Associations of Diplotypes of Vldlr Gene with Egg Production Traits in Laiwu Black Chickens

Yan Zhou1,2, Hai Xia Han1,2, Qiu Xia Lei1,2, Jin Bo Gao1,2, Wei Liu1,2, Fu Wei Li1,2, Jie Liu1,2 and Ding Guo Cao1,2*

1Institute of Poultry Science, Academy of Agricultural Sciences of Shandong Province, Jinan, Shandong, China

2Poultry Breeding Engineering Technology Center of Shandong Province, Jinan, Shandong, China

Yan Zhou and Hai Xia Han contributed equally to this study.

ABSTRACT

Very low density lipoprotein receptor (VLDLR) is of vital importance for egg production in mediating the synthesis of yolk protein precursors. To better understand the effects of VLDLR on reproduction in chickens, the haplotypes and diplotypes based on three genetic mutations (NC_006127.2:g.8467G>A, NC_006127.2:g.12321G>A and NC_006127.2:g.13876A>G) were constructed, and the associations of diplotypes with reproduction traits were assessed, their effects on gene expression were evaluated also. As a result, three haplotypes H1 (G-G-A), H2 (G-G-G) and H3 (A-A-G) were obtained, H1 was the main haplotype with a frequency of 91.75%. The correlation analysis showed that diplotypes (H1H1, H2H2 and H3H3) were significantly associated with egg production at age of 40W (E40) (P=0.0342) and egg production at age of 43W (E43) (P=0.0184). The egg production at age of 38W (E38), E40 and E43 of H2H2 chickens were all higher than those of the H1H1 and H3H3 chickens. Compared with H1H1 and H3H3 chickens, the highest mRNA levels of VLDLR were found in ovary, 6 mm - 8 mm follicles and 4 mm follicles from H2H2 chickens, and significant difference compared with those of H3H3 chickens (P<0.01). These findings suggest that VLDLR could be considered a candidate gene for egg production in chickens.

Article Information

Received 12 January 2018

Revised 11 May 2019

Accepted 02 September 2019

Available online 17 September 2020

Authors’ Contribution

YZ, DGC and HXH conceived and designed the experiments. YZ, HXH, QXL, JBG, WL, FWL and JL performed the experiments. YZ, HXH, QXL and JBG analyzed the data. YZ and HXH wrote the paper.

Key words

Gallus gallus, VLDLR gene, Diplotype, Egg production traits

DOI: https://dx.doi.org/10.17582/journal.pjz/20180112070136

* Corresponding author: [email protected]

0030-9923/2020/0006-2371 $ 9.00/0

Copyright 2020 Zoological Society of Pakistan

INTRODUCTION

Very low density lipoprotein receptor (VLDLR) is a member of the low density lipoprotein receptor (LDLR) gene superfamily (Bujo et al., 1994). As a multifunctional receptor, VLDLR has many biological functions, including the regulation of lipid metabolism (Beisiegel, 1995; Tacken et al., 2001; Takahashi et al., 2003), cell proliferation and differentiation (Wada et al., 2000; Kosaka et al., 2001), and Reelin and Wnt signaling pathways (Sharaf et al., 2013; Khialeeva and Carpenter, 2017; Chen et al., 2016); VLDLR is also related to type 2 diabetic (Yuan et al., 2011; Pardina et al., 2016).

In poultry, VLDLR was found to be a key event in the control of oocyte growth (Stifani et al., 1990; Barber et al., 1991). During the rapid final stage of growth, chicken oocytes take up massive amounts of plasma components and convert them to yolk (Shen et al., 1993). More than 30% of the yolk weight is composed of lipids imported in the form of serum-borne lipoproteins, mainly including yolk lipoprotein precursors, vitellogenin (VTG) and very low density lipoprotein (VLDL) (Bujo et al., 1997). VLDLR is the key receptor that mediates VTG and VLDL endocytosis into growing chicken oocytes. Based on this, multiple studies have assessed its relationship with egg production in oviparous species. Nimpf et al. (1989) found that VLDLR absence from oocytes is responsible for the R/O (Restricted Ovulator) phenotype. This was further confirmed by Bujo et al. (1995). The latter authors described a single nucleotide substitution (G→C), which results in Cys-682→Ser replacement. Hens harboring this mutation are sterile and display severe hyperlipidemia. Subsequently, several VLDLR mutations were shown to have close associations with egg quality and production traits in duck (Wang et al., 2011), quail (Wu et al., 2015) and chicken (Cao et al., 2012). Interestingly, changes of ovary VLDLR mRNA expression are correlated with clutch size, laying interval, and egg mass in zebra finch (Han et al., 2009).

