Submit or Track your Manuscript LOG-IN

Muhammad Shah Zaman1, Ghulam Muhammad Ali2, Aish Muhammad1, Khalid Farooq2, Iqbal Hussain1*

...aCl supplemented with MS medium. Kroda emerged as the most salt tolerant variety with the highest plant height (6.5 cm), number of nodes (8.8), fresh shoot weight plant-1 (0.166 g), number of roots (4.6) and root length (2.5 cm) at 60 mM NaCl followed by Sh-5. Desiree and Cardinal were moderately tolerant varieties to NaCl stress. The most sensitive variety Asterix produced minimum plant height (2.7 cm), number of nodes (2.4), number of roots (2.6), root leng...

Ummara Waheed Khan, Raza Ahmed, Irum Shahzadi and Mohmmad Maroof Shah

Email | [email protected]

...ant tissue, culture medium, plant genotypes, and their interactions, the detail of which is not fully explored. Current article described this issue in detail. The information synthesized would be important to select and manipulate appropriate factor(s) for successful wheat tissue culture and regeneration that in turn
would help its improvement.

...

 Shahab e Saqib, Mokbul Morshed Ahmad, Sanaullah Panezai, Hidayatullah, Khalid Khan Khattak

...rmal sources compared to medium and large farmers, whereas they had more access to informal sources. Similarly, small farmers have more credit inadequacy compared to medium and large farmers, and most of their credit gap was filled by informal sources. Probit model results showed that experience, education, landholding size and total income had positive relationship with access to credit whereas, age and farmers’ group...

Ghani Akbar, Muhammad Munir Ahmad, Muhammad Asif, Iqbal Hassan, Qurban Hussain3 and Greg Hamilton

Muhammad Sohail1,*, Muhammad Naeem Khan1, Naureen Aziz Qureshi2 and Abdul Shakoor Chaudhry3

... low (120 µg L-1), medium (240 µg L-1) and high (360 µg L-1) levels of lead (Pb), chromium (Cr) and copper (Cu) alone and in combinations (Pb + Cr + Cu) for 15 days under laboratory conditions. Gill cells of mussels were used to determine the DNA damage by comet assay. The tail DNA (%), comet tail length and olive tail moment (OTM) were the parameters selected to detect DNA damage. Low doses (120 µg L-1) of each metal induced significan...

Muhammad Shafiq and Tahir Maqsood

...ield trial was done on a medium textured soil to notice the return of wheat crop to model based applied fertilizer B. For this idea, B adsorption isotherm of the soil was developed at the Institute of Soil and Environmental Sciences, University of Agriculture, Faisalabad, during 2013-14. Adsorption procedure was done by harmonizing 2.5g soil in 0.01M CaCl2 solution having diverse B doses (0, 0.01, 0.03 , 0.05 , 0.07, 0.09, 0.11, 0.13,0.15 and 0.17 mg B L-1). F...

Naushad Khan1*, Shahnaz Akhtar1, Munir Khan1, Shaista Naz2, Javeria Tanveer1 and Muhammad Kaleem3

...ale farmers who obtained medium term credit followed by short term credit type. Thus, higher amount of credit was disbursed under the category of medium term followed by short term. The average yield, cost and return for the maize crop showed significant results due to the proper utilization of the credit by the farmers. The major constraints to farmers while obtaining credit were complicated procedure of pass book preparati...

Sana Irshad Khan1*, Zafar Iqbal2, Hamid Ullah Shah2 and Shaukat Hussain3

...e (EtOAc) extract of PDB medium gave significant results against selected phytopathogens compared to GNB medium and selected for further study. Crude (1 µg.mL-1 ) obtained from PDB medium showed 2.50 ± 0.64 mm and 1.97 ± 0.21 mm inhibition zone against X. campestris and C. michiganensis respectively compared to positive reference (streptomycin) and negative refrence (Et...

