Characterization of a Novel Recombinant β-Lactamase from Bacillus subtilis R5

Amjed Ali1, Muhammad Tayyab1*, Abu Saeed Hashmi2, Asif Nadeem3, Shumaila Hanif4, Sehrish Firyal1, Shagufta Saeed1, Ali Raza Awan1 and Muhammad Wasim1

1Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Sciences, Abdul Qadir Jillani Road, Lahore, Pakistan.

2Riphah International University, Raiwind Road Campus, Lahore

3Department of Biotechnology, Virtual University of Pakistan

4Department of Chemistry, University of Agriculture Faisalabad, Faisalabad

ABSTRACT

Current study deals with the characterization of recombinant β-lactamase from a locally isolated strain Bacillus subtilis R5. The study was an initial step for the fulfillment of commercial needs of β-lactamase in Pakistan. The 1 kb β-lactamase gene was amplified by PCR using the genomic DNA of B. subtilis R5 as template. The purified PCR product was cloned in pTZ57R/T and sub-cloned in pET21a. Expression of recombinant protein was examined in BL21 CodonPlus (DE3) cells. SDS-PAGE confirmed the size of recombinant protein as 34 kDa. Recombinant β-lactamase was produced optimally when the BL21 CodonPlus (DE3) cells were induced with 0.6 mM IPTG with a post induction time of 5h at 37 °C. The characterization studies demonstrated the maximal enzyme activity at 37 °C in 50 mM sodium phosphate buffer pH 7. The presence of EDTA in the activity assay mixture reduced the β-lactamase activity to 91% while Zn2+, Co2+, Mn2+ enhanced the enzymatic activity to 144, 121 and 108% when used at a final concentration of 1 mM. The ionic and non-ionic detergents showed slight inhibitory impact on the recombinant β-lactamase activity. The enzyme exhibited the Km and Vmax values of 2.27 mM and 45.45µmol/min, respectively when benzylpenicillin was utilized as substrate. The degradative ability of recombinant β-lactamase to hydrolyze a variety of β-lactam ring containing antibiotics makes it a suitable candidate for its utilization as positive control in diagnostics and in antibiotic susceptibility testing experiments.

Article Information

Received 18 July 2021

Revised 14 August 2021

Accepted 21 August 2021

Available online 07 December 2021

(early access)

Published 13 June 2022

Authors’ Contribution

AA performed experimental work. MT conceived the idea, provided guidance for the studies and manuscript write-up. ASH, AN, SF and SS facilitated the first author in conduction of experiments. SH, ARA and MW helped in data analysis and manuscript write-up.

Key words

β-lactamase, Antibiotic resistance, Bacillus subtilis R5, Antibiotic susceptibility, Diagnostics

DOI: https://dx.doi.org/10.17582/journal.pjz/20210718130706

* Corresponding author: muhammad.tayyab@uvas.edu.pk; tayyab_pakistan@yahoo.com

0030-9923/2022/0005-2301 $ 9.00/0

Copyright 2022 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

INTRODUCTION

β-lactamases (EC 3.5.2.6) hydrolyze the amide bond between the beta carbon atom and the nitrogen atom of the four corner beta lactam ring which is core part of all beta lactam based antibiotics. β-lactamases render the antibiotics ineffective by breaking the beta lactam ring causing development of resistance in bacteria (Gaude and Hattiholli, 2013). These enzymes have a wide range of applications in pharmaceutics, waste water treatment, diagnostics, food analysis, contamination control and in cancer chemotherapy (Giang et al., 2014).

β-lactamases are produced only by bacterial strains (Therrien and Levesque, 2000). Four classes of β-lactamases, namely A, B, C and D have been recognized based on their amino acid sequences and molecular function. While the activities of A, C and D classes of β-lactamases are governed by the serine based mechanism, the metallo-β-lactamases or class B lactamases require zinc for their activity (Bush et al., 1995). Uptil now more than 890 β-lactamases have been reported from different bacterial strains (Bush and Jacoby, 2010). Bacteria have developed resistance against various antibiotics due to the presence of genes responsible for the production of β-lactamases, involved in catabolism of antibiotics (MacGowan and Macnaughton, 2017).

