Streptococcus iniae: A Growing Threat and Causative Agent of Disease Outbreak in Farmed Chinese Sturgeon (Acipenser sinensis)

Murtala Muhammad, Ting Zhang, Siyu Gong, Jing Bai, Jiansong Ju, Baohua Zhao* and Dong Liu*

College of Life Science, Hebei Normal University, Shijiazhuang 050024, China

ABSTRACT

Streptococcus iniae infection of cultured fish species is in an alarming trend, due to the possible emergence of antibiotic resistant strains. The bacteria was responsible for the disease outbreak that caused massive mortality of Chinese sturgeon (Acipenser sinensis) in 2016. We isolated the pathogenic bacteria (HNM-1) from the infected A. sinensis and identified its identity by conventional physiological, biochemical, and molecular techniques. Virulence and pathogenesis of the disease were determined by intraperitoneal injection of the etiological agent to the healthy A. sinensis. Physiological and 16s rRNA molecular analysis identified Streptococcus iniae as the causative agent of the disease outbreak. The bacteria has a unique biochemical profile compared with most of the previously isolated strains. Antimicrobial susceptibility tests revealed that S. iniae HNM-1 is resistant to most of the important antibiotics, including Kanamycin, Amoxicillin, gentamycin, Penicillin G and spectinomycin. The bacteria is pathogenic to Chinese sturgeon via intraperitoneal injection. It instigated pathological changes in vital organs that lead to mortality of the infected A. sinensis with a cumulative mortality of 40% to 100%. S.iniae HNM-1 ability to evade the innate immune system was determined by whole blood killing, exposure to hydrogen peroxide, and biofilm assays. This study represents the first Report of S. iniae infection of Chinese sturgeon (Acipenser sinensis).

Article Information

Received 09 February 2019

Revised 22 March 2019

Accepted 02 April 2019

Available online 21 May 2020

Authors’ Contribution

BZ and DL conceived the project. ALL statistically analyzed the data and wrote the article. MM, JB, TZ, and SG executed the experimental work. DL, BZ and JJ supervised the research project.

Key words

Acipenser sinensis, Streptococcus iniae, Virulence, Antimicrobial Resistance, Biofilm

DOI: https://dx.doi.org/10.17582/journal.pjz/20190209200236

* Corresponding author: pqw1234@163.com;

baohua519@126.com

0030-9923/2020/0005-1931 $ 9.00/0

Copyright 2020 Zoological Society of Pakistan

INTRODUCTION

Sturgeon is the common name for the 27 species of fish belonging to the family Acipenseridae, which includes a Chinese sturgeon (Acipenser sinensis); an essential delicacy in China, that was listed among critically endangered fish species. As such government banned its commercial fishing at its only natural breeding grounds (channel of the Yangtze River, the Pearl River, and the East and South China Seas). Which leads to an increase of more sturgeon artificial breeding farms across China (Zhang et al. 2012). However, the rapid increase of cultured fish farming and high stock density have resulted in higher susceptibility of sturgeon species to infections of bacteria such as Aeromonas hydrophila, Aeromonas veronii (Di et al., 2018), and Streptococcus dysgalactiae (Yang and Li, 2009).

Streptococcus iniae is a fish pathogen, which can cause a high mortality of about 50% to 75% of susceptible cultured fish. It has so far infected more than 30 fish species, significantly contributed to the economic losses of aquaculture industries across the world (Agnew and Barnes, 2007). The bacteria was initially isolated in 1976 from an Amazon freshwater dolphin (Inia geoffrensis) in San Francisco, California, USA (Pier and Madin, 1976). Subsequently, reports of mass mortality associated with S. iniae of both fresh, salt and brackish water fish species were documented (Kayansamruaj et al., 2017). The zoonotic bacteria was also reported to cause bacteremia, cellulitis, meningitis, and osteomyelitis in human (Lau et al., 2003). Not all S. iniae are virulent due to the lack of some critical virulent factors in some strains (Weinstein et al., 1997).

The primary objectives of this study, are to identify and characterize the etiological agent of the disease outbreak in Chinese sturgeon fish farm located at Hebei province of China during the summer of 2016, evaluate its virulence and pathogenesis in experimentally infected A. sinensis, as well as to determine the effective antibiotics treatment.

