Submit or Track your Manuscript LOG-IN

Lei Chen, Ling Zhu, Zhi-Wen Xu, Wan-Zhu Guo

 

Molecular Genetics of Aichivirus C (Porcine Kobuvirus) in China
...volutionary features and pathogenicity of Aichivirus C.

 

...

Hu Zenglei1 and Xiufan Liu1, 2*

 

...justify; ">Virulence and pathogenicity of Newcastle disease virus (NDV) is one of the major determinants for the clinicopathological manifestations in infected hosts. Recent studies showed that the host innate immune responses to infection play important role in the pathologenesis of NDV, and correlate with the severity of the clinical disease. Virulent strains of different genotypes induce distinct pathological manifestations in chicken organs, especially in ...

Leonard Izzard1, 2, John Stambas1, 2*

...being used to manipulate pathogenicity and immunity and as biomarkers for disease severity.

...

Mohammed A. Rohaim1*, Rania F. El Naggar2, Ahmed M. Helal3, Hussein Ahmed Hussein1 and Neil LeBlanc4

...gs and the intracerebral pathogenicity index (1.2), and the amino acid motif, (112KRQKR116), at the cleavage site of the fusion (F) protein indicated the emergence of PPMV-1 in Egypt. Phylogenetic analysis of the F and haemagglutinin-neuraminidase (HN) genes indicated that the isolate clustered with the PPMV-1 strains recently reported from Israel within subgenotype VIb. Our findings report the emergence of PPMV-1 in Egyptian pigeons and the potential role the...

Ahmed Samy, Wesam Mady, Naglaa M. Haggag, Samah H. Mohamed, Ebtissam N. AlShamy, M.K. Hassan

...ture affecting the viral pathogenicity and associated with impairment of innate immune response that in turn facilitate and magnify the effect of co-infections.

...
Waheed Anwar*, Muhammad S. Haider, Ahmad A. Shahid, Hamid Mushtaq, Usman Hameed, Muhammad Zia Ur Rehman and Muhammad Javed Iqbal
...d isolates. Additionally pathogenicity of isolated Fusarium species was evaluated against nymph and adult of Bemisia tabaci. Under controlled conditions different species of Fusarium restrained the growth of B. tabaci as compared with control.
...
Muhammad Mansoor, Zaigham Abbas and Nageen Husssain*
...tibodies production. The pathogenicity and etiology of the disease has yet to be elucidated. It is presently accepted that environmental factors trigger the disease in genetically sensitive individuals. Gluten, a protein fraction commonly found in wheat grains, associated with food related disorders and a number of autoimmune diseases. We hypothesized that gluten containing diet would further exacerbate an already undergoing arbitrary immune reaction in SLE pa...

Gadeeyya G and Ratna Kumar P.K.

...relevant literature. The pathogenicity of the isolates was examined to select biocontrol agent against host weed. 
...
Tiansen Li1, Meiling Huang2, Zhen Wang1,Fei Guo3,Hui Zhang1,* and Chuangfu Chen1,*
... affect its survival and pathogenicity.
...
Hailong Dong1, Hui Zhang2, Kun Li2, Khalid Mehmood2,3, Mujeeb Ur Rehman2, Fazul Nabi2, Yajing Wang2, Zhenyu Chang1,2, Qingxia Wu1,* and Jiakui Li1,2,*

 

...>Stxl, Stx2, EAST1), pathogenicity island (eaeA, irp2, ETT2) and outer membrane protein (ompA). Moreover O-antigen serotype was tested by slide agglutination test and a mouse model was built to assess the lethality of the E.coli isolates through subcutaneous-infection. Out of 81 E.coli isolates, the most prevalent gene detected was ompA (90.12%), followed by ETT2 (69.14%), irp2 (54.32%), EAST1 (46.91%...

Ayesha Aihetasham*, Faiza Qayyum and Muhammad Xaaceph

Qiang Li1,2, Guo Qiao2, Li Wang1, Jipeng Zhang1, Ruijun Li1, Ping Ni1, Yi Guo1 and Shigen Ye1,*
...plification, followed by pathogenicity determination. Results showed that the isolates belonged to 10 genera, including Vibrio (72%), Staphylococcus (9%), Pseudomonas (4%), Bacillus (4%), Vagococcus (3%), Shewanella (3%), Planococcus migula (4%), Exiguobacterium (1%), Enterobacter (1%) and Kocuria roseus (1%). Vibrio spp. and Vibrio harveyi were the predominant genus and specie...