Muhammad Afzal1 and Murad Khan2*

...three groups i.e. small, medium and large. For analysing the data, descriptive statistics and gross margin were used. The average total cost of small poultry farm was Rs. 3,10,067 per flock while that of medium and large farms were Rs. 4,99,002 and Rs.7,34,290 respectively. The highest cost was estimated for feed followed by chicks cost. The average gross margin of small farms was Rs. 38,556 while that of
Sidra Ilyas1, Abdul Rehman1* and Qasim Ilyas2
...r) and 87% (Pb) from the medium after 8 days of incubation. This multi-resistant yeast can be used efficiently for the removal of toxic metals from the wastewater.
...

B. Ramanujam, R. D. Prasad, S. Sriram and R. Rangeswaran

Mass production, formulation, quality control and delivery of Trichoderma for plant disease management
... like molasses and yeast medium in deep tanks on a commercial scale. Biomass from the liquid fermentation can be made into different formulations like, dusts, granules, pellets, wettable powders. Trichoderma formulations can be applied to the seed either by dry seed treatment or by seed biopriming for control of several soil-borne diseases of some field crops. Similarly, seedlings of horticultural crops and rice are treated by dipping the roots in Trichoderma ...

1S. A. Khan and 2S. Jha

Effect of dates of sowing, moisture regimes, varieties and weather factors on incidences of aphid, Lipaphis erysimi (Kalt.) in rape and mustard
...ls developed, along with medium range weather forecasts of 5 days available from India Meteorological Department (IMD), could be useful to forewarn aphid 2 days in advance for farmers. To escape critical aphid incidence, rape and mustard crops need to be sown by 15 October, because crops sown beyond this period are likely to be adversely affected by aphid. Keywords : Aphid, sowing date, moisture regime, weather parameters, correlation, regression

&nb...

A. K. Chaubey and Satyandra Kumar

Bio-management of root knot nematode and root rot disease by antagonistic fungi and rhizobacteria
...otein supplemented broth medium and culture filtrates (CF) were prepared. In in-vitro test single eggmasses of uniform size were kept in 5ml CF in 5cm diameter Petri plates. Antifungal activity was tested by dual culture of wilt fungus with antagonist fungus and bacteria isolates in PDA media plates. In in-vivo test soil was amended with antagonist and wilt fungal and bacterial isolates 2 x 106 CFU/ml and 2 x 108 CFU/ml respectively as talc formulation @ 0.2% ...

M.S. Islam, M.Ali, and I. Ahmad

Efficacy of sedomil 72WP and recozeb 80WP to control die-back (Colletotrichum gloeosporioides) of tea in Bangladesh
...nfected tea twigs on PDA medium. Mycelial blocks of the isolated pathogen were transferred to PDA plates amended with sedomil 72WP (mancozeb) @ 720, 1080, 1440 and 1800 ppm and recozeb 80WP (mancozeb + metalaxyl) @ 800, 1200, 1600 and 2000 ppm concentrations. Sedomil 72WP and recozeb 80WP caused colony growth inhibition, respectively by 75.00-90.77% and 75.88-91.33% in 2008 and 74.66-90.55% and 75.66-91.11% in 2009. In a field experiment at the main farm of Ba...

Dharmishthabahen R. Shah and Abhishek Shukla

Reaction of gerbera cultivars to spider mite, Tetranychus urti-cae Koch (Tetranychidae: Acari) under polyhouse conditions
...(15.56 mites/plant) were medium tol-erant under polyhouse conditions. On the basis of biomorphological characters cultivar stanza has maximum mite population having green coloured leaves and red coloured flowers, while the highly tolerant cultivar Cherany with dark green leaves and pink coloured flower.

...

Partha Pratim Ghosh and 2N. C. Mandal 

Some disease management practices for bacterial wilt of potato
...62) loamy sand soil with medium fertility status in a Randomised Block Design with three replicates and seven treatment modules, as described in Materials & Methods. Investigation revealed that T1 (TPS whole tuber planting) and T4 (supervised management - cowdung @ 40 ha-1 at land preparation + seed piece tuber treatment with carbendazim 2.5 gL-1 and Streptocycline @ 1 gL-1 + stable bleaching powder drenching with out removal of affected plant at 40 Days A...