Despite a wealth of data regarding VLDLR, its biological effects on chicken reproduction remain largely unknown. In this study, we aimed to examine the sequence variants of VLDLR in Lai Wu Black chicken and assess their genetic effects on reproduction traits.

 

MATERIALS AND METHODS

Animals and data collection

Four hundred LaiWu Black chickens selected randomly from the Local Breed Genetic Resources Bank of Shandong Province were used for the detection of VLDLR SNPs and association analyses. Four reproduction traits, including age at first egg (AFE), egg production at age of 38W (E38), egg production at age of 40W (E40), and egg production at age of 43W (E43), were measured according to The Poultry Production Performance Terms and Measurement Statistics Method (NY/T823-2004). All animal procedures were carried out in accordance with the Directory Proposals on the Ethical Treatment of Experimental Animals, established by the Ministry of Science and Technology (Beijing, China).

Detection of SNPs, genotyping, and diplotype construction

Venous blood samples were collected from all four hundred LaiWu Black chickens by venipuncture, then the genomic DNA was isolated with TIANamp Blood DNA Kit (DP318, Tiangen, Beijing, China) and stored at -20°C. According to the CDS sequence of VLDLR (GenBank Accession no. NC_006127.2, GI: 118136399), nineteen sets of PCR primers were designed to detect VLDLR SNPs, but only three genetic mutations were found and genotyped by PCR-RFLP with specific primers (Table I). PCR-RFLP reactions were performed in a 15 µL system containing 0.5 µL of restriction enzymes (10U/µL) (HinfI, Eco47I or MvaI, New England Biolabs, Inc., USA), 1 μL of 10× NEBuffer, 8 μL of PCR product, and 5.5 µL ddH2O. The PCR products were digested at 37°C for 4 h; the digestion products were separated by 2.5% agarose gel electrophoresis for 30 min at 120V. After genotyping, two samples per SNP genotype were sequenced by Jinan Li Ge Technology Co., Ltd (Jinan, China) to confirm the variation. Haplotypes and diplotypes were constructed based on the SNPs identified in the 400 chicken, using the PHASE 2.0 software.

Tissues and real-time quantitative PCR

To characterize the mRNA expression of chicken VLDLR gene of individuals with different diplotypes, five LaiWu Black chickens for each diplotype were euthanized, and the 4 mm diameter follicles, 6 mm-8 mm diameter follicles and ovary (O) were sampled rapidly. All the tissues were frozen and stored in liquid nitrogen.

Total RNA was isolated from tissue samples using Ultrapure RNA Kit (CW0581, CWbio. Co. Ltd., Beijing, China) according to the manufacturer’s instructions, and assessed by the A260/A280nm ratio, with the expected values falling between 1.8 and 2.0 (Eppendorf, Hamburg, Germany). 1µg of total RNA was used for cDNA synthesis with HiFi-MMLV cDNA Kit (CW0744, CWbio Co. Ltd., Beijing, China). The chicken β-actin gene was used as an internal control for qRT-PCR. The primers used in this study are listed in Table II. qRT-PCR was carried out at 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 60 s. The cycle threshold (CT) value of the control gene was used to normalize target gene signals in each sample. Specimens were assessed in triplicate. The 2-△△CT method was used to derive the relative amounts of target gene transcripts based on the control gene.