Ahmed Samy1*, Hala Mohamed Nabil Tolba2, Gamelat Kotb Farag3 and Ahmed Abd El Halim1 

...olates were assessed for pathogenicity based upon the mean death time (MDT), the intracerebral pathogenicity index (ICPI) and the intravenous pathogenicity index (IVPI) in chicken. The ICPI and MDT revealed that all tested isolates were of moderate virulence (Mesogenic) in chickens. Mature chickens showed no clinical signs or death as assessed by IVPI. Pigeon in Egypt reared in free rang s...

Ali Mahmoud Zanaty, Naglaa Mohammed Hagag, Neveen Rabie, Mahmoud Saied, Karim Selim, Saad A. Mousa, Azhar Gaber Shalaby, Abdel-Sattar Arafa and Mohamed Khalifa Hassan 

...rmore, the intracerebral pathogenicity index (ICPI) for selected 5 virulent viruses reveals velogenic features with high pathogenicity index (1.60 to 1.74). 

...
Irfan Irshad1, Asim Aslam1,*, Muhammad Yasin Tipu1, Kamran Ashraf2, Beenish Zahid3 and Abdul Wajid4
Zhijun Zhong1, Rui Tu1, Xichun Wang2, Yi Geng1, Qicheng Xiao1, Yinan Tian1, Bin Wei1, Jiaming Dan1, Ya Wang1 and Guangneng Peng1,*
...nding of B. canis pathogenicity in naturally-infected pet dogs.

...
Shaheen Rahman1, Kafeel Ahmad1*, Niaz Ali2, Muhammad Idrees3 and Waqar Ali4
...>A. tumefaciens. The pathogenicity of the isolates was confirmed by in vitro carrot and potato discs inoculation assays. A total of seven strains of A. tumefaciens were isolated on yeast extract mannitol agar (YEMA) medium. The isolated strains were confirmed as A. tumefaciens on the basis of morphological, biochemical and pathogenicity tests. The bacterial cells were rod shaped having rounded ends. The str...

Kajol, A. H. Bhat, Aasha and A. K. Chaubey

Biochemical and molecular characterization of Photorhabdus akhurstii associated with Heterorhabditis indica from Meerut, India
...urther, we evaluated its pathogenicity against Galleria mellonella and Helicoverpa armigera. The LD50 value of strain DH3 against G. mellonella larvae at 48 hours was 8 IJs/larva for 50% larval mortality whereas in Helicoverpa armigera it needed 13 IJs/larva, to kill 50% of the larvae.

...

Muhammad Riaz1*, Naureen Akhtar1, Salik Nawaz Khan1, Muhammad Shakeel1,2 and Ateeq Tahir1

Neocosmospora rubicola: An Unrecorded Pathogen from Pakistan Causing Potato Stem Rot
...e confirmed Koch’s pathogenicity postulates. Association of N. rubicola causing stem rot in potato is never reported before in Pakistan.

...

Shishir Sharma* and Laxmi Prasad Joshi

Current Insights on Stemphylium Blight of Lentil with its Management Strategies
...athogens, their effects, pathogenicity, integrated disease management approaches, and future views.

...
Laura Alejandra Arriola-Mosqueda1, Yadira Jiménez-Lara2, Eugenia del Carmen Prieto-Avella1, Carlos Ricardo Cruz-Vazquez3, Roberto Montesinos-Matias4, Mauricio Valencia-Posadas2, Ana Martha Cruz-Avalos5, Jaime Molina-Ochoa6,7 and César Andrés Angel-Sahagún2,*
...ae. We evaluated the pathogenicity on the eggs and larvae of all tested strains of R. sanguineus at day 3 and 7. The LC50 of four strains of M. anisopliae was determined by Probit analysis, and a chi-square test was used to determine the relationship of LC50 with variable radial growth and germination at 18 and 24 h. Germination at 18 h and 24 h ranged from 83.8–92.5% and 89.5–100%, respectively. The average ...

Muhamamd Rizwan1*, Muhammad Arshad2, Muhammad Kashif3, Aneela Zameer Durrani4, Asghar Abbas5, Tanveer Ahmad6, Muhammad Nadeem7 , Kinza Khan8

... bacteria, enhance their pathogenicity and can survival in host body. 
 
Novelty Statement | CRISPR Cas system is an integral part of prokaryotic immune system that provides protection against viral infection and involved in genome editing, bacterial virulence and antibiotics resistance.
...

