Research Article

Biological and Molecular Detection of Fig latent trichovirus in Naturally Infected Fig Plants

Hanaa H.A. Gomaa1*, Dalia Y.Z. Amin1, Mona A. Ismail1 and Khalid A. El-Dougdoug2

1Department of Botany and Microbiology, Faculty of Science, Suez Canal University, Ismailia, Egypt; 2Department of Microbiology, Faculty of Agriculture, Ain Shams University, Cairo, Egypt

Received | January 15, 2022; Accepted | March 28, 2022; Published | March 30, 2022

*Correspondence |Hanaa H.A. Gomaa, Department of Botany and Microbiology, Faculty of Science, Suez Canal University, Ismailia, Egypt; Email: hgoumaa@hotmail.com

Citation | Gomaa, H.H.A., D.Y.Z. Amin, M.A. Ismail and K.A. El-Dougdoug. 2022. Biological and Molecular detection of Fig latent trichovirus in naturally infected fig plants. Journal of Virological Sciences, 10(1): 8-17.

DOI | https://dx.doi.org/10.17582/journal.jvs/2022/10.1.8.17

Keywords | DAS ELISA, FLV-1, Host range, RT-PCR, TEM, Trichovirus

Copyright: 2022 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

Introduction

Virus-like diseases of fig trees have been reported to reduce yields significantly. Five distinct virus-like diseases were described in fig plants in Egypt. A “nondescript mosaic” and green-banding were the two predominant symptoms. It was not known if the variations in symptoms were induced by more than one virus or by a variation in response among the several species. During a survey for viruses in a fig germplasm collection of the Faculty of Agriculture of the University of Bari (Southern Italy), filamentous virus-like particles were very frequently observed in negatively stained leaf dips from a number of fig accessions, regardless of whether they showed mosaic symptoms or not. Similar particles were also found in 1-year-old symptomless seedlings from seeds collected from mosaic diseased figs (Castellano et al., 2009; Gattoni et al., 2009). The present study aims to evaluate the presence of Fig latent trichovirus (FLV-1) the most important RNA viral agents causing the disease by applied biological, DAS- ELISA and RT-PCR methods in different fig orchards of Egypt.

Materials and Methods

Plant samples

One hundred fig trees were collected at autumn season 2018/2021; with naturally virus-like symptoms and symptomless fig trees (Ficus carica, cv. sultani, family, Moraceae) from farms of Barshom village, Agriculture Research Station in El-Qanater El Khiria and Department of Horticulture, Faculty of Agriculture, Ain Shams University, Qalubia governorate. Healthy host range plants were obtained from Virology greenhouse and fig plants (Ficus carica, cv. Sultani) obtained from Department of Horticulture, Faculty of Agriculture, Ain Shams University.

Detection of the virus

The virus was detected based on distinct viral symptoms. DAS-ELISA using specific FLV-1 polyclonal antibody (Pab) kit was kindly provided from (Institute Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ), German Collection of Microorganisms and Cell cultures, Inoffenstrasse 7B, 38124 Branuschwieg, Germany) according to Clark and Adams (1977).

Isolation of the virus

Infected fig leaves which gave positive result with (Pab) kit FLV- ELISA were grinded in 0.1 M phosphate buffer pH 7.2 (2/1w/v) in sterilized mortar and pestle.The filtrated crude sap was centrifuged at 6000 rpm for 15 min. Virus inoculum was mechanically inoculated on indicator Chenopodium amaranticolor L. plants. The morphologically identical local lesions were crushed in 0.1M phosphate buffer and re-inoculated on Ch. amaranticolar L. and Nicotiana glutinosa for virus propagation. The inoculated plants were kept under insect-proof cages under greenhouse conditions at 26 ±1°C and 16 h daylight to 21 days.

Host range

According to Gattoni et al. (2009), seventeen herbaceous plant species (five seedlings of each host) belonging to four families (Table 1) were mechanically inoculated with infectious crude sap and observed daily for symptoms development under observation in insect-proof greenhouse at 26±1°C for three to five weeks after inoculation and confirmed by DAS-ELISA.