Statistical analysis

The Hardy-Weinberg equilibrium was evaluated by χ2 test. The associations of diplotypes with reproduction traits were determined by the general linear model (GLM) procedures of SAS8.12 (SAS Inst. Inc., Cary NC, USA) with the following statistical model: Y= μ + Gi+ e, Where Y is the observed value of reproduction traits, μ is the population mean, G is the fixed effects of the diplotype, and e is random error. Multiple comparisons were performed with least squares means. One-way ANOVA was used to assess gene expression differences among tissues with various diplotypes. Data are least squares means ± standard error of the means; P < 0.05 was considered statistically significant.

 

RESULTS

Genotype and allele frequencies, and associations

There were three genetic mutations, with a total of six genotypes detected. By sequencing, nucleotide changes at various loci were further confirmed. Based on GenBank Accession No. NC_006127.2, a G→A synonym mutation at nucleotide 8467 (NC_006127.2: g.8467G>A) was located in exon 6; a G→A mutation at position 12321 (NC_006127.2: g.12321G>A) was found in intron 15, and an A→G mutation at position 13876 (NC_006127.2: g.13876 A >G) in intron 17.

According to genotype and allele frequency analysis (Table III), the GG genotype had advantage over others, with G being the dominant allele in NC_006127.2: g.8467G>A. In NC_006127.2: g.12321G>A, G was the dominant allele since the GG genotype (0.975) occurred much more frequently than the AA genotype (0.025). In NC_006127.2: g.13876A>G, AA genotype frequency was higher than that of the GG genotype, and the allele A was dominant. The genotype distribution in the experimental chicken for all three SNPs did not fit the Hardy-Weinberg equilibrium with a P-value lower than 0.05.

 

Table I. Parameters of primers for SNP identification and genotyping of VLDLR.

Primer	Sequences (5′–3′)	Length of products /bp	Annealing temp (°C)	Usage
NC_006127.2: g.8467G>A	F: GGCTCAGGTGAATGTATC	474	50.3	Genotyping with HinfI
	R: CAGTCTCCGTGATGGTTA
NC_006127.2: g.12321G>A	F: ATTGGGAATCAGGATACTAAAC	640	50.5	Genotyping with Eco47I
	R: CCTACTCATTTCAGGCTCT
NC_006127.2: g.13876A>G	F: GGCTGTTCTTCCTATCTG	441	50	Genotyping with MvaI
	R: GGTCCCTTCTGATTGC

 

Table II. Parameters of primers for RT-qPCR.

Gene	Primer sequence(5’-3’)	Annealing temp (°C)	Product size(bp)
VLDLR	F: CCGTTTGTATTGGCTTGATTC R: CACCATAGACTGCCTCGTTC	60	173
β-actin	F: CCATCTATGAAGGCTACGC R:CTCGGCTGTGGTGGTGAA	60	124

 

Table III. Genotype and allele frequencies at NC_006127.2: g.8467G>A, NC_006127.2: g.12321G>A and NC_006127.2: g.13876A>G.

SNPs	Location	Genotype frequency		Allele frequency		P-value a
NC_006127.2: g.8467G>A	Exon6	GG	AA	G	A	5.51E-89
		0.973	0.027	0.973	0.027
NC_006127.2: g.12321G>A	Intron15	GG	AA	G	A	5.51E-89
		0.975	0.025	0.975	0.025
NC_006127.2: g.13876A>G	Intron 17	AA	GG	A	G	5.51E-89
		0.915	0.085	0.915	0.085

 

a P-value is the probability in χ2-test for the Hardy-Weinberg equilibrium

 

Table IV. Haplotypes and diplotypes inferred based on the 3 single nucleotide polymorphisms.

Haplotype	NC_006127.2: g.8467G>A	NC_006127.2: g.123217G>A	NC_006127.2: g.13876A>G	Frequency (%)	Diplotype	Frequency (%)
H1	G	G	A	91.750	H1H1	91.750
H2	G	G	G	5.750	H2H2	5.750
H3	A	A	G	2.500	H3H3	2.500

 

Construction of haplotypes and associations

PHASE 2.0 data are shown in Table IV. Based on the three SNPs, three haplotypes were obtained. G-G-A was the main haplotype with a frequency of 91.75%. In addition, three diplotypes were obtained at frequencies higher than 2%; H1H1 was the main diplotype, accounting for 91.75% of all cases.