NawalM. Abdulla1, M. Haroun1*,Mohamed A. Shalaby2and Ahmed A. Elsanousi2

...eveal virus identity and pathogenicity. Both NDV
isolates were found to be velogenic strains. Real time reverse transcriptase polymerase
chain reaction (rRT-PCR) used as a confirmatory technique, successfully amplified and
detected cDNA fragments corresponding to the NDV RNA extracted from amnioallantoic
fluids (AAF). Sequence analysis and phylogensis of the NDVQF13 strain using 150bp
primer sets reve...

Rafia Ahsan1, Saif Ullah1, Ijaz Yaseen1, Faisal Sohail Fateh1, Muhammad Fayyaz1, Shahzad Asad1, Atif Jamal1, Muhammad Sufyan2 and Muhammad Zakria1*

...ae (Xoo) through PCR and pathogenicity on susceptible host. The results indicate that BLB is continuously present in rice growing areas of Pakistan specially in Basmati area of Punjab for last many years. There is need to introduce resistant Basmati varieties to reduce the inoculum level and yield losses.

...

Ayman S. El-Habbaa 1, Gabr F. El-Bagoury1, Samar F. El-Adaway2, and Susan S. El-Mahdy2

Dalia M. Omar1, Nermeen A. Marden1, Lamiaa M. Gaafar1, Elham A. El-ebiary1, Khalid El-Dougdoug2, Badawi Othman2, Abd Elsattar Arafa3, Hussein A. Hussein4
Yang Yang1,2, Ji Shao1,2, Mingxu Zhou3,4, Qiangde Duan1,2, Xinyi Zhang1,2 and Guoqiang Zhu1,2*

...uge economic losses. The pathogenicity of E. coli is closely related to its virulence factors, which are strictly regulated in vivo, and the quorum sensing system is involved in this process. To study the effect of quorum sensing signal molecule acyl homoserine lactone (AHL) on the biological characteristics of Enterotoxigenic E. coli (ETEC), gene lasI of Pseudomonas aeruginosa which is responsible for the synthesis of long s...

Rehman Shahzad1, Saba Irshad1*, Malik Saddique Mehmood1 and Faisal Amin2

...uting to the increase in pathogenicity of the circulating H9N2 virus.

...

Mona M. Osman1, Kamelia M. Osman2, Manal Abu Elmakarem Mohamed1, Mahmoud E. Hashad2, Jeeser Alves Almeida3, Alaa Saad4, Octavio Luiz Franco5,6, Heba N. Deif 2* 

...actors implicated in the pathogenicity of Mycoplasma arginini (M. arginini) and Mycoplasma ovipneumoniae (M. ovipneumoniae). It shed light on the current knowledge gap in the role of two potential virulence determinants viz H2S production and catalase activity, for their possible roles in biofilm formation, antibiotic resistance and hemolytic activity of M. ovipneumoniae. The recovered sheep isolates of M. arginini and M. ovipneumoniae were examined bacteriolo...

Rizwana Abdul Ghaffar* and Kamil Nadeem

...yers. This causes severe pathogenicity in the intestine as a result the pigeon shows signs and symptoms of illness. Pathological studies of tissues from infected intestine reveal several changes from the normal architectural organization of tissues. The most common findings were massive congestion, cellular infiltration, atrophy, hypertrophy and dystrophy of cells and disintegration of cellular layers, fibrosis, necrosis and dilation and proliferation of blood...

Nishant Shah1*, Rakesh Kumar Yadav1, Anil Gautam1*, Shambhu Shah1 and Mohan Kumar Gupta2

...serotype 078: K80:H9) at pathogenicity amount (9.4 x 105 cfu E. coli per bird) was done and morbidity and mortality rate was also recorded. The significantly minimum ammonia (ppm) was recorded in CRH (30.53±0.77); however, the maximum ammonia (ppm) was recorded in RH (49.78±0.42) with that compared to SD (33.42±0.25) and RS (43.22±0.56). Similarly, the mortality rate due to colisepticemia was recorded minimum in CRH (68.75%), howeve...
C.A. Angel-Sahagún1, J.E. Ortega Palomares1, A.A. Hernández-Rangel1, C. Cruz-Vázquez2, R. Montesinos-Matias3, M. Valencia-Posadas1 and A.M. Cruz-Avalos4*
...tudy was to evaluate the pathogenicity of Metarhizium anisopliae (Ma) and Beauveria bassiana (Bb) isolates, obtained from adult Ctenocephalides canis, the dog flea, under laboratory conditions. Nine, monosporic cultures were isolated. Each were pathogenic when exposed by immersion at a concentration of 1x108 conidia/ml, causing between 10-100% mycosis at ten days post-inoculation. Four isolates identified as Bb9, Bb6, Ma9 and Ma10, were the most pathogenic as ...

