Molecular Identification of Mediterranean three Spicara Species to Improve 16S rRNA Partial Region Sequences

Asli Şalcioğlu

Institute of Environmental Sciences, Boğaziçi University, Bebek-Istanbul, Turkey.

Editor | Muhammad Abubakar, National Veterinary Laboratories, Park Road, Islamabad, Pakistan.

Received | February 02, 2022; Accepted | March 04, 2022; Published | April 05, 2022

*Correspondence | Asli Şalcioğlu, Institute of Environmental Sciences, Boğaziçi University, Bebek-Istanbul, Turkey; Email: asli.salcioglu@gmail.com

Citation | Şalcioğlu, A., 2022. Molecular ıdentification of mediterranean three spicara species to ımprove 16S rRNA partial region sequences. Veterinary Sciences: Research and Reviews, 8(1): 8-14.

DOI | https://dx.doi.org/10.17582/journal.vsrr/2022.8.1.8.14

Keywords | Spicara, Gene, mtDNA, 16S rRNA, Mediterranean

Copyright: 2022 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

Introduction

Spicara spp. (Picarels) are small to medium sized fish, and the genus is native to the eastern Atlantic and the western Indian Ocean (Tortonose, 1986; Froese and Pauly, 2022). Spicara genus is represented by three species (Spicara flexuosa, Rafinesque, 1810, Spicara maena, L, and Spicara smaris, L) in the Mediterranean and the Black Sea (Heemstra 1990; Şalcıoğlu et al., 2021).

Morphologic misidentification among the three Spicara species is possible, due to sexual dimorphism and protogynous hermaphroditism. Previous studies revealed that sex reversal which can be affected by protoygnous hermaphroditism (sex change from female to male) (Salekhova, 1979; Vidalis and Tsimenidis, 1996; Dulcic et al., 2000) were widely observed in picarels, which contributes to difficulties in their morphological identification. As a result of this, many studies (Tortonose, 1975; Heemstra, 1981, 1990; Quero et al., 2003; Eschmeyer, 2010) reported that S. flexuosa was considered as a synonym of Spicara maena. On the other hand, previous genetic studies (Imsiridou et al., 2011; Georgidias et al., 2014; Bektaş et al., 2018; Şalcıoğlu et al., 2021) indicated that Spicara flexuosa was separated from S. maena.

Mitochondrial DNA sequences especially partial 16S rRNA were previously used to resolve species delimitation among Sparids (Hanel and Sturmbauer, 2000). Previous phylogenetic study (Şalcıoğlu et al., 2021) showed that some of the sequences deposited in GenBank and BOLD originated from Spicara genus,

 

have been found misidentified based on the COI (Costa et al., 2012; Landi et al., 2014) and cyt-b (Orrell et al., 2002; Sanciangco et al., 2016) genes. Three Spicara species were previously evaluated 16S rRNA sequences in the literature (Imsiridou et al., 2011; Georgiadis et al., 2014; Bektaş et al., 2018) however, none of the studies were actually represented incorrectly classified sequences. Therefore, the main aim of this study was to evaluate mtDNA (16S rRNA) gene to identify misidentified sequences and to improve 16S rRNA region sequences on the GenBank Database of the three Spicara species.

Materials and Methods

Sample collection

Total 70 individuals of Spicara flexuosa and S. maena individuals were sampled from Turkish coastal waters (that were represented in the three different Turkish seas) and Greece which were previously identified by two mtDNA and nuclear genes (Figure 1A). Specimens were collected by fishermen, who were using various fisheries equipments by using trawlers and handline fishing. Identification of specimens was based on the main morphological characters of the two species in the identification keys (Tortonose, 1986; Minos et al., 2013). Additionally, experienced field collectors were used to identify S. maena based on morphology due to their comparative experience of two Spicara species in Greece. GenBank samples were also used in the data set (Figure 1A, Table 1). Fresh tissues of S. flexuosa/maena (muscle or caudal) were used and preserved in 80% ethanol in the field and at -20°C in the laboratory.