Bacteria are a diverse group of microbes, distributed in all environments and are involved in the production of enzymes. Genus Bacillus is being utilized for the fulfillment of industrial demand of enzymes worldwide (Salcido et al., 2013; Pasvolsky et al., 2014; Liu et al., 2014). Extracellular enzymes in bulk are produced industrially from the selected strains of bacteria thus it is thought that they occupy the most prominent place regarding industrial production of enzymes. Food and Drug Administration (FDA) has listed some Bacillus species to be safe for their usage in the food and drugs (Sorokulova et al., 2008).

Bacillus subtilis R5 are Gram positive, small rod shaped, highly motile cells that show optimal growth at 30°C (Jalal et al., 2009). The present study describes characterization of recombinant β-lactamase from Bacillus subtilis R5 and its utilization as a positive control for antibiotic resistance detection in diagnostic laboratories.

MATERIALS AND METHODS

All chemicals utilized in the current study were of purified grade and procured from Sigma Aldrich (USA). The DNA extraction kit, Ins T/A cloning kit and restriction endonucleases were procured from Thermo-Fischer Scientific and Invitrogen, Life Sciences, USA.

Culture maintenance and isolation of genomic DNA

The pure culture of Bacillus subtilis R5, a gift from School of Biological Sciences, University of the Punjab, Lahore, was maintained on LB medium and used for isolation of genomic DNA (Sambrook and Russell, 2001).

Cloning of β-lactamase gene

The β-lactamase gene was amplified by PCR using BL-3N: CATATGACAACTGAAGATG and BL-3C: TCACCTCTTCATTGTTTTAA as forward and reverse primers and the genomic DNA of B. subtilis R5 as template. β-lactamase gene sequence of B. subtilis 168 (NZ_CP010052), the closet homolog of B. subtilis R5 was utilized for designing the primers. The forward primer contained the unique NdeI restriction site. Ligation of purified PCR product was performed in pTZ57R/T using T4 DNA ligase (Thermo-Fisher, Life Sciences, USA) at 20°C for overnight. E. coli DH5α competent cells were transformed using the ligated mixture and blue white screening method was followed for the screening of positive clones (Sambrook and Russell, 2001). The white colonies from the plate were utilized for isolation of plasmid DNA (Jalal et al., 2009). The presence of insert in the recombinant vector was examined by single and double digestion using HindIII and NdeI endonucleases. The plasmid DNA after confirmation by restriction digestion, was utilized for sequencing of β-lactamase gene using M13 forward and reverse primers. The obtained nucleotide sequence was utilized for deduction of amino acid sequence and for homology analysis (Naas et al., 2003; Sabir et al., 2017).

Expression analysis of β-lactamase gene

The β-lactamase gene was transferred from recombinant pTZ57R/T to pET21a already restricted with same endonucleases and this recombinant pET21a having β-lactamase gene was used for the transformation of BL21 Codon Plus (DE3) cells. The expression of β-lactamase was analyzed by growing the recombinant cells in the presence of 100 µg/mL ampicillin. The overnight grown cells were diluted to 1% with fresh LB broth and were incubated at 37 °C until the optical density at 660 nm reached to 0.4. The cells were induced with 0.6 mM IPTG followed by further incubation of 5h at the same temperature under shaking conditions. The cell pellet after centrifugation (6000xg for 10 min) was resuspended in 10 mL sodium phosphate buffer (pH 7) and the cells were lysed by sonication. The production of recombinant β-lactamase was analyzed by 12% SDS-PAGE.

Optimal production of β-lactamase

The production of β-lactamase was examined by varying the IPTG concentration from 0.1 to 1mM and with post induction time from 1 to 6h. The samples were withdrawn after every hour and were utilized for the estimation of β-lactamase activity.

Purification of recombinant β-lactamase

The soluble part after sonication process was applied on pre-equilibrated DEAE Sephadex A-50 column. The equilibration and washing of unbound proteins in column was done with 50 mM sodium phosphate buffer (pH 7). The bound proteins in the column were eluted by NaCl gradient prepared in the same buffer. The fractions containing β-lactamase activity were pooled and was applied to pre-equilibrated Sephadex G-50 gel filtration column. The purity of the fractions with β-lactamase activity was analyzed on SDS-PAGE. The purified recombinant β-lactamase was called as LACBS.