Hams M.A. Mohamed1*, Katreen K.G.2, M.W. Abd Al-Azeem1, Faysal A. Wasel2, Ahmed M. Abd-Eldayem3 

... forming capability. The pathogenicity of L. monocytogenes, particularly virulent, drug-resistant and biofilm-forming strains, is highlighted in this study and can result in a public health danger when present in raw milk. Therefore, it is essential to keep an eye on bacterial resistance in the setting of food production.

Keywords | Listeria spp., L. monocytogenes, Virulence genes, Biofilm, antimicrobial resistance 

...
Chunlan Shan1, Chaoying Liu1, Qin Lu1, Guowen Fu2, Syed Aftab Hussain Shah3, Rana Waseem Akhtar4, Ru Zhao2, Libo Gao2, Chang Liu2, Shushu Miao2, Hongdan Wang2 and Hong Gao2*

 

...xt-align: justify;">High pathogenicity island (HPI), a critical genomic element of pathogenic Yersiniabactin (Ybt) carries out synthesis, regulation, transportation as well as virulence. As a virulent determinant for the E. coli, the role of HPI in Saba pig was explored to provide some perspective about disease association. This is the first study in which 44 E. coli superior serotype strains were isolated and identified from Yunnan Saba pigs. The genomic DNA ...

A.H. Choshali1, S. Rezaee2, S. Jamali3, H. Reza3, Zamanizadeh4 and F. Rejali5

...nificant decrease in RKN pathogenicity factors (number of galls, eggs, egg sacs and J2) in both tolerant and susceptible cultivars. Inoculation of susceptible roots with AMF significantly reduced the nematode pathogenicity factors. Also the results indicated that the activity of both enzymes increased in the plant with AMF compared with the cucumber roots inoculated with M. incognita alone. Cucumber mycorrhizal roots showed ...

A. M. Rahoo1,*, †, T. Mukhtar2, S. I. Abro3, S. R. Gowen1 and B. A. Bughio4

...ctivity, persistence and pathogenicity for longer periods. In the present study, emergence of Steinernema
feltiae infective juveniles (IJs) from infected Galleria mellonella cadavers was monitored under moist and dry
conditions at 5 and 10oC. Greater numbers of IJs of S. feltiae recovered from G. mellonella cadavers kept at 10oC
than from those kept at 5oC. Likewise, significantly greater number of infective juveniles emerge...

Ahmed S.M.H. EL Roby

...re efficient with higher pathogenicity and virulence in the laboratory than the
other strains and gave the highest corrected mortality percentage in the infestation (from 68.59% to 70.83%). The
LC50 were 25.42 and 45.5 IJs/ insect for the two strains, respectively.
...

I.K.A. Ibrahim1 and Z. A. Handoo2

...n rice plants.

...

F. Shahina†, K.A. Tabassum and M.A. Habib*

Hina Safdar1,2*, Nazir Javed2, Sajid Aleem Khan2, Muhammad Zeeshan Majeed3, Arif Mehmood3 and Muhammad Arshad4

Hagar Magdy Ahmed1, Mohamed Mahrous Amer2*, Khaled Mohamed El-Bayoumi1, Ahmed Ali El-Shemy3, Mohamed Abd El-Rahman Bosila1, Gomaa Abd El-Rhim Abdel Alim2
...al broiler chickens. The pathogenicity studies parameters included the effects on protection, growth performance and clinico-pathological changes. The results indicated that, immunostimulants can keep maternal immunity longer where lector® was the best; the decline in HI titers also indicates that bird groups not contract ND natural infection. The results of performance parameters after immunostimulants administration and challenged with IBDV at 14-days of...

Nachaat Sakr

...ed that the variation in pathogenicity among the FHB population is crucial for developing disease-resistant cultivars. FDK component did not differentiate the eight analyzed cereal genotypes and pathogen strains. Most significantly, stability of cultivars for head blight resistance was fulfilled during seasons as well as under several experimental conditions, suggesting that cultivars with stable and high disease resistance could be incorporated to crossbreedi...
Syeda Fakhra Waheed1, Asim Aslam1*, Muti-ur-Rehman Khan1, Kamran Ashraf2 and Beenish Zahid3
...equired to determine the pathogenicity of the IBDV reassortant and development of new policies for IBDV intervention in the country.

...

