Submit or Track your Manuscript LOG-IN

Ghazalah Yasmin1*, Mir Ajab Khan2, Nighat Shaheen3, Umbreen Javed Khan4


E-mail | ghazalahrizwan@yahoo.com

Sarhad Journal of Agriculture, Vol. 31, Iss. 1
...ceae), we studied pollen morphology in three (A. alpinum, A. rumicifolium and A. tortuosum) of five species distributed in Pakistan using light microscopy and scanning electron microscopy. Results showed that Aconogonon is characterized by tricolpate pollen with microspinulose type of exine ornamentation. One distinctive pollen type was recognized on the basis of aperture number and sculpturing of exine under SEM. Based on analyses in the present study, diagno...
Lingtong Ye1, Chao Cao1,2, Bin Tang1,2, Tuo Yao1, Ruixuan Wang1 and Jiangyong Wang1*
...c approach that combines morphology and molecular analysis of the mitochondrial cytochrome c oxidase subunit 1 (COI) gene. Adult P. websteri exhibit a high degree of morphological plasticity in the palp pigmentation pattern, the shape of the anterior edge of the prostomium, the shape of the major spines on chaetiger 5, and the shape of the pygidium. The COI gene sequence demonstrated that the intraspecific distance of P. websteri was 0.33%, where...
Mahanama De Zoysa1, Si-yun Ryu1, Hyeon-cheol Kim2 and Bae Keun Park1*
...t of A. japonicus morphology with light and scanning electron microscopy. 
...
Andrea Rezic1, Ivica Boskovic2, Piera Lubinu3, Marina Piria1, Tihomir Florijancic2, Massimo Scandura3 and Nikica Sprem1*
...on in skull and mandible morphology was statistically significant for the shape (p<0.01). Sexual dimorphism as main effect was highly significant for the dorsal skull shape and the mandible shape and size (p<0.01). The comparison of mandible mean shapes using discriminant function analysis and parametric test did not reveal significant differences between the sexes, while dorsal mean skull shape was statistically significant (p<0.05). The shape compar...
Matiyar Rahaman Khan1,*, Sabyasachi Pal2, Ghule Tushar Manohar2, Somnath Bhattacharyya3, Amit Singh4, Prahlad Sarkar5 and Samuel Lalliansanga6
...based on observations on morphology of different life stages, beta-esterase phenotype and amplification of rDNA and partial sequence homology of ITS-1and ITS-2. Host differential tests confirmed the race 2 of M. incognita infecting passion fruit. Pathogenic relationship with the passion fruit was proved through inoculation studies and inoculated plants also produced almost similar above-ground symptoms and profuse root galling. The pathogenic potential ...
YaQiu Liu and ZhiJian Wang*
...s study aimed to observe morphology and ultrastructure of intestinal tract of Paramisgurnus dabryanus with light and electron microscopies. Intestinal tract was divided into three parts. Morphologically complex folds were formed on surfaces of anterior and middle intestines where many secretory cells were present. Highly developed junction complex were seen in anterior intestine. Cytoplasm contained abundant mitochondria and pinocytotic vesicles. Epithe...
Muhammad Qadir Ahmad¹*, Farheen Ashraf Raza¹, Abdul Qayyum¹, Waqas Malik¹, Rao Wali Muhammad2, Muhammad Asif Saleem1, Amir Hamza2, Ahmad Baksh Mahar3
...e across the world. Leaf morphology and physiology provides a balance between leaf temperature, leaf energy exchange and photosynthesis. The experiment was undertaken to study the association of leaf related traits i.e. leaf area (LA), leaf angle position (LP), number of lobes per leaf (NL), leaf chlorophyll contents (SV), relative water content (RWC), leaf hairiness (HL), leaf color (LC) and yield related traits i.e. boll weight (BW), number of seeds per boll...

M.A. Pendse, P.P. Karwande and M.N. Limaye

Past, present and future of nematophagous fungi as bio-agent to control plant parasitic nematodes
...orkers on the diversity, morphology ecology, physiology of nutrition, trap formation and mechanism of nematode capture as well as probable causes of death. The review traces the shift in the areas of research as well as ups and downs in the interest shown by the researchers. Guide lines for organized, coordinated research to i) screen different strains of NF that are tolerant to antagonism by other fungi, and ii) develop a bioagent based on nematophagous fungi...
Hai-Ji Zhang1, Di Zhang2, Dong-Min Hou1 and Wan-Long Zhu1,*
...bolic rate (RMR), organs morphology, serum leptin levels and food intake were measured in the present study. The results showed that food deprivation decreased body mass and body fat mass. After refeeding, body mass can not be returned to the control value on refeeding 12 h, and it returned to control level on refeeding 7 days, but body fat mass can not be restored to the control level on refeeding 7 days. RMR and mass of liver decreased significantly in fasti...
Muhammad Ashfaq,1 Shamim Akhtar,2 Saleem Akhtar2,* and Mariyam Masood2
.... The current study used morphology and DNA sequences from mitochondrial (cytochrome oxidase I) and nuclear (internal transcribed spacer I) genes to identify the hyperparasitoid Promuscidea unfasciativentris. The successful PCR-based detection of hyperparasitism is promising for designing strategies for the biological control program of cotton mealybug.
...
Kanwer Shahzad Ahmed1, Muhammad Zeeshan Majeed1,*, Muhammad Ather Rafi2, Fatima Sellami3 and Muhammad Afzal1
...vel by means of external morphology, published descriptions and male genitalia micrometry. Nine species were identified belonging to 9 genera and 4 subfamilies occurring along with 10 trophic associations. Five species viz; Coccinella septempunctata (Linnaeus 1758), Hippodamia variegata (Goeze 1777), Menochilus sexmaculatus (Fabricius 1781), Micraspis allardi (Mulsant 1853) and Propylea dissecta (Mulsant 1850) belonged to tri...
Lu Liu1, Sher Khan Panhwar2, Tianxiang Gao3, Zhiqiang Han3, Chunhou Li4, Dianrong Sun4 and Na Song1,*
...been identified based on morphology: Liza affinis, Liza carinata, and Liza klunzingeri. To confirm the validity of the species by molecular methods, we sequenced a fragment of the cytochrome oxidase subunit I (COI) gene of mitochondrial DNA of Liza affinis and Liza klunzingeri from coastal waters of China and Pakistan, respectively. Sequences of L. carinata were obtained from GenBank. A neighbor-joining tree showed the...
Asmatullah Kaka2, Wahid Haron1,*, Rosnina Yusoff 1, Nurhusien Yimer1,  A.M Khumran1, Akeel Ahmed Memon2, Kazhal Sarsaifi1 andMahdi Ebrahimi3
...ility ≥70% and normal morphology ≥80% were extended into Tris extender consist of equal concentration of each ALA and DHA (0, 3, 5, 10,15ng/ml). Extended semen was cooled at 5oC for 2 hours at 5oC and then packaged in 0.25ml straws and stored into liquid nitrogen for 24 hours. Successively, thawing and evaluation was performed for sperm motility, viability, membrane integrity, morphology, malondia...
Liana Mihaela Fericean1* and Mihaela Corneanu2
...te knowledge on external morphology of this species. By knowledge of biology and ecology of Aphis nasturtii a protocol for the prevention and control can be established.
...
Muhammad Khaled Siddiq1, Ayesha Riaz2, Muhammad Akbar Khan1, Muhammad Adeeb Babar1, Khalid Mahmood1,* and Muhammad Akhtar1
...r knowledge of the taxon morphology, and this material expands our anatomical knowledge of this taxon. Boselaphus namadicus is spanning from about 3.4 to 0.6 Ma in the Siwalik Group. The Pleistocene species, Boselaphus cf. namadicus, was adapted to open and dry habitats of the Siwaliks.
...
Falah Baiee1,3, Wahid Haron1,*, Rosnina Yusoff1, Ariff Omar,2 Nurhusien Yimer1, Salman Hammadi1, Tarig Ahmedeltayeb1, Asmatullah Kaka4
... sperm volume, motility, morphology, viability, and concentration. In conclusion, gradation of electrical stimulation into three stages (our modified Method II) could help to ease the collection of semen samples from bulls with minimum discomfort signs. Furthermore, the modified method is also recommended to use for other animals, in particular, the wild animals.
...
Serap Gelibolu1,*, Yasemen Yanar2, M. Ayce Genc3 and Ercument Genc4
...dy physiology and tissue morphology of gilthead seabream (Sparus aurata). Treatment of fish with MOS-feed shown a significant increase in live weight and protein efficiency rates when were directly compared with mock-treated fish control. However, there was no statistically supported level of significance was observed for growth rates and feed conversion rates among groups. Improved live weight and protein efficiency rates reflected positively on the su...
Xiaoting Zhang1,2, Jiaxiang Wang1,2,*, Peng Li1,2,* and Lixun Ye1,2

Waqas Liaqat1, Mohammad Akmal1* and Jawad Ali 

...mp; maturity) as well as morphology (i.e. plant height, ear height, including ear length) was affected (p<0.05)by sowing dates. Likewise, yield traits (i.e. rows per ear, grains per ear, thousand grain weight) were also adversely affected by sowing dates, which decreases both biomass and grain yield. Varieties did differ in phenology (i.e. emergence, silking, tasseling, maturity) and morphology (i.e. height, leaf area, ea...
Nay Naing Htoo1, Basit Zeshan1,2,*, Aung Tun Khaing1, Than Kyaw1, Erkihun Aklilu Woldegiorgis1 and Mohd Azam Khan1
... goat kids improve rumen morphology.
...
Irfan1,*, Arshad Javid7, Muhammad Ashraf2, Athar Mahmud3, Muhammad Altaf4, Syed Makhdoom Hussain5, Muhammad Shahbaz4 and Khalid Javed Iqbal6
Dachuan Cheng1,2, Md Mahbubul Hassan3, Zhenhua Ma1, 2, 3,*, Qibin Yang1 and Jian G. Qin3
... knowledge to functional morphology of crimson snapper that would be useful to larval aquaculture of marine teleosts.
...

Nadia Faqir1, Aish Muhammad2*, Ghulam Muhammad Ali2, Armghan Shehzad2, Hafeez Ur Rahman3, Farhatullah4 and Muhammad Zeeshan Hyder

...elationship of the plant morphology with the chemical composition of fruit. 

...

Mahwish Rehman1*, Sajjad Ahmad1, Maqsood Shah1 and Inamullah Khan

...ynal shields, periterme, morphology of setae on the legs and palps and its arrangement and number were observed. Results of the present study showed that the studied specimens were Varroa destructor, however, no Varrova jacobsoni were recorded during chaetotaxy and morphological studied. The study also confirms that V. jacobsoni population is not present in Khyber Pakhtunkhwa region of Pakistan. 