 

MATERIALS AND METHODS

Sampling

Fish that showed clinical sign and symptoms of the disease were collected during the outbreak and sent to the laboratory for further examinations. Liver, brain and spleen samples from the infected fish were aerobically inoculated on Brain heart infusion (BHI) agar plates and incubated at 30°C for 36 hours, followed by re-culture of a single colony on another BHI agar plates, then in BHI medium and incubated at 30°C for 24 hours. 20 % (V/V) of glycerol was added to the stock culture and stored at -80°C.

Experimental animal

Chinese Sturgeon (A. sinensis, 100-130 g) obtained from Hebei aquaculture experimental station, Shijiazhuang China, were grouped into four, each with 10 fishes and kept in recirculation freshwater tanks for experimental infection.

All fish experimental procedures were strictly carried out according to the recommendations in the Guide for the Care and Use of the Laboratory Animals of Hebei Province of China. The animal experiment protocol was approved by the Animal Monitoring Committee of Hebei Normal University.

Phenotypic and biochemical characterizations of the isolate

The isolate was cultured on Tryptone soy yeast extract agar (TSYEA) (Sigma-Aldrich) plates, incubated at 30°C for 24 h, and used for gram stain and capsule stain, according to standard protocols. While hemolysis was determined using Tryptone soy agar plates supplemented with 5% sheep blood (Henan Zhengzhou, China). Optimum growth temperature and salt tolerance test were conducted by incubating the bacterial culture at different temperatures (10oC, 20oC, 30oC, 35oC and 45°C) and also in TSYE medium containing different salt concentrations (0%, 1.0%, 3.0%, 5.0% and 6.5%) respectively. Biochemical profile of the isolate was determined by using the API-20 strep kit (Biomerieux, France) according to the manufacturer’s instructions.

Molecular identification and phylogenetic analysis

Genomic DNA of the isolate was extracted using the TIANamp Bacterial DNA kit (Tiangen Biotech, Beijing China). PCR amplification was performed using species-specific PCR primers targeting genes of 16S rRNA (F - 5’-AGAGTTTGATCCTGGCTC-3’ and R-5’-TCAAAGGCTGCTGGAC-3’) (Jensen et al., 2002) and lactate oxidase (Lox)

(F- 5’-GAAATGATAAATGCGACTAC-3’ and

R- 5’-TCAAAGGCTGCTGGAC-3’) (Mata et al., 2004). DNA sequencing analysis was conducted using the ABI 3730x1 DNA sequencer (Applied Biosystems). Genetic distance tree analysis of 16S rRNA gene was build using MEGA 5.0 software.

Antimicrobial susceptibility test

The sensitivity of the isolated strain to 19 kinds of antimicrobial agents was determined by disc diffusion method on TSYEA plates, using antimicrobial disks (Hangzhou Tai he, Hangzhou China), according to the Clinical and laboratory standards institute (CLSI-2015) guidelines.

Virulence genes of Streptococcus iniae

Six essential virulence genes of S. iniae were detected by PCR, as described previously with little modifications (Deng et al., 2017). Primers sequences and gene descriptions were offered in Table I.

 

Table I. Primers used for the amplification and sequencing of virulence genes, virulence genes of the bacteria were detected by using the listed primers; the PCR products were sequenced and confirmed by blast analysis.

Primer set	Primer	Sequence (5’ to 3’)	Virulence factors	Amplicon Size (bp)
A	scpI-a scpI-b	GCAACGGGTTGT CAAAAATC GAGCAAAAGGAGTTGCTTGG	C5 α peptidase	822
B	simA-a simA-b	CGCAAAATGATCACATCAGCAGTCCTTG CAGCTCCAACCATAACCGCGATAGCAC	M-like protein	760
C	Pdi-a Pdi-b	TTTCGACGACAGCATGATTG GCTAGCAAGGCCTTCATTTG	Polysaccharide Deacetylase	381
D	saga-a saga-b	AGGAGGTAAGCGTTATGTTAC AAGAAGTGAATTACTTTGG	Cytolysin SLS	190
E	Pgm-a Pgm-b	ATGACTTATACAGAAAATTATCAAAAATG ACAAAAGTGTTGATTTCAGCTTCAATTG	Phosphog-lucomutase	1700
F	cpsD-a cpsD-b	TGGTGAAGGAAAGTCAACCAC TCTCCGTAGGAACCGTAAGC	Capsule	534

 

Scanning electron microscope

The ability of S. iniae to produce biofilm was analyzed using a scanning electron microscope (SEM); Conducting glass and 1ml of HNM-1 culture were added to the wells of 24 wells plate, and incubated at 35oC for 6 days. The glasses were washed with 0.1M PBS and fixed for 6 hours in 2.5% buffered glutaraldehyde, washed again in 0.1M PBS, and dehydrated in a graded series of ethanol solutions (50-100%), After critical point drying, the specimens were mounted on SEM discs, coated with gold and observed with a Hitachi S-570 scanning electron microscope (Hitachi, Japan) at an accelerating voltage of 60 kV (Liu et al., 2015).

