it and its nearest neighbor was 5% (0.05). The differences between the three sequences in the tree do not exceed two percent, and in the dark (distinguendus) and light (hyalinus) subspecies, it is generally less than one percent. We found the same result in the NJ tree. The subspecies relationship of Myrmeleon hyalinus hyalinus Olivier, 1811 and M. hyalinus distinguendus Rambur, 1842 was substantiated by Hölzel (1987). However, recently, geographical subspecies and mixed populations in sympatrical zones were discussed using morphological features (Kerimova and Krivokhatsky, 2018) and confirmed by genetic data in the given study.

Also, in both dendrograms, a closer interpopulation relationship of individuals (sequences IGK 12 and IGK 18 from Turkey) is more evident than for a subspecies relationship, which indicates a heterogeneous composition of populations.

The specimen Palpares sp. undertermined (Table 1, IGK15) belongs to P. turcicus Koçak, 1976. The two species from Palpares libelluloides species group divided morphologically with high levels of support. Previously, we described the problem of difficult recognition of immature forms of adult antlions Palpares libelluloides and P. turcicus with similar brown rings on the last abdominal segments (Krivokhatsky et al., 2017). For libelluloides, another characteristic feature was the small spots on the cubital forks of the hindwing against the extensive brown spots in turcicus. The specimen that could not be determined was marked as questionable. The genetic method finally solved this question now: Palpares sp. questionable (IGK15) is now surely assigned to a known species, P. turcicus.

Myrmecaelurus solaris (Krivokhatsky, 2002) (IGK2) and M. trigrammus (Pallas, 1781) (IGK22) differ from each other in dendrogram by more than 10%. The same result we see in the NJ tree. In Azerbaijan, these two pale yellow species, close in opinion, are found together only on the Caspian coast, where they inhabit multiple biotopes (Kerimova and Krivokhatsky, 2018). In the second dendrogram, with the involvement of the additional species Myrmecaelurus major McLachlan, 1875 from the Genbank, it becomes clear that the species of the same larger size category are more closely related, while the smaller one, M. trigrammus, is located at a considerable distance from the larger pair.

As we see from the NJ tree, the genus Myrmecaelurus Costa, 1855 is supported by 97-100% (3 species: M. major, M. trigrammus, and M. solaris), and it is connected with another close genus Nohoveus Navás, 1918 (Azerbaijanian population of N. zigan (Aspöck et al., 1980) and Chinese population of N. atrifrons Hölzel, 1970, taken from Genbank; 100 %). In the last catalog of antlions of the world fauna (Stange, 2004), these two genera were synonymized; however, we recognize their independence in the tribe Myrmecaelurini, confirmed by absolute differences in the structure of male genitalia (Krivokhatsky, 2011).

 

As can be seen from the ML tree, the sequences of Bubopsis hamata Klug, 1834 (IGK25) and B. andromache (Aspöck et al., 1979) (IGK26) are identical (Figure 3). The same result occurs in NJ (Figure 4). A genetic approach forces us to synonymize these two names: Ascalaphus hamatus Klug, 1834 = B. andromache. syn. n. However, two nomenclature types are corresponding to the presence of discrete subspecific ranks of the species. We propose that sympatric (Aspöck et al., 2001) morphological forms of sole East-Mediterranean-Iran-Arabian species actually coexist in nature and belong to infrasubspecific morphs. Thus, B. hamata (Klug, 1834) includes B. hamata morpha typica, and B. hamata morpha andromache, that coexist geographically and are not divided genetically with the COI barcode method.

 

A noticeable convergence of the compact cluster of the genus Bubopsis Mac Lachlan, 1898 with the owlfly Deleproctophylla variegata (Klug, 1845), which, together belongs to the subfamily Ascalaphinae Lefèbvre, 1842, indicates a characteristic point of embranchment in the genus Libelloides Schäffer, 1763 inside Libelloidini Pantaleoni, (Pantaleoni and Loru, 2018). Thus, Libelloidini is a daughter tribe within Ascalaphinae.