DNA analyses

Genomic DNA was isolated from the tissues of each specimen with a PureLink® Genomic DNA Kit (Invitrogen, Carlsbad, USA) by using the manufacturer’s protocol, and subsequently stored at -20 oC. New 16S rRNA gene primers (Forward: GTGTGCTGCATGGGAAAGAC; Reverse: CTGGTCCACATGGGGGTTTT) were designed by Primer Blast (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) based on a published sequence of S. maena from GenBank (JF795031) (Turan, 2011). The PCR reactions were performed in a total of 25 μl reaction volume, containing 2.5 μL of 10 X Taq Buffer with KCl (100 mM Tris–HCl, 500 mM KCl, pH 8.8), 2 μL of MgCl2 (25 mM), 0.5 μL of dNTPs (10 mM each), 0.5 μL of each primer (20 pM/μL), 0.25 μL of Taq polymerase (5U/μL), and 5 μL of DNA. Thermal cycle conditions for PCR amplification were as follows: 95 °C for 2 min for the initial denaturation step, followed by 35 cycles of denaturation 95 °C for 30 s, annealing at 56 °C for 40 s, extension 72°C for 1 min, and with a final extension step of 72 °C for 7 min (Turan, 2011). All amplified products were sequenced in the Macrogen Europe, Amsterdam, The Netherlands.

Statistical analyses

Alignment of all 16S rRNA gene sequences (including GenBank sequences) were edited manually with Sequencher v. 5.4.1. (Genecodes Inc., Ann Arbor, MI). A 469 bp fragment was used for further analyses of the 16S rRNA gene.

A sequence similarity based methods were used for species assignment of each individuals based on the reference sequences (Georgiadis et al. (2014), accession codes KF796614-KF796618, and Imsiridou et al. (2011) accession codes FJ625835-FJ625836) on the Basic Local Alignment Search Tool (BLAST).

Haplotype and nucleotide diversities, number of mutations, parsimony informative sites, and the number of net nucleotide substitutions between the three species were calculated in DnaSP v.5.10.1 (Librado and Rozas, 2009). Genetic distances between the three species were also determined in MEGA X (Kumar et al., 2018) by using Kimura 2-parameter model (Kimura, 1980). Finally, the average nucleotide composition of the three species of Spicara was determined by MEGA X.

Haplotype network, phylogenetic analyses

Relationship among haplotypes of Spicara species was determined by haplotype network using the median joining method (Bandelt et al., 1999) in PopART v.1.7 (Leigh and Bryant, 2015).

Phylogenetic relationships between the three species were determined by the Maximum Likelihood (ML) and Bayesian Inference (BY) using the software MEGA X and BEAST v.2.4.8 (Bouckaert et al., 2014), respectively. HKY substitution model was used for building the ML and BY trees. Spondyliosoma cantharus, GenBank (AF2474031) was used as the outgroup sequence. The analysis was executed for 4.0×107 generations.

Results and Discussion

Statistical analyses

A total of four haplotypes were determined within the 84 sequences, including 14 Spicara specimens (four Spicara flexuosa; five Spicara maena and five sequences of Spicara smaris) were retrieved from GenBank. Blast tools analyses of the GenBank sequences are shown in Table 1. Furthermore, Blast tools analyses of the sequences from this study (haplotypes based on the collected samples) are also represented in Table 2. Percentage identity of those sequences ranged from 99.57 to 100 %.

Considering molecular diversities indices, S. maena had the lowest haplotype and nucleotide diversities (h=0; π =0). The mean haplotype and nucleotide diversities of S. flexuosa (h=0.0360; π =0.0001) were higher than those reported for the S. meana. The total number of mutations ranged from 16 (between S. flexuosa and S. maena) to 22 (between S. maena and S. smaris) as well as pairwise sequence divergences between the three Spicara species ranged from 3 (between S. maena and S. flexuosa) to 4.44 % (between S. smaris and S. maena). Genetic distance values between the three Spicara species ranged from 0.031 to 0.046. Among the three species, a total of 28 nucleotide sites exhibited variable, of which 26 were parsimony informative. Of all parsimony informative sites, twelve positions were informative for S. maena and S. flexuosa, five positions for S. smaris and S. maena and six for S. smaris and S. flexuosa (Supplementary Table 1). The mean nucleotide frequencies of S. flexuosa was A=28.35, T=20.89, C=26.23, G=24.52; S. maena was A=28.57, T=22.17, C=24.95 G=24.31 and S. smaris was A=29.60, T=21.80, C=25.10 and G=23.9.