Reactive oxygen assays

The isolated strain was sub-cultured to OD (600 nm) of 0.5 and incubated for 2 hours in 1mM and 2mM concentrations of hydrogen peroxide (H2O2) (Sigma–Aldrich, St. Louis, MO) at 300C, each in triplicate. One thousand U /mL of Catalase (Sigma–Aldrich, St. Louis, MO) was added to quench H2O2 at the end of the assay. Dilutions were plated on TSYEA plates to determine the number of surviving CFU, control samples were prepared by inoculating the bacteria without the addition of hydrogen peroxide. Percent survival was calculated as (CFUs after co-incubation in H2O2/ CFU in control inoculums) ×100 (Buchanan et al., 2008).

Whole-blood killing assay

100µl of diluted log-phase bacteria culture with OD (600 nm) of 0.5 was added to 300µl of fresh fish heparinized blood (sodium heparin, Sigma–Aldrich, St. Louis, MO) from three individual fish and incubated at 35°C in a shaker for 2.0 hours. The percentage of live bacteria was determined by plating on TSYEA and calculated as follows: (CFUs after co-incubation/ CFUs in initial inoculums) ×100% (Buchanan et al., 2008). The negative control was made by direct inoculation of the 100μl of PBS directly into the heparinized fish blood.

In vivo infection assay

Preliminary pathogen screening of fish was conducted to make sure they were in good health. HNM-1 culture, diluted to concentrations of approximately 2.0 x 105, 2.0 x 106, 2.0 x 107 CFU were intraperitoneally injected to the healthy Chinese sturgeon, one concentration per group, while the control group was injected with sterile Phosphate buffered saline (PBS). Mortality was recorded every day for 7 days post-infection and only attributed to the inoculated bacteria when it was recovered from the dead fish in pure culture and confirmed by PCR using16S rRNA and lox Genes specific primers.

Histopathological analysis

The collected Liver, heart, brain and spleen samples of the fish were fixed in 10% buffered formalin (pH 7.2) for 24 h, embedded with paraffin Sections (4μm) and stained with Hematoxylin and Eosin (HandE) as well as examined by light microscopy (Nikon Eclipse ci, imaging system: NIKON digital sight DS-FI2, magnification: 200×, 400×).

Statistical analysis

Statistical analysis was performed with SPSS 16.0 (SPSS Inc. USA) and the Prism software program 7.0 (GraphPad Software, Inc. USA). Survival data were analyzed with the log-rank test. The P values in other experiments were obtained using Student’s t-test. P values < 0.05 and < 0.01 were considered statistically significant and highly statistically significant, respectively.

 

RESULTS

Phenotypic and molecular identification of the isolate

The isolated bacteria were identical in morphology, having a small round smooth, white colonies with a diameter of 0.8-1.0 mm, it is capsulated, β-hemolytic, gram-positive bacteria arranged in pairs, and chains of varying lengths, with the optimum growth temperature within the range of 30oC to 35oC, but unable to grow at 10oC and 45oC. Salt tolerance test results showed that the bacteria is not viable in a broth medium with 6.5% NaCl concentration but very slow in media with 5% NaCl for two days which subsequently able to tolerate the salt and grow viably.

Expected PCR products sizes of 16S rRNA (1400 bp) gene and Lox (870 bp) were visualized by gel electrophoresis, 16S rRNA and Lox genes were sequenced and analyzed with the NCBI Blast program, 16S rRNA and Lox genes has 98% and 99% homology compared with previously isolated strain (ATCC 29178) respectively. The sequence of the 16S rRNA gene was uploaded to the NCBI Genbank database under accession number KY781829. The phylogenic tree analysis showed that 16S rRNA gene of HNM-1 is evolutionary very close to previously isolated strains, it also showed the distribution of different isolates of S. iniae and other related species. Three clusters were observed in the phylogenetic tree, the first one corresponding to the root is streptococcus lutetiensis, followed by a defined group of Streptococcus agalactiae ATCC 13813 and Streptococcus dysgalactiae 172755 strains, at the top is a group comprising our isolate (HNM-1) and other S. iniae strains isolated from China, Japan, and Israel (Fig. 1).