Table V showed that significant associations of diplotypes with E40 (P=0.0342) and E43 (P=0.0184) were found. H3H3 chickens were superior to H1H1 and H2H2 chickens in AFE, but their egg production from 38 to 43 weeks was poorest among all chickens. For egg production, H2H2 chickens showed an absolute advantage, with E38, E40 and E43 higher than those of the other chickens.

Comparison of VLDLR mRNA expression in tissues with different diplotyps

The mRNA expression of VLDLR in ovary, 4 mm and 6 mm-8 mm diameter follicles were analyzed and compared among H1H1, H2H2 and H3H3 chickens. The results in Figure 1 showed that, in the same tissue, mRNA levels in different diplotypes chickens were ordered as: H2H2 > H1H1> H3H3; the highest mRNA levels were found in H2H2 chickens, and significant difference compared with those of H3H3 chickens (P<0.01).

 

Table V. Associations of diplotypes of the chicken VLDLR gene with reproductive traits.

Traits	P value	H1H1(367)	H2H2(23)	H3H3(10)
AFE	0.8404	139.69±0.47	139.08±1.88	138.20±2.86
E38	0.0552	94.16±0.88	102.36±3.50	90.00±5.48
E40	0.0342	104.15±0.96ab	112.81±3.85a	95.88±6.032b
E43	0.0184	117.33±1.11ab	127.04±4.431a	104.66±6.932b

 

The least square means within a row lacking a common lowercase letters differ significantly (P<0.05).

 

DISCUSSION

Previous studies have demonstrated that VLDLR is essential for vitellogenesis and influences subsequent egg production in chicken. Its point mutation at position 2177bp of the chicken VLDLR cDNA, termed restricted ovulator, characterized by leghorn female sterility (Nimpf et al., 1989; Takahashi et al., 2004). To further explore relevant VLDLR mutations affecting chicken reproduction, sequencing and PCR-RFLP were used to screen all eighteen VLDLR exons to examine their variants in four hundred LaiWu Black chicken. Interestingly, three genetic mutations (NC_006127.2: g.8467G>A, NC_006127.2: g.12321G>A and NC_006127.2: g.13876A>G) were detected. NC_006127.2: g.8467G>A was a synonymous mutation at positon 8467 in exon 6; the other two mutations were located in introns. The R/O genotype was not found in this experimental population, indicating that the harmful mutation might be deleted during the breeding process.

Zhan et al. (2009) found five SNPs in introns 2, 7 and 9 by PCR-SSCP, PCR-RF-SSCP and sequencing in 390 chickens; intron 2 polymorphisms (T3967G) were significantly associated with age at first egg and egg shell thickness (P<0.01). In most eukaryotic genes, the coding sequence is interrupted by introns, which are eventually removed by a precise splicing mechanism in the nucleus during mRNA maturation (Sharp, 1987). Although introns do not directly encode proteins, more and more studies have revealed that they might play a role in chromatin structure and its associations with gene function (Svaren and Chalkley, 1990), e.g. regulation of gene expression both transcriptionally and post- transcriptionally (Breitbart et al., 1987; Jonsson et al., 1992). In addition, mutations in introns have close relationships with human diseases (Yang, 2016; Kim et al., 2016; Karakus et al., 2013) and important economic traits in animals (Maitra et al., 2014; Yang et al., 2017; Zhang et al., 2017). The currently known VLDLR mutations mainly occur in intronic regions (Sharp, 1987; Zhan et al., 2009). In this study, two of the three SNPs were also located in introns, correlation analysis showed that diplotypes were significantly associated with E40 and E43, and the association between these parameters increased with chicken age. E38, E40 and E43 in H2H2 chickens were all higher than those of the remaining chickens. It is worth noting that E43 of H2H2 chickens had 9.71 and 22.38 eggs more than those of H1H1 and H3H3 chickens, respectively. Previous studies showed that the expression of VLDLR mRNA were related with reproduction traits e.g. egg mass in zebra finch (Han et al., 2009). VLDLR is also found highly expressed in the ovary, oviduct, pituitary gland in duck (Wang et al., 2011). To further assess the effects of VLDLR on reproduction, we further compared the mRNA expression of VLDLR gene in ovary, 6 mm-8 mm diameter and 4 mm diameter follicles among different diplotypes. In all the three tissues, the highest expression level of VLDLR gene were found in H2H2 chickens, showing significant difference compared with those of H3H3 chickens. The data were consistent with the results of association analysis on egg production. Therefore, H2H2 may be considered an advantageous diplotype for the reproduction trait.