 

Table 1: Reaction of host plants inoculated with isolated virus.

ELISA (OD at 405 nm)	Symptoms	Host	Family
0.135	NS	Beta vulgaris	Chenopodiacaea
0.095	NS	Ch. Album
0.297	Ch L L	Ch. Amaranticolor
0.283	Ch L L	Ch. Quinua
0.365	M,	Cucumus sativus cv Beta-, Alpha	Cucrubiacaeae
0.175	NS	Cucumber pepo cv skandrani
0.158	NS	V. faba L. Giza 2	Fabiaceae
0.276	Vc, mM	P. vulgaris cv.contender.
0.312	mM	Datura metel L	Solanicaeae
0.078	NS	D. stramonium L.
0.325	mM	N. glutinosa L.
0.085	NS	N.rustica L.
0.273	mM	N. tabaccum cv.Samson L.
0.192	M,	N. tabacum cv. white burly
0.123	mM , C	C. annum. cv. californiawonder
0.285	mM	P. hyprida
0.372	M	S. esculantum L. cv. Castle rock

 

Five replicates for each plant species. NS: no symptoms; Ch LL: chlrotic local lesions; VC: vein clearing; M: mosaic; mM: mild mosaic; C: crinkling. Optical density at 405 nm Negative control= 0.114, Positive control= 0.475.

 

Grafting transmission

A fresh, semi-hard wood cutting with 4-6 nodes were collected from naturally infected fig plants which gave positive result with (Pab) FLV kit ELISA. The healthy fig plants cv. Sultani cultivated in the peat moss and perlite media inside a plastic bag were grafting inoculated with chip budding (blind eye) of infected fig plants and control was done at the same pot according to Roistacher (1991). Grafting inoculated fig trees were kept in a greenhouse conditions at temperatures 24 ºC to 27 ºC maximum during the daytime and 18 ºC to 21 ºC minimum in the night). Symptom observations were routinely carried out since shoots flushing and confirmed by DAS-ELISA.

Inclusion bodies

The strips of infected and healthy N. glutinosa leaves were separated using a forceps in distilled water and other strips, treated with 5% Triton-XI00 for 5 minutes, then immersed directly in mercuric bromophenol blue stain for 15 minutes, then transferred to 0.5% acetic acid for 15 minutes according to the method (Jordan and Baker, 1955) then washed in distilled water for 10 minutes and mounted on glass slide. The strips were viewed under light microscope at magnification of 400X.

Electron microscopy

The extracted infectious sap of N. glutinosa leaves was clarified by n-butanol and chloroform (1:1V:V) at room temperature and centrifuged at 6000 rpm at 4°C for 15 min. Few drops of clarified sap were placed on carbon coated grids for one min and stained with 2 % uranyl acetate according to Milne (1993). The dried grids were examined using Transmission Electron Microscope (JEOL-JEM-1010 Electron microscope) in the Regional Center for Mycology, Al-Azhar Univeresity.

Extraction of total RNA

It was isolated from four naturally fig leaves showing symptoms and symptomless according to the instruction manual of High Pure RNA tissue kit (Version 1, 2000) from Roche diagnostics GmbH, Germany.

Reverse transcription polymerase chain reaction (RT-PCR)