Antibiotic susceptibility

The susceptibility of HNM-1 to 19 antimicrobial agents is summarized in Table III. The bacteria is resistant to many important antibiotics that include Amoxicillin, ceftazidime, gentamycin, Penicillin G, piperacillin, polymyxin B, kanamycin and spectinomycin. This signifies an emergence of multidrug resistant strain which was not the case before.

 

Biochemical profiles of the isolate

API 20 Strep kit was used for the determination of HNM-1 biochemical profile, and compared the result with previously isolated strains of S. iniae (Table II), reactions were consistently positive or negative in all the samples analyzed, Aesculin hydrolysis, pyrrolidonylaryl-amidase, alkaline phosphatase, Arginine dihydrolase reactions, and leucine-arylamidase reactions were positive but negative for Hippurate, acetoin, α-galactosidase, β-glucuronidase, and β-galactosidase. The bacterium was also able to produce acid from ribose, mannose, Trehalose, and glycogen, but no change in pH when grown in the presence of Arabinose, Sorbitol, lactose, Inulin, and Raffinose.

Determination of S. iniae virulence genes

6 significant virulence genes assayed in this study were all present in HNM-1 genomic DNA. Blast analysis of all the genes showed 99% similarities with previously isolated virulent strains of S. iniae.

Scanning electron microscope of S. iniae

It was well established that biofilm can protect the bacterial community from the innate immune system and antibiotics action (Chao et al., 2015). Scanning electron microscope revealed the structure of S. iniae arranged in chains as well as in clusters of communities (Fig. 2), indicating its ability to produce biofilm, which could contribute to its virulence and ability to overcome A. sinensis defense mechanisms (Nikolaev and Plakunov, 2007). Making it the first time to confirm the ability of S. iniae to produce biofilm.

 

Table II. Comparison of S. iniae HNM-1 biochemical profile with that of other strains, the experiment was conducted using API 20 strep kit; the results were compared with that of previously isolated strains, indicated with alphabets A to E.

Test	HNM-1	A	B	C	D	E
Acetoin production	-	-	-	+	-	ND
Hippurate	-	-	-	-	-	-
Aesculin hydrolysis	+	-	+	+	+	+
Pyrrolidonylaryl-amidase	+	+	+	+	+	ND
a-galactosidase	-	+	-	+	+	ND
b-glucuronidase	+	+	+	+	+	ND
b-galactosidase	-	+	-	-	+	ND
Alkaline phosphatase	+	+	+	+	+	ND
Leucinearylamidase	+	+	+	+	+	ND
Arginine dihydrolase	+	+	+	+	+	ND
Ribose fermentation	+	+	+	+	+	ND
Arabinose fermentation	-	-	-	-	-	-
Mannitol fermentation	+	+	+	+	+	+
Sorbitol fermentation	-	-	-	-	-	-
Lactose fermentation	-	-	-	-	-	-
Trehalose fermentation	+	-	-	+	+	+
Inulin fermentation	-	-	-	-	-	-
Raffinose fermentation	-	-	-	-	-	-
Starch fermentation	+	+	+	+	+	+
Glycogen fermentation	+	+	+	+	+	ND
β Haemolysis	β	β	β	β	β	β

 

Notes: “+”: positive reaction; “-” : Negative reaction; ND: not determined; HNM-1:current study; A: Jantrakajorn et al., 2014; B: El Aamri, et al, 2010; C: Rahmatullah et al., 2017; D: Suanyuk et al., 2010; and E: Pier and Madin, 1976.

 

Reactive oxygen and whole fish blood survival assay

One important mechanism by which phagocytic cells eliminate pathogens is through the release of reactive oxygen species generated by nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (Liu et al., 2005). Assay result revealed that HNM-1 has an average survival rate of 77% and 58% after 2 hours incubation at 2mM and 4mM concentrations of H2O2, respectively (Fig. 3A).

 

Table III. Susceptibility of HNM-1to Antibiotics, 19 selected antibiotics were used in this study, the results were presented as susceptible or resistance according to Clinical and Laboratory Standards Institute (CLSI) guidelines.