Manidipa Chowdhury 

Incidence of saw fly, Athalia lugens proxima Klug. as influenced by level of irrigation and fertilizers on mustard
...n without irrigation and medium level of fertilizers (60:30:30 Kg NPK ha-1) while lowest population level (0.10 larvae/plant) was observed at highest level of irrigation (three) coupled with medium level of fertilizers (60:30:30 kg NPK ha-1) and two irrigations coupled with lowest level of fertilizers (40:20:20 Kg NPK ha-1).
 

 

...
Rauf Ahmad1, Karam Ahad2 and Aziz Ullah Shah3
...ent samples were long or medium size but slender shape and coarse type as well. Whereas, 21% sample were short or medium size only. Regarding cooking quality, 60% samples were excellent or good and 30% were OK (poor quality). The cooking quality of 10% sample was very poor. Overall 50% candidate varieties were excellent or good and 16% were OK whereas only 23% were below standard limit. In fine category, milling quality of o...

Jawad Anwar* and Zafar Iqbal 

...wth nutrient broth (GNB) medium as compared to other culture media (Potato dextrose broth and yeast extract broth). Similarly maximum zone of inhibition was observed in optimized parameters like shaking flask culture, 25 °C temperature, media of pH 5 and light fermentation.The EtOAc extract exhibited the minimal value of MIC (10.41±4.50 µg/mL) against gram negative E. coli, while its acetonitrile fraction yielded (6.50±2.25 µg/mL)...

Qudsia Khalid, Safdar Hussain Shah*, Faiza Zaeem and Saad Hussain Shah 

... line was obtained on MS medium supplemented with 2,4-D (2 mg/l) and kinetin (0.25 mg/l). For regeneration MS medium with 1.0mg/l NAA and BAP + 30g/l D-Sorbitol was used. LiCl adapted line showed significantly higher indices of tolerance than unadapted line at 100, 150, 200 and 250 mM NaCl stress. Adaptation resulted in enhanced accumulation of saturated fatty acids (myristic and stearic acids), while unsaturated fatty acids...

Zaheer Abbas*, Shaukat Ali, Jalal-Ud-Din and Ghulam M. Ali

...steine in co-cultivation medium, heat shock to immature embryos prior to infection, resting stage and Agrobacterium strains that deliver T-DNA into plant cell from which whole plant can be regenerated. The results indicated that optimal embryo physiological age is 15 and 18 days after pollination and transient transformation efficiency decreased at 22 days after pollination. Enhanced transient beta glucuronidase (GUS) expression with average frequency of 40.56...

Zaheer Abbas*, Shaukat Ali, Jalal-Ud-Din and Ghulam M. Ali* 

...nsformation of maize. MS medium fortified with 3 mgL-1 BAP and 5 mgL-1 picloram produced maize seedlings with expanded coleoptilar nodes. Longitudinal cut sections of expanded coleoptilar nodes produced maximum primary calli on callus induction medium containing both 0.5mgL-1 2, 4-D and 1 mgL-1 picloram. Eighty percent of embryogenic calli were obtained on MS medium containing only single ...
Nosheen Rafiq1, Asmatullah Kakar2,*, Arshad Ghani3, Asim Iqbal2, Wali Mohammad Achakzai2, Shagufta Sadozai2, Mohammad Shafiq4 and Mohammad Alam Mengal5 
...s of tick infestation in medium body condition (92.9%), poor body condition (57.44%), and good body condition (87.39%) was observed to be significant at P-value (P < 0.01)  among the three body. Analysis of sex wise tick counting with age of animals revealed positive and significant correlation (P = 0.1145, P < 0.05). The ratio of tick infestation was observed to be insignificant (P < 0.01) among the breeds, with most elevated prepotency in local...
Qunhua Han1,2, Meiwen Zhang1,*, Cong Guo2, Xunjun Zhou1, Bo Li1 and Yong Wang1
..., low density), 3-5 (MD, medium density), and 6-9 (HD, high density) individuals, and the body weight, body length, tail length, and hind foot length were measured and curve-fitted by using Von Bertalanffy and Logistic equations. Instantaneous growth rates and growth acceleration of Yangtze voleat different densities were calculated. Results showed that at different stages, the growth of the pups was density-dependent, while during the adult age, was independe...