We should note that although the support between the clades of L. macaronius kolyvanensis – L. hispanicus ustulatus – D. variegata and B. hamata – B. andromache is not so high (44), it organizes the traditional owlflies of the Ascalaphidae family into one cluster, opposed to the cluster that unites all the studied antlions (Myrmeleontidae). Thus, the proposal to merge the Myrmeleontidae and Ascalaphidae (Machado et al., 2018) is not supported by our data. Although the research material is not sufficient for a final conclusion.

The position of the only species of the family Nemopteridae, Lertha ledereri, was recovered within the Myrmeleontidae, which on both dendrograms (forms a single, poorly supported cluster with the genus) joined the cluster of the genus Myrmeleon. This is definitely an artifact since a well-supported separate position of the cluster of the superfamily Nemopteroidae from the Myrmeleontoidae on the phylogenetic tree involving 3 species of spoontails with 100% support is reliable (Michel et al., 2017).

To the next artifact in the second dendrogram, we assign the sequence Acanthaclisis occitanica IGK 7 from Ordubad, which is far apart from two closely related sequences (IGK6 and IGK5) from different areas (Figures 3, 4).

Our study provided the first DNA barcode library of Neuroptera from Azerbaijan, including 25 species. The present dataset will be the first step toward the DNA barcoding of Azerbaijan Neuroptera.

Acknowledgement

The study was performed in the frames of the research project CPEA-LT-2016/10140 supported by the Norwegian Centre for International Cooperation in Education (SIU). The authors express their gratitude to V. Gusarov in the Natural History Museum, the University of Oslo, for providing resources for the laboratory work and for his constructive comments that greatly improved the manuscript. The authors also thank Dr. Edward R. Dewalt from Illinois Natural History Survey for comments and for improving the language of the manuscript.

Conflict of interest

The authors have declared no conflict of interest.

References

Aspöck, U., Aspöck, H. and Hölzel, H., 1979. Bubopsis andromache n. sp. -- eine neue Spezies der Familie Ascalaphidae (Neuropteroidea, Planipennia) aus dem östlichen Mittelmeerraum. Zeit. Arbeitsgem. Österreich. Entomol., 30:113-116.

Aspöck, H., Aspöck, U., and Hölzel, H., 1980. Die Neuropteren Europas. Einezusammen fassende Darstellung der Systematik, Ökologieund Chorologieder Neuropteroidea Megaloptera, Raphidioptera, Planipennia). Europas. Goecke Evers Krefeld, 2: 1-355.

Aspöck, H., Hölzel, H., and Aspöck, U., 2001. An annotated catalogue of the Neuropterida (Raphidioptera, Megaloptera, Neuroptera) of the Western Palaearctic. Denisia, 2: 1–606.

Engel, M.S., Winterton, S.L., and Breitkreuz, L., 2018. Phylogeny and evolution of neuropterida: where have wings of lace taken us? Ann. Rev. Entomol., 63: 531–551. https://doi.org/10.1146/annurev-ento-020117-043127

Fitch, W.M., and Margoliash, E., 1967. A method for estimating the number of invariant amino acid coding positions in a gene using cytochrome c as a model case. Biochem. Genet., 1: 65–71. https://doi.org/10.1007/BF00487738

Folmer, O., Black, M., Hoeh, W., Lutz, R., and Vrijenhoek, R., 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol., 3: 294–299.

Haring, E., and Aspöck, U., 2004. Phylogeny of the Neuropterida: A first molecular approach. Syst. Entomol., 29: 415-430. https://doi.org/10.1111/j.0307-6970.2004.00263.x

Hölzel, H., 1987. Myrmeleon hyalinus Olivier eine chorologischtaxonomische Analyse (Neuropteroidea: Planipennia: Myrmeleonidae). Z. Österreich. Entomol., 38: 78-88.