Antibiotic Name	Paper content (µg/disc)	Zones of inhibition (mm)	Remarks	Standard inhibition zones diameter (mm)
Amoxicillin-clavulanic acid	20	16	R	S ≥ 18
Cefazolin	30	28	S	S ≥ 23
Cefotaxime	30	30	S	S ≥ 26
Cefoxitin	30	27	S	S ≥18
Ceftazidime	30	15	R	R ≤ 17
Gentamicin	10	13	R	S ≥ 15
Levofloxacin	5	24	S	S ≥ 17
Lomefloxacin	10	27	S	S ≥ 22
Norfloxacin	10	26	S	S ≥ 17
Ofloxacin	5	30	S	S ≥ 16
Oxacillin	1	21	S	S ≥ 20
Penicillin G	10	19	R	S ≥ 24
Piperacillin	100	18	R	S ≥ 21
Polymyxin B	300	10	R	R ≤ 11
Spectinomycin	100	11	R	R ≤ 14
Ticarcillin - clavulanic acid	75/10	41	S	S ≥ 20
Tobramycin	10	24	S	S ≥ 15
Vancomycin	30	20	I	S ≥ 17
Kanamycin	30	12	R	≥18

 

S, susceptible; R, resistant.

 

 

To determine the percentage of S. iniae HNM-1 that can survive the innate immune response of A. sinensis, we examined its survival in whole fish blood. Up to 85% of the bacteria escaped macrophage and other innate immune responses killings and showed only a 15% reduced survival rate compared with the control sample (P < 0.05) (Fig. 3B).

In vivo infection assay

Chinese Sturgeon infected with S. iniae HNM-1 strain manifested visible clinical signs, and symptoms, such as enlarged, pale liver, dark-colored kidney, and spleen, hemorrhage of internal organs, corneal opacity and accumulation of yellow fluid in the intestines, as well as erratic swimming and sluggishness, which were similar with the symptoms observed during field examination. S. iniae HNM-1 is highly lethal to Chinese Sturgeon at a concentration of 2.0 x 105, 2.0 x 106 and 2.0 x 107 CFU fish-1 which resulted in cumulative mortality of 40%, 80%, and 100% respectively (Fig. 4) and LD50 of 1.6 x 106 CFU, the control group maintained normal biological activities (with no deaths) during the experiment. S. iniae was re-isolated from the liver and spleen of the infected fish and confirmed its identity with 16S rRNA and Lox genes by PCR amplification to satisfied Koch’s postulate.

 

Histopathological examination

Histopathological analysis of the infected A. sinensis revealed bacterial colonization and inflammatory cells infiltration of vital organs; the principal lesions in the heart includes loose myocardial, interstitial edema, thickened pericardium, and many inflammatory cells infiltration (black arrow in Fig. 5A). In the liver; hepatocytes were characterized with severe steatosis, cytoplasm filled with some round vacuoles of different sizes (black arrow in Fig. 5B); increased inflammatory cells in the sinusoids, and inflammatory cells infiltration in the portal area (yellow arrow in Fig. 5B). The brain structure is disorganized, the tissue is swollen and loose, accompanied by a large amount of inflammatory cells infiltration (black arrow in Fig. 5C). While in the spleen the boundaries of red and white pulps were unclear as well as diffuse spleen, lymphocyte necrosis (black arrow in Fig. 5D), accompanied by a small number of red blood cells infiltration and inflammatory cells enlargement (red arrow in Fig. 5D).

 