 Bushra Mazhar1, Nusrat Jahan1, Nazish Mazhar Ali1, Saiqa andleeb2, Shaukat Ali2*

...nd suitable fermentation medium, E. hormaechei can be used at an industrial level as producer of vanillin. Bioconversion of waste residues of rice bran oil to vanillin by bacterial strains is of greater interest nowadays. Bioproduction of vanillin is not only considered natural but also safe for human health.

...

Farah Rauf Shakoori, Momina Shokat, Faiza Saleem and Tanzeela Riaz

...xylanase was produced in medium M1 containing xylan after 48 hours of incubation. Maximum amount of enzyme was produced by XPB-GS02 at 45ᵒC, pH 9 using 1% xylan concentration, while XPB-CW01 produced maximum amount of xylanase at 50ᵒC, pH 7 with 1.5% xylan concentration. Maximum xylanase activity was achieved at temperature 50ᵒC, pH9 with 2% xylan concentration. Xylanase produced by XPB-GS02 was active from 35-80oC, while XPB-CW01 was active ...

Ronaq Zaman*, Shahid Ali and Inam Ullah 

...was estimated for small, medium and large farms, respectively. The mean calculated technical efficiencies for small, medium and large farms were respectively 0.76, 0.96 and 0.92. This implies that the medium size farms in the study area were the most efficient in resource utilization as compared to small and large size farms whereas the small size farms were the most inefficient in resourc...
Sumaira Zareen1, Syeda Sadaf Zahra2, Ayeza Mehmood3, Muhammad Asadullah4* and Aish Muhammad5

 

...Murashige and Skoog (MS) medium supplemented with different concentrations and combinations of benzyl amino purine (BAP) or kinetin for shoot induction and Indole acetic acid (IAA) for primary shoot and Indole Butyric acid (IBA) for root proliferation. Best shoot proliferation (4.48 per explant) was observed in MS medium containing 0.2/0.4 mg/L BAP/IAA combination. For rooting of the micro shoots, MS

 S.A. Khan*, M.M. Rahman Jamro** and M.Y Arain***

...1.33% and 28.33%, 32.33% medium size tubers (35-55 mm size). Whereas wider spacing (70cm x 20cm, 50cm x 20cm) produced relatively higher number of large size tubers.

...

 Mazher Abbas*, Muhammad Waqas Akram**, Ikram Saeed*** and Arshed Bashir*

... comparatively higher at medium farms as compared to small and large farms. The results of the study showed higher yield of canola at large farms as compared to medium and small farms. Average gross revenue by small, medium and large farmers was Rs. 35913.10, Rs. 39635.54 and Rs. 39868.80 acre-1 respectively. Average of net income by small, medium and la...

Arshed Bashir *, Shamsheer-Ul-Haq**, Mazher Abbas*, M. Aamir Munir** and Aneela Afzal***

Corresponding author:[email protected]

IMPACT OF SUGARCANE MILLS DEVELOPMENT ACTIVITIES ON CANE PRODUCTION IN PUNJAB
.... Inclusion of small and medium farmers in the sugar mills development activities is recommended to meet the sugar consumption requirements of the country by domestic production and ultimately reduction in sugar import.

...

 Mazher Abbas*, Tahir Mehmood**, Arshed Bashir*, Muneeb Zafar*** and Aneela Afzal****

ECONOMICS OF LALLEMANTIA ROYLEANA (TUKHAM-EBALANGOO) PRODUCTION IN THE LOW INTENSITY CROPPING ZONE OF THE PUNJAB, PAKISTAN
...all farms as compared to medium and large farms. The study showed higher yield of L. royleana at large farms as compared to medium and small farms. Average gross revenue by small, medium and large -1 farmers was Rs. 44175, Rs. 52483.02 and Rs. 55247.73 acre respectively. Average net income by small, medium and large farmers was Rs. 25281.02, Rs. 28734.98...