Two oligonucleotide primers, CPtr15ʹ CCATCTTCACCACACAAATGTC3ʹ 5040-5060nt position and CPtr2, 5ʹ CAATCTTCTTGGCCTCCATAAG3ʹ 5398-5419nt position were synthesized for FLV-1 coat protein CP gene according to Gattoni et al. (2009). The oligonucleotide primers were synthesized in ThennoHybaid GmbH, Germany. cDNA was synthesized and amplified as the following procedure according to Latinović et al. (2019). cDNA was performed at 50°C for 30 min (reverse transcription). For each sample, 1 µg of total RNA, 3 µl of the primer (CPtr1 5ʹ CCATCTTCACCACACAAATGTC3ʹ), 20µl of reaction solution 4 µl of 5X first strand cDNA buffer (250 mM Tris-HC1, pH 8.3; 500 mM KC1; 15 mM MgCl2), 5 µl of 0.3 M 2-ß mercaptoethanol, 2.5 µl of 10 mM each deoxynucleotide triphosphate (dNTPs), 1 µl of RNasin (40 units/ µl), 2 µl of 0.1 M dithiothreitol (DTT), 4.5 µl deionized water, and 1 µl (10.000 units/ µl) of Moloney Murine Leukamia. Virus reverse transcriptase (MMLV-RT), (Promega, Co) were mixed with annealing reaction mixture, and incubated for 1 hour at 42°C. Amplification was performed in thin walled PCR tubes. Each tubes containing the following reaction mixture: 5 µl of 10xPCR buffer (1 x= 10mM Tris-HC1, pH 8.3; 50 mMKCl and 0.001 % gelatin), 3 µl of 25 mM MgCl2, 1 µl of 10 mM dNTPs, 5µl of 10 pmol each (CPtr1) and (CPtr2) primers for FLV-1-CP, 2.5 units of Taq DNA polymerase, and sterile water to a volume of 50 µl, in a programmable thermocycler. Five µl of the cDNA was added to the PCR reaction and amplified with the following cycling parameters: 95°C for 15 min (initial PCR activation step) and followed by 40 cycles at 94°C for 30 s, 55°C for 30 s, 72°C for 1 min, and a final extension step at 72°C for 10 min. Aliquots 10 µl of RT-PCR amplified DNA product were mixed with 2 µl of gel loading buffer and separated on a 1% agarose gel in 1 X TBE buffer. DNA was stained with 0.5 µg/ml ethidium bromide added to the gel at a concentration of 0.5 µg/ml. DNA was visualized on a UV transilluminator (wavelength=254 nm) and photographed using Gel Documentation System (GELDOC 2000, BioRad, USA). pGEM DNA Ladder (Promega) was used to determine the size of RT- PCR amplified cDNA products.

Multiple alignments of sequences were performed using DNAMAN software (Wisconsin, Madison, USA) and clustal w (Ver.1.74) program (Thompson et al., 1994). The nucleotide distances were estimated considering alignment gaps and using the Jukes and Cantor’s method (Jukes and Cantor, 1969) for correction of superimposed substitutions with the Molecular Evolutionary Genetics Analysis (MEGA) software (Ver. 4.0) (Tamura et al., 2007). Phylogenetic relationships were evaluated using un-weight Pair Group Method with Arithmetic Mean (UPGMA) through DNAMAN software and Neighbour Joining (NJ) implemented through MEGA 4.0 software, and bootstrap analysis (1000 replicates) was performed to assess the reliability of the constructed phylogenetic tree.

Results and Discussion

Fig latent virus (FLV) (genus Trichovirus and family Betaflexiviridae) was isolated from naturally infected fig trees cv. Sultani. It was identified biologically serologically and molecularly.

The virus incidence in farms, Qalubia governorate was 7.5% out of 200 fig trees. Viral symptoms on leaves included crinkling, mild mosaic, veinal necrotic and leave deformation (Figure 1) and confirmed by FLV DAS-ELISA.

 

Virus isolation

The virus was isolated on Ch. amaranticolor and showed homologous small round local chlorotic lesions at 12 to 15 days post inoculation under greenhouse condition. The virus was propagated on N. glutinosa L. and exhibited systemic infection (vein clearing and mild mosaic) on leaves (Figure 2) and confirmed by DAS-ELISA. The isolated virus was identified based on host range, mode of transmission, inclusion bodies, virus morphology and coat protein gene.