 

CONCLUSIONS

In summary, three VLDLR mutations were detected and characterized in LaiWu Black chickens. The diplotypes were significantly associated with egg production traits. The E38, E40 and E43 of H2H2 chickens were all higher than those of the H1H1 and H3H3 chickens, and the mRNA expressions of VLDLR in H2H2 chickens were highest in ovary, 6 mm-8 mm and 4 mm follicles than those in H1H1 and H3H3 chickens. H2H2 might be considered a potential favorable molecular marker for egg production in chicken. These findings provide further insights into the molecular mechanism by which VLDLR regulates egg production.

 

ACKNOWLEDGMENTS

This work was financially supported by grants from the Agricultural Stock Breeding Project of Shandong Province (2019LZGC019), Youth Fund Project of Shandong Academy of Agricultural Sciences (2014QNM14), the Major Natural Science Foundation of Shandong Province, China (ZR2014CZ003), the joint Funds of the Natural Science Foundation of Shandong Province, China (ZR2014YL024) and Major Agricultural Stock Breeding Project of Shandong Province, China (2014lz039).

 

Statement of conflict of interest

The authors declare that there is no conflict of interest regarding the publication of this paper.

 

REFERENCES

Barber, D.L., Sanders, E.J., Aebersold, R. and Schneider, W.J., 1991. The receptor for yolk lipoprotein deposition in the chicken oocyte. J. biol. Chem., 266: 18761-18770.

Beisiegel, U., 1995. Receptors for triglyceride-rich lipoproteins and their role in lipoprotein metabolism. Curr. Opin. Lipidol., 6: 117-122. https://doi.org/10.1097/00041433-199506000-00002

Breitbart, R.E., Andreadis, A. and Nadal-Ginard, B., 1987. Alternative splicing: a ubiquitous mechanism for the generation of multiple protein isoforms from single genes. Annu. Rev. Biochem., 56: 467-495. https://doi.org/10.1146/annurev.bi.56.070187.002343

Bujo, H., Hermann, M., Kaderli, M.O., Jacobsen, L., Sugawara, S., Nimpf, J., Yamamoto, T. and Schneider, W.J., 1994. Chicken oocyte growth is mediated by an eight ligand binding repeat member of the LDL receptor family. EMBO J., 13: 5165-5175. https://doi.org/10.1002/j.1460-2075.1994.tb06847.x

Bujo, H., Hermann, M., Lindstedt, K.A., Nimpf, J. and Schneider W.J., 1997. Low density lipoprotein receptor gene family members mediate yolk deposition. J. Nutr., 127: 801S-804S. https://doi.org/10.1093/jn/127.5.801S

Bujo, H., Yamamoto, T., Hayashi, K., Hermann, M., Nimpf, J. and Schneider, W.J., 1995. Mutant oocytic low density lipoprotein receptor gene family member causes atherosclerosis and female sterility. Proc. natl. Acad. Sci. U. S. A., 92: 9905-9909. https://doi.org/10.1073/pnas.92.21.9905

Cao, D.G., Zhou, Y. and Lei, Q.X., 2012. Associations of very low density lipoprotein receptor (VLDLR) gene polymorphisms with reproductive traits in a Chinese indigenous chicken breed. J. Anim. Vet. Adv., 11: 3662-3667. https://doi.org/10.3923/javaa.2012.3662.3667