DISCUSSION

Chinese sturgeon is an endangered fish species and essential delicacy in China. With the increasing susceptibility of sturgeon species to bacterial infections, it becomes mandatory to implement more measures and solutions to protect it from extinction. Streptococcus iniae remains one of the leading fish pathogens and responsible for causing morbidity and mortality of more than 30 fish species (Agnew and Barnes, 2007). In this study, we identified the etiological agent responsible for Chinese sturgeon (Acipenser sinensis) disease outbreak to be a strain of S. iniae ( HNM-1), which increased its host range and highlighted the alarming threat to the survival of the endangered fish species. characterization of S. iniae HNM-1 revealed: β- hemolytic, capsulated and gram-positive chained cocci, unable to grow at 10°C, 45°C and in 6.5% NaCl concentration, properties that differentiated it from Enterococcus and Lactococcus species (Schleifer and Kilpper-Bälz, 1987). Its ability to viably grow between 20°C to 35°C explained why its outbreaks are more prevalent during summer. Likewise, its capability to grow optimally in a medium with salt concentrations from 0% to 3.0% gave it an ability to be lethal to both freshwater and marine fish species (Kia and Mehrabi, 2013). Biochemical profiles of S. iniae HNM-1 differs with most of the previously reported strains, for instance, it exhibits great variations in ɑ-galactosidase, β-glucuronidase and trehalose reactions compared with the strains reported by (Rahmatullah et al., 2017; El Aamri et al., 2010; Jantrakajorn et al., 2014; Dodson et al., 1999), but comparable with the dolphin isolate which was the first isolated strain of S. iniae (Pier and Madin, 1976). Inconsistency in biochemical profiles is common among different strains of the bacteria, which can lead to frequent miss-identification of S. iniae using the biochemical method (Lau et al., 2003). We employed a molecular approach for its identification which successfully confirmed the responsible pathogen to be a strain of S. iniae. The phylogenic tree showed a clear geographical separation between groups, as well as genetic proximity, with Chinese and Israel isolates having more significant genetic similarities with S. iniae HNM-1 strain, which highlighted the probable relationship between them, as well as possible chain and source of transmission of the disease across China. Two possible ways of its spread could be due to the fact that not all the infected fish show apparent signs of the disease but can serve as a reservoir for future infection when used in fish feed as a source of protein (Zlotkin et al., 1998) or as a result of contamination of ponds by heavy rains or other forms of contaminants that may contains infectious bacteria (Creeper and Buller, 2006).

Antimicrobial susceptibility profile can help in effective chemotherapy to reduce mortality as well as avoid development of selective antibiotic resistance of, especially Zoonotic bacteria. S. iniae HNM-1 was found to be resistant to many important antibiotics that include Amoxicillin, gentamycin, Penicillin G and spectinomycin. This signifies an emergence of multidrug resistance strain unlike previously reported strains that were susceptible to most of the antibiotics (Rahmatullah et al., 2017; El Aamri et al., 2010; Kayansamruaj et al., 2017). The cumulative mortalities and LD50 of HNM-1 strain in A. sinensis indicated the high vulnerability of A. sinensis to its infection.

The prominent symptoms manifested by both naturally and experimentally infected A. sinensis were of common streptococcal infection, the differences in clinical presentations between our results and previous studies could be attributed to age, genetic differences of fish species, virulence of the isolate and experimental conditions (Agnew and Barnes, 2007). We also determined its capability to produce biofilm which might contribute to its virulence. Scanning electron microscopy confirmed its ability to live in communities which can enable them to make biofilm as well as quorum sensing that are key to virulence and antibiotics resistance.

Histopathological examination revealed pathological lesions, a large number of bacteria in clusters, and massive infiltration of multi-systematic necrotizing inflammatory cells in the organs of the infected fish. These findings were consistent with the histological changes associated with streptococcosis (Ortega et al., 2018; Kayansamruaj et al., 2017; Deng et al., 2017).

Although the presence of virulence genes only may not necessarily correspond to expression of their virulent factors, but yet this result can serve as a fingerprint and subject for subsequent studies, such as allelic exchange mutagenesis, to fully understand their roles in the pathogenesis of the bacteria, which was limited in this study but part of our ongoing projects. In vitro reactive oxygen species killing assay for 2 h shows that 77% of the bacteria can survived in 2mM hydrogen peroxide, unlike non virulent strain of S. iniae which has 10 fold increased in susceptibility to hydrogen peroxide (Buchanan et al., 2008), in addition, the bacteria also survived whole blood killing (85%), which indicated resistance to oxidative killings of macrophages is a significant contributor for S. iniae survival.

 

CONCLUSION

In this study we reported the first S. iniae infection of Chinese sturgeon (A. sinensis ), which increased the number of its host ranges and highlighted its increasing threat to the aquaculture industries. We also isolated and characterized the etiological agent. Furthermore S. iniae HNM-1 is resistant to most of the important antibiotics which is an alarming threat to the aquaculture industries and highlighted emergence of multidrug resisstant strain. The bacteria caused morbidity and mortality of Chinese sturgeon due to its ability to survived in blood, under oxidative stress, disseminated to various organs and caused fatal lesions. Furthermore, we determined S. iniae biofilm formation, effective chemotherapeutic treatments, as well as suggested preventive measures, such as an efficient vaccine, improvement of water quality, adequate quarantine, and low stock density as the best options for circumventing future disease outbreaks.