 

Host range

The host plants inoculated with isolated virus at the 4-5 leaves old stage showed different reactions (Figure 2). The reaction was divided into four categories React and none visible symptoms (after 40 days inoculation) like, Datura metel L., Cucumis sativus cv Beta-, Alpha, Nicotina tabaccum cv. samson and Phasolus vulgaris cv. Contender, Slightly systemic symptoms (after 40 days inoculation) like, Nicotiana glutinosa L., N. tabacum cv. white burly, Pepper Capsucum annum, Petunia hyprida and Tomato Solanium Esculantum cv. Castle rock, slightly local symptoms (after 15 to 20 days inoculation) like, Ch. amaranticolor L. and Ch. quinua, gave local chlorotic symptom and no react like, Ch. album, Squash Cucumber pepo cv. skandrani, Datura stramonium L, Nicotina rustica L and Viccia faba Giza2 (Table 1 and Figure 2). Virus particles were detected by DAS-ELISA in extracts from inoculated host leaves. These results suggest that virus can be transmitted by sap inoculation to herbaceous hosts, in which it does not multiply efficiently under our experimental conditions.

Virus transmission

The isolated virus was mechanically transmitted by infectious sap to the host range plants. Grafting transmission as well as the virus was easily grafting transmitted by blind eye to healthy fig plants and showed slightly symptoms (latent) symptoms (Figure 3) at 24 to 32 days post grafting and confirmed by DAS-ELISA.

 

Morphological of virus particles

The partial purified virus particles prepared from infected N. glutinosa leaves showed flexible rod shape of the most frequent 50 particles by TEM and measured 650 nm and wide 12 nm (Figure 4).

Inclusion bodies

The cytoplasmic crystalline and amorphous viral inclusions were detected in epidermal strips of systemically infected N. glutinosa leaves (Figure 5).

 

 

Serological characters

The infectious sap of naturally infected fig trees and herbaceous hosts was reacted by serological precipitation with specific polyclonal antibodies of FLV using DAS-ELISA.

Molecular characters of FLV

Extracted total RNA from infected fig leaves was confirmed integrity and quantity by gel electrophoresis and UV spectrophotometer. The purity of yield RNAs was measured by an A260/280 absorbance ratio (1.6) indicating high yield and purity of the extracted RNAs. The concentration of yield RNA was 0.12 mg of infected tissues.

cDNA of coat protein gene of infected fig leaves were reverse transcribed using sense primer coat protein, CPtr-s (5ʹCCATCTTCACCACACAAATGTC3ʹ). cDNA of coat protein gene nucleotides was amplified using (1 μl of cDNA) mixed with PCR reaction mixture, taq DNA polymerase and two primers (sense CPtr-s and antisense CPtr-s) directly. Electrophoresis analysis of RT-PCR-product was done using 1.5% agarose gel. The fragment of RT-PCR-product expected 400 bp corresponding to the C-terminal region of CP gene. The size of the RT-PCR amplicon for FLV-CP was estimated by comparing its electrophoretic mobility with DNA Ladder as shown in (Figure 6).

 

Nucleotide sequence analysis

The partial nucleotide sequence of the amplified C-terminal region of CP gene of isolate was done from the forward direction at Macrogen3730XL6-1518-009, Korea to determine the relationship with other recommended FLV strains registered in GenBanklt2456301 (Figure 7). Nucleotides were found to be 302 bp mRNA linear corresponding to the C-terminal region of CP gene (Figure 7).

 

Nucleotide sequence analysis

The partial nucleotide sequence was aligned with four registered FLV isolates in gene bank (Table 2) using the clustal W program with minor manual adjustments. The alignment showed 302bp positions including the gaps.

 

 

Phylogenetic trees

The genetic distance between the isolated virus and Nahav (KM5167521), I5o5 (FN3775731), Loestanr-1(MG4075531) and Mazandaran, (KM5167521) of FLV-1 isolates recorded in gene bank was 0.008 genetic distance value (Table 2 and Figure 8). The higher genetic distance value was recorded for FLV-1 isolate Nahav (accession no.KM5167521) with 98.3% similarity. The lower genetic distance value was recorded for FLV isolate Mazandaran (accession no.KM5167521) with 100% similarity (Table 2 and Figure 8). Phylogenetic trees showing the relationship of isolated FLV with other members of the family Flexiviridae in the CP gene. The neighbour-joining tree was produced and boots trapped 1000 times using CLUSTAL X. Branch lengths are proportional to sequence distances. The scale represents a relative genetic distance of 0.008

 

Amino acids translation

The partial nucleotide sequence of partial (CP) gene was translated to amino acids sequence. The predict number of amino acids produced were 100 starting with Tyrosine (Figure 9).