...
Muhammad Akbar Khan
...r knowledge of the taxon morphology. Hexaprotodon sivalensis is reported for the first time from the Bhimber Pleistocene locality of Azad Kashmir, Pakistan.
...
Abdur Rahman1,*, Ibrahim Sadi Cetingul2, Ismail Bayram2, Cangir Uyarlar2, Abdil Burhaneddin Akkaya2, Eyup Eren Gultepe2, Hikmet Keles3, Aykut Ulucan4 and Zafar Hayat1
...tinal properties and gut morphology. Quails fed diets containing 0% (A), 1% (B), 2% (C), 3% (D), 4% (E) and 5% (F) dried ground Oregano leaves. Results revealed that villus height was significantly higher in group D compared to control group, whereas crypt depth was significantly higher in all supplemented groups specifically remarkable in group D. Thickness of the tunica muscularis was higher in group C while other groups like D, E and F showed reduction in t...
Irshad Ali1, Mohammad Masood Tariq2,*, Abdul Waheed2, Ferhet Abbas Yousafzai1, Farhat Abbas Bokhari1, Majed Rafeeq1, Muhammad Ali1, Muhammad Adnan Attique1, Shahid Amin3 and Tahir Hameed1
...abitat. The data on morphology and performance of 1020 Bhag Nari (BN) cattle were collected from Bhag Nari cattle Farm, Usta Mohammad Baluchistan during 2015-16 and its surrounding areas. Some distinct characteristics have been found exclusively in Bhag Nari breed. These characters are rare in other local breeds of the area such as tick resistance, tolerance against > 50oC temperature in the hot weather nevertheless still gives good producti...
Rafa Almeer1,*, A. Alqarni1,2, S. Alqattan3, S. Abdi4,*, S. Alarifi1, Z.Hassan5 and A. Semlali6
...or 48 h followed by cell morphology evaluation. Cell viability was examined by MTT assay and gene expression of three tissue inhibitors of metalloproteinase (TIMPs) and two matrix metalloproteinase (MMPs) were measured by real-time PCR. All subgroups exhibited altered morphology with accelerated detachment compared to untreated cells. The MTT assay after 48 h revealed that treatment with H1 and H2, reduced cell viability by ...
Amtur Rafeh, Rana Manzoor Ahmad, Ayesha Iqbal, Abdul Majid Khan*
...vative bovid with simple morphology
...
Merica Slišković1, Meta Povž2, Marina Piria3,*, Goran Jakšić4, Ana Gracanin5 andGorana Jelić Mrčelić1
... provide new data on the morphology and ecology of sichel from the Mur River, and its distribution in Croatia and Slovenia. In 2009, the schooling of sichel were observed at a high-water level in the Mur River of Slovenia. In total, 14 specimens were sampled by fishermen using sport fishing techniques. The age, condition, length-weight relationship (LWR), 20 morphometric and four meristic traits, were analysed. Fulton condition coefficient and LWR value indica...
Naila Chand1, Shamsullah1, Rafiullah1, Rifat Ullah Khan2, Muhammad Mobashar3, Shabana Naz4,*, Ebrahim Rowghani5 and Murad Ali Khan2
...gans and intestinal histomorphology of broilers during starter phase. A total of 180 day-old broiler chicks were distributed into 3 treatments, designated as MOS-0, MOS-50 and MOS-100 having MOS at the rate of 0, 50 and 100 g/kg respectively. Each treatment was further replicated 3 times having 10 chicks per replicate. Treatment MOS-0 was kept as control and the birds in this treatment were fed on basal ration without alteration in feed contents while the othe...
Nizam Uddin Jamali1, Asmatullah Kaka1,*, Pershotam Khatri1, Moolchand Malhi2, Muhammad Naeem3, Akeel Ahmed Memon1, Rameez Raja Kaleri4, Habibullah Janyaro5 and Dildar Hussain Kalhoro
...olume, colour, motility, morphology, live dead ratio, membrane integrity and sperm concentration, post chilling for motility, morphology, live dead ratio, membrane integrity and frozen thawed for motility, morphology, live dead ratio and membrane integrity. Semen volume and colour were determined by visual examination, pH was determined by digital pH meter. Motility was determined under mi...

Babar Tasim1, Tariq Masood1*, Zafar Ali Shah1, Muhammad Arif2, Ata Ullah1, Ghazal Miraj3 and Muhammad Samiullah4 

...opy (FTIR) and structure morphology by Scanning Electron Microscope (SEM) were carried out in biochar samples by using standard methods. Statistical analysis of the data revealed significant difference for proximate composition, pH, EC and macro and micro nutrients. Biochar obtained from Sesbania stem was found high in fixed carbon content (66.9%) and volatile matter (27%) but low in ash content (4.5%). AD biochar contained lowest amount of fixed carbon (49%) ...
Muhammad Tufail1, Naila Chand1, Rafiullah1, Shakoor Ahmad2, Rifat Ullah Khan2, Muhammad Mobashar3 and Shabana Naz4,*
... the performance and gut morphology of broiler chicks (Ross 308) during the finisher phase. A total of 180 of 22 days broiler chicks were distributed into 3 treatments with 3 replicates having 20 chicks per replicate. One group was kept as control and the birds in this treatment were fed on basal ration without alteration in feed contents while the other treatments MOS-50 and MOS-100 represented 50 and 100 g MOS/kg feed respectively during the finisher phase. ...

Ali Awais, Charassri Nualsri and Watcharin Soonsuwon* 

...seeds, panicles and leaf morphology. Phenotypic observations determined that the Dawk Kha 50 has more potential of variability than Dawk Pa-yawm towards EMS. Later selection in the advance generations might be useful to isolate agronomically useful mutants for the future use in upland rice breeding programme. 

...
Rishen Liang*, Meng Zhou, Zhenxiang Lin, Guozhang Li, Yuan Chen, Xuan Lin and Zaohe Wu
... (oriental sweetlips) in morphology. In order to investigate the validity of two species at the molecular level, complete mitochondrial genomes of the two species were first determined. The genomes were 16,546 bp (P. orientalis) and 16,545 bp (P. vittatus) in size, respectively, which both consisted of a typical structure of 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and one noncoding control region. Genomic compositio...
Iqra Bano1,*, Moolchand Malhi2, Pershotam Khatri3, Saeed Ahmed Soomro2, Hira Sajjad4, Ambreen Leghari5, Muhammad Awais2, Safia Kandhro6 and Shakeel Ahmed Lakho5 and Munaza Soomro7
Ahmed Ali Samejo* and Riffat Sultana*

 Ping Zhang1,2, Yabin Pu1, Yu Zhang2, Jia Chen2, Kunfu Wang3, Qian Li3, Yujiao Sun3, Yuehui Ma1, Shuqing Jiao2,* and Weijun Guan1,*

...tachment technique. Cell morphology were observed using an inverted microscope, and MDSCs proliferation pattern were determined through growth curve analyses. MDSCs were identified by immunofluorescence and RT-PCR, and the immunofluorescence antibody invoved Sca-1, CD34, CD144, Desmin and CD45 which are the makers of MDSCs. Finally, MDSCs were induced into Adipocytes, osteoblasts, chondrocytes and neuron-like cells by the optimized inducing medium. After the t...
Xiaopeng Tang1, Wen-qin Su1 and Re-jun Fang1,2,*
... by the MTT method. Cell morphology and phosphorus concentration in the cell supernatant were measured after 24 h of CT treatment. The NaPi-IIb protein expression was determined by Western Blot, and the NaPi-IIb mRNA expression was determined by RT-PCR. The results showed that, compared with the control group, different levels of CT had no effect on cell proliferation, but it inhibited (P < 0.05) the absorption of phosphorus at CT concentratio...
De-Yong Zhang1, Xiao-Lu Xu1,*, Qin Ruan2, Xiu-Ying Shen3 and Yin Lu1
Chen-Yu Sun, Wen-Chao Liu*, Mei Xiao, Zhi-Hui Zhao and Li-Long An*
...rformance and intestinal morphology in Chinese indigenous young yellow feather broilers. A total of 360 male, one-d-old Huaixiang chickens with an average initial BW of 44.52 ± 1.07 g were randomly allotted to 4 treatments. Each dietary treatment consisted of 6 replicate cages, with 15 birds per replicate. The 4 dietary treatments were corn-soybean meal-based diets and supplemented with 0, 500, 1000 and 2000 mg/kg betaine, respectively. During d 1-14, w...
Sadreddin Tusun*
...lustrated.
...

Mazhar Habib1, Aamir Saleem1, Arshad Mahmood Malik2*, Sarfraz Ahmed3 and Sameera Arshad4 

Qaisar Jamal*, Akram Shah, Syed Basit Rasheed and Muhammad Adnan
...poral variability in the morphology and various morphotypes of the promastigotes were noted. Acquisition and propagation of axenic amastigotes was assessed. During promastigote culture, log, mid-log, and late-log phases were observed respectively on day 4, 5 and 6. The stationary phase was observed on day 7. The day following inoculation, most of the promastigotes were nectomonads having long and slender bodies with roughly uniform width from anterior to near ...
Awais Bin Shahid1, Moolchand Malhi1,*, Saeed Ahmed Soomro1, Muhammad Giasuddin Shah2, Nazeer Hussain Kalhoro3, Asmatullah Kaka4, Rajoo Mal1, Muhammad Awais Soomro1Saba Parveen Samo1 and Muhammad Nawaz Sanjrani5
...tation pattern, papillae morphology and antioxidant status in rumen of goats. A total of ten goats were randomly divided into two groups; control (C, n=5) and selenium yeast (SY, n=5). Animals were fed concentrate (2 % BW) as basal diet without (C) or with selenium yeast (SY, @ 0.3 mg.Se.kg-1.diet) supplementation. Hay and water was provided ad libitum. The results revealed that the molar concentrations of propionate and the...
Riffat Sultana1, Nuzhat Soomro1,*, Santosh Kumar2, Ahmed Ali Samejo1 and Samiullah Soomro1
Jing Zhang1,2, Xin Wang2, Yun Zhao2, Yongcheng Jin2, Yongfeng Zhou2, Junmei Wang2, Yurong Fu2, Rui Wang2, Ruihua Li2, Hengtong Fang2 and Hao Yu2,*
...colon. We found that the morphology of colonic mucosa in mice was normal after ZEA was administered by gavage for one week, the mRNA expression levels of mucosal Mucin-1, Mucin-2, regenerating islet-derived protein 3 gamma (Reg3γ), and tumor necrosis factor (TNF) were significantly downregulated. The mRNA expression levels of mucosal β-defensin, regenerating islet-derived protein 3 alpha (Reg3a), regenerating islet-derived protein 3 beta (Reg3β...
Maria Khalid1, Tanveer Hussain1*, Zahid Farooq2, Kamran Abbas1 and Masroor Ellahi Babar1  
...suggested based on their morphology, geographical distribution and chromosome number. In Pakistan the Chukar partridge (A.chukar)), is an important member of Phasianidae family, however a scarce molecular data is reported that urged us to investigate its genetic diversity and phylogeny using mitochondrial DNA, Cyt-b and Cox1 genes. A total of 749bp of Cox1 and 472 bp of Cyt-b complete coding regions of both genes were amplifi...
Imran Khan1, Muhammad Nawaz1,*, Aftab Ahmad Anjum1, Mansur-ud-Din Ahmad2, Adnan Mehmood1, Masood Rabbani1, Amina Mustafa1 and Muhammad Asad Ali1
...rius IKP 333 on histomorphology of small intestine and D-xylose absorption capacity in broiler challenged with S. enteritidis. Negative control group was not supplemented with probiotics. Positive control groups received only the challenge bacteria (S. enteritidis) ATCC 13076 at day 07. Groups (3, 4 and 5) received probiotics (IKP23, IKP111, IKP333) at day 01 to 35 and challenge bacteria at day 07 in prevention model. Groups (6, 7 and 8) star...
Muhammad Tahir Waseem1, Abdul Majid Khan1*, Saliha Khalid1, Rana Manzoor Ahmad1,2, Ayesha Iqbal1, Muhammad Ameen1
...n on systematics, dental morphology and dietary habits of the Late Miocene (7-5 Ma) boselaphines which are represented today by their living kin Boselaphus tragocamelus and Tetracerus quadricornis
 
Ayesha Iqbal1, Ghulam Sarwar1, Abdul Majid Khan1*, Muhammad Tahir Waseem1, Ayesha Iqbal1, Rana Manzoor Ahmad1,2, Muhammad Ameen1
...tudy reports the cranial morphology of Sus scrofa, with detailed comparison of different features of skull. The cranial morphology has been utilized as a tool to discriminate between the different species of wild and domesticated suids. The studied material comprises of the three skulls. The straighter snouts and slenderer crania manifests that specimens under study were wild while the sex of species was determined by...

Nabeel Maqsood1,2*, Afzal Khan1, Muhammad Khalid Alamgir2, Shaukat Ali Shah1, Muhammad Fahad3 

PTFE THIN FILM COATING ON 316L STAINLESS STEEL FOR CORROSION PROTECTION IN ACIDIC ENVIRONMENT
...rature and compared. The morphology of uncoated and coated substrates were examined by scanning electron
microscopy (SEM) while the compositional analysis performed through energy dispersive x-ray spectroscopy (EDX).
The morphology of the coated and uncoated substrates were also studied before and after electrochemical corrosion
test and then compared. The thickness of the coating was also examined well....