Enzyme activity assay

β-lactamase activity was examined by following the method of Sawai and Yamagishi (1978). The assay mixture comprised of 0.1 mL enzyme solution, 2.4 mL 50 mM sodium phosphate buffer (pH 7) and 0.5 mL benzylpenicillin. The mixture was incubated at 37 °C for 10 min in a water bath and was allowed to stay at room temperature for 10 min followed by addition of 3 mL iodine solution with rapid mixing and absorbance was recorded at 540 nm. Two blanks were utilized for performing the activity assay. Blank A was comprised of 2.9 mL sodium phosphate buffer and 0.1 mL enzyme solution while Blank B was having 2.5 mL sodium phosphate buffer and 0.5 mL benzylpenicillin. The blanks were treated in the same way as described above. One β-lactamase unit was the amount of enzyme which hydrolyzed 1 µmol of substrate per min under the assay conditions.

Characterization of β-lactamase

Effect of temperature

The enzyme activity was recorded at various temperatures ranging from 15 to 45°C. Regarding the activity assay, the assay mixture was incubated at specific temperature in water bath and the absorbance was recorded as 540 nm.

Effect of pH

The impact of pH on enzyme activity was recorded by examining the β-lactamase activity in the presence of 50 mM of each of sodium acetate buffer (pH 3-5), sodium phosphate buffer (pH 5-7), Tris HCl buffer (pH 7-9) and Glycine NaOH (pH 9-10).

Effect of metal cations and detergents

The enzyme activity was recorded in the presence of 1mM of each of metal cations including Ca2+, Mg2+, Fe2+, Zn2+, Cd2+, CO2+, Cu2+ Ni2+ and Mn2+ as well as in the presence of 1mM EDTA. The activity was also recorded in the presence of 1% non-ionic (Triton X-100, Tween 20 and Tween 80) and ionic (SDS) detergents.

Kinetic studies of β-lactamase

β-lactamase activity was examined by changing the substrate concentration from 0.1 to 1%. The attained data was used for the construction of Lineweaver Burk/double reciprocal plot and for the calculation of kinetic parameters.

Antibiotics degradative ability of recombinant β-lactamase

The β-lactamase activity was examined against various β-lactam ring containing antibiotics using LB agar plates and commonly available bacterial strains.

RESULTS

The PCR resulted in the amplification of 1 kb β-lactamase gene. Single digestion of recombinant pET21a with Nde1 resulted in the linearization of the vector and double digestion with HindIII and Nde1 resulted in the liberation of insert from the recombinant vector (Fig. 1). The DNA sequencing confirmed the presence of β-lactamase gene. The homology analysis based on deduced amino acid sequence showed the sequence identity of 100% with the non-characterized members of genus Bacillus whereas this lactamase did not show significant homology among the characterized counterparts.

Maximal production of β-lactamase was observed at 37°C when BL21 CodonPlus (DEL) cells having recombinant pET21a were induced with 0.6 mM IPTG (Fig. 2) with a post induction period of 5h. SDS-PAGE analysis of the purified protein after DEAE Sephadex A-50 column confirmed the molecular weight of β-LACBS as 34 kDa (Fig. 3).

 

 

LACBS activity was linearly increased with the increase in temperature from 15 to 37°C. Further increase in temperature beyond 37°C resulted in the decreased enzymatic activity (Fig. 4). LACBS activity was found pH dependent and was able to perform its activity between pH ranges from 3 to 10 with an optimal activity at neutral pH (Fig. 5). The presence of 1mM EDTA in the assay mixture reduced the LACBS activity to 91%. However, the presence of Zn2+, Co2+ and Mn+2 in the activity assay enhanced the enzymatic activity to 144, 121 and 108% whereas, Mg2+, Ca2+ and Fe2+ reduced the activity to 90, 82 and 50% when used at a final concentration of 1mM. The presence of non-ionic (Triton X-100, Tween 20, Tween 80) and ionic (SDS) detergents could reduce the LACBS activity to 97, 94, 73 and 71% respectively when used at final concentration of 1% (Table I). Kinetic studies revealed the Km and Vmax values of 2.27 mM and 45.45 µmoles/min, respectively (Fig. 6). LACBS has degraded the β-lactam ring containing antibiotics and due to the degradation of antibiotics the bacterial growth was observed in the LB plates as compared to the controls.

 

 

 

 

Table I. Effect of metal cations and detergents on LACBS activity.