 

Amino acids sequencing analysis of CP gene: The amino acids sequence was aligned with eleven FLV isolates registered in gene bank (Table 3 and Figure 10) using the clustal W program with minor manual adjustments. All of these sequences were multiple-aligned using the clustal w program with minor manual adjustments (Figure 10). The alignment showed 100 amino acids positions.

 

 

Phylogenetic tree of CP gene

The relationship of isolated FLV with other members of the family Flexiviridae (Table 3) produced the neighbour-joining tree and boots trapped 100 times using clustal X. Branch lengths are proportional to sequence distances. The genetic distance of amino acid sequences was limited 0.4 genetic distance value (Table 3) between the isolated virus and four FLV strains published in GenBank with accession number AKW77649-1, AZT10869-1, AKW77650-1, CAY32624-1 and seven of Apple chlorotic leaf spot virus with accession number, APZ84182-1, ASJ27539-1, CAE52475-1, ABC59575-1, ALB35600-1, AJF38246-1and ADC80524-1. The higher genetic distance value was recorded for FLV-1 isolate (accession no. AKW77649-1, AZT10869-1, AKW77650-1 and CAY32624-1) with 100% similarity. The lower genetic distance value was recorded for FLV-1 isolate and Apple chlorotic leaf spot virus with accession number APZ84182-1 with 80% similarity and Apple chlorotic leaf spot virus with accession number ASJ27539-1, CAE52475-1, ABC59575-1, ALB35600-1, AJF38246-1and ADC80524-1with 84% similarity (Table 2 and Figure 8).

 

 

Virus taxonomy

According to the nucleotide and amino acid sequences of CP gene related to the strains recorded in gene bank (Table 4). The isolated virus classified and characteristic belongs to (genus Trichovirus with number of Hits 140 and family Betaflexiviridae). Fig latent virus 1 (FLV-1) (genus Trichovirus with number of Hits 140 and family Betaflexiviridae ) according to the nucleotide and amino acid sequences of CP gene related to the strain recorded FLV 1 with Score 209 and number if Hits 128 on gene bank (Table 4).

A filamentous virus FLV-1 was detected and isolated in naturally infected fig trees showing latent symptoms by biological, serological and molecular methods. The virus infection was higher by grafting transmission than most of the other grafting transmitted plant viruses. However, the availability of sensitive and specific diagnostic tools allows a careful detection of FLV in certification programs to be run in future for the crop.

FLV (genus Trichovirus and family Betaflexiviridae) (Adams et al., 2005; Elbeaino et al., 2009; Walia et al., 2009) was isolated biologically from naturally infected fig trees cv. sultani, and identified biologically, serologically and molecularly (Gattoni et al., 2009; Shahmirzaie et al., 2010; Latinović et al., 2019).

The incidence of virus found was 7.5% out of 200 natural virus symptom and symptomless fig trees cultivated at some farms in Qalubia governorate based on distinct viral symptoms (lead narrow, mild mosaic, necrotic vein) as mentioned by Gattoni et al. (2009) and gave positive result with FLV kit specific polyclonal antibody by DAS-ELISA, Gattoni et al. (2009). A survey for the preliminary assessment of the incidence of FLV-1 infections and the association of this virus with symptoms, showed that FLV-1 infects a high percentage (68%) of 40 different cultivars tested from the fig germplasm collection of the University of Bari (Gattoni et al., 2009, 2010). A virus with filamentous particles ca. 700 nm long, denoted Fig latent virus is widespread in Apulian (Southern Italy) fig orchards, in trees with or without mosaic symptoms and in symptomless seedlings (Gattoni et al., 2009, 2010).