 

Table 1: Blast tools analyses of the GenBank sequences used for 16S marker, alignment length, accession numbers, scientific names, total score, E-value, % Identity, mismatches and taxid number. Red bold fonts indicate misidentified sequences on GenBank.

Species	Accession numbers	Location	Reference sequences’ accession numbers	% identity	Align-ment length	Total score	E value	Mis-matches	Hit species	Taxid
S. maena	AJ247298	France	FJ625835.1; KF796618.1	100	481	889	0.0	0	S. maena	98823
S. maena	KF796618	Greece	FJ625835.1	100	566	1046	0.0	0	S. maena	98823
S. maena	FJ625835	Greece	KF796618.1	100	566	1046	0.0	0	S. maena	98823
S. maena	JF795031	Turkey	KF796616.1; KF796617.1	100	648	1197	0.0	0	S. flexuosa	458843
S. maena	AF247434	Italy	KF796616.1; KF796617.1	99.48	577	1048	0.0	2	S. flexuosa	458843
S. flexuosa	JF795029	Turkey	KF796616.1; KF796617.1	99.85	648	1192	0.0	1	S. flexuosa	458843
S. flexuosa	KF796616	Greece	FJ625836.1	100	566	1046	0.0	0	S. flexuosa	458843
S. flexuosa	KF796617	Cyprus	FJ625836.1	100	566	1046	0.0	0	S. flexuosa	458843
S. flexuosa	FJ625836	Greece	KF796616.1; KF796617.1	100	566	1046	0.0	0	S. flexuosa	458843
S. smaris	JF795032	Turkey	KF796616.1; KF796617.1	100	648	1197	0.0	0	S. flexuosa	458843
S. smaris	JF795033	Turkey	KF796616.1; KF796617.1	100	648	1197	0.0	0	S. flexuosa	458843
S. smaris	JF795034	Turkey	KF796616.1; KF796617.1	100	648	1197	0.0	0	S. flexuosa	458843
S. smaris	KF796614	Greece	KF796615.1	99.74	763	1399	0.0	2	S. smaris	119752
S. smaris	KF796615	Cyprus	KF796614.1	99.74	763	1399	0.0	2	S. smaris	119752

Table 2: Blast tools analyses of this study sequences (Haplotypes) used for 16S marker, alignment length, reference sequences’ accession numbers, scientific names, maximum score, total score, query cover, E- value, % Identity, mismatches and taxid number.

Sequence names	Alignment length	Reference sequences’ accession numbers	Scientific name	Max. score	Total score	Query cover	E value	% Identity	Mis-matches	Taxid
Hap 1	469	KF796617.1; KF796616.1	S. flexuosa	867	867	100	0.0	100	0	458843
Hap 3	469	KF796618.1	S. maena	867	867	100	0.0	100	0	98823

 

Haplotype network, phylogenetic analyses

Overall, 46 specimens were determined as Spicara flexuosa and 24 as Spicara maena from the 16S network (Figure 1B). The results of the haplotype network show three distinct Spicara haplotypes/haplogroups, corresponding to three different species. According to classification of Imsiridou et al. (2011) and Georgiadis et al. (2014), those individuals collected from Turkey, which all have Hap 1, were clustered with reference sequences of S. flexuosa from Greece in GenBank. On the other hand, samples collected from Greece coast for this study, which all have Hap 3, were grouping together with reference sequences of S. maena in GenBank. Thus, the samples collected from Turkey and Greece corresponded to S. flexuosa and S. maena, respectively, based on the results for the 16S gene.

Phylogenetic relationships of the three Spicara species indicated that three Spicara species were also clearly differentiated on the 16 S rRNA topology (Figure 1C), with high posterior probabilities (≥ 0.70) and bootstrap (≥ 70) values. ML and BY analyses result almost identical. In addition, S. flexuosa and S. maena species were reciprocally monophyletic based on the 16S tree.