	Metal ions and detergents	Relative activity
	Control	100
	EDTA	91
Metal ions
	Zn2+	144
	Co2+	121
	Mn2+	108
	Mg2+	90
	Ca2+	83
	Fe2+	50
Detergents
	Tween 20	94
	Tween 80	73
	Triton X-100	97
	SDS	71

 

Metal chlorides were used in β-LACBS activity assay.

 

DISCUSSION

β-lactamases are enzymes that play important role as positive control in antimicrobial susceptibility testing in clinical laboratories. These are responsible for the hydrolysis of amide bond in the β-lactam ring to make the antibiotic ineffective. β-lactamases have been classified into various classes including A, B, C and D. Classes A, C and D have serine as active site amino acid and follow the development of acyl enzyme intermediate during the hydrolysis of β-lactam ring. Class B lactamases are metal dependent enzymes which require Zn 2+ for their activity (Fisher et al., 2005; Massova and Mobashery, 1998; Wilke et al., 2005).

Interestingly, β-lactamase from current study is unique as it didn’t share the basic conserved domains required for the activity of class A, C and D of β-lactamases and this lactamase shows its activity even in the absence of Zn2+ which is the unique character of class B β-lactamases. The lactamase from current study have ability of showing 90% of its activity even in the presence of 1mM EDTA; however LACBS activity is increased in the presence of Zn2+. These characteristics make this enzyme novel.

The optimal production of β-lactamase was observed 5h after induction of cells with 0.6 mM IPTG. The results are similar to those of lactamase produced from Mycobacterium smegmatis which showed optimal production 6h after induction of cells with 0.5mM IPTG (Bansal et al., 2015).

LACBS has molecular weight of 34 kDa which is close to 36 kDa for lactamase of Bacillus cereus ATCC 13061 (Fenselau et al., 2008) and 32.5 kDa for lactamase of Bacteroides uniformis (Hedberg et al., 1995). LACBS showed maximal activity at 37oC which is in agreement with β-lactamases from Mycobacterium tuberculosis (Voladri et al., 1998), Burkholderia pseudomallei (Cheung et al., 2002), Prevotella intermedia (Madinier et al., 2001) and Staphylococcus aureus (East and Dyke, 1989) whereas the lactamase from Stenotrophomonas maltophilia (Crowder et al., 1998) showed optimal activity at 35oC. In contrast to this, the lactamases from Bacteroides fragilis (Wang and Benkovic, 1998), Pseudomonas aeruginosa (Krasauskas et al., 2015), Legionella gormanii ATCC 33297T (Mercuri et al., 2001), Yersinia ruckeri (Mammeri, et al., 2006) and Bacillus clausii (Girlich et al., 2007) showed optimal activity between a temperature range from 25 to 30oC.

The LACBS shows optimum activity at neutral pH which is being supported by lactamases from Bacteroides fragilis (Wang and Benkovic, 1998), Pseudomonas aeruginosa (Krasauskas et al., 2015), Stenotrophomonas maltophilia (Mercuri et al., 2001), Prevotella intermedia (Madinier et al., 2001), Yersinia ruckeri (Mammeri et al., 2006), Staphylococcus aureus (East and Dyke, 1989), Proteus mirabilis N29 (Sawai et al., 1982) and Bacillus clausii (Girlich et al., 2007) whereas the lactamases from Mycobacterium tuberculosis (Voladri et al., 1998) Legionella gormanii (Mercuri et al., 2001) and Mycobacterium tuberculosis (Voladri et al., 1998) showed maximal activity at pH 6. However, the lactamases from Burkholderia pseudomallei (Cheung et al., 2002) and Pseudomonas maltophilia GN12873 showed the optimal activity at 7.4 and pH 8 respectively (Saino et al., 1982).

Metallo β-lactamases require Zn2+ for performing their activity and these enzymes can’t work in the absence of cofactor (Paton et al., 1994; Concha et al., 1996; Salahuddin et al., 2018; Meini et al., 2015). LACBS retains 90% activity in the presence of EDTA indicating the ability of enzyme to work even in the absence of Zn2+. At the same time its activity is being enhanced with the availability of Zn2+. This might be due the stabilizing impact of Zn2+ on the structure of LACBS. The results demonstrated that LACBS requires 0.8 mM Zn2+ for performing maximal activity. In contrast to this, β-lactamase VIM-4 from Pseudomonas aeruginosa possessed maximal activity at 0.4 mM concentration of Zn2+ (Lassaux et al., 2011).