Kerimova, I.G., 2020. To studies on thread-winged lacewings (Neuroptera: Nemopteridae). In Azerbaijan. Transactions of Pedagogical University. Ser. Math. Natl. Sci., 68: 158-161. (in Azerbaijani). https://doi.org/10.17580/gzh.2020.08.11

Kerimova, I.G., and Krivokhatsky, V.A., 2018a. Current composition of the fauna of antlions (Neuroptera: Myrmeleontidae) of Azerbaijan. Caucasian Entomol. Bull., 14(1): 55–66. https://doi.org/10.23885/1814-3326-2018-14-1-55-66

Kerimova, I.G., and Krivokhatsky, V.A., 2018b. About fauna and distribution of owlflies (Neuroptera, Ascalaphidae) in Azerbaijan. Artvin Coruh University International Artvin Symposium. Abstract Book, 18-20 October, pp. 33.

Krivokhatsky, V.A., 2002. New asian species of antlions (neuroptera, myrmeleontidae). Entomol. Rev., 81: 883-889.

Krivokhatsky, V.A., 2011. Antlions (Neuroptera: Myrmeleontidae) of Russia. Tovarishestvo nauchnikh izdaniy KMK. Saint-Petersburg-Moscow. (in Russian)

Krivokhatsky, V.A., Hajiesmailian, A., Mirmoayedi, A., Khabiev, G., Dobosz, R., and Ostroverkhova, M., 2017. Palpares turcicus Koçak, 1976 – new name for Iranian fauna and its place in the P. libelluloidesspecies group (Neuroptera: Myrmeleontidae). Proc. Zool. Inst., 321: 377-402. https://doi.org/10.31610/trudyzin/2017.321.4.377

Kumar, S., Stecher, G., and Tamura, K., 2016. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol., 33: 1870–1874. https://doi.org/10.1093/molbev/msw054

Lanfear, R., Calcott, B., Ho, S.Y.W. and Guindon, S., 2012. Partition finder: Combined selection of partitioning schemes and substitution models for phylogenetic analyses. Mol. Biol. Evol., 29: 1695–1701. https://doi.org/10.1093/molbev/mss020

Machado, R., Gillung, J., Winterton, S.H., Garzón-Orduña, I., Lemmon, A., Lemmon, E. and Oswald, J., 2018. Owlflies are derived antlions: Anchored phylogenomics supports a new phylogeny and classification of Myrmeleontidae (Neuroptera). R. Entomol. Soc. Syst. Entomol., pp. 1-33. https://doi.org/10.1111/syen.12334

Michel, B., Clamens, A.L., Béthoux, O., Kergoat, G.J., and Condamine, F.L., 2017. A first higher-level time-calibrated phylogeny of antlions (Neuroptera: Myrmeleontidae). Mol. Phylogenet. Evol., 107: 103-116. https://doi.org/10.1016/j.ympev.2016.10.014

Pantaleoni, R.A. and Loru, L., 2018. Libelloidini, new name for an old tribe (Neuroptera Ascalaphidae). Zootaxa, 4438: 597-598.

Rambaut, A., and Drummond, A.J., 2007. Tracer v1.4. Encycl. Atmos. Sci., 141: 2297–2305. https://doi.org/10.1017/CBO9781107415324.004

Saitou, N., and Nei, M., 1987. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol., 4: 406–425.

Stange, L.A., 2004. A systematic catalog, bibliography and classification of the world antlions (Insecta: Neuroptera: Myrmeleontidae). Mem. Am. Entomol. Inst., 74: 565.

Taberlet, P., Coissac, E., Pompanon, F., Brochmann, C., and Willerslev, E., 2012. Towards next-generation biodiversity assessment using DNA metabarcoding. Mol. Ecol., 21: 2045–2050. https://doi.org/10.1111/j.1365-294X.2012.05470.x

Tavaré, S., 1986. Some probabilistic and statistical problems in the analysis of DNA sequences. American Mathematical Society: Lectures on Mathematics in the Life Sciences.

Thompson, J.D., Higgins, D.G., and Gibson, T.J., 1994. Clustal W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucl. Acids Res., 22: 4673–4680. https://doi.org/10.1093/nar/22.22.4673

Yang, Z., 1993. Maximum-likelihood estimation of phylogeny from DNA sequences when substitution rates differ over sites. Mol. Biol. Evol., 10: 1396–1401. https://doi.org/10.1093/oxfordjournals.molbev.a04008