Parsa Riaz and Muhammad Naeem*

Digestive Enzymes Activity with Gut Morphometric Parameter of Carnivorous Fish Wallago attu (Siluridae, Siluriformes)
...relation to Wallago attu morphology as Relative gut mass, length and Zihler’s Index are basically explored as potential indices to identify habits.

...

Tao He1,2,3, Cheng-jing Chen4, Jian-guang Qin3, Yun Li1,2, Rong-hua Wu1,2 and Tian-xiang Gao4,*

...ary tool along with body morphology to distinguish L. haematocheilus stocks.
...

Muhammad Tariq-Khan1*, Syed Zanib Ali Gardazi1, Abu Daud Ahmad Khan1, Muhammad Ilyas2 and Ishaq Ahmad3,4

Virulence and Distribution Trends of Root-Knot Nematode (RKN) Fauna on Summer Vegetables in District Bagh, Azad Jammu and Kashmir (Pakistan)
...ased on perineal pattern morphology. M. javanica was identified as predominant species of the study area. RKN tropical species was found on M. incognita 37%, M. javanica 38% and M. arenaria 28% sites parasitizing vegetable crops. Host preference of M. javanica and M. incognita was detected in mixed field conditions as M. javanica preferred okra as host while M. incognita reproduced maximum on tomato. Common beans were found most susceptible host providing surv...
Sadaf Aslam1,2*, Abdul Majid Khan2 and Muhammad Akhtar2
...provides new insights of morphology of an extinct species of the suid, Hyotherium pilgrimi.
...
Fanrong Xiao, Jichao Wang and Haitao Shi*
...he relationships between morphology, performance and ecology is central to understand how morphology influences fitness. Previous work has already shown that two sympatric turtles, the Keeled box turtle Cuora mouhotii and the Flowerback box turtle C. galbinifrons, have divergent morphologies and occupy different microhabitats (steep, rocky hillslopes vs gentle, less rocky hillslopes). However, it is unclear how...
Yihong Tian, Yongmei Qi*, Sajid Naeem, Ke Gao and Yingmei Zhang*
...njunction with disrupted morphology. Moreover, spermidine caused cell damage as evidenced by elevated LDH leakage and compromised MMP as demonstrated by flow cytometry. Concomitantly, western blot analysis showed that spermidine induced autophagy by activating the LC3 conversion and p62 degradation at different concentrations and durations. However, inhibition of autophagy by 3-MA rescued the survival of Hela cells. This study demonstrated that the potential e...
Gautam Patra1*, Ana Sahara2, Sonjoy Kumar Borthakur1, Parthasarathi Behera3, Subhamoy Ghosh1, Apurba Debbarma4 and Seikh Sahanawaz Alam5
...P. relictum based on morphology and subsequently confirmed by PCR which selectively amplified 712bp of P. relictum. Based on sequences and phylogenetic analysis of cyt b gene, 8 isolates of P. relictum were identified. The obtained complete nucleotide sequences of cyt b gene from P. relicum revealed100% identity among themselves while the other sequences registered in Gen Bank showed 95% to 99% similarity. In the phylogenetic an...
Muhammad Ramzan, Unsar Naeem-Ullah*, Mudssar Ali and Hasan Riaz
... small;">The biology and morphology of Trilocha varians was studied on Ficus benjamina (L.) under the laboratory conditions. The results on different biological and morphological parameters showed that the fecundity of female ranged from 160 to 281 which increased its survival rate. Trilocha varians has five larval instars. The last instar changed its colour to dark reddish and look like branches of host plants. The male and female mean lo...

Sidra Shehzadi, Sher Bahadar Khan*, Umar Sadique and Saqib Nawaz

Isolation and Molecular Identification of Clostridium perfringens Type D in Goats in District Peshawar
...44%. However, the colony morphology, microscopy, biochemical tests and polymerase chain reaction of C. perfringens  type D showed that PCR is an effective diagnostic and confirmatory tool for the toxinogenic typing of C. perfringens  type D infection.

...
Somia Shehzadi1, Sana Javaid Awan2, Maryam Javed1*, Asif Nadeem1 and Tahir Yaqub3
..., each group showed same morphology and appearance, there was also no significant difference between any groups, when viability was compared by using Trypan blue staining. Collagen1 was also equally expressed in all groups and there was no significant difference observed. Thus, present study concluded that AES or ABS could also be used as affordable alternatives to FBS. ABS could be preferred as it can easily be obtained from slaughter house and has almost equ...
Shahid Hussain Abro1*, Mohammed N. Alghamdi2, Muhammad Sohail Hanif3, Hazim Moria2 andHamza Suharwardi1
 
 
...h austenitic development morphology investigated. The CHQ steel analyzed in the context of Advanced Optical Microscope of Olympus GX51, SEM and Thin-film X-ray Diffracto-meter, with high-intensity mode have been deployed in order to examine the kinetics behavior of austenitic development at CHQ steel. On several quenching experiments the austenite formed at different temperatures and time 10s, 15s, 30s, and 60sec and 800°C 710°C, 740°C, 770°C r...
Muhammad Zubair1, Habib Ahmad2*, Brian E. Hemphill3, Muhammad Tariq4 and Muzafar Shah5
Alamaary Mohaammed Saad1,3, Abd Wahid Haron1*, Mohamed Ali2
Mark Wen Han Hiew1 and Lawan Adamu1
...perm membrane integrity, morphology, and acrosome integrity. Four stallions were nominated for AI in the current study. The best result from different concentrations of cysteine and ascorbic acid were used for AI. Thirty mares were divided into three groups of 10 mares each and were then inseminated using the frozen semen with the following extenders: HF-20 extender (0) as control, 0.5 cysteine, and 0.5 ascorbic acid. The level of oxidative stress steadily inc...
Majed Rafeeq1,*, Nadeem Rashid1, Muhammad Masood Tariq1, Irfan Shahzad Sheikh1, Muhammad Zahid Mustafa1, Muhammad Shafee1, Khalid Mehmood1, Rana Muhammad Bilal2 and Tauseef Asmat1
... SRBC), intestinal histo-morphology, bacterial enumeration and cecal volatile fatty acids (VFAs) were measured. There were significant improvements in weight gain (WG), feed conversion ratio (FCR) and average daily gain (ADG) in the treatment groups supplemented with extract (P<0.05) compared to control. Similarly, intestinal histo-morphic parameters and ileal bacterial count were significantly different between treatments (P<0.05), but no significant ef...
Allam A. Megahed, Badawi A. Othman, Samar S. El Masry, Abeer A. Faiesal and Mohamed A. Nasr Eldin
...sed to examine the virus morphology. The cytopathic effect of the virus on
tissue ultrathin section was examined by transmission electron microscope (TEM). Finally, the PVM
isolate was detected using reverse transcription-polymerase chain reaction (RT-PCR) in the sprouts
after dormancy breaking for the harvested potato tubers.
Results: The obtained results demonstrated that, PVM isolate causes severe symptoms on ...

Md. Abdullah Al Mamun1,2*, Shamima Nasren1,3, Sanjay Singh Rathore1 and Kavalagiriyanahalli Srinivasiah Ramesh1

... operculum. Based on the morphology of the specimens, the parasites were identified as Argulus japonicus. Moribund fishes were examined and up to 350±50 lice were hand-picked from a single fish. Microscopic examinations of A. japonicus revealed that most of these were at juvenile stages. Infested fish were transferred to the glass aquaria (60 L) and treated with 4 treatments for 15 days: I) Potassium permanganate II) Aquarium salt III) Formalin and IV) ...

Ahmed Ali Moryani1, Nasir Rajput1*, Muhammad Naeem1, Atta Hussain Shah1 and Hidayatullah Soomro2

Gulzar Ullah* and Gohar Ayub

 Yanqiang Zhou1, Lixin Wang1, Chunxiao Hao1, Xiuyun Li2, Shakeel Hussain1, Dongdong Shen1, Zhiwei Peng1, Qi`an Zhai1 and Zhijun Hou1,*

...c analysis, based on the morphology of oocysts, indicates that the present parasites are Capillaria sp. in blue wildebeest; Eimeria christenseni, E. alijevi, Trichuris sp. and one Strongy-type species in goats; Trichuris sp., Nematodirus sp., Moniezia sp., E. macusaniensis, another Eimeria sp. and another Strongy-type (different with goats) in alpacas. It was discovered that the infection rate was 45.74%,...
Waqar Ali1,3*, Muhammad Yaqoob2, Abida Arshad1, Guifu Dai3,Safir Ullah Khan1, Muhammad Arshad Malik4, Imran Ullah1 and Ihsan Ullah1
...chemical test and colony morphology from positive milk sample were Staphylococcus aureus (25.4%), Escherichia coli (20.3%), Streptococcus (16.9%) in which (6.7%) Streptococcus agalactiae, and (10.1%) other streptococcus species, Pseudomonas aeruginosa (15.2%), Salmonella (13.5%) and Klebsiella pneumonia (8.4%). Staphylococcus aureus was found most prevalent pathogen that causes mastitis in goats. The o...
Dong-Min Hou1, Ting Jia2, Chun-yan Liu1, Zheng-Kun Wang1 and Wan-Long Zhu1*
...ng metabolic rate (RMR), morphology, the positive expressions of uncoupling protein 1 (UCP1) and Cd137, and the relative expressions of PR domain containing 16 (PRDM16), bone morphogenetic proteins 7 (BMP7), peroxisome proliferator-activated receptor α (PPARα), cyclooxygenase 2 (COX-2) and peroxisome proliferator-activated receptor coactivator 1α (PGC-1α) of WAT were measured. The results showed that body mass, food intake and RMR were ...
Essam H. Ibrahim1,2,3, Attalla F. El-kott1,4, Ali Alshehri1, Mona Kilany2,5,  Reza Yavari6, Salahud Din7* and Diaa Massoud8,9
...="font-size: small;">The morphology and histology of the tonguein two adult Asian bears were examined by light and scanning electron microscopy. Four types of papillae; filiform, conical, fungiform and vallate were observed on the dorsaum lingua. Numerous filiform papillae were visible on the lingual apex and body, while, fungiform papillae were scattered among them. The discoid-shaped fungiform papillae were more densely on the lingual apex. The filiform papi...

Mst. Deloara Begum1, Md. Muniruzzaman1, Md. Salauddin2* and Md. Mostafizer Rahman1

...taining reaction, colony morphology, cultural characteristics, biochemical and antibiotic susceptibility test. All most 100% dried and 20% cooked fish sample were contaminated. In this study seven different species and 168 isolates were identified from dried fish and these were Escherichia coli 21.43% (36), Vibrio spp. 18.45% (31), Staphylococcus spp.17.86% (30), Pseudomonas spp.17.86% (30), Salmonella spp.12.5% (21), Shigella spp. 8.93% (15) and Klebsiella sp...
Nabila Rasheed1*, Bushra Waseem1, Kanwal Haneef2, Shumaila Usman3, Madeeha Sadiq1, Tabinda Urooj1, Sarah Tarique2 and Dabeeran Zeha4
... potential of WJMSCs and morphology of the cells to some extent whereas the viability of cells remains unaffected by GDM.
...

Nedžad Hadžiomerović1*, Ozan Gündemir2, Senad Kovačević1 

Anguara Khatun1*, Sachchidananda Das Chowdhury1, Bibek Chandra Roy2, S.M. Shafikul Gani3, Bipul Chandra Ray1, Tanvir Ahmed1 

... performance, intestinal morphology, and cost-effectiveness in commercial broiler production. Four hundred eighty Cobb 500 straight run broiler chicks were randomly allocated to three dietary treatments each of eight replications having 20 birds each. The basal diets were corn-soya broiler starter and broiler grower diets. Starter diet was fed up to 21 days and grower diet during 22-35 days. In treatment 1, chicks were fed a basal diet (Diet 1), in treatment 2...