Overall results indicated that some sequences previously submitted to GenBank have been incorrectly classified. Focusing on the other GenBank entries, based on the 16S classification that is followed here, samples from Italy (Orell and Carpenter, 2004) as well as S. maena and S. smaris collected by Turan (2011) (GenBank accession numbers (JF795031-JF795034)) were probably misidentified. On the other hand, the classification of samples, whose sequences were retrieved from GenBank, was based on the studies of Imsiridou et al. (2011), Georgiadis et al. (2014) and Hanel and Sturmbauer (2000) as S. maena were confirmed as correct.

Considering the source studies for some of these sequences and their resolution for diagnosing the three Spicara species, Imsiridou et al. (2011) found an interspecific sequence polymorphism between S. maena and S. flexuosa. The sequences submitted by Georgiadis et al. (2014) were previously used to diagnose three Spicara species by using real-time (melt-curve haplotype specific) PCR.

Misidentification problem of the three Spicara spp. was also observed in another study that used the 16S rRNA marker (Turan, 2011). The results of this study showed that samples assigned to the three different species by Turan (2011) are members of the same species, namely, S. flexuosa. Low levels of genetic divergence (0.5 %) between S. maena and S. flexuosa as well as no genetic divergence between S. maena and S. smaris were found by Turan (2011). However, the values reported in this study are higher (3.0- 4.4 %) than those recorded by Turan (2011). In the same study, morphological analyses of these Spicara spp. were also performed, and the result was congruent with the genetic results. Sexual and seasonal dimorphism, which is reinforced by sex inversion, morphological modifications during spawning seasons (Pollard and Pichot, 1971; Froese and Pauly, 2022; Minos et al., 2013) might be some other reasons for morphological incorrect identification as observed by Turan (2011).

Genetic differentiation between Spicara maena and S. flexuosa was initially reported by Imsiridou et al. (2011). The results from the number of mutations (16) and genetic distance value (p=0.031) between S. maena and S. flexuosa were found nearly identical with Imsiridou et al. (2011), who found total 15 mutations and genetic distance values (p=0.027) between two Spicara species.

Recently, genetic differentiation of the three species of Spicara and intraspecific substructure of S. flexuosa were investigated by using 16S rRNA and cytochrome b genes (Bektaş et al., 2018). The results from Bektaş et al. (2018) found that three Spicara species were clearly separated from each other based on the phylogenetic trees. The tree from this study also showed that S. flexuosa and S. maena are more closely related each other than S. smaris as observed in Bektaş et al. (2018). With regard to molecular diversity indices results as seen in Bektaş et al. (2018), three Spicara species had low levels of haplotype and nucleotide diversities for the cyt-b and 16S rRNA genes. Low levels of molecular diversities indices for COI (h=0.0340, π=0.0001) and cyt-b genes (h=0.0710, π=0.0002) and star-shaped haplotype network for S. flexuosa were also found in the previous study (Şalcıoğlu et al., 2021), and this study. Moreover, relatively high interspecific sequence variations among the three Spicara species based on the 16S (2.90-4.44 %) and cyt-b genes (7.99-9.41 %) were reported by Bektaş et al. (2018), similar to 16S (3.0- 4.4 %) (this study) and cyt-b findings (9.01- 9.35 %) (Şalcıoğlu et al., 2021).

Conclusions and Recommendations

The taxonomy of the genus Spicara has been problematic around the Mediterranean region. The result of the current phylogenetic analyses (ML and Bayesian) and the haplotype network using data of this gene indicated three different species namely, S. maena, S. flexuosa, and S. smaris. Overall results indicated that some of the sequences that belongs to studies by (Orell and Carpenter, 2004; Turan, 2011) previously submitted to GenBank have been incorrectly classified.

Acknowledgements

This study was supported by a grant (No: 1903) from the Research Fund of Boğaziçi University in Istanbul, Turkey, to R. Bilgin. I would like to thankful to my advisor I would also like to thank Dr. G. Krey from Greece and fishermen from the Turkish coastal waters for providing fish samples.

Novelty Statement

The present study revealed the first focus on the study of the identification and confirmation of incorrectly classified sequences on the Genbank Database based on the 16S r RNA gene of Spicara species. The results of this study have been outperformed of the previous studies based on the phylogenetic analyses approach.

Data availability

New 16S rRNA sequences of each samples have been deposited to GenBank under the following accession numbers: OM935680-OM935682. Parsimony informative sites of each Spicara species are given in Supplementary Table 1.