Lipigwe Lauya1*, Peace Nkiruka Okeke2, Chukwudi Chizorom Ibeh1, Bello Ozovehe Banimoh1 and Nanma Tongnan Cosmas1

...p of HIV-2 patients, the pathogenicity of the HIV-2 virus, and the clinical picture of the disease depending on the sex of individuals.

...

Saddam Hussein Mahmoud* and Shaimaa Nabhan Yassein

...tors that were linked to pathogenicity and the severity of infection. There findings suggest that poor sanitation and a reduction in goat health and nutrition were to blame for the high morbidity incidence of mycotic mastitis in Iraqi goats. 
 
Keywords | Goats, Dairy industry, Mycotic, Mastitis, C. albicans, virulence factors, Yeast’s virulence and biochemical indices
...

Frah R Kbyeh1*, Ahmed N. Abedsalih2 

... also have a role in the pathogenicity of the resistant Escherichia coli 0157: H7 strain. Resistance Escherichia coli 0157 H7 for antibiotics decreases the cure rate. Repurposing Food and Drug Administration (FDA) approved medications against the contributing factors is a novel method to overcome this scarcity. The analgesic medication diclofenac was reported to have anti-virulence action against resistance Escherichia coli O157 :H7. This study aimed to demons...

Sidra Hafeez1, Tayyaba Sanaullah2, Hafsa Naeem3, Mah Noor Hassan4, Muttalib5, Farhana Kausar6, Muhammad Salman Hameed7*, Muhammad Anayat Ullah8, Abdul Samad9, Memoona Bashir10 and Sadaf Shabbir11

...’s postulates, the pathogenicity test was performed. CTAB method and Internal Transcribed Spacer region were applied to isolate and amplify the fungal genomic DNA respectively, by using universal primers ITS1/ITS4. The analysis of polygenetic of an amplified product revealed that black rot caused by D. bryoniae in pumpkin.

...

Nafissa Sahel1*, Fadela Chougrani2, Abderrahim Cheriguene3 and Zineb Hamani1

.... All samples tested for pathogenicity were negative for pathogenic germs.

...
Morcos Ibrahim Yanni1* and Eid Elsaid Abdelaziz2
...ne plays a role in viral pathogenicity, the detected variance in nucleotide and amino acid identities of the P gene in our local circulating isolates over the years confirmed the anticipation of distinction in the pathogenicity of such isolates. All vaccinal strains have a genetic distance from field Dakahleya, Beheira, and Alexandria isolates (ranging from 88.2% to 88.9% for the China human rabies vaccine AG)

Omarl , Dalia M.; El-Ibiaryl , Elham A.; Sadik2, Atef S.; Abdel-Ghaffar2, Mamdouh. H. and Othman2, Badawy A.

...r determination of their pathogenicity in specific pathogen free (SPF) 4-6 week old chicken. All the Al isolates proved to be HPAI viruses where the Intravenous Pathogenicity Index (IVPI) score for them were 2.1, 2.5, 2.3, 2.2 & 2.3 and their titers in ECE were 10.1, 9, 9.3, 9.3 and 10 Logo10 EID50/ ml for 2006, 2007, 2008, 2009 and 2010 isolates respectively.

...

Sofyl *, A.R.; Soliman , A.M.; Mousal, A.A. and El-Dougdoug , Kh.A.

...P) tend to influence the pathogenicity of the HSVd-EG. Finally, the genetic diversity and evaluation of entropy power for the Egyptian cifrus gummy bark agent and HSVd-citrus populations registered in GenBank, were viewed against the phylogenetic backgound of CVd-II variants including the noncachexia (CVd-IIa) and the causal agents of severe (CVd-IIb, CVd-IIc), more moderate (Ca903) and mild (Ca909).
...

El-Dougdoug, Kh.A.; Rezk , A.A.; Dawoud, Rehab A. and Sofy, A.R.

...lieved to control viroid pathogenicity. Finally, this constitutes the first isolation and identification of CSVd from diseased Chrysanthemum plants in Egypt

...

H. A. Hussein1, N.A. Mohamed2, F.M. Mohamed2 and M.A. Shalaby1

...ic effect (CPE). The cytopathogenicity of the isolates were different when these viruses were inoculated on BVDV-free and-infected cell lines. To study the discrepancies on the growth behavior of the local isolates, the viruses subjected to further passages on MDBK cells infected with non-cytopathic (NCP) strain of BVDV which was homologues (pair) to their genotype (type I). After four passages on cell culture. The local isolates demonstrated enhancement in th...