The infectious sap gave local chlorotic lesions on Ch. amaranticolor after 12 to 15 days post inoculation. The homologous local lesions (small round chlorotic lesions) re-inoculated on N. glutinosa L exhibited systemic infection (as vein clearing, and mild mosaic) on leaves and confirmed by DAS-ELISA. These results were in agreement with Saldarelli et al. (1999) and Gattoni et al. (2009, 2010) who detected the virus particles after 20 days in inoculated leaves of Ch. quinoa, Ch. amaranticolor. The reaction of isolated virus and host plants was divided into four categories, none visible symptoms, lightly systemic symptoms and no react. These results suggest that virus can be transmitted by sap inoculation to herbaceous hosts, in which it does not multiply efficiently under our experimental conditions. This virus was transmitted by sap inoculation to a very restricted range of herbaceous hosts without inducing apparent symptoms (Gattoni et al., 2009, 2010; Shahmirzaie et al., 2010).

The isolated virus was easily grafting transmitted by blind eye by 85 %. The inoculated fig plants showed variable symptoms. This virus was transmitted by sap inoculation to a very restricted range of herbaceous hosts without inducing (Gattoni et al., 2009, 2010; Shahmirzaie et al., 2010) apparent symptoms.

Virus particles were detected after 24 to 32 days in inoculated leaves. The most frequent size of isolated virus particles was ca. 650 nm long and ca.12 nm wide with model length more 50 particles were detected in partial purified preparation of infected N. glutinosa leaves. Gattoni et al. (2009, 2010) found virus particles showing a distinct cross banding were plentiful. Most of the particles were fragmented, so their size was determined from leaf dip preparations. The most frequent length of some 60 particles measured was ca. 700 nm. Shahmirzaie et al. (2010) reported that a virus with filamentous particle ca. 700 nm long. The crystal and amorphous inclusion bodies were detected in cells of epidermal strips obtained from infected N. glutinosa leaves.

The isolated virus have antigenicity characteristic with which the infectious sap of naturally infected fig trees and herbaceous hosts reacted by serological precipitation with specific polyclonal antibodies of FLV particles using DAS ELISA. Gattoni et al. (2009, 2010) found the antiserum had a titre of 1:160. It clearly decorated homologous virions. These, however, were not decorated by antisera to ACLSV, GINV, ChMLV and GVA. The serological assay, DIBA, was also performed by using specific polyclonal antiserum Shahmirzaie et al. (2010). The purity of yield extracted from symptomatic leaves RNAs was confirmed by gel electrophoresis and quantity an A260/280 absorbance ratio by UV spectrophotometer. RT-PCR was performed by using specific primers (CPtr1/CPtr2) dsRNAs. Latinović1 et al. (2019) detected four viruses detected: Fig leaf mottle-associated virus 1 (FLMaV-1), Fig mosaic virus (FMV), Fig mild mottle associated- virus (FMMaV) and Fig badna virus 1 (FBV- 1). Most of the viruses were present in mixed infections.

cDNA-FLV-CP from inoculated N. glutinosa was amplified using PCR reaction mixture with product expected 400 bp corresponding to the C-terminal region of CP gene and confirmed by electrophoresis on 1.5% agarose gel (Gattoni et al., 2009, 2010). RT-PCR on silica-extracted TNAs template from tissue of a number of different fig trees from the above mentioned collection (Foissac et al., 2001; Gattoni et al., 2009). A fragment DNA band with the size of 389 bp was amplified using specific primers (CPtr1/CPtr2) by RT-PCR method for the CP gene of virus Shahmirzaie et al. (2010).

The partial nucleotide sequence of FLV strain CP gene found to be 302 bp mRNA linear done from the forward direction at Macrogen 3730XL6-1518-009, Korea and recorded in gene bank with accession number (MZ076515). The alignment with four FLV-1 isolates registered in gene bank by clustal W program with minor manual adjustments, resulting 302 bp positions including the gaps. The genetic distance between FLV strain and FLV-1 isolates, Nahav and (KM5167521) with 98.30% and Mazandaran (accession no.KM5167521) with 100% similarity. Phylogenetic trees showed the relationship of isolated FLV-1 with other members of the family Flexiviridae in the CP gene. The neighbour-joining tree was produced and bootstrapped 1000 times using clustal X. Branch lengths are proportional to sequence distances. The scale represents a relative genetic distance 0.008 (Boscia et al., 1993; Gattoni et al., 2009).