Yao Zou, Shien Ren, Miao Xu, Nannan Liang, Xuxin Zhang, Chongxuan Han and Xiaoning Nan

...ailable studies on skull morphology of zokors, the interspecific differentiation of their skulls is still unclear. To differentiate among species and to describe the sexual dimorphism within each species, we measured morphological variation using one-way analysis of variance and cluster analysis in four species of zokor including Eospalax cansus, Eospalax rothschildi, Eospalax baileyi, and Myospalax aspalax. We also used principal component analysis and dichot...

Sozan A.A. Ismaeil1*, Hassan Emam2 

Mirza Lena1,2, Dinda Fathia Syahramadani2, Alfi Nurrachma Gustya2, Arif Darmawan2,3, Sumiati2, Wiwin Winarsih4, Minoru Maeda5, Komang Gede Wiryawan2*  

... utilization, intestinal morphology, and microbial population. A total of 600 one-d-old Lohmann broiler chicks of 300 males and 300 females were used and reared for 35 days. Chicks were distributed into 6 groups (100 birds, 5 replicates of 20 birds) in a completely randomized design. The treatment diets were basal diet with 0.1% different supplementations: T1= CaCO3 (w/w) (control), T2 = L. lactis at 108 CFU/g, T3 = B. licheniformis spore at 108 CFU/g, T4 = co...

Ali Ghazi Atiyah1*, Nadia Hameed Rija Al-Falahi2 and Ghazi Atiya Zarraq3

...e with pillars particles morphology, with Ca/P ratio (0.8) which matched with theoretical predictions. Also, there was a formation of rough precipitation layer when using SBF showed the bioactivity of the scaffold. Finally, the β-CPP scaffold was successfully synthesized from avian eggshell waste with high purity and favourite biocompatibility which was promising for use as bone substitution materials.

...

Sajjad Khan*, Naila Chand, Abdul Hafeez, Nazir Ahmad 

...ong with intestinal histomorphology and selected pathogenic bacteria in broiler chickens. A total of 160 day-old Ross chicks were assigned to four groups, containing 0, 0.5,1 and 1.5% GA along with basal feed for 42 days. A completely randomized design (CRD) was followed during statistical analysis while difference in means was calculated through Tukey’s test. Results indicated that supplementation of GA at 1.5% significantly (P<0.05) improved feed in...

Rafiqul Islam1, Nasrin Sultana1*, Md. Abu Hadi Noor Ali Khan2 

...erol and triglycerides), morphology, and morphometry of broiler hearts. Eighty one-day-old chicks (DOCs) were randomly categorized into four groups i.e., one control group and three trial groups (i.e., E1, E2, and E3). The control group was given commercial broiler feed and the trial groups were given commercial broiler feed containing DEX at the rate of 3, 5, and 7 mg/kg respectively for 28 days. On days 7, 14, 21, and 28 of the trial, blood and heart samples...
Ali Zohaib1*, Muzzammil Hussain1, Iftikhar Ahmad1, Mushtaq Ali2, Tahira Tabassum3 and Adnan Bashir1

Jumshaid Iqbal1, Muhammad Sharif1*, Muhammad Nadeem Suleman2, Muhammad Saeed3, Fawwad Ahamd1, Asghar Ali kamboh4, Tugay Ayaşan5 and Muhammad Arslan3

...wth performance and histomorphology in broiler chickens. One hundred and twenty day-old broiler chicks were randomly distributed into four treatment groups with three replicates per treatment (10 chicks per replicate) under Completely Randomized Design. Four iso-nitrogenous and iso-caloric diets i.e. A, B, C and D were supplemented with a natural growth promoter (NGP) at the rate of 0 (control), 1.5, 3 and 4.5g/kg of feed, respectively. Feed consumption (FC) a...

Taghreed Mohamed Nabil1, Randa Mohamed Hassan1, HebatAllah Hamdy Mahmoud2, Mohamed Gomaa Tawfiek2, Usama Kamal Moawad1* 

Saima Naz1*, Ahmad Manan Mustafa Chatha2, Sajjad Ali2 and Muhammad Irfan Ullah3

...structure, productivity, morphology and physiology of their gut microbiota for first time. The study will raise the concerns about the bee conservation.
...

Jiang Wu*

...cilli-like and spherical morphology with uniform cell size, and the cell surface looked intact and shiny. On the contrary, when the cells were treated with increased concentration of chemical constituents of T. officinale, the cells exhibited irregular morphology, aggregated and showed extensive surface collapse, thereby increasing the rate and extent of cell damage. After treatment, in the presence of chemical constituents ...

Luke Chukwudi Ali*, Nnanna Ephraim Ikeh, Bright Chigozie Amaefule, Amarachi Linda Obinna, Ndubuisi Samuel Machebe 

...lar morphometry and histomorphology evaluation. Semen colour showed milky white in all groups although T4 appeared creamy white. There were significant (P<0.01) differences among treatment groups of rabbits in all the semen traits except in semen volume. Semen pH showed significant (P<0.01) variations with semen of bucks in T4 having the highest value (8.67). Sperm motility, sperm concentration, live and normal sperms in decreased with an increase in die...

Zhongqing Wang1, Qiuyue Wu1, Ruiling Ye1, Fazul Nabi1,4, Yangfei Shang1, Sarfaraz Ali4 and Juan Liu1,2,3*

...ith normal structure and morphology with protective rate of 0 %, 70 %, 66.7 %, 40 % and 33.3 %, from IG, PG, HG, MG and LG groups respectively at 6 h. As compared to CG, the quantity of iIELs in IG was significantly (P<0.01) higher at 6 h and 4 d in duodenum and ileum of diarrheal mice; however, the iIELs quantity in IG was significantly (P<0.01) higher and lower at 6 h and 4 d in jejunum, respectively. The AMP pre-treatment reduced iIELs in duodenum and...
Manatsanun Nopparatmaitree1*, Pornpan Saenphoom1, Sittichai Bunlue1, Silchai Washiraomornlert1, Warangkana Kitpipit2,3,4, Soranot Chotnipat1
...obiota, small intestinal morphology, and performance. Three hundred twenty-one days old, Ross 308® chicks; were raised under ambient temperature and assigned to a completely randomized design with four treatments and four replications per treatment (n = 20). The treatment consisted of a control diet based on a corn-soybean basal diet and a control diet supplemented with 10, 30, and 50 g/kg TABP combined with 2 g/kg probiotics. This study shows that TABP co...

Sri Melia1*, Indri Juliyarsi1, Yulianti Fitri Kurnia1, Evy Rossi2, Hurriya Alzahra3

...ct of cheese production, morphology, physiology, and biochemistry; (2) in vitro probiotic characteristics testing, including survival at pH 3, resistance to 0.3% bile salt media, and antimicrobial activity against Escherichia coli: O157, Pseudomonas, Listeria inokua, and Klebsiella pneumonia; and (3) Molecular identification of LAB by analysis of the base sequence of the 16S RNA gene. The whey for this study was collected in Lasi Farm in Agam Regency, West Sum...

Masudul Haq Wani and Arshad Bhat*

...st emphasis on the urban morphology and degree of level urbanization. Attempts have also been made to assess the changes in workforce structure and food availability and consumption pattern in the UT over the years. The study also analyses the inter-district scenario of urban growth and its level and extent in to consideration. The annual exponential growth rate of urban population in India has gone down from 0.97 per cent during 1981-91 to 0.77 per cent durin...
Ramadan Sary, Asmaa M. Ibrahium*

Febriza Dwiranti1, Nur Fadhilah2, Ursula Paulawati Maker2, Priyo Sambodo3* 

...carried out to determine morphology based on body hair patterns (spots) and physiology based on the blood values of adult males, adult females, and juvenile Spilocuscus papuensis (S. papuensis). In total, nine S. papuensis ex situ in the Manokwari Region of Papua (three adult males, three adult females, and three juveniles) were used in this study. Morphological observations of S. papuensis were based on body hair pattern and blood values, including erythrocyt...

Sarzamin Khan1, Abdul Jabbar Tanweer2, Rafiullah1, Ibrahimullah1, Ghulam Abbas3*, Jabbar Khan4, Muhammad Saeed Imran5, Asghar Ali Kamboh6 

...carcass quality and histomorphology of Coturnix japonica (Japanese quails). For this, 120 Japanese quail chicks (day-old) were taken and randomly divided into 4 groups (G1, G2, G3 and G4) with three replicates and ten birds were assigned to each replicate. Group 1 was control (C) without adding mealworm scales in feed (basal diet). Group 2, 3 and 4 were fed ration with 1, 2 and 3 g/kg mealworm scales respectively incorporated in the basal feed. Feed intake, FC...

Indyah Aryani 1,3*, Suyadi Suyadi2, Hartutik Hartutik2, Kuswati Kuswati2 

... was identified by their morphology. A total 43 Madura cattles were infected by nematode worm as follows: Oesophagostomum sp., Cooperia sp., Capilaria sp., Ostertagia sp, and Moniezia sp) while, 14 Madura cattles infected by trematode worms (Fasciola sp and Paramphistomum sp). The prevalence of gastrointestinal endoparasite was found as follows: Cooperia sp. 31%, Fasciola sp. 12%, Oesophagostomum sp. 6%, Moniezia sp. 4%, Paramphistomum sp. 2%, Capilaria sp. 2...

Yue Ren1, Ting Jia2, Hao Zhang1, Zhengkun Wang1 and Wanlong Zhu1*

...versity. Moreover, skull morphology changed for adapting to changing environment in T. belangeri chinensis. Finally, MengLa population had remarkable differences with the other populations both in genetic diversity and skull morphology. Our study provides genetic diversity and skull morphology knowledge of T. belangeri chinensis, their adaptation of genetic level and skull offers new insig...

Ahmad Nadeem1,2 and Rubina Arshad1,2,*

...d on the basis of colony morphology on De Man Rogosa Sharpe (MRS) agar plates, Gram staining, biochemical tests and molecular characterization. The co-culturing of LAB isolates with fungal cultures (in vitro) showed that among seven LAB isolates, only three possessed antifungal activity. One promising wild type isolate (LPA6) was subjected to gamma irradiation for mutation induction. Seeds of two chickpea varieties were inoculated with LAB isolates in four tre...

Xibin Liu1,2,3, Weijun Guan2,* and Dong Zheng1,*

...tin adhesion method. The morphology of CPSCs was observed under an inverted microscope. Based on the growth curve test, we found that the growth mode of the cells was “S” type growth. The clonogenic assay was performed to determine the clonogenic efficiency CPSCs. The expression of cell surface markers was detected by immunofluorescence, flow cytometry, and RT-PCR, and it was found that the CPSCs positively expressed FGFR-3, collagen type II, CD44,...

Sekobane Daniel Kolobe, Tlou Grace Manyelo*, Jones Wilfred Ng’ambi, Munyadziwa Felicia Dorcus Nemauluma, Emmanuel Malematja  

...owth performance and gut morphology of Ross 308 chickens from day-old to 6 weeks of age. 320-day-old Ross 308 broiler chicks were assigned to a 2 (sex) × 4 (dietary treatment levels) factorial arrangement in a CRD, having 8 treatments, replicated x4 with 10 chicks/replicate. AKLM inclusion levels were at 0, 0.5, 1.0 or 1.5g/kg dry matter (DM). Weekly feed intake (FI), live weight (LW), and growth rate (GR) were measured to obtain the feed conversion rat...

Siriporn Namted, Kanokporn Poungpong, Wiriya Loongyai, Choawit Rakangthong, Chaiyapoom Bunchasak* 

...immune function, and gut morphology of pigs. Inconsistent results have been reported for the various yeast products utilized in the animal feed industry, with differing types of YE processing (autolysis or hydrolysis) and differing doses/responses. In a feed additive, the components of the cell wall (β-glucan and mannan-oligosaccharides) and some of their cellular metabolites are key beneficial factors in promoting the growth performance, immunological re...

Tlou Grace Manyelo1,2, Nthabiseng Amenda Sebola1, Jones Wilfred Ng’ambi2, Monnye Mabelebele1* 

...lood parameters, and gut morphology of indigenous Boschveld chickens. A total of 200 one-day-old indigenous Boschveld chicks were randomly allocated to five treatments in a completely randomized design each with four replicates of ten chicks. Amaranth leaf meal (ALM) levels evaluated in this study were 0, 5, 10, 15, and 20% with recording weekly body weights, feed intakes, and feed conversion ratios. Gut organ weights, lengths, pH, and meat characteristics wer...