Ethics approval

The work raises no ethical issues. All fish examined were from commercial fishing activities and none of them were killed for the specific purpose of the study.

Supplementary Material

There is supplementary material associated with this article. Access the material online at: https://dx.doi.org/10.17582/journal.vsrr/2022.8.1.8.14

Conflict of ınterest

The author has declared no conflict of interest.

References

Bandelt, H.J., Forster, P., and Rohl, A., 1999. Median joining networks for ınferring ıntraspecific phylogenies. Mol. Biol. Evol., 16: 37–48. https://doi.org/10.1093/oxfordjournals.molbev.a026036

Bektaş, Y., Aksu, İ., Kalayci, G., Irmak, E., Engin, S., and Turan, D., 2018. Genetic differentiation of three Spicara (Pisces: Centracanthidae) species, S. maena, S. flexuosa and S. Smaris and intraspecific substructure of S. flexuosa in Turkish coastal waters. Turk. J. Fish. Aquat. Sci., 18: 301-311. https://doi.org/10.4194/1303-2712-v18_2_09

Bouckaert, R., Heled, J., Kühnert, D., Vaughan, T., Wu, C.H., Xie, D., Suchard, M.A., Rambaut, A., and Drummond, A.J., 2014. BEAST 2: A software platform for Bayesian evolutionary analysis. PLoS Comp. Biol., 10(4): e1003537. https://doi.org/10.1371/journal.pcbi.1003537

Costa, F., Landi, M., Martins, R., Costa, M.H., Costa, M.E., and Carneiro, M.A., 2012. Ranking system for reference libraries of DNA barcodes: Application to marine fish species from Portugal. PLoS One, 7(4): 1-9. https://doi.org/10.1371/journal.pone.0035858

Dulcic, J., Kraljevic, M., Grbec, B., and Cetinic, P., 2000. Age, growth and mortality of blotched picarel Spicara maena L. (Pisces: Centracanthidae) in the eastern central Adriatic. Fish. Res., 48: 69-78. https://doi.org/10.1016/S0165-7836(00)00112-0

Eschmeyer, W.N., 2010. Catalog of fishes. Available at http://research.calacademy.org/ ichthyology/catalog/fishcatmain.asp.

Froese, R., and Pauly, D., 2022. Fish Base. World Wide Web electronic publication. Retrieved on February 17, 2022, from http://www.fishbase.org.

Georgiadis, A., Sandaltzopoulos, R., Stergiou, K.I., and Apostolidis, A.P., 2014. Melt curve multiplex haplotype specific PCR, a valuable tool for biological studies: Application in congeneric species discrimination assay. Biochem. Syst. Ecol., 56: 271-277. https://doi.org/10.1016/j.bse.2014.07.013

Hanel, R., and Sturmbauer, C., 2000. Multiple recurrent evolution of trophic types in northeastern atlantic and mediterranean seabreams (Sparidae, Percoidei). J. Mol. Evol., 50: 276–283. https://doi.org/10.1007/s002399910032

Heemstra, P.C., 1981. Centracanthidae. In FAO species ıdentification sheets for fishery purposes. Eastern Central Atlantic, Fishing Area 34, 47 (in part) (Fischer, W. Bianchi, G. and Scott, W. B., eds). Ottawa: Department of Fisheries and Oceans, pp. 1-332.

Heemstra, P.C., 1990. Centracanthidae. In: Check list of the fishes of the eastern tropical Atlantic (Clofeta, II) (Quero, J. C., Hureau, J.C., Karrer, C., Post, A. and Saldanha, L., eds), Paris: UNESCO, pp. 768–772.