The predicted 100 amino acids were produced from translation of partial (CP) gene nucleotide sequence starting with tyrosine. The alignment of predicted 100 amino acids with the clustal W program with minor manual adjustments, with genetic distance was limited 0.4 between the isolated virus and four FLV-1 strains published in GenBank with 100% similarity according to Caglayan et al. (2012).

The isolated virus was named FLV-1 and classified to genus Trichovirus and family Flexiviridae according to the nucleotide and amino acid sequences of CP gene related to the strains recorded in gene bank. The phylogenetic trees showed the relationship of isolated FLV with other members of the family Flexiviridaein the CP gene. Branch lengths are proportional to sequence distances. The scale represents a relative genetic distance of 0.4. The viral genome structure and organization resembles that of members of the genus Trichovirus, family Flexiviridae and, indeed, FLV clusters with trichoviruses in phylogenetic trees constructed with coat protein sequences (Gattoni et al., 2009, 2010).

Novelty Statement

For the first time, FLV-1 is isolated in Egypt, and it is one of the latent viruses. It is transmitted through vegetative propagation, so it must be detected by PCR and serology. It reduces the horticultural properties of the fig trees in terms of quantity and quality.

Author’s Contribution

Conceptualization: Hanaa H.A. Gomaa, Mona A. Ismail and Khalid A. El-Dougdoug; Methodology: Hanaa H.A. Gomaa, Mona A. Ismail and Khalid A. El-Dougdoug; Formal analysis and investigation: Dalia Y.Z. Amin and Khalid A. El-Dougdoug; Writing-original draft preparation: Dalia Y.Z. Amin; Writing-review and editing: Hanaa H.A. Gomaa, Mona A. Ismail and Khalid A. El-Dougdoug; Supervision: Hanaa H.A. Gomaa, Mona A. Ismail and Khalid A. El-Dougdoug.

Conflict of interest

The authors have declared no conflict of interest.

References

Adams, M.J., Accotto, G.P., Agranovsky, A.A., Bar-Joseph, M., Boscia, D., Brunt, A.A., Candresse, T., Coutts, R.H.A., Dolja, V.V., Falk, B.W., Foster, G.D., Gonsalves, D., Jelkmann, W., Karasev, A.V., Martelli, G.P., Mawassi, M., Milne, R.G., Minafra, A., Namba, S., Rowhani, A., Vetten, H.J., Vishnichenko, V.K., Wisler, C.G., Yoshikawa, N., and Zaviev, S.K., 2005. Family flexiviridae. In: (eds. Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U., and Ball, L.A.,). Virus Taxonomy, 8th Report of ICTV, Elsevier/Academic Press, London, UK. pp. 1089-1124.

Boscia, D., Savino, V., Minafra, A., Namba, S., Elicio, V., Castellano, M.A., Gonsalves, D., and Martelli, G.P., 1993. Properties of a filamentous virus isolated from grapevines affected by corky bark. Arch. Virol., 130: 109-120. https://doi.org/10.1007/BF01319000

Caglayan1, K., Elci1, E., Ulubas Serce, C., Kaya1, K., Gazel, M. and Medina, V., 2012. Detection of fig mosaic virus in viruliferous eriophyid mite Aceria ficus. J. Plant Pathol., 94(3): 629-634.

Castellano, M.A., De Stradis, A., Minafra, A., Boscia, D., and Martelli, G.P., 2009. Seed transmission of Fig Latent Virus 1. J. Plant Pathol., 91: 697-700.