Chen, Q., Takahashi, Y., Oka, K. and Ma, J.X., 2016. Functional differences of very-low-density lipoprotein receptor splice variants in regulating Wnt signaling. Mol. Cell Biol., 36: 2645-2654. https://doi.org/10.1128/MCB.00235-16

Han, D., Haunerland, N.H. and Williams, T.D., 2009. Variation in yolk precursor receptor mRNA expression is a key determinant of reproductive phenotype in the zebra finch (Taeniopygia guttata). J. exp. Biol., 212: 1277-1283. https://doi.org/10.1242/jeb.026906

Jonsson, J.J., Foresman, M.D., Wilson, N. and McIvor, R.S., 1992. Intron requirement for expression of the human purine nucleoside phosphorylase gene. Nucl. Acids Res., 20: 3191-3198. https://doi.org/10.1093/nar/20.12.3191

Karakus, N., Yigit, S., Kurt, G.S., Cevik, B., Demir, O. and Ates, O., 2013. Association of interleukin (IL)-4 gene intron 3 VNTR polymorphism with multiple sclerosis in Turkish population. Hum. Immunol., 74: 1157-1160. https://doi.org/10.1016/j.humimm.2013.05.011

Khialeeva, E. and Carpenter, E.M., 2017. Nonneuronal roles for the reelin signaling pathway. Dev. Dyn., 246: 217-226. https://doi.org/10.1002/dvdy.24462

Kim, M.K., Yoon, K.A., Park, E.Y., Joo, J., Lee, E.Y., Eom, H.S. and Kong, S.Y., 2016. Interleukin-10 polymorphisms in association with prognosis in patients with B-cell lymphoma treated by R-CHOP. Genomics Inform., 14: 205-210. https://doi.org/10.5808/GI.2016.14.4.205

Kosaka, S., Takahashi, S., Masamura, K., Kanehara, H., Sakai, J., Tohda, G., Okada, E., Oida, K., Iwasaki, T., Hattori, H., Kodama, T., Yamamoto, T. and Miyamori, I., 2001. Evidence of macrophage foam cell formation by very low-density lipoprotein receptor: interferon-gamma inhibition of very low-density lipoprotein receptor expression and foam cell formation in macrophages. Circulation, 103: 1142-1147. https://doi.org/10.1161/01.CIR.103.8.1142

Maitra, A., Sharma, R., Ahlawat, S., Tantia, M.S., Roy, M. and Prakash, V., 2014. Association analysis of polymorphisms in caprine KiSS1 gene with reproductive traits. Anim. Reprod. Sci., 151: 71-77. https://doi.org/10.1016/j.anireprosci.2014.09.013

Nimpf, J., Radosavljevic, M.J. and Schneider, W.J., 1989. Oocytes from the mutant restricted ovulator hen lack receptor for very low density lipoprotein. J. biol. Chem., 264: 1393-1398.

Pardina., E., Ferrer, R., Rossell, J., Baena-Fustegueras, J.A., Lecube, A., Fort, J.M., Caubet, E., González, Ó., Vilallonga, R., Vargas, V., Balibrea, J.M. and Peinado-Onsurbe, J., 2016. Diabetic and dyslipidaemic morbidly obese exhibit more liver alterations compared with healthy morbidly obese. BBA Clin., 5: 54-65. https://doi.org/10.1016/j.bbacli.2015.12.002

Sharaf, A., Bock, H.H., Spittau, B., Bouche, E. and Krieglstein, K., 2013. ApoER2 and VLDLr are required for mediating reelin signalling pathway for normal migration and positioning of mesencephalic dopaminergic neurons. PLoS One, 8: e71091. https://doi.org/10.1371/journal.pone.0071091

Sharp, P.A., 1987. Splicing of messenger RNA precursors. Science, 235: 766-771. https://doi.org/10.1126/science.3544217

Shen, X., Steyrer, E., Retzek, H.E., Sanders, J. and Schneider, W.J., 1993. Chicken oocyte growth: receptor-mediated yolk deposition. Cell Tissue Res., 272: 459-471. https://doi.org/10.1007/BF00318552