H.A. SULTANl, H.A. HUSSEIN2, and F.F. EL-KHAYAT3

...s-based AC-ELISA and the pathogenicity of some representative infectious bursal disease virus (IBDV) field isolates were studied. Of the selected 22 IBDV -positive bursal samples, 59.1% (13/22) were typed as classic IBDVs and 40.9% (9/22) were of variant IBDVs. The majority of IBDV variant antigens detected (89% Of IBDV variants) were related to IBDV Del/E variant strain and one sample (11% of IBDV variants) was related to RS593 strain. The

Wahid Hussein El-Dabae*, Eman Shafeek Ibrahim, Eslam Gaber Sadek, Mai Mohamed Kandil

...s checked. Intracerebral pathogenicity index (ICPI) of the attenuated strain was 0.2, the mean death time (MDT) was 120 hours and infectvity titer was 7 log10 EID50/ml compared to 1.97 ICPI, 36 hours MDT, and 9.5 log10 EID50/ml of the original strain. The attenuated AOAV-1 was protective in vaccinated chicks by means of HI antibody response and protection from heterologus virulent challenge while showing little to no residual pathogencity. Histopathological in...

Hongsen Xu*, Xiaoni Wang, Tie Tian, Changyu Zhao, Denghang Yu and Jun Liu

...ological characteristic, pathogenicity and drug sensitivity of this bacterium. The results of this study will provide scientific guidance for the effective prevention and control of muscle turbidity of P. clarkii.

...

Habibeh Jabbari

...only differences between pathogenicity populations.

...

Amir Afzal1*, Sairah Syed1, Hafiz Husnain Nawaz2, Ruqeah Mustafa1, Marjan Aziz1, Madeeha Khan1, Azra Khan3, Uzma Javed1, Attiq Ur Rehman4, Rubab Altaf 5 and Qamar Shakil6

Roshan Ara1, Muhammad Ali Khanzada1, Amir Khan Korai1*, Abdul Mubeen Lodhi, Anam Mehwish Khanzada1, Khalid Hussain Qureshi1, Shakal Khan Korai2*

Pavana Jyothi Vanjavaka1, Mouradam Veerasami2, Mohana Subramanian Bhaskaran2*, Vijay A.K.B. Gundi1*

...derstand their impact on pathogenicity. In contrast, molecular characterization has become an essential tool in comprehending the evolution of viruses. For studying the molecular level changes, 28 field isolates were collected from various regions in India and subjected to PCR for amplification, with sequencing of a partial region of the VP2 gene. Among these isolates, 27 samples were positive for CPV, of which one was CPV 2b while the remaining were CPV 2a, a...

Ying Zhong1,3,4, Jingni Chen1, Chunping Huang1, Huaiyuan Jin1, Jinlu Huang1, Lining Zhao1, Yi Geng3, Guiping Wang1,4 and Xueqiao Qian1,2*

...lation. In addition, the pathogenicity of the three V. parahaemolyticus strains were similar. In the present study, V. parahaemolyticus was identified as one of the pathogenic bacteria causing acute hepatopancreatic necrosis of L. vannamei, and the O1:KUT and OUT:KUT serotypes may be the main pathogenic strains in Zhuhai. These results provided a foundation for the isolation, identification, and pathogenicity study of acute ...

Nahed Yehia1*, Rania I. Mohamed2

...stify;">However, the low pathogenicity of avian influenza (H9N2), can have significant economic losses in poultry farms associated with other viral and bacterial infections. The purpose of this research is to study the genetic evolution and pathogenicity of the H9N2 virus during 2022. The forty tracheal samples were gathered from broiler chicken farms from 5 governorates (El-Dakahlia, El-Sharqia, Alexandria, Al-Qalyubia, and...

Yasser Asaad Hameed Al-Shareef, Firas Hussain Kadim Abawi*

... determinant of ND virus pathogenicity by the analysis of the fusion protein cleavage sites, phylogenetic analysis sand compared genomics of NDV isolates to publish sequences. Isolates characterized here showed 90.37% sequence similarity to the Iranian isolate Asil/IR/AAA158/2019 (MN370894.1) within velogenic clusters. Taken together, clinical, genetics and molecular biological approaches identified velogenic strains of NDV in poultry which breach the immunity...
Mat Zin Ain-Auzureen1, Maizan Mohamed1, Tan Li Peng1, Mohd Faizal Ghazali2, Choong Siew Shean1, Kamaruddin Mardhiah3, Najiah Musa4, Nora Faten Afifah Mohamad5, Chai Min Hian2 and Ruhil Hayati Hamdan1*
... V. alginolyticus pathogenicity and evaluating antibiotics misuse for the development of sustainable disease control methods.
...