 Ashiq Saleem, Muhammad Ashraf Zahid, Habib Iqbal Javed*, M Ansar**, Asghar Ali, Rashid Saleem* and Noor Saleem***

EFFECT OF SEEDING RATE ON LENTIL (LENS CULINARIS MEDIK) SEED YIELD UNDER RAINFED CONDITIONS
...wing season. An improved medium-grain size (1000-grain weight. around 25 g) variety Masoor 93 (18-12 x ILLP 4400) was used in these experiments. Eleven seeding rates i.e., 14.0, 21.25, 28.50, 35.75, 43.0, -1 50.25, 57.50, 64.75, 72.0, 79.25 and 86.50 kgha were evaluated in the study. Results of the three-year study showed that grain yield kept on -1 increasing up to a seed rate of 43 kgha and remained static thereafter with a non-significant difference for any...

 Shafique Qadir Memon*, Muhamamd Safar Mirjat, Abdul Quadir Mughal** Nadeem Amjad***, Muhammad Azhar Saeed, Shabbir Kalwar, Asif Ali Mirani and Habib Iqbal Javed****

TILLAGE AND NPK EFFECT ON GROWTH AND YIELD OF SPRING MAIZE IN ISLAMABAD, PAKISTAN
...urce farmers can use the medium level of NPK @ -1 150-75-75 kg ha for getting an economical and successful maize crop.

...

 Naheed Zahra*, Muhammad Zubair Anwar*, Sonila Hassan** and Irfan Mehmood**

INSTITUTIONAL CREDIT ARRANGEMENT AND THEIR IMPLICATION ON AGRICULTURAL INCOME IN THE SELECTED VILLAGES OF RAWALPINDI DISTRICT
...he interest of small and medium farmers by providing them loans on easy terms and to facilitate them against any natural hazards and disaster.

...

 Muhammad Qasim*, Khuda Bakhsh**, Sultan Ali Tariq*, Mahmood Nasir***, Rashed Saeed**** and Muhammad Ather Mahmood****

FACTORS AFFECTING GROUNDNUT YIELD IN POTHWAR REGION OF PUNJAB, PAKISTAN
...e classified into small, medium and large farms. Farm-level crop data were gathered during two cropping seasons i.e., rabi 2008-09 and kharif 2009. One hundred and forty groundnut producers were selected for collecting data using the well-structured questionnaire from two important districts recognised for area and production of groundnut. Results showed that large farmers allocated significantly higher area (34%) to groundnut cultivation compared to other cat...

 Abdul Rehman Khan*, Muhammad Mahmood–Ul-Hassan**, Rizwan Ahmad** and Anjum Munir ***

ARSENIC III TOLERANCE POTENTIAL OF FUNGI ISOLATED FROM POLLUTED AND NON-POLLUTED SOILS OF PAKISTAN
...tato Dextrose Agar (PDA) medium amended with different concentrations of As (50 to 5600 mg/L). The fungal tolerance was evaluated by comparing tolerance index (TI), minimum inhibitory concentrations (MIC) and growth rate. Out of 18 isolates, 12 belonged to genus , 3 to , 2 to and one to . The isolates and appeared to be most tolerant to arsenic. Fungal strains isolated from Gujranwala soil exhibited more As(III) tolerance than those from Multan and Islamabad. ...