 

ACKNOWLEDGMENT

This work was supported by the Natural Science Foundation of Hebei Province (C2019205044); the Outstanding Youth Foundation of Department of Education of Hebei Province (YQ2014026); the Research Fund of Hebei Normal University (L2016Z03); the State Key Laboratory of Pathogen and Biosecurity (Academy of Military Medical Science) (SKLPBS1529); and the Science and technology research project of Hebei Normal University (ZD2018070).

 

Statement of conflict of interest

The authors declare no conflict of interest.

 

REFERENCES

Agnew, W. and Barnes, A.C., 2007. Streptococcus iniae: An aquatic pathogen of global veterinary significance and a challenging candidate for reliable vaccination. Vet. Microbiol., 122: 1–15. https://doi.org/10.1016/j.vetmic.2007.03.002

Buchanan, J.T., Colvin, K.M., Vicknair, M.R., Patel, S.K., Timmer, A.M. and Nizet, V., 2008. Strain-associated virulence factors of Streptococcus iniae in hybrid-striped bass. Vet. Microbiol., 131: 145–153. https://doi.org/10.1016/j.vetmic.2008.02.027

Chao, Y., Marks, L.R., Pettigrew, M.M. and Hakansson, A.P., 2015. Streptococcus pneumoniae biofilm formation and dispersion during colonization and disease. Front. Cell. Infect. Microbiol., 4: 1–16. https://doi.org/10.3389/fcimb.2014.00194

Creeper, J.H. and Buller, N.B., 2006. An outbreak of Streptococcus iniae in barramundi (Lates calcarifera) in freshwater cage culture. Aust. Vet. J., 84: 408–411. https://doi.org/10.1111/j.1751-0813.2006.00058.x

Deng, M.L., Yu, Z.H., Geng, Y., Wang, K.Y., Chen, D.F., Huang, X.L., Ou, Y.P., Chen, Z.L., Zhong, Z.J. and Lai, W.M., 2017. Outbreaks of streptococcosis associated with Streptococcus iniae in Siberian sturgeon (Acipenser baerii) in China. Aquacult. Res., 48: 909–919. https://doi.org/10.1111/are.12934

Di, J., Zhang, S., Huang, J., Du, H., Zhou, Y., Zhou, Q. and Wei, Q., 2018. Isolation and identification of pathogens causing haemorrhagic septicaemia in cultured Chinese sturgeon (Acipenser sinensis). Aquacult. Res., 49: 3624–3633. https://doi.org/10.1111/are.13830

Dodson, S.V., Maurer, J.J. and Shotts, E.B., 1999. Biochemical and molecular typing of Streptococcus iniae isolated from fish and human cases. J. Fish Dis., 22: 331–336. https://doi.org/10.1046/j.1365-2761.1999.00170.x

El Aamri, F., Padilla, D., Acosta, F., Caballero, M.J., Roo, J., Bravo, J. and Vivas, F.R., 2010. First report of Streptococcus iniae in red porgy (Pagrus pagrus L.). J. Fish Dis., 33: 901–905. https://doi.org/10.1111/j.1365-2761.2010.01191.x

Jantrakajorn, S., Maisak, H. and Wongtavatchai, J., 2014. Comprehensive investigation of Streptococcosis outbreaks in cultured Nile Tilapia, Oreochromis niloticus, and red Tilapia, Oreochromis sp., of Thailand. J. World Aquacult. Soc., 45: 392–402. https://doi.org/10.1111/jwas.12131

Jensen, S., Bergh, Ø., Enger, Ø. and Hjeltnes, B., 2002. Use of PCR-RFLP for genotyping 16S rRNA and characterizing bacteria cultured from halibut fry. Can. J. Microbiol., 48: 379–386. https://doi.org/10.1139/w02-033

Kayansamruaj, P., Dong, H.T., Nguyen, V.V., Le, H.D., Pirarat, N. and Rodkhum, C., 2017. Susceptibility of freshwater rearing Asian seabass (Lates calcarifer) to pathogenic Streptococcus iniae. Aquacult. Res., 48: 711–718. https://doi.org/10.1111/are.12917

Kia, E.R. and Mehrabi, Y., 2013. Detection and identification of different Streptococcosis strains in farmed rainbow trout in Boyerahmad and Dena Regions ( North South of Iran ). World J. Fish Mar. Sci., 5: 315–321. https://doi.org/10.5829/idosi.wjfms.2013.05.03.72123