The presence of ionic and non-ionic detergents showed slight to moderate inhibitory impact on the LACBS activity. Among the nonionic detergents, Tween 80 reduced the enzymatic activity to 73% as compared to Tween 20 or Triton X-100 which exhibited negligible impact and reduced the enzymatic activity to 94 or 97%, respectively. SDS reduced the LACBS activity to 70%.

CONCLUSION

β-lactamase from current study is unique as it does not show significant homology with the previously characterized lactamases. Secondly, this enzyme shows its activity similar to class A, C and D of lactamases in a metal independent way, however the activity is being increased in the presence of Zn2+ that is unique characteristic of class B of lactamases. The antibiotic hydrolyzing ability of this enzyme makes it suitable for its use in diagnostic laboratory. The domestic production of β-lactamase will result in cost effective availability of this enzyme and will save huge foreign exchange for the import of this enzyme.

ACKNOWLEDGEMENTS

The authors are grateful to the Higher Education Commission, Pakistan for providing funds for completion of this work.

Statement of conflict of interest

The authors have declared no conflict of interest.

REFERENCES

Bansal, A., Kar, D., Murugan, R.A., Mallick, S., Dutta, M., Pandey, S.D., Chowdhury, C. and Ghosh, A.S., 2015. A putative low-molecular-mass penicillin-binding protein (PBP) of Mycobacterium smegmatis exhibits prominent physiological characteristics of DD-carboxypeptidase and beta-lactamase. Microbiology, 161: 1081-1091. https://doi.org/10.1099/mic.0.000074

Bush, K. and Jacoby, G.A., 2010. Updated functional classification of β-lactamases. Antimicrob. Agents Chemother., 54: 969-976. https://doi.org/10.1128/AAC.01009-09

Bush, K., Jacoby, G.A. and Medeiros, A.A., 1995. A functional classification scheme for beta-lactamases and its correlation with molecular structure. Antimicrob. Agents Chemother., 39: 1211. https://doi.org/10.1128/AAC.39.6.1211

Cheung, T.K., Ho, P.L., Woo, P.C., Yuen, K.Y. and Chau, P.Y., 2002. Cloning and expression of class A β-lactamase gene blaABPS in Burkholderia pseudomallei. Antimicrob. Agents Chemother., 46: 1132-1135. https://doi.org/10.1128/AAC.46.4.1132-1135.2002

Concha, N.O., Rasmussen, B.A., Bush, K. and Herzberg, O., 1996. Crystal structure of the wide-spectrum binuclear zinc β-lactamase from Bacteroides fragilis. Structure, 4: 823-836. https://doi.org/10.1016/S0969-2126(96)00089-5

Crowder, M.W., Walsh, T.R., Banovic, L., Pettit, M. and Spencer, J., 1998. Overexpression, purification, and characterization of the cloned metallo-β-lactamase L1 from Stenotrophomonas maltophilia. Antimicrob. Agents Chemother., 42: 921-926. https://doi.org/10.1128/AAC.42.4.921

East, A.K. and Dyke, K.G.H., 1989. Cloning and sequence determination of six Staphylococcus aureus β-lactamases and their expression in Escherichia coli and Staphylococcus aureus. Microbiology, 135: 1001-1015. https://doi.org/10.1099/00221287-135-4-1001

Fenselau, C., Havey, C., Teerakulkittipong, N., Swatkoski, S., Laine, O. and Edwards, N., 2008. Identification of β-Lactamase in antibiotic-resistant Bacillus cereus spores. Appl. Environ. Microbiol., 74: 904-906. https://doi.org/10.1128/AEM.00788-07

Fisher, J.F., Meroueh, S.O. and Mobashery, S., 2005. Bacterial resistance to β-lactam antibiotics: compelling opportunism, compelling opportunity. Chem. Rev., 105: 395-424. https://doi.org/10.1021/cr030102i

Gaude, G.S. and Hattiholli, J., 2013. Rising bacterial resistance to beta-lactam antibiotics: Can there be solutions? J. Dr. NTR. Univ. Hlth. Sci., 2: 4. https://doi.org/10.4103/2277-8632.108504