Mohammad Nazeer* and Safdar Hussain Shah 

...ere mostly straight with medium length in Damani and Surguli, and long in Kaghani and Gaddi breed. Body size manifested by weight, length and other body measurements, was highest in Gaddi, followed by Kaghani and then Surguli. The body size of Damani was the smallest compared to the other breeds; however, statistically it was similar to Surguli. Kaghani is the highest ranking along with similarities to Gaddi breed and also recommended for management to achieve...
Zheng Quan Jiang1,2, Feng Shan Li3, Jiang Hong Ran1,*, Chen Hao Zhao1, Man Zhang1 and Hua Li4
...he smallest in June with medium size in May, implying that nest size tended to decrease with time over a year.
...
Yanxiao Meng1, Guihua Wang1, Dongmei Xiong1,*, Haixia Liu1, Xiaolin Liu1, Lixin Wang1 and Jianlu Zhang2
...ow head, sharp snout and medium diameter of eye; B. tumensis had short head, blunt snout and shortest eye diameter and narrow dorsoventral orientation. Furthermore, discriminant function analysis (DFA) showed that all samples (except six) were correctly reclassified. Our morphological analysis supported the validity of taxonomic status of B. lenok and B. tumensis as two species, and B. lenok tsinlingensis could be considered as an i...
Filiz Kutluyer* 
...an be used in activation medium for O. mykiss, S. rizeensis and S. coruhensis.
...

Muhammad Jamal Khan1, Abdul Malik2*, Muhammad Shahzad Khattak2, Naveedullah1, Naeem Ijaz3 and Ishaq Ahmad4 

...n C2-S1 class indicating medium salinity having low Sodium concentration and may be suitable to salt tolerant crop. Regular assessment of water resource and constant monitoring of water quality is recommended. An appropriate measure may be adopted for recharge of the ground water aquifer through development of small dams in the catchments plain. 

...
Abid Hussain1,*, Mansur-ud-Din Ahmad2, Muhammad Hussan Mushtaq2, Mamoona Chaudhry2, Muhammad Sarwar Khan2, Michael Reichel3, Tanveer Hussain4, Amjad Khan2, MuhammadNisar2 and Imtiaz Ahmad Khan5
...81/534 (52.6%) in small, medium and large herds, respectively. Mastitis has greater economic losses in the dairy industry and it can be minimized by improving management and milking practices. It is concluded from the present study that mastitis increases when herd size increase. It order to control the mastitis, it is mandatory to screen the mastitis cases at quarter and herd size level.
...
Muhammad Tariq Zahid1, Farah Rauf Shakoori2, Soumble Zulfiqar3, Khalid A. Al-Ghanim4 and Abdul Rauf Shakoori3,4*
...icro;g/ml in wheat grain medium, Bold-basal salt medium and modified Neff’s medium, respectively. T. farahensis exhibited significant copper storage ability removing 54.9 % copper from medium within 96 h of 30 µg/ml copper stress. The maximum uptake rate was observed within 30 min of copper administration in response to 5-100 µg ...
Mousa O. Germoush1,*, Mohsen G. Al-Mutary2, Ahmad R. Al-himaidi3, Muath G. Al-Ghadi3, Daisaku Iwamoto3,4, Yousef Al-anazi3, Aiman Ammari3, Javed Ahmad3,5, Abdulaziz Al-Khedhairy3,5
...oups. In conclusion, IVM medium supplemented with 10% SFF showed the best rate of blastocyst development.
...

Murad Khan1* and Muhammad Afzal2 

...three groups i.e. small, medium and large. For analysing the data, profit function and multiple regression model, analysis of variance (ANOVA) and independent t test were used. The average profit of large size farm was Rs. 85228 followed by medium and small farm that were Rs. 58049 and Rs. 36090 respectively. The results of independent sample t-test indicated that there is no significant difference between the profit of the ...