Lau, S.K.P., Woo, P.C.Y., Tse, H., Wong, S.S.Y., Yuen, K.-Y. and Leung, K.-W., 2003. Invasive Streptococcus iniae infections outside North America. J. clin. Microbiol., 41: 1004–1009. https://doi.org/10.1128/JCM.41.3.1004

Liu, D., Zhang, L., Xue, W., Wang, Y., Ju, J. and Zhao, B., 2015. Knockout of the alanine racemase gene in Aeromonas hydrophila HBNUAh01 results in cell wall damage and enhanced membrane permeability. FEMS Microbiol. Lett., 362: 1–8. https://doi.org/10.1093/femsle/fnv089

Liu, G.Y., Essex, A., Buchanan, J.T., Datta, V., Hoffman, H.M., Bastian, J.F., Fierer, J. and Nizet, V., 2005. Staphylococcus aureus golden pigment impairs neutrophil killing and promotes virulence through its antioxidant activity. J. exp. Med., 202: 209–215. https://doi.org/10.1084/jem.20050846

Mata, A.I., Blanco, M.M., Domínguez, L., Fernández-Garayzábal, J.F. and Gibello, A., 2004. Development of a PCR assay for Streptococcus iniae based on the lactate oxidase (lctO) gene with potential diagnostic value. Vet. Microbiol., 101: 109–116. https://doi.org/10.1016/j.vetmic.2004.03.012

Nikolaev, Y.A. and Plakunov, V.K., 2007. Biofilm—“City of microbes” or an analogue of multicellular organisms? Microbiology, 76: 125–138. https://doi.org/10.1134/S0026261707020014

Ortega, C., García, I., Irgang, R., Fajardo, R., Tapia-Cammas, D., Acosta, J. and Avendaño-Herrera, R., 2018. First identification and characterization of Streptococcus iniae obtained from tilapia (Oreochromis aureus) farmed in Mexico. J. Fish Dis., 4: 1–10. https://doi.org/10.1111/jfd.12775

Pier, G.B. and Madin, S.H., 1976. Streptococcus iniae sp. nov., a Beta-Hemolytic Streptococcus Isolated from an Amazon Freshwater Dolphin, Inia geoffrensis. Int. J. Syst. Bact., 26: 545–553. https://doi.org/doi: 10.1099/00207713-26-4-545

Rahmatullah, M., Ariff, M., Kahieshesfandiari, M., Daud, H.M., Zamri-Saad, M., Sabri, M.Y., Amal, M.N.A. and Ina-Salwany, M.Y., 2017. Isolation and pathogenicity of Streptococcus iniae in cultured red hybrid tilapia ( Oreochromis sp.) in Malaysia. J. aquat. Anim. Hlth., 29: 208–213. https://doi.org/10.1080/08997659.2017.1360411

Schleifer, K.H. and Kilpper-Bälz, R., 1987. Molecular and Chemotaxonomic approaches to the classification of streptococci, enterococci and lactococci: A review. Syst. appl. Microbiol., 10: 1–19. https://doi.org/10.1016/S0723-2020(87)80002-4

Weinstein, M.R., Litt, M., Kertesz, D.A., Wyper, P., Rose, D., Coulter, M., McGeer, A., Facklam, R., Ostach, C., Willey, B.M., Borczyk, A. and Low, D.E., 1997. Invasive infections due to a fish pathogen, Streptococcus iniae. N. Engl. J. Med., 337: 589–594. https://doi.org/10.1056/NEJM199708283370902

Yang, W. and Li, A., 2009. Isolation and characterization of Streptococcus dysgalactiae from diseased Acipenser schrenckii. Aquaculture, 294: 14–17. https://doi.org/10.1016/j.aquaculture.2009.05.018

Zhang, H., Wei, Q.W., Li, C., Wu, X.S. and Liao, W.G., 2012. Effects of annual flow characteristics on the freshwater life history of Chinese sturgeon: concern inferred from the number of seaward migrating juveniles. Int. aquat. Res., 4: 1–13. https://doi.org/10.1186/2008-6970-4-8

Zlotkin, A., Hershko, H. and Eldar, A., 1998. Possible transmission of Streptococcus iniae from wild fish to cultured marine fish. Appl. environ. Microbiol., 64: 4065–4067.