Imsiridou, A., Minos, G., Gakopoulou, A., Katsares, V., Karidas, T., and Katselis, G., 2011. Discrimination of two picarel species Spicara flexuosa and Spicara maena (Pisces: Centracanthidae) based on mitochondrial DNA sequences. J. Fish Biol., 78: 373–377. https://doi.org/10.1111/j.1095-8649.2010.02858.x

Kimura, M., 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol., 16: 111–120. https://doi.org/10.1007/BF01731581

Kumar, S., Stecher, G., Li, M., Knyaz, C., and Tamura, K., 2018. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol., 35: 1547–1549. https://doi.org/10.1093/molbev/msy096

Landi, M., Dimech, M., Arculeo, M., Biondo, G., Martins, R., and Carneiro, M., 2014. DNA barcoding for species assignment: The case of Mediterranean marine fishes. PLoS One, 9(9): 1-9. https://doi.org/10.1371/journal.pone.0106135

Leigh, J.W., and Bryant, D., 2015. Popart full features of the software for haplotype network construction. Methods Ecol. Evol., 6: 1110–1116. https://doi.org/10.1111/2041-210X.12410

Librado, P., and Rozas, J., 2009. DnaSPv5: A Software for comprehensive analysis of DNA polymorphism data. Bioinformatics, 25: 1451–1452. https://doi.org/10.1093/bioinformatics/btp187

Minos, G., Imsiridou, A., and Katselis, G., 2013. Use of morphological differences for the identification of two picarel species Spicara flexuosa and Spicara maena (Pisces: Centracanthidae). Mediterr. Mar. Sci., 14(3): 26-31. https://doi.org/10.12681/mms.423

Orrell, T.M., and Carpenter, K.E., 2004. A phylogeny of the fish family Sparidae (porgies) inferred from mitochondrial sequence data. Mol. Phylogenet. Evol., 32: 425–434. https://doi.org/10.1016/j.ympev.2004.01.012

Orrell, T.M., Carpenter, K.E., Musick, J.A., and Graves, C.E., 2002. A phylogenetic and biogeographic analysis of the Sparidae (Perciformes: Percoidei) based on cytochrome b sequences. Copeia, 3: 618–631. https://doi.org/10.1643/0045-8511(2002)002[0618:PABAOT]2.0.CO;2

Pollard, D.A., and Pinchot, P., 1971. The systematic status of the Mediterranean Centracanthidae fishes of the genus Spicara, and in particular S. chryselis (Val.) as indicated by electrophoresis studies of their eye-lens proteins. J. Fish Biol., 3: 59–72. https://doi.org/10.1111/j.1095-8649.1971.tb05905.x

Quero, J.C., Porche, P., and Vayne, J.J., 2003. Guide des poisons de l’Atlantique europ´een (les guides du naturaliste). Lonay (Switzerland) and Paris: Delachaux et Niestle, pp. 1-304. (in French).

Salekhova, L.P., 1979. Centracanthidae fishes of the genus Spicara from the Mediterranean and Black Sea. Haykova-Dumka, Kiev Academy of the Science, pp. 1-172.

Sanciangco, M.D., Carpenter, K.E., and Betancur, R.R., 2016. Phylogenetic placement of enigmatic percomorph families (Teleostei: Percomorphaceae). Mol. Phylogenet. Evol., 94: 565-576. https://doi.org/10.1016/j.ympev.2015.10.006

Şalcıoğlu, A., Gubili, C., Krey, G., Sakinan, S., and Bilgin, R., 2021. Molecular characterization and phylogeography of Mediterranean picarels (Spicara flexuosa, S. maena and S. smaris) along the coasts of Turkey and the Eastern Mediterranean. Reg. Stud. Mar. Sci., 45: 101836. https://doi.org/10.1016/j.rsma.2021.101836

Tortonose, E., 1975. Fauna d’Italia Osteichthyes. Pesci Ossei. Edizioni Calderini Bologna, XI, pp. 1-636.

Tortonose, E., 1986. Centracanthidae. In: Fish of the North-eastern Atlantic and Mediterranean (Whitehead, P.J.P., Bauchot, M.L., Hureau, J.C., Nielsen, J. and Tortonese, E., eds), Paris: UNESCO, 2: 908–911.

Turan, C., 2011. The systematic status of the Mediterranean Spicara species (Centracanthidae) inferred from mitochondrial 16S rDNA sequence and morphological data. J. Black Sea Mediterr. Environ., 17: 14-31.

Vidalis, K., and Tsimenidis, N., 1996. Age determination and growth of picarel (Spicara smaris) from the Cretan continental shelf (Greece). Fish. Res., 28: 395-421. https://doi.org/10.1016/S0165-7836(96)00488-2