Abdur Rehman1*, Wang Jian2, Noor Khan3 and Raheel Saqib

...arse grain rice with the medium risk level and finally the corn and wheat with lower levels of market risk. According to the results, the crops having similar characteristics belong to the same level of market risk. Therefore it is essential to accomplish the market risk management system to monitor the risk of major crops by introducing various kinds of products. This ensures the competency, accuracy and decreases significantly the cost of market risk managem...
Muhammad Kashif Munir1*, Sana Rehman1, Rizwan Iqbal1, Muhammad Saqib Saeed2, Muhammad Aasim1
... using Lowenstein Jensen medium as well as GeneXpert MTB/RIF assay.
Results: A total of 125 subjects were registered in present study including 64 (51.2%) males and 61 (48.8%) females of age 15 years and above with mean age of 36.9±14.99. Sensitivity and specificity of the assay was observed as 92.1% and 93.5%, respectively. Association of rifampicin resistant by MTB/RIF assay and isoniazid resistance was found to be 88.1% and an agre...
Hanif Ur Rahman1, Umer Saddique1, Zahoor-ul-Hassan1, Shakoor Ahmad1, Muhammad Kamal Shah1, Said Sajjad Ali Shah1, Farhan Anwar Khan1Fazli Rabbani2, Muhammad Asif Hussain2, Attaur-Rahman2, Irshad Ahmad3,4 and Sadeeq ur Rahman2,*
...nia like organism (PPLO) medium for isolation and identification of Mycoplasma species. Confirmed mycoplasma isolates were subjected to species specific PCR to identify members of MM cluster. Results revealed that 79/300 (26.3%) samples were found positive for the growth of Mycoplasma. MM cluster specific PCR showed 49 (16.3%) samples were found positive, of which 34 (11.3%) were found positive for Mycoplasma mycoides subsp. capr...
Zainab Saeed, Abdul Majid Khan*, Ayesha Iqbal, Muhammad Amin
...ered dental remains of a medium sized gazelle from the Dhok Pathan Formation in northern Pakistan, are described in this paper. The specimens comprise mandibular fragment and isolated teeth. The specimens are on the basis of rigorous comparison ascribed to Gazella lydekkeri, a late Miocene antelope. The Dhok Pathan Formation is late Miocene to early Pliocene in age.
...
Mutassim M. Abdelrahman1,*, Ibrahim A. Alhidary1, Gamaleldin M. Suliman1,2, Abdullah H. Alyemni3, Mohamed Y. Al-Saiady3, Faisal A. Alshamiry1,Mohsen M. Alobre1 and Riyadh S. Aljumaah1
...evel); TMR2 (30.88% NDF; medium level-recommended); TMR3 (55.93% NDF; high level). A significantly higher (P<0.05) average daily gain and lower value for the feed conversion ratio of lambs fed TMR2 compared with other dietary groups. There were no significant differences (P>0.05) between lambs fed TMRs with different levels of NDF for slaughter and body components parameters, except empty stomach (TMR2) and chill shrink (TMR1). Furthermore, the meat colo...
Li Lv1, Liuan Li1,*, Ruibo Zhang1, Zhichao Deng1, Tianming Jin1 and Gaimei Du2
...-dose group), 0.6 mg/kg (medium-dose group) and 1.2 mg/kg (high-dose group). Each experimental group had four cohorts and each cohort had 10 hens. Experimental diets were fed for 28 d and daily egg production was recorded. Eggs were collected every seven days for determination of egg white, egg yolk and total egg selenium using hydride generation-atomic fluorescence spectrometry. Selenium dietary supplementation significantly increased egg white, egg yolk and ...
Ali Murad Rahoo1, Tariq Mukhtar2,*, Barkat Ali Bughio3 and Rehana Kanwal Rahoo4
...i>G. mellonella than medium and small sized and the emergence was found to be positively correlated with the size of the host. It was also observed that emergence of IJ of H. bacteriophora was significantly greater than that of S. feltiae from the three different sized G. mellonella. The emergence of IJ started from the 4th day and continued till the 37th day. The maximum numbers of IJ were recorded on the 13...
Tahira Jamil*1, Mohammad Asghar1, Fatma Husain1, Haq Nawaz Bhatti2
...th substrate. The growth medium has an important effect on lovastatin production. Effect of carbon and nitrogen supplementation was investigated due to their restrictive ingredients role. Best yield (49.3±15 mg/g) was achieved by P. spodoecus using lactose (Carbon source) and NaNO3 (Nitrogen source) under pre-optimize circumstances. Different C/N ratios were used to obtain the optimal ratio. Best statin production was attained a...

 *Irum Javed1, Muhammad Asgher2, Sadia Noreen1, Humara Naz Majeed1 and Tanzila Sahar1

SOLID STATE FERMENTATION OF ASPERGILLUS NIGER FOR CITRIC ACID PRODUCTION USING AGRICULTURE RESIDUE AS SUBSTRATE
...red using molasses based medium and the different carrier substrate. In a second set of study wheat bran was utilized for citric acid production via fermentation parameters was optimized. The results showed significant (P≤ 0.05) difference among LSF and SSF and between different substrates in LSF and SSF. Wheat bran showed significantly increased (P≤ 0.05) production of citric acid (P= 0.001) compared to other carrier substrates used through SSF. It was ...