Stifani, S., Barber, D.L., Nimpf, J. and Schneider, W.J., 1990. A single chicken oocyte plasma membrane protein mediates uptake of very low density lipoprotein and vitellogenin. Proc. natl. Acad. Sci. U. S. A., 87: 1955-1959. https://doi.org/10.1073/pnas.87.5.1955

Svaren, J. and Chalkley, R., 1990. The structure and assembly of active chromatin. Trends Genet., 6: 52-56. https://doi.org/10.1016/0168-9525(90)90074-G

Tacken, P.J., Hofker, M.H., Havekes, L.M. and Van Dijk, K.W., 2001. Living up to a name: The role of the VLDL receptor in lipid metabolism. Curr. Opin. Lipidol., 12: 275-279. https://doi.org/10.1097/00041433-200106000-00006

Takahashi, S., Sakai, J., Fujino, T., Miyamori, I. and Yamamoto, T.T., 2003. The very low density lipoprotein (VLDL) receptor--a peripheral lipoprotein receptor for remnant lipoproteins into fatty acid active tissues. Mol. Cell Biochem., 248: 121-127.

Takahashi, S., Sakai, J., Fujino, T., Hattori, H., Zenimaru, Y., Suzuki, J., Miyamori, I. and Yamamoto, T.T., 2004. The very low-density lipoprotein (VLDL) receptor: characterization and functions as a peripheral lipoprotein receptor. J. Atheroscler. Thromb., 11: 200-208. https://doi.org/10.5551/jat.11.200

Wada, Y., Homma, Y., Nakazato, K., Ishibashi, T. and Maruyama, Y., 2000. Effect of overexpression of very low density lipoprotein receptor on cell growth. Heart Vessels, 15: 74-80. https://doi.org/10.1007/s003800070035

Wang, C., Li, S.J., Yu, W.H., Xin, Q.W., Li, C., Feng, Y.P., Peng, X.L. and Gong, Y.Z., 2011. Cloning and expression profiling of the VLDLR gene associated with egg performance in duck (Anas platyrhynchos). Genet. Sei. Evol., 43: 29. https://doi.org/10.1186/1297-9686-43-29

Wu, Y., Pi, J.S., Pan, A.L., Du, J.P., Shen, J., Pu, Y.J. and Liang, Z.H., 2015. Two novel linkage SNPs of VLDLR gene intron 11 are associated with laying traits in two quail populations. Arch. Anim. Breed., 58: 1-6. https://doi.org/10.5194/aab-58-1-2015

Yang, H., Xu, Z. and Zuo, B., 2017. Polymorphism of IGFBP2 gene and its association with carcass and meat quality traits in pigs. Chinese J. Anim. Sci., 53: 25-28.

Yang, S.A., 2016. Association study between growth hormone receptor (GHR) gene polymorphisms and obesity in Korean population. J. Exer. Rehabil., 12: 632-636. https://doi.org/10.12965//jer.1632844.422

Yuan, G., Liu, Y., Sun, T., Xu, Y., Zhang, J., Yang, Y., Zhang, M., Cianflone, K. and Wang, D.W., 2011. The therapeutic role of very low-density lipoprotein receptor gene in hyperlipidemia in type 2 diabetic rats. Hum. Gene. Ther., 22: 302-312. https://doi.org/10.1089/hum.2010.038

Zhan, H.Q., Feng, Y.P., Shen, S.X., Gong, P., Peng, X.L., Li. X.J. and Gong, Y.C., 2009. Polymorphisms of chicken oocyte vitellogenesis receptor gene (ovr) and association with egg traits of chickens. J. Agric. Biotechnol., 17: 967-971.

Zhang, H., Zhang, Q.W., Wang, Q., Ma, Y.J., Zhang, Y. and Zhao, X.X., 2017. Polymorphism of TMEM-18 gene and its correlation with production traits in Yak. Biotechnol. Bull., 33: 89-96.