Humera Manzoor1,2,5 Norbert Brüggemann2,3, Hafiz Muhammad Jafar Hussain1, Tobias Bäumer2, Frauke Hinrichs2, Muhammad Wajid4, Alexander Münchau2, Katja Lohmann2* and Sadaf Naz1*

...ucted thumb and clubfoot morphology. A novel homozygous missense variant in ECEL1 c.2051A>G, p.(Tyr684Cys) was identified in all three patients. The variant was absent from the DNA of 500 ethnically matched control samples as well as from all public databases. In conclusion, this study reports a family with clinical features of distal arthrogryposis type 5D and extends the genotype spectrum of the disorder. 

...

Muhammad A. Ahmad1, Shabbir Hussain2*, Humera A. Awan3, Muhammad Riaz4 and Muhammad Saeed1

...ry, physiology and plant morphology of wheat crop. Current studies were performed to investigate the effect of PGRs on the yield of wheat crop in Sayban International, Lahore (Pakistan). The field experiments were performed to evaluate the effects of numerous concentrations of three PGRs (sodium-5-nitroguaiacolate, sodium ortho-nitrophenolate and sodium para-nitrophenolate) on the yield of wheat crop. Numerous compositions of PGRs were formulated and sprayed o...

Shaolin Zeng, Shuai Yuan* and Kai Liu

...tent affected myocardium morphology of rats in the sevoflurane group, Biochemical experiments for assessing how miR-26a-5p expression content affected myocardial tri-enzymes in the sevoflurane group, as well as Western blot for evaluating how miR-26a-5p expression content affects apoptosis of rats in the sevoflurane group. The impact of miR-26a-5p expression content on levels of oxidative stress indicators of myocardial tissue of rats in the sevoflurane group ...

Z.A. Handoo1,†, I.K.A. Ibrahim2, D.J. Chitwood1 and A.A. Mokbel2,3

...dentified
on morphology of females that included female body and total stylet (odontostyle and odontophore) length, location
of guiding ring and excretory pore from oral aperture, shape of head and tail including various tail measurements
and vulva percentage in relation to body length. This is the first report of this nematode from Egypt, Africa. The
values of the morphological parameters completely fall within ...

Aiman Amur1*, Nasreen Memon1, Khalida Unar2 and Roshan Jamali3

...x fruit fly according to morphology, physiology and genetically. It is very serious pest of many fruits in the overall world; such as guava, apricots, Sapodillas etc. this species is voracious for the mango in whole world mostly; means the favorable host of delicious mango. During current study observe the ecological margins and its habitats, host effects on the occurrence of this decisive pest. This study was steered in district Naushahro feroze of Sindh Paki...

Kalsoom1, Nasir Shah2, Muhammad Ibrahim3*, Tahira Bibi1, Kazim Ali4 and Zahir Shah2

...f various salt levels on morphology and biochemical attributes of a wild (Sante wild) and two transgenic (Sante 2 event and Sante 8 event) potato varieties in in vitro condition. These varieties were grown on Murashige and Skoog (MS) media subjected to (0, 25, 50, 75 and 100 mM) of Sodium Chloride (NaCl). Potato varieties showed an adverse in vitro growth response to all levels of salt in MS media, while plants of all the tested varieties were dead at concentr...

Asmatullah Kaka1*, Wahid Haron2, Nurhusien Yimer3, Abdullah Channo1, Ali Raza Jahejo2, Mahdi Ebrahimi3, Dildar Hussain Kalhoro4 

...e above 70 %, and normal morphology and viability of ≥ 80 % were extended in TBE, to which different concentrations (0, 3, 5, 10 and 15 ng/ml) of DHA were enriched. Semen sample with supplementations were sequentially incubated for 15 minutes at 37 ºC and cooled at 5 ºC for 2 hour than packed in 0.25 ml straws, and cryopreserved in liquid nitrogen for 24 hours. Consequently, straws were thawed at 37C0 for 30 seconds and motility was accessed with ...

Salahud Din

Van-Thanh Vo1, Thi-Hieu Tran1, Thi-Truc-Thao Nguyen1, Van-Tri Truong1, Cu-Thien Pham1, Thanh-Minh Pham2 and Huyen Nguyen Thi Thuong1*

... examined the blood cell morphology and physiological blood indices of red tilapia (including hemoglobin; hematocrit; red blood cells count; the total number of white blood cells and thrombocytes, erythrocyte size) at three stages: after 15 days of adding essential oils without infection; five days after infection; and ten days after infection. In this study, fish supplemented with peppermint essential oils stimulated the body to create immunity. However, conc...

MARIAM ZAHEER, KHALID MAHMOOD*, MUHAMMAD ADEEB BABAR & MUHAMMAD AKBAR KHAN

...basis of the comparative morphology and measurements, the material can be assigned to Pachyportax latidens, Selenoportax vexillarius and cf. Gazella. The new dental material is presented in this article.
 
Key Words: Taxonomy, Palaeontology, Gazella, Pachyportax, Selenoportax
...

A. S. Gamal El din1; Sohair I. El-Afifi2; A. S. Sadik2; Nashwa M. A. Abd El Mohsen1; and H. M. Abdelmaksoud1

 Salwa N. Zeinl and Hanaa S. Zawam2

...f transmission, particle morphology, serological tests, and SDS-Polyacrylamide gels. Purification of ACLSV was performed using bentonite/polyethylene glycol. Electron micrograph of purified virus preparation revealed flexuous filamentous virus particles of 700 nm length and 12 nm wide. The average yield was 1.14-1.7mg/100 g tissue of Chenopodium quinoa Willd. Purified virus preparation was used for rabbit immunization. The polyclonal antibodies raised against ...
Saiwa N. Zein
...f transmission. particle morphology and serological typing. Examination or the purified virus preparation 1» electron microscopy revealed rod-purify the Egyptian isolate of TRV. The yield of the virus was 2.6-5.7 mg/ 100 g tissue of Nicotiona rustica plants. The polyclonal antibodies raised against the Egyptian isolate of TRV had a specific titer of I: 10000. The concentration of 12G and lgG conjugated with alkaline phosphatase was I : 1000. The prepared...

Lalu Ahmad Zaenuri*, Rodiah Rodiah, Adji Santoso Dradjat, Oscar Yanuarianto, I Wayan Lanus Sumadiasa , Lukman Hy 

...rogressive motility, and morphology, including normal and abnormal spermatozoa. The statistical significance of the results was evaluated by pre- and post-test analyses using T-test with repeated measuring. Data were expressed as Means ± SD and SEM. Results revealed that semen volume, spermatozoa concentration/ejaculate, plasma membrane integrity, viability and progressive motility, and normal spermatozoa were significantly higher in the bucks during SG...

Edwin Ormachea V1,2*, Bilo Calsin C1,2, Eyner Aguilar S3, Buenaventura Ormachea V4, Henry Gonzales C1, Yecenia M. Masias G5

...ep, clustering analysis, morphology; correlation
...

Pawinee Kingkan1, Thanathip Supcharoenkul1, Chaowit Rakangthong1, Chaiyapoom Bunchasak1, Komwit Surachat2,3, Wiriya Loongyai1* 

... performance, intestinal morphology, E coli detection, cecal bacterial composition, and the incidence of diarrhea in nursery pigs for 6 weeks. A total of 800 pigs (Large White × Landrace × Duroc) were randomly allocated to two treatments: a basal diet supplemented with a mixture of amoxicillin and colistin (Amox-Co) and a basal diet supplemented with amoxicillin and 1 g/kg of a bacteriophage cocktail (Amox-Phage). Each treatment consisted of eight ...

Thekra Fadel Saleh, Omar Younis Altaey*

... and Insight into caecal morphology enhance bird’s productivity and health.
 
Keywords | Biochemical, Food security, Histology, Histochemistry, Histomorphometry, Muscovy ducks
...

Ying Liu1,2, Ji-Yong Fang2, Na Zheng3 and Hai-Long Wu1*

...o far been recorded. The morphology of S. schmackeri sp. nov. differs from that of S. numidica and exhibit a few unique characteristics, including more denticles in the lip, shorter intestinal caecum, longer spicular, more caudal papillae, and pre-, ad-, and post-cloacal caudal papillae pairs in the ratio of 3: 1: 6-7. BLAST analyses of the COI sequences show 59.31% nucleotide divergence with Seuratascaris numidica (Seurat, 1917) (GenBank acc. no. MG434691 and...

Ramzan Ali1, Erum Iqbal1*, Muhammad Ismail Bhatti2 and Saboohi Raza1

...ented in this paper. The morphology and morphometric traits of native populations of these nematodes were found correspond to the type specimens. According to the latest information, these identified nematodes species are new records from Pakistan.

...

Kazi Afsana Homayra Orchy1, Mst. Antora Akter1, Nelema Yesmin1, Md. Moshiur Rahman Khan1, Marzia Rahman2, Md. Mahmudul Alam1* 

...markers. On the basis of morphology, histopathology, and biochemical analysis, it can be concluded that PRP, irrelevant of source improves and accelerates the burn wound healing with no adverse effects 

...

Afifatul H.A. Adilah1, Junun Sartohadi2* and Suci Handayani1

... selected with the ideal morphology for measurement of interception, throughfall, and stemflow during rain events. Soil sampling under the plant canopy was used to measure texture, bulk density, particle density, porosity, macro pores, initial soil moisture, and organic matter. Coconut plants are considered better for the purpose of vegetative soil and water conservation than Mahogany. However, Mahogany must be arranged at the upper plot and Coconut at the low...

Lili Zhao1, Fan Zhao1 and Yaping Jin2*

...hich resulted in altered morphology and function of GTCs. The cell shape showed a subrounded configuration, and the cell size also significantly increased. Furthermore, Grp78 knockout significantly decreased proliferation and adhesion activity, while increasing invasion activity. The secretion of estradiol and progesterone was also dramatically decreased after Grp78 knockout. Our results strongly suggest that GRP78 plays an important role in maintaining the no...

Mudawamah Mudawamah1*, Sumartono Sumartono1, G. Ciptadi2, E. Susanto3, Y. Hartoyo4, L. Affandhy5,6

...en physiological status, morphology, and total protein of the single and twin ewe sheep and their crosses. The research method was a field study with quantitative and laboratory analysis, with statistical analysis using ANOVA and LSD with SPSS Statistic 9 software. The research design used descriptive with total sample of 60 heads (morphometry and physiological status) and 24 heads (total protein).  There are three breeds of sheep: Sapudi, Dormas (Dormer ...
Misbah Ammanat1, Abdul Qadir1, Zulfiqar Ali2*, Rida Ahmad2,3, Usman Ahmad1, Irfan Zainab2 and Aliza Batool2,3
... on published reports or morphology. Natural birds and migratory sub-routes in the study area highlight the study’s significance. Researchers might benefit from this research for similar studies in future developmental projects.

...

Yuyu Wang1,2, Mingzhu Li 3,4, Gang Lin4, Xiaohua Guo5, Aihua Sun5, Hao Dong5, Qinghui Ai1,* and Kangsen Mai1,*

... survival and intestinal morphology among fish fed various levels of algae meal (P>0.05). Fish fed diet S5 had significantly higher final body weight than that of fish fed diet S15, and no significant differences were observed among fish fed diets S0, S5 and S10 (P>0.05). Trypsin in intestinal segments, specific activities of alkaline phosphatase (AKP) in intestine and purified brush border membrane (BBM) of intestine were significantly higher in fish fe...

Khalid Mahmood1*, Muhammad Akbar Khan1, Sayyed Ghyour Abbas1,2, Muhammad Adeeb Babar3 and Muhammad Asim4

...homboidalis based on the morphology of canine. The recovered material is unique and rare in the Siwaliks of northern Pakistan. It also increases the stratigraphic range of this barbourofelines species from the Chinji Formation to the Nagri Formation.

...