Shahbaz Ahmad1*, Mubashar Iqbal1, Arshad Javaid2, Muhammad Bilal Chattha3, Muhammad Ashfaq4, Tajamal Hussain5 and Sumra Ashraf1

...act of these oils on the pathogenicity of EPF strains against melon fruit fly (Bactrocera cucurbitae Coquillett) maggots. Under the laboratory conditions, EPF strains namely Metarhizium anisopliae (F 52), Metarhizium pinghaense (MBC 709), Isaria cateniammulata (MBC 289), Isaria javanica (MBC 524), Isaria farinose (MBC 389), Isaria fumosorosea (MBC 053), Lecanicillium attenuatum (MBC 807), Beauveria brongniartii (MBC 397) and Beauveria bassiana (MBC 076) were a...
Hadda Kareche1*, Ola Elbohy2 and Janet M. Daly2
...atural reservoirs of low pathogenicity avian influenza (LPAI) viruses. This review focusses on the epidemiological situation and the spread of LPAI viruses of the H9N2 subtype in poultry in North African countries including Morocco, Egypt, Algeria, Tunisia, and Libya. Although H9N2 virus infections do not typically cause severe disease in poultry, they can result in significant economic losses to the poultry industry. Furthermore, the H9N2 subtype has zoonotic...

 

Ahmed M.F.A

Volume 2, Issue 2 March and April 2018 Pages 37-47
...n: justify;">, and their pathogenicity were confirmed on date palm seedlings in the greenhouse. These fungi cause economic losses in date palm yield and a wide range of other cultivated plants. Many different antagonistic isolates (bioagents) i.e. 

Ayesha Bibi 1 Muhammad Junaid 2 Musharaf Ahmad 3

Volume 2, Issue 6 November and December 2018 Pages 167-174

 

Muhammad Junaid1*; Ayesha Bibi2; Musharaf Ahmad3; Muhammad Ali4; Yousaf Noor5

Novel Research in Microbiology Journal (2019), 3(2): 314-325
... on the agar plates; and pathogenicity assays, about 29 isolates were guessed to be R. solanacearum. To further confirm the identity of these isolates, a species-specific primers-mediated Polymerase chain reaction (PCR) was carried out. Two specific primers i.e. forward primer: 5'GTCGCCGTCAACTCACTTTCC3', and reverse primer: 5'GTCGCCGTAGCAATGCGGAATCG3', were used for amplification of the 281bp band. Twenty five isolates out of the 29 were genetically confirmed ...

 

Ahmed Ali1*; Ahmed I. Abd El-Mawgoud2; Al-Hussien M. Dahshan1; Azza A. EL-Sawah1; Soad A. Nasef3

Novel Research in Microbiology Journal (2019), 3(4): 415-427
...oyed as an indication of pathogenicity, rather than the tedious E. coli serotyping methods. In Egypt; several virulence genes were studied, and were found to be different based on the geographical area. However; all studies were limited to a small number of screened virulence genes, in addition to the inconsistency of these screened genes. To control APEC, antibiotics have been used for decades; however the emergence of multi-drug resistant E. coli, and the di...

Andrei V. Kozlov1,2; Artem V. Lyamin1; Aleksei A. Neilenko1; Anna V. Yanchenko1; Alena A. Ereshchenko1,2*

...Porphyromonas gingivalis pathogenicity factors into the brain tissue through the outer
membrane vesicles and/ or as part of the bacterial cell structures leads to neuro-inflammation
and accumulation of the amyloid plaques. It is concluded that focusing on this bacterium as a
risk factor for Alzheimer’s disease development will help to develop an effective therapy and/
or a set of preventive measures.
...

Mahmoud Abou-Alhmd Soliman

...syringae pv. tomato. The pathogenicity of the
bacterial isolate was confirmed by molecular identification through detection of coronatine
production and 16S rDNA analysis. The obtained nucleotide sequence was deposited at
GenBank with accession no. OQ117369.1 and designed as P. syringae pv. tomato strain Pst1-
MAS. The tomato plants only produced the typical bacterial speck symptoms among the tested
s...