Giang, I., Boland, E.L. and Poon, G.M., 2014. Prodrug applications for targeted cancer therapy. AAPS J., 16: 899-913. https://doi.org/10.1208/s12248-014-9638-z

Girlich, D., Leclercq, R., Naas, T. and Nordmann, P., 2007. Molecular and biochemical characterization of the chromosome-encoded class A β-lactamase BCL-1 from Bacillus clausii. Antimicrob. Agents Chemother., 51: 4009-4019. https://doi.org/10.1128/AAC.00537-07

Hedberg, M., Lindqvist, L., Bergman, T. and Nord, C.E., 1995. Purification and characterization of a new beta-lactamase from Bacteroides uniformis. Antimicrob. Agents Chemother., 39: 1458-1461. https://doi.org/10.1128/AAC.39.7.1458

Jalal, A., Rashid, N., Rasool, N. and Akhtar, M., 2009. Gene cloning and characterization of a xylanase from a newly isolated Bacillus subtilis strain R5. J. Biosci. Bioeng., 107: 360-365. https://doi.org/10.1016/j.jbiosc.2008.12.005

Krasauskas, R., Labeikyte, D., Markuckas, A., Povilonis, J., Armalyte, J., Planciuniene, R., Kavaliauskas, P. and Suziedeliene, E., 2015. Purification and characterization of a new β-lactamase OXA-205 from Pseudomonas aeruginosa. Annls clin. Microbiol. Antimicrob., 14: 1-8. https://doi.org/10.1186/s12941-015-0113-1

Lassaux, P., Traore, D.A., Loisel, E., Favier, A., Docquier, J.D., Sohier, J.S., Laurent, C., Bebrone, C., Frere, J.M., Ferrer, J.L. and Galleni, M., 2011. Biochemical and structural characterization of the subclass B1 metallo-β-lactamase VIM-4. Antimicrob. Agents Chemother., 55:1248-1255. https://doi.org/10.1128/AAC.01486-09

Liu, Y., Lin, S., Zhang, X., Liu, X., Wang, J. and Lu, F., 2014. A novel approach for improving the yield of Bacillus subtilis transglutaminase in heterologous strains. J. Ind. Microbiol. Biotechnol., 41: 1227-1235. https://doi.org/10.1007/s10295-014-1468-6

MacGowan, A. and Macnaughton, E., 2017. Antibiotic resistance. Medicine, 45: 622-628. https://doi.org/10.1016/j.mpmed.2017.07.006

Madinier, I., Fosse, T., Giudicelli, J. and Labia, R., 2001. Cloning and biochemical characterization of a class A β-lactamase from Prevotella intermedia. Antimicrob. Agents Chemother., 45: 2386-2389. https://doi.org/10.1128/AAC.45.8.2386-2389.2001

Mammeri, H., Poirel, L., Nazik, H. and Nordmann, P., 2006. Cloning and functional characterization of the ambler class C β-lactamase of Yersinia ruckeri. FEMS Microbiol. Lett., 257: 57-62. https://doi.org/10.1111/j.1574-6968.2006.00148.x

Massova, I. and Mobashery, S., 1998. Kinship and diversification of bacterial penicillin-binding proteins and β-lactamases. Antimicrob. Agents Chemother., 42: 1-7. https://doi.org/10.1128/AAC.42.1.1

Meini, M.R., Llarrull, L.I. and Vila, A.J., 2015. Overcoming differences: The catalytic mechanism of metallo-β-lactamases. FEBS Lett., 589: 3419-3432. https://doi.org/10.1016/j.febslet.2015.08.015

Mercuri, P.S., Bouillenne, F., Boschi, L., Lamotte-Brasseur, J., Amicosante, G., Devreese, B., Van Beeumen, J., Frere, J.M., Rossolini, G.M. and Galleni, M., 2001. Biochemical characterization of the FEZ-1 metallo-β-lactamase of Legionella gormanii ATCC 33297T produced in Escherichia coli. Antimicrob. Agents Chemother., 45: 1254-1262. https://doi.org/10.1128/AAC.45.4.1254-1262.2001