Zhipeng Song1,2, Jialiang Xin1,3, Xiaoli Wei1,2, Abula Zulipiya1,3, Kadier Kedireya1,2 and Xinmin Mao1,3*

...inkage, abnormal nuclear morphology, etc., and ultimately enhance retinal function. In vivo and in vitro experiments showed that after a period of intervention, marein regulates diabetic retinopathy by inhibiting the protein expressions of VEGF, PI3K, fibrin (FN) and spleen tyrosine kinase (SYK), and upregulating the level of E-cadherin, an epithelial marker. Molecular docking results showed that marein could integrate with VEGFA, PI3K and SYK, and the resulti...

Mohammed M. Jassim, Mohammed R. Abduljaleel*, Zainab B. Abdulkareem, Noor H. Sanad, Ibrahim M.H. Alrashid

...F group’s cellular morphology ratings were significantly higher (P 0.050). These findings showed that using the osteotomy gap model with SMF enhanced the histological and radiographic features of rabbit bone healing. Rabbits that were under the risk of the delayed fracture healing could take advantage of treatments with the SMF.
 
Keywords | Rabbits, Bone fracture, Avian implantation
...

Shafqat Ullah1, Asad Ullah2*, Imad Khan2, Rafiq Ullah1, Raheela Taj3, Fatima Syed3, Shumaila Gul4, Faiza Khan5, Ibad Ullah Jan6, Muneeb Islam7 and Sumaira8

...for the reduction of gut morphology and growth performance in the poultry birds. The present study was performed to explore the impact of inorganic selenium (sodium selenite). Day old chicks were kept in a control environment. At day 7, five groups were made with four replicas in each group based on the diet being offered. Group A, the positive control group fed with normal basal diet group B was termed as negative control group offered basal diet + dexamethas...
Rabiea Pervaiz, Shaista Bano*, Sarfraz Ali Tunio, Abdul Nabi Jatt and Aisha Amber Soomro
...ed from rhizoidal colony morphology of B. pseudomycoides, a colony mutant of a strain showing strong antibacterial activity was obtained by screening/selection method and designated as B. pseudomycoides strain SB138m. The sequence of 16S rRNA gene of both wild type and mutant strains of B. pseudomycoides was comparable. In vitro test for antagonism of B. pseudomycoides strain SB138m against indicator cells showed that the strain contained antibacterial potenti...

Ho Thi Dung, Nguyen Van Chao, Nguyen Thi Hoa, Le Dinh Phung, Tran Thi Na, Nguyen Thi Thuy, Tran Nguyen Thao, Pham Hoang Son Hung* 

... aimed to determine histomorphology change and tight junction genes expression in the cecum of chicken exposing to heat stress. Fifty broiler chickens at 14 days old were randomly allocated to the thermoneutral control (TC) treatment and the high ambient temperature (HT) treatment (5 cages of 5 chickens per treatment). The broilers of the TC treatment remained under a constant 26 ± 1°C (mean ± standard deviation), while those of the HT treatm...

Wisit Ketpanyapong1, Kulisara Marupanthorn2* 

...rformance and intestinal morphology in weaned pigs are poorly understood. This study examined the effects of MOLE supplementation (250 mg/kg or 500 mg/kg diet) on 144 Duroc × Landrace × Large White weaned pigs over a 5-week period. The results of this study showed that dietary supplementation with MOLE for 5 weeks improved average daily weight gain, feed efficiency and reduced the incidence of diarrhea in weaned pigs. Blood hematological parameters...

Eisa*, Nawal A.; Abd El-Ghafar **, N. Y. Abd EL-Mageed*, M.H.; Mohamed* , F.G. and Hasan*, Eman O.

...(TEM). Particle size and morphology of each phage isolate were examined by electron microscopy. The obtained results indicated that, the isolated phages were of the head and tail types. Four phages were detected and designated A,B,C and D, their head diameters were found to be 57.83, 43.84, 63.43, and 79.25 nm, respectively. Phages A and B were isolated from tomato leaves, whereas, phages C and D were isolated from tomato rhizosphere soils. This study seems to...

Ahmed, AmalA.; Zein, Salwa N. and Khatab, Eman A. H.

...ransmission and particle morphology.  CeMV able to infect only 20 plant species and varieties from 22 tested by mechanical inoculation. The virus was transmitted in a non-persistent manner using Myzus persicae Sulz. Infected plants were reacted positively only with the specific antiserum for the CeMV using double antibodies sandwich—enzyme linked immunosorbent assay (DAS-ELISA). It was successfully purified from infected N. tabacum L. var. White Bur...

Mayada A. Abd Elgalell; B.A Othman2; Th. Radwan, 1 and Amal S.M. Abo-Sinna3

...ted host range. Particle morphology of the isolated phages was determined and it was found that the two viruses have tadpole shape, which phage PPI has an isometric head (135 nm) and long non-contractile tail (225 nm) whereas phage PP2 has an isometric head (121 nm) and long contractile tail (202 nm), the tail possing an outer sheath (135 nm) and neck (27 nm). Protein patterns of the isolated Ps. putida phages were analysed by SDS-PAGE and the data revealed th...

B. A. Othman; Kh. A. El-Dougdoug; M. H. Abdel Ghaffar and T. F. El-Arabi

...rnorates based on plaque morphology, The extinction spectra of purified preparations showed A260/A280 of 1.25. 1.16. 1.28 and 1.24 for RM1, RM2, RM3, and RM4, respectively. When the purified preparations of RM1, RM2, and RM3 phages examined in transmission electron microscope they showed particles have isometric heads or about 52.5, 58.8 and 64.2 nm in diameter with long contractile tails of about 100x30, 80.2x29.4, and 102x33.5 nm, respectively. While the RM4...

Sajjad Khan*, Naila Chand, Abdul Hafeez and Nazir Ahmad

...ong with intestinal histomorphology and selected pathogenic bacteria in broiler chickens. Day-old 200 Ross male chicks were allotted to five groups each subdivided in four replicates with ten birds per replicate. Similarly, five different types of feed i.e., diet A as control while B, C, D and E having 1.5% GA, 30mg/kg BS, 1.5% GA+30mg BS and 0.75% GA+15mg/Kg BS respectively, were offered during 42 days of experimental trial. Statistical analysis was performed...
Syed Roohullah Jan1, Kareem Akhtar2*, Uroosa1, Muhammad Zeeshan Zahir3, Abdul Shakoor4
 
...y. The particle size and morphology of Ag-Sn-Cu powder are studied, before and after coatings. Hardness tests are carried out to determine surface hardness before and after the coatings. This study reveals that uniform composite coating of Ag-Sn-Cu can be achieved without Mercury using the cold spray. Hence cold spray technique can be used in the future for filling cavities and other dental applications.  
...

Kadhim Kh. K. Al-Khayat1*, Athmar K. A. Al-Azawi2

Frennada Lu’fatul Azizah1, Osfar Sjofjan2*, Eko Widodo2

...ion performance and histomorphology of the ileum of broiler chickens. The BSF (Black Soldier Fly) oil isolation process was initiated using the Soxhlet method. Subsequently, 160 broiler chickens were utilized in the research. An experimental design in the form of a completely randomized design with five treatments and four replications was employed, involving eight broiler chickens per treatment per replication. The feed treatments were formulated as follows: ...

Hilwah Nora1,2, Rajuddin2*, Hafizuddin3, Rachmad Suhanda4, M. Fathurrahman5

...ozoa quality parameters, morphology, and morphometry of testes and seminal vesicles that have never been reported. The main objective of this research is to examine the effects of curcumin on several aspects of reproduction and determine the optimal dose for using curcumin as an antifertility agent. The test animals in this study were Wistar rats (Rattus norvegicus) three-month-old males weighing 300 g. Rats were acclimatized for 7 days and given standard feed...

NAILA MALKANI*, IRFAN ISHAQUE, KHALID SHAHBAZ, RIZWAN ULLAH KHAN, ARIFA SHABBIR & ATIF YAQUB

...infiltration and altered morphology of functional units. It is concluded from findings of the present study that farm-raised Labeo rohita were healthier and safer to consume compared to the wild-caught fish.

...

MUBEEN RIAZ1, KIRAN ZAHID1, SUMAIRA ASLAM CHOHAN1, MUHAMMAD ASHFAQ*2, MUHAMMAD ALI2, RIFFAT SIDDIQUE1, NUDRAT ANEES1 & FARAH KHAN1

...ich in turn affected the morphology and physiology of plant. The present piece of work also highlights the importance of salt stress as biomarker.

...

FOZIA HUMAYUN1, ZARRIEN AYUB2, MUHAMMAD SAMEE HAIDER3 & SYED ABID ALI1*

... profiling). Macro/micro morphology of the shells was also studied by scanning electron microscopy and energy dispersive X-ray spectrometry. The analysis of nutritional status of the three Siphonaria sp. revealed quite similar profiles among the three Siphonaria sp with the presence of nine essential and nine non-essential amino acids. Our results successfully established the method of molecular identification of Siphonaria sp. The study also showed that Sipho...

Nawab Ali1, Akeel Ahmed Memon1, Asmatullah kaka1, Amjad Hussain Mirani2, Muhammad Ibrahim Panhwar3*, Nisar Ahmed Solangi1, Kashif Ali Malik1, Fazul U Rahman1, Moin Akhtar Vistro1 

...aving ≥ 80% motility, morphology, and live-dead ratio were pooled and diluted in Tris-based Egg Yolk (TEY) extender supplemented with various concentrations of selenium, i.e., group A control (0mM), group B (2mM), group C (4mM) and group D (6mM). Results showed significantly (P<0.05) higher motility (78.1±0.22), morphology (86.5±1.08), membrane integrity (85.6±0.30) and live dead ratio (85.3±...

Marwa R. El-Deken1, Raouf E. Rizk1, Mona R. Ahmed1, Fouad A. Tawfeek1, Hossam A. Shahba1, Wesam A. Fares1, Ayman M. Khalifah2*

...hatchability, intestinal morphology, tibia quality and blood parameters for Inshas chickens during the late laying period was performed. A total of 330 of Inshas chickens aged 50 weeks were randomly divided into five treatment groups. The birds of control group (Glu 1) were not supplied with Glu acid. Rest birds groups were supplemented with Glu as additional doses (0.4, 0.6, 0.8 and1%) for Glu2, Glu 3, Glu 4 and Glu 5, respectively. Egg production percentage ...

Md. Khayrul Basher1, Sumon Sarkar2,3, Md. Samiul Haque1, Sourav Sarker4, Md. Rashedul Islam1*

...o-body weight ratio, and morphology of the Liver and Lung were assessed. Na-arsenite exposure caused significant (p<0.05, respectively) increases in WBC count, RBC count, platelet count, hemoglobin, ESR, TCE, and RDW SD. The result also showed that serum RBS, ALT (SGPT), Alkaline phosphatase, Total cholesterol, Triglyceride, and Uric acid levels were significantly (p<0.01) higher in the NaAsO2 exposed group. Arsenic exposure also led to a significant (p&...
Fawad Khan1, Zahir Muhammad1, Khushdil Khan2 , Shabir Ahmad2, Muhammad Jamil Khan3, Tamana Bakht4 And Asif Kamal2
...EM and LM for the pollen morphology. Most of the
species recorded with pollen of tricolporate and echinate. Species belonging to Asteraceae
were considered as most abundant and allergenic as compared to others. The maximum
polar diameter was noted in the Convolvulus arvensis L. is 40.00 μm and the minimum were
noted in Oxalis corniculata is 6.15 μm. Maximum outer layer thickness was noted in
con...

Shabana Mangi1, Waheed Ali Panhwar1, Abdul Manan Shaikh1, G. Sarwar Solangi2, Khalid Hussain Rind3, Nazir Ahmed Abro4, Zaibun-nisa Memon1, Gul Hafeeza Lund1 and Paras Somroo1

...e genitalia and external morphology represented as its body is lengthened, brown to blackish in body coloration, with densely coarse punctures on whole body, frons depressed, prontal angles tapered, lengthened, scutellum shield shaped trigonal spots, 1st to 3rd antennomers quadrates, clypeus bigonal, legs lengthened, tarsi denticated, 5 claws on tarsi, meta tarsi slightly smooth. Male genitalia (aedeagus) is wider than longer, base broader, lateral lobe of par...