 

Fatma Ahmed Abdel Aziz1; Gamal Fadl Mahmoud Gad1; Ahmed Mohamed Kamal El Shafei2; Reham Ali Ibrahem1*

Novel Research in Microbiology Journal (2022), 6(5): 1725-1741
...nce of several bacterial pathogenicity genes, including MecA, PVL, icaA, icaD, and Hla in the MRSA and in MR- CoNS. Results of the PCR revealed that all MRSA and MR-CoNS had MecA, icaA, and icaD genes, whereas 28.9 % of the MRSA had PVL and Hla. However, no isolate of MR-CoNS recorded the presence of the PVL or HLa genes. This study showed that prevalence of the bacterial eye conjunctivitis has increased with MRSA dominance. All the MRSA possessed at least the...

 

Simiat O. Jimoh1*; Faizah R. Adebowale2; Kifayat O. Asafa-Adedimeji2, Ramat B. Badmos-Oladapo2; Taiwo A. Sorunke1

Novel Research in Microbiology Journal (2024), 8(3): 2452-2468
...idues, and eradicate the pathogenicity and risk associated with Pseudomonas aeruginosa alginate. Preliminary screening for alginate production revealed the presence of different alginate products. High-performance liquid chromatography (HPLC) confirmed the existence of varying alginate concentrations, such as sodium alginate (2.42754×10-1g/ 100 ml), calcium alginate (1.09597×10-1g/ 100 ml), acid alginate (1.39420×10-2g/ 100 ml), alginate olig...
Frank G. Cedeño-Lozano1, Freddy Zambrano-Gavilanes2 and Felipe R. Garcés-Fiallos3*
 
...icrosclerotia (n=20) and pathogenicity of two Macrophomina isolates on COCKER seedlings were determined. After the data were subjected to a two-way ANOVA, the Tukey test separated the means (P ≤ 0.05). All the plants analyzed presented charcoal rot and presence of microsclerotia, mainly in hypocotyls. Only vascular damage in hypocotyls was higher in COCKER 310 plants compared to those of the other genotype. A significant interaction between va...

I Wayan Wisaksana Yasa1, I Wayan Teguh Wibawan2, Okti Nadia Poetri2*

...udy aims to evaluate the pathogenicity and immunogenicity of the IBD virus 098 Bogor ‘19 as a candidate for IBD live vaccine master seed through the bursal-body-weight ratio (BBWR), index of bursal-body-weight ratio (IBBWR), bursal lesion scoring (BLS), and IBD antibody titre evaluation. The IBD master seed candidate should be safe and have good immunogenicity responses. Thirty Specific Pathogen Free (SPF) chickens were divided into three groups of 10 ch...

Xiao Li, Wen Liu, CaiYi Chen and Shaoming Lu*

...lysis also confirmed the pathogenicity of the variant.The similarity index of superimpose 3D structure of wild-type and mutant DNAAF2 protein was just 14.81%. A current genetic study identified a homozygous variant of DNAAF2, which results in infertility in a Chinese male patient. This study will also assist in genetic counseling of Chinese families at risk of PCD.

...

Onifade Sururoh Joy1,2, E.F. Aluko2,4, Olowe Rita Ayanbolade1,3 and Olugbenga Adekunle Olowe1,2*

...y a critical role in the pathogenicity of H. pylori, promoting cellular damage and immune evasion. Transmission occurs predominantly through fecal-oral and oral-oral routes, but growing evidence suggests a potential animal source of transmission, complicating the epidemiology of the infection and its control. Clinically, H. pylori infection presents with a range of symptoms, from asymptomatic colonization to severe conditions like peptic ulcers and gastric can...
Fayaz Khan1, Aziz Uddin1, Hisham N. Altayb2, Bibi Nazia Murtaza3
Sajid Ul Ghafoor1, Faisal Imam4, Saima Iftikhar5, Sadia Tabassum1
Khushi Muhammad1* and Muhammad Shahid Nadeem2
...ovel to CAD. Score based pathogenicity analysis of tRNA variants with MSeqDR, MitoTIP, HMTVar and PON-mt-tRNA have suggested that the variants were either likely or possibly polymorphic. Molecular docking studies of variants have shown significant difference in their structure, binding position and binding affinities with corresponding amino acyl tRNA synthetase. In silico results with structural abnormalities and molecular docking studies reflecting a failure...

Jia-lue Hua1,*, Peng-fei Wang2,*, Ye-ping Song3, Meng-lei Ding4, Li-ling Wang3 

Pakistan Journal of Nematology

December

Pakistan Journal of Nematology, Vol. 42, Iss. 2, Pages 88-179

Featuring

Click here for more

Subscribe Today

Receive free updates on new articles, opportunities and benefits


Subscribe Unsubscribe