Naas, T., Bellais, S. and Nordmann, P., 2003. Molecular and biochemical characterization of a carbapenem-hydrolysing β-lactamase from Flavobacterium johnsoniae. J. Antimicrob. Chemother., 51: 267-273. https://doi.org/10.1093/jac/dkg069

Pasvolsky, R., Zakin, V., Ostrova, I. and Shemesh, M., 2014. Butyric acid released during milk lipolysis triggers biofilm formation of Bacillus species. Int. J. Fd. Microbiol., 181: 19-27. https://doi.org/10.1016/j.ijfoodmicro.2014.04.013

Paton, R., Miles, R.S. and Amyes, S.G., 1994. Biochemical properties of inducible beta-lactamases produced from Xanthomonas maltophilia. Antimicrob. Agents Chemother., 38: 2143-2149. https://doi.org/10.1128/AAC.38.9.2143

Sabir, F., Tayyab, M., Muneer, B., Hashmi, A.S., Awan, A.R., Rashid, N., Wasim, M. and Firyal, S., 2017. Characterization of recombinant thermostable phytase from Thermotoga naphthophila: A step for the fulfilment of domestic requirement of phytase in Pakistan. Pak. J. Zool., 49. https://doi.org/10.17582/journal.pjz/2017.49.6.1945.1951

Saino, Y., Kobayashi, F., Inoue, M. and Mitsuhashi, S., 1982. Purification and properties of inducible penicillin beta-lactamase isolated from Pseudomonas maltophilia. Antimicrob. Agents Chemother., 22: 564-570. https://doi.org/10.1128/AAC.22.4.564

Salahuddin, P., Kumar, A. and Khan, A.U., 2018. Structure, function of serine and metallo-β-lactamases and their inhibitors. Curr. Protein Pept. Sci., 19: 130-144. https://doi.org/10.2174/0929866524666170724160623

Salcido, D.L.F., Casados-Vazquez, N.M.L.E. and Barboza-Corona, J.E., 2013. Bacteriocins of Bacillus thuringiensis can expand the potential of this bacterium to other areas rather than limit its use only as microbial insecticide. Can. J. Microbiol., 59: 515-522. https://doi.org/10.1139/cjm-2013-0284

Sambrook, J. and Russell, D.W., 2001. Molecular cloning: A laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, New York.

Sawai, T.E., Kanno, M.A., and Tsukamoto, K.I., 1982. Characterization of eight beta-lactamases of Gram-negative bacteria. J. Bact., 152: 567-571. https://doi.org/10.1128/jb.152.2.567-571.1982

Sawai, T., Takahashi, I. and Yamagishi, S., 1978. Iodometric assay method for beta-lactamase with various beta-lactam antibiotics as substrates. Antimicrob. Agents Chemother., 13: 910-9113. https://doi.org/10.1128/AAC.13.6.910

Sorokulova, I.B., Pinchuk, I.V., Denayrolles, M., Osipova, I.G., Huang, J.M., Cutting, S.M. and Urdaci, M.C., 2008. The safety of two Bacillus probiotic strains for human use. Dig. Dis. Sci., 53: 954-963. https://doi.org/10.1007/s10620-007-9959-1

Therrien, C. and Levesque, R.C., 2000. Molecular basis of antibiotic resistance and β-lactamase inhibition by mechanism-based inactivators: perspectives and future directions. FEMS Microbiol. Rev., 24: 251-262. https://doi.org/10.1111/j.1574-6976.2000.tb00541.x

Voladri, R.K.R., Lakey, D.L., Hennigan, S.H., Menzies, B.E., Edwards, K.M. and Kernodle, D.S., 1998. Recombinant expression and characterization of the major β-lactamase of Mycobacterium tuberculosis. Antimicrob. Agents Chemother., 42: 1375-1381. https://doi.org/10.1128/AAC.42.6.1375

Wang, Z. and Benkovic, S.J., 1998. Purification, characterization, and kinetic studies of a soluble Bacteroides fragilis Metallo-β-lactamase That Provides Multiple Antibiotic Resistance. J. biol. Chem., 273: 22402-22408. https://doi.org/10.1074/jbc.273.35.22402

Wilke, M.S., Lovering, A.L. and Strynadka, N.C., 2005. β-Lactam antibiotic resistance: A current structural perspective. Curr. Opin. Microbiol., 8: 525-533. https://doi.org/10.1016/j.mib.2005.08.016