Khushdil Khan1, Mushtaq Ahmad1, Muhammad Zafar1, Khafsa Malik2, Shazia Sultana1, Shabir Ahmad1, Fawad Khan3, Asif kamal1, Kalim Ullah3

...-align: justify;">Pollen morphology of 10 different weedy bee foraged plants belong to 10 various families from Southern Khyber Pakhtunkhwa were collected, identified, and studied using light microscopy (LM). The plants were Asphodelus tenuifolius, Euphorbia helioscopia, Parthenium hysterophorus, Rhazya stricta, Datura innoxia, Eruca sativa, Convolvulus arvensis, Anagallis arvensis, Galium aparine, and Anethum graveolens. Slides for light microscopic studies w...
Md. Jasim Uddin,Sultan Ahmed,Md. Mahmudul Hasan,Md. Nizamul Hassan
ASIM MUHAMMAD,SAAD ULLAH KHAN,RAFI WAZIR,SULTAN MEHMOOD,REHMAN ULLAH KHAN,HIDAYAT ULLAH KHAN,Zahid Hussain,ATIQ MEHSUD
AKBAR ALI MEO,MIR AJAB KHAN

Majid Ali1*, Naila Chand1, Sarzamin Khan1, Shakoor Ahmad2 and Muhammad Tahir3

Muhammad Shuaib1*, Abdul Hafeez1, Sarzamin khan1, Muhammad Shahkar Uzair1, Abubakar Sufyan2 and Muhammad Ayaz3

...ency and intestinal histomorphology during early peak egg production period in the laying hens.

...

Putri Islamiati1, Muhammad Fathin Hanif2, Joko Sujiwo1,3, Adi Nugroho4, Bambang Ariyadi1*

...ogy, and intestinal histomorphology of broilers. A total of 240-day-old male New Lohmann broilers were randomly assigned to two treatments: ad libitum feeding (AF) and restriction feeding (RF). Restricted feeding is carried out by fasting method once a week after the brooding period at 10, 17, 24, and 31 d. Each treatment was replicated in 15 groups (each replicate consisted of 8 broilers). Data collected during the study were broiler growth performance, carca...
Tanvir Hussain1, Said Akhtar2, Khalid Hussain3* and Zahid Rauf4
... Keywords: Fiber morphology, Hardwoods, Lalkoo-Swat....
Md. Aktar Hossain , Mohammad Kamaluddin and M. Serajuddoula
...ing propagation, cutting morphology is not significantly changed due to the etiolation of the stockplants. ...
Abdul Ghani Awan, Sohail Jamil Qureshi, Mir Ajab Khan and Sofia Bano
...in the Asteraceae....
Abdul Samad Mumtaz, Mir Ajab Khan and Tanweer Akhtar
...heir plant forms (gross morphology). Characters like pollen shape, polar diameter 'P', equatorial diameter 'E', 'P/E' ratio, exine thickness and pore diameter are found considerably important. Artemisia japonica and A. desertorum are distinguished due to pollen grain size and the absence of operculum on the pore of A. dubia is distinguished due to pollen grain size and the absence of operculum on the pore of A....
Mohammad Arif Chaudhry
...nuary. Studies on flower morphology showed that the clayx hairy surface material was of ash grey color (easily removable) in P. fortunei while it was golden brown (sticky) in P. tomentosa, P. australis and P. elongata. The corolla color was white in P. elongata, dark purple in P. tomentosa, light purple in P. australis and mild off white in P. fortunei. The flower length was maximum (10.9 cm) in P. fortunei
Mohammad Saleem and C. A. Call
...ption of shoot and root morphology is essential for understanding the seedling establishment process of dominant forage grasses found on arid and semiarid rangelands in Baluchistan. A controlled environment study was conducted to determine differences in leave and tiller development and root development between seedlings of Chrysopogon aucheri (Boiss.) staph, and Cymbopogon jwarancusa (Jones) Schult, at 15, 30, 45, and 60 days after ...
Shahida Parveen and Zakaullah
...ibed the symptoms, morphology and cultural characteristics of the fungus causing wilt-disease of cumin.

Mathur and Prasad (1962) recorded powdery mildew (Erysiphe polygoni DC), blight (Alternaria burnsii) and wilt (Fusarium oxysporum f. cumini) diseases on cumin. Of these, wilt was the most serious one causing heavy losses to the crop. The average loss due to the disease was estimated to be 20%....

Hafiz Ishtiaq Ahmad1, Jinlong Zhang1, Fuxun Luo1, Owais Iqbal2 and Yuying Wang1*

...ing plant physiology and morphology. To gain a comprehensive understanding, an experiment was designed to investigate the impact of various light-emitting diode (LED) spectrums including red, blue, yellow, green, and their composite lights on the plant growth parameters, physiological characteristics, and antioxidant activity of Dendrobium officinale tissue culture seedlings. The fluorescent white light served as control. The tissue culture seedlings were grow...
Fangmei Zhang1,2, Xiaocen Zhao1,2, Li Qiao1,2, Shibao Guo1,2, Li Zhang1,2
Jian Yin1,2, Zhou Zhou1,2, Chuleui Jung3 and Shubao Geng1,2*
...Geometridae), the types, morphology, quantity and distribution of sensilla on the antenna were observed by scanning electron microscopy. The results showed that females and males antennae were filiform, bipectinate, respectively, which be divided into three segments, scape, pedical and flagellum that consisted numerous individual flagellomeres, respectively. There were eight kinds and twelve types of sensilla on the antennae, including 4 subtypes of sensilla t...

Lin Li1*, Lu Lu2, Gang An2 and Xiaoguang Zhang3

...ted by CCK-8 method. The morphology in the cells were observed under the inverted microscope electron microscope. The apoptosis of the cells was assayed by Hoecht staining. The expressions of TF, Bax and Bcl-2 in the cells were determined by Western blot. After treatment with TF-TP 150 μmol/L, the cell monolayer adhered to the wall, which was fusiform or polygonal. The suspended cells and cell debris were significantly reduced compared with the blue light m...

Ashiq Ullah1, Sarzamin Khan1, Muhammad Shuaib1*, Sohaib ul Hassan2, Abubakar Sufyan3, Kinkpe Lionel5, Muhammad Shahkar Uzair1, Majid Ali1, Aamir Khan4, Qudrat Ullah2 and Waqar Azeem6

... growth performance, gut morphology, and economics in broilers.

...

Abdullah Channo1,2*, Asmatullah Kaka1, Akeel Ahmed Memon1, Mool Chand Malhi3, Muhammad Bakhsh4, Qudratullah Kalwar5, Shakeel Ahmed Tunio6 and Muhammad Ibrahim Panhwar7

...d microscopic (motility, morphology, viability, concentration and membrane integrity) parameters were observed. The samples having motility, morphology, viability and membrane integrity ≥70% were pooled and processed. Pooled semen samples were divided into four groups and diluted with Tris, Tris+Vitamin E(α-tocopherol) and BIOXcell­­­TM, BIOXcell­­­TM+Vitamin E (α-tocopherol). Post-thaw...

Shumaila Usman1,2, Irfan Khan2, Kanwal Haneef3 and Asmat Salim2*

...last like spindle shaped morphology. The strategy to induce efficient transdifferentiation of NIH3T3 cells into IPCs has shown positive endocrine expression pattern, specifically β-cell specific transcription factors, demonstrating their successful regeneration. It is concluded that DNP has a potential to induce efficient transdifferentiation of NIH3T3 cells into insulin producing β-cells. The study could further be evaluated for their in vivo effect...

Jamal Abdul Nasir1, Naila Chand1, Abdul Hafeez1 and Rifat Ullah Khan2*

...munity, and improved gut morphology in quails, all without affecting liver and kidney functions. The most favorable outcomes were achieved when oyster mushroom stem waste was incorporated at a 3% level in the feed.

...

Israa M. Essa*, Ghazi Y. Azzal, Alaa Tariq Abdulwahid

...dults (20.69%). Based on morphology, all adult flukes were diagnosed as Fasciola. Accordingly, positive rate, risk and Odd ratio of fasciolosis were reported significantly in sheep of larger than 3 years than those of larger than 2-3 years, 1-2 years and sheep of less than 1 year. Concerning sex, no variation was detected between female (9.02%) and male (5.26%) sheep; however, females were appeared at higher risk of infection males. Molecular examination using...
Mohammad Moneruzzaman Khandaker1*,Nuratiqah Emran1, Nurul Elyni Mat Shaari1, Arba Aleem2, Zanariah Mohd Nor1 and Ali Majrashi3
...e germination behaviour, morphology, growth and development of Pak Choi plants. The sterilized Pak Choi seeds were germinated on a soaked filter paper of a petri dish. The petri dish included seven different treatments of Cd chloride with concentrations of 0, 0.01, 0.05, 0.1, 0.2, 0.3, and 0.4 mM. Each treatment was replicated five times. The germination and growth of the seeds were observed for 15 days. Pak Choi seedlings were also planted under hydroponic co...

Sumaya Loay Mohamed Shams Al-Dean1*, Sura Shakir Hammoud2, Mohammedali J. Ghafil3

...ity, and normal acrosome morphology were evaluated using paired sample T-test. The p-value (<0.05) is considered statistically significant. After thawing, the sperm cells’ motility dramatically increased with the addition of 2 mM (56.8±1.16), 4 mM (57.6±1.36), and 7 mM (62.1±1.67). The sperms viability is improved post-thawimg and at 5C after addition of anti-oxidants vitamin C. When compared to the control values, the fresh, 5C, ...

Khaeruddin1,2, Gatot Ciptadi1, Muhammad Yusuf3, Hermawansyah2, Sahiruddin3 and Sri Wahjuningsih1*

...atment affected abnormal morphology, progressive motility, local motility, total motility, immotil, linearity and straightness. In general, Ringer’s acetate-yolk glucose diluent is better in maintaining the quality of Gaga’s chicken spermatozoa during storage.

...

Preetysh Nanda Patnaik1, V.K. Venkataramani1, N. Jayakumar1, R. Durairaja1, Adyasha Sahu 1 and C. Sudhan2*

... on body morphometry and morphology to delineate them by employing a truss network. With regard to conventional morphometry in portunid species, only few characters are seemed to be diagnostic and many characters are found to be overlapping. Hence, Truss morphometry was attempted. Eleven truss distance landmarks were fixed on the cephalothorax dorsal surface using tpsUtil and digitized using tpsDig computer software package. A set of multivariate methods (Prin...

Aya Salah Eldin Mohamed1*, Gamal E. Shams1, Gihan G. Moustafa2, Reda M. Abd El-Aziz3

...e sperms count and sperm morphology when compared with G2. There are regressive histopathological alterations in the testis of citalopram-treated rats and these lesions were alleviated with administration of ginseng, vitamin D alone or in combination. In conclusion, ginseng and vitamin D could reduce oxidative stress, necrotic and apoptotic alterations, and protects against testicular damage caused by citalopram. Therefore, they might act as potential candidat...

Jennarong Kammongkun1, Doungnapa Promket2*

...d growth performance and morphology traits in 281 PH chickens using PCR-RFLP genotyping. The analysis revealed significant associations between growth performance and morphology traits in PH chickens. The correlations between average daily gains (ADG4 to ADG16) and body weights (BW0 to BW16) ranged from 0.33 to 0.99, indicating a consistent upward trend over time. The high body weight (HBW) group exhibited superior growth pe...
Phuong-Thao Ho1, 2, Thi Tuong Vy Nguyen3, Ngoc Hai Tran3 and Tran Van Giang4*
...key features of external morphology and internal anatomy. The results show that all these sipuncula have striking similarities to the sipuncula Siphonosoma australes (Keferstein, 1865), which has greater than 100 fibrous tentacles around their mouth and 15-17 longitudinal bands running along the body wall. Besides, we detected significant differences body mass, body length, introvert length, BM/BL and IL/BL ratios but not trunk length and diameter, number of t...
Khaled A. El-Dougdoug1, Wael S. El-Araby2* and Rehab, A. Dawoud3
... proteins organized in a morphology that resembles the original virion but lacks the viral genetic material. VLPs are appealing as a system because their proteins can be altered both chemically and genetically, opening up a wide range of potential uses. Virus-like particles (VLPs) are ideal for antigen and medication administration because viruses are strong immune activators and efficient vectors for transporting genetic elements into host cells. Recent devel...