Clark, M.F., and Adams, A.N., 1977. Characteristics of microplate method of enzyme linked immunosorbent assay for the detection of plant viruses. J. Gen. Virol., 34: 475-483. https://doi.org/10.1099/0022-1317-34-3-475

Elbeaino, T., Digiaro, M., Alabdullah, A., De Stradis, A., Minafra, A., Mielke, N., Castellano, M.A., Martelli, G.P., 2009. A multipartite single-stranded negative-sense RNA virus is the putative agent of fig mosaic disease. J. Gen. Virol., pp. 1281-1288. https://doi.org/10.1099/vir.0.008649-0

Foissac, X., Svanella-Dumas, L., Gentit, P., Dulucq, M.J., and Candresse, T., 2001. Polyvalent detection of fruit tree trichocapillo and foveaviruses by nested RT-PCR using degenerated and inosine containing primers (PDO RT-PCR). Acta Hortic., 550: 37-43. https://doi.org/10.17660/ActaHortic.2001.550.2

Gattoni, G.A., Minafra C.M.A., De Stradis, A., Boscia, D., Elbeaino, T., Digiaro, M., and Martelli, G.P., 2009. Some properties of Fig Latent Virus 1, a new member of the family Flexiviridae. J. Plant Pathol., 91: 543-552.

Gattoni, G., Minafra, A., Castellano, M.A., De Stradis, A., Boscia, D., Elbeaino, T., Digiaro, M., Martelli, G.P., 2010. Worldwide diffusion of Fig latent virus 1 in fig accessions and its detection by serological and molecular tools Julius-Kühn-Arch., 427: 83.

Jordan, B.M., and Baker, J.R., 1955. A simple pyronin methyl green technique. Quad. S. Microscope. Sci., 96: 177. https://doi.org/10.1242/jcs.s3-96.34.177

Jukes, T.H., and Cantor, C.R., 1969. Evolution of protein molecules. In: (ed. Munro, H.N.,) Mammalian Protein Metabolism. New York Academic Press, pp. 21–132. https://doi.org/10.1016/B978-1-4832-3211-9.50009-7

Latinović, J., Radišek, S., Bajčeta, M., Jakše, J., and Latinović, N., 2019. Viruses associated with fig mosaic disease in different fig varieties in Montenegro. Plant Pathol. J., 35(1): 32-40. https://doi.org/10.5423/PPJ.OA.04.2018.0058

Milne, R.G., 1993. Electron microscopy of in vitro preparations. In: (R.E.F. Matthews) diagnosis of plant virus diseases, CRC Press, Boca Raton, FL, USA. pp. 215-131. https://doi.org/10.1201/9781351071352-8

Roistacher, C., 1991. Graft-transmissible diseases of citrus. Hand book for detection and diagnosis, FAO. Roma, pp. 286.

Saldarelli, P., Rowhani, A., Routh, G., Minafra, A., and Digiaro M., 1999. Use of degenerate primers in a RT-PCR assay for the identification and analysis of some filamentous viruses, with special reference to clostero- and vitiviruses of the grapevine. Eur. J. Plant Pathol., 104: 945-950. https://doi.org/10.1023/A:1008608506699

Shahmirzaie, M., Rakhshandehroo, F., Zamanizadeh, H.R., Minafra, A. and Martelli, G.P., 2010. First report of Fig latent virus 1 (FLV-1) from Fig trees in some provinces of Iran. 19th Iran. Plant Prot. Cong., 31 July - 3 August 2010. https://www.researchgate.net/publication/215674941

Tamura, K., Dudley, J., Nei, M., and Kumar, S., 2007. MEGA 4: Molecular evolutionary genetic analysis (MEGA) software version 4.0. J. Mol. Evol., 24: 1596-1599. https://doi.org/10.1093/molbev/msm092

Thompson, J.D., Higgins, D.G., and Gibson, T.J., 1994. Clustal W improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucl. Acids Res., 22(22): 4673-4680. https://doi.org/10.1093/nar/22.22.4673

Walia, J.J., Salem, N.W., and Falk, B.W., 2009. Partial sequence and survey analysis identify a multipartite, negative-sense RNA virus associated with fig mosaic. Plant Dis., 93: 4-10. https://doi.org/10.1094/PDIS-93-1-0004