El-Sayed I. Hassanein1, Abdallah E. Metwally1, Hossam Eldin M. Abd Elbaky1*, Walaa Fathy Saad Eldin2

...ant capacity, intestinal morphology, mortality percentage, and estimates of economic efficiency. Over the course of the five-week trial period, 150 (Ross 308) one-day-old chicks were separated into five groups, each consisting of three replicates (10 chicks/replicate). The chicks were fed five different experimental diets with varying quantities of oil (0% oil, 1 (SBO and 1% LO), 2% LO, and 3% LO, respectively). For assessment, four chicks from each replicatio...

Hussain Shah1, Ali Hazrat2*, Ateef Ullah1, Hafsa Razzaq3, Shabir Ahmad1, Muhammad Yahya2, Muhammad Abdullah1, Sahar Nasim2, Waqar Ahmad2, Muhammad Junaid1 and Gul Rahim2

... investigation evaluates morphology, seed yield, and yield components to maximize pea cultivars’ performance. The present research was done to assess the yield production of eleven different pea varieties as PL8, PL3, pL4, PL7, Meteor, PL6, PL11, PL2 (4), PL2, PL19, and Climax were grown in an experimental Field at the University of Malakand. Many quantitative characteristics such as the number of leaves, leaf size, leaf color, venation, leaf arrangement...

Muhammad Mushtaq1, Ihsan Ullah Khan1, Muhammad Shuaib5*, Naila Chand1, Abubakar Sufyan3, Muqader Shah2, Ziaul Islam4, Muhammad Shahkar Uzair1, Aamir Khan5, Qudrat Ullah2 and Usman Zeb6

Lalu Ahmad Zaenuri*, Rodiah Rodiah

...motility, viability, and morphology of Boer buck spermatozoa. The semen used in this study was collected from a 3-year-old Boer buck weighing 85 kg, which was well-trained, fertile, and free of both internal and external parasites. Ten semen samples were collected using an artificial vagina every four days over a period of ten consecutive days. The collected semen was divided into four tubes based on to the treatment extenders: FF0 (0 ml), FF1 (4 ml), FF2 (6 m...

Yong Su Park1a, Dong Won Seo2a, You Sam Kim2, Myung Hum Park2, Min Jee Oh3, Sang Hwan Kim3,4*

...North Korea that had the morphology suggested in the literature, collected mtDNA of the deer, and analyzed whole-genome sequencing (WGS) to determine whether they could be classified as subspecies of Cervus nippon hortulorum in the Korean Peninsula. 11 Sika deer with similar morphology to those presented in ancient literature were finally selected. Most of the sequence reads of the mtDNA gene sequence were mapped to a 2.8 Gb...

Roheena Abdullah*, Kinza Nisar, Afshan Kaleem and Mehwish Iqtedar

...ional methods, including morphology and microscopic features, and confirmed by 18S rDNA gene sequencing using specific ITS primers. The selected strain was then subjected to sequencing and phylogenetic analysis to further characterize its properties. The result indicates the selected strain was found to be A. niger.and this strain was given code A.niger KBT-3. The Five fermentation media were also screened. The Medium2 gave higher titer of alpha amylase activi...
Sanjay Chandravanshi1*, H.S. Mogalekar2, Omkar Sahu2, C. Sudhan3
Roshan Kumar Ram2 and Shivendra Kumar2
... Bihar, India. The hydro-morphology of the river were studied and revealed that river width varied from 87.34±10.17 to 102.77±11.58 m and maximum river width was recorded in August 2020. The maximum depth was observed between 8.62±0.99 to 13.55±1.21 m and maximum depth was observed in August 2020 and minimum depth ranged from 6.44±0.80 to 9.92±1.06 m and minimum depth was found in June 2021. The maximum water flows var...

Renny Fatmyah Utamy1, Ambo Ako1, Syahdar Baba2, Zulkharnaim1, Sri Gustina1, Laode Alhamd3, Indrawirawan2, Aulia Uswa Noor Khasanah1, Arif Rahman4,5, Siti Annisa Sukri5, Rara Mufliha5, Zyahrul Ramadan5 and Purnama Isti Khaerani6

... and seedling density on morphology and nutritional quality of fodder (Maize or Corn). The research was arranged according to a randomized, complete factorial design. Factor A was PGPR levels (0, 5, 10, and 15 ml/l) expressed as P, hereafter and Factor B was the density (0.26, 0.33, 0.40, and 0.47 g/cm²) hereafter refers as D. Parameters observed in the research included germination percentage, plant height, fresh weight, dry weight, and proximate analysi...

 Qin Yang Xinlei Fan

Volume 2, Issue 1 January and February 2018 Pages 17-18

Ayesha Bibi 1 Muhammad Junaid 2 Musharaf Ahmad 3

Volume 2, Issue 6 November and December 2018 Pages 167-174
...s yielded typical colony morphology of Clavibacter michiganensis subsp. michiganensis, when grown on Nutrient agar (NA) medium. 34 isolates out of the 47 exhibited Clavibacter michiganensis subsp. michiganensis like cultural characteristics when grown on Yeast extract-Dextrose-CaCO3 (YDC) medium. However, 27 isolates only out of these 34 were confirmed to be Gram positive. Pathogenicity of the 27 Clavibacter michiganensis subsp. michiganensis isolates were con...

 

Muhammad Junaid1*; Ayesha Bibi2; Musharaf Ahmad3; Muhammad Ali4; Yousaf Noor5

Novel Research in Microbiology Journal (2019), 3(2): 314-325
... medium. Based on colony morphology of R. solanacearum on the agar plates; and pathogenicity assays, about 29 isolates were guessed to be R. solanacearum. To further confirm the identity of these isolates, a species-specific primers-mediated Polymerase chain reaction (PCR) was carried out. Two specific primers i.e. forward primer: 5'GTCGCCGTCAACTCACTTTCC3', and reverse primer: 5'GTCGCCGTAGCAATGCGGAATCG3', were used for amplification of the 281bp band. Twenty f...

Ram Bahadur Khadka1*; Khimdhoj Karki1; Gautam Prasad Chaudhary2; Jitendra Pandey3

... explore the
morphology of MPXV, clinical manifestations, and mitigation strategies in the developing
nations. Clinically, MPXV resembles smallpox. It has an unidentified natural host, despite it
has been isolated from the rope squirrels and Sooty mangabeys. Transmission occurs through
the respiratory excretions, saliva, contact with lesions, and potentially via the feces. The
disease comprises a prod...

 

Yasmine Abdallah; Ranya M. El-Ashmony; Abdelrazek S. Abdelrhim*

Novel Research in Microbiology Journal (2020), 4(4): 939-954
... P. polymyxa on the cell morphology of Xoo. Applying P. polymyxa decreased the severity of bacterial leaf blight on rice seedlings to 4.9 %, compared to 42.5 % of the control. Moreover, this strain also improved the growth parameters of the rice seedlings significantly by increasing the shoot length, root length, fresh and dry weight by 166.7 %, 168.2 %, 100 %, and 255.6 %; respectively, compared to the positive control (Xoo only). Three antimicrobial related ...

Zeinab S. Hashem1*; Ahmed S. Hashem2

Novel Research in Microbiology Journal (2021), 5(2): 1176-1193
... on Candida cells’ morphology; the light microscopic examination demonstrated the inhibition in germ tube formation of all tested C. albicans with percentages of 68 % and 53 %, and for C. krusei with inhibition percentages of 69 % and 59 %, respectively. L. acidophilus and L. plantarum strains showed high co-aggregation ability with C. albicans strains with ranges of 42-49 % and 30-35 %, respectively. The antibiofilm activities of the two Lactobacillus s...

Rasha M. Elnagar

Novel Research in Microbiology Journal (2021), 5(2): 1194-1213
...ates according to colony morphology; microscopic examination and biochemical reactions. About 173 specimens were positive for bacterial pathogens; out of them 83 were GNB isolates. The most commonly isolated bacteria were; Klebsiella spp. 31 (37.3%), followed by Escherichia. coli 22 (26.5%), Pseudomonas. aeruginosa 17 (20.5%), Proteus spp. 10 (12.0%) and Enterobacter spp. 3 (3.6%). The antibacterial sensitivity testing of the total 178 bacterial isolates was a...

Remy Ntakirutimana1,2*, KM Mujeeb Rahiman2, Megha Lovejan2

...n, haematology, gut histomorphology and gut microbiota of juvenile Nile Tilapia fed these diets for 60 days were evaluated. The results showed that T2 had comparable growth and nutrient utilisation to T1, while T3 showed inferior performance. Yeast supplementation improved feed conversion efficiency, intestinal morphology, and protein and lipid utilization. The replacement did not affect negatively the fish blood parameters....

Mashael Alhumaidi Alotaibi*

...extract on mitochondrial morphology in MCF7 cells. It was observed that mitochondrial fragmentation increased with higher concentrations of the extract, accompanied by changes in nuclear morphology and DNA fragmentation. To elucidate the molecular mechanisms underlying these effects, the study examined the mRNA expression levels of apoptotic genes in MCF7 cells treated with lemongrass extract. The results revealed that lemon...

Andi Mushawwir1*, Ronnie Permana1, Johar Arifin2, Najma Ali3, Eli Sahara4

...al chickens’ ileum morphology and growth. Three hundred and fifty day-old Sentul chickens were randomly assigned to 35 experimental groups, each containing ten chickens. The study involved five different dietary treatments: P1: 2417 kcal/kg; P2: 2590 kcal/kg; P3: 2417 kcal/kg with amino acids; P4: 2590 kcal/kg with amino acids; and P5: 3178 kcal/kg. The chickens were fed these diets for eight weeks, from one day to eight weeks old. The results indicated ...

Fuling Wang1,2, Changlin Yue2, Hong Li2, Wenjing Yu1, Wenlan Li1* and Guosong Xin1*

...is while normal cellular morphology was preserved in the control. Staining with propidium iodide (PI), followed by flow cytometry showed that following 48 h TET treatment at 3.75, 7.5, and 15 μmol/L, the rate of apoptosis in HepG2 was 5.1%, 19.7%, and 36.9%, respectively. Western blotting was done to study the effect of TET on the expression profile of proteins involved in Hippo signalling pathway. We observed that in response to 48 h incubation with TET, t...

Usama Bin Naeem1, Muhammad Adil Rasheed1*, Muhammad Ashraf1 and Muhammad Yasir Zahoor2

..., zeta sizer, potential, morphology by scanning electron microscope, drug entrapment efficiency and in vitro drug release. In TAM and IVM loaded chitosan nanoparticles the peaks were at 1606 cm-1 and 1640 cm-1 respectively. TAM and IVM-CsNPs have size 189 and 196 nm with positive charge. The morphology of both nanoparticles were spherical and smooth surface. Drug entrapment efficiency was 79.08 ± 1.3 % and 89.00 &plus...

R.L. Rengarajan1,2*, G. Archunan1,3, B. Balamuralikrishnan4, I. Peatrise Geofferina5 and A. Vijaya Anand5

...d species of rodent pest morphology. The study revealed that the number of rodents seems to be equal in pre-monsoon and post-monsoon and there is a seasonal variation between the numbers of species in different localities. However, there were no morphological changes within the species. The present investigation showed that there were no intra-specific nucleotide alterations within M. meltada and T. indica and low intraspecific variation within B. indica and R...

Pakistan Journal of Zoology

November

Pakistan J. Zool., Vol. 56

Featuring

Click here for more

Subscribe Today

Receive free updates on new articles, opportunities and benefits


Subscribe Unsubscribe