 Muhammad Akram and Faheem Aftab

THIDIAZURON INDUCES IN VITRO BUD BREAK AND SHOOT DEVELOPMENT FROM NODAL EXPLANTS OF ORTHOTROPIC SHOOTS OF MAIDENHAIR TREE (GINKGO BILOBA L.)
...urashig and Skoog, 1962) medium supplemented with different concentration (0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1,2,3,4 or 5uM) of TDZ for 24 days. Highest bud break (100%) was obtained at 0.005 uM TDZ after 14 days of initial culture. The same cultures were further maintained and subsequently obtained with 20.6 mm shoot length and 7.2 average number of leaves for another 10 days. Similarly, all other TDZ’s concentrations below 1 uM were also effective in...

 Muhammad Mohsin Ahsan1, Hafiz Muhammad Tahir2*, Muhammad Khalid Mukhtar1, Arshad Ali3, Zafar Iqbal Kahan4, Kafeel Ahmed4

Intra- and inter-specific foraging in three scorpion species
...uvenile and sub- adults (medium- sized), scorpions. They also consumed dead scorpions of their own species. Odontobuthus odonturus preferred to attack and consume healthy adults and did not feed on dead scorpions. Androctonus finitimus aggressively attacked and consumed all types of prey scorpions of its own species, except the dead ones. In inter-specific feeding experiment, M. tumulus consumed healthy adults, injured adults, pregnant females and dead adults ...

 Mohsin Arshad1, Muhammad Irfan*2, Asad-Ur-Rehman1, Muhammad Nadeem3, Zile Huma3, Hafiz Abdullah Shakir4, Quratulain Syed3

Optimization of medium and substrate for CMCase production by Bacillus subtilis-BS06 in submerged fermentation and its applications in saccharification
... using different media (medium 1 (M1), medium II (M-II), medium III (M-III) &
medium IV (M-IV)).Of all these tested substrates, sugarcane bagasse was found to
be the most suitable substrate for CMCase production. The effect of shaking on the
production of CMCase demonstrated that sugarcane bagasse gave maximum
CMCase acti...

 Siddra Tayyab Akhtar, Anjum Nasim Sabri

Twitching, swimming, swarming in biofilm forming strains in response to chemical and physical factors
...g them on congo red agar medium and then by performing
ring test. By 16S rRNA sequencing, bacterial strains were identified as
Exiguobacterium aurantiacum, Bacillus subtilis, Bacillus megaterium, Bacillus
endophyticus, Pseudomonas fragi and Bacillus subtilis. The optimum temperature
and pH for swimming, swarming and twitching motilities was 37°C and pH 7. All the
bacterial strains showed reduction in diameter of zones of ...
Haniya Mazhar1, Naaz Abbas2, Tehseen Zamir3, Zahid Hussain1, Syed Shahid Ali4*
...r characterization. Best medium for lipase production was olive oil and mustard oil cake and the best carbon sources were fructose and maltose whereas yeast extract was found to be the best nitrogen source, showing 55U/mL enzyme activity. The best inoculum size for the growth of this strain was 4-5%. Optimum pH was 8 and best temperature was 40oC for the reported strain. Addition of divalent Mg2+ and Ca2+ ions resulted in 2-fol...

Nighat Seema1*, Muhammad Hamayun1, Husan Ara1 and Raham Sheer Khan

...the EC to provide smooth medium for plant growth. Interestingly, the inoculation did enhance the extent of usage of organic compounds by the plants available in the soil and hence lowered the contents. During drought stress, ammonium ion concentration was increased in all endophytic treated soil except that of A. niger. Similarly, inoculation of endophytic fungi did also increased the value of soil nitrate ions in the range of 26.86±1.34~39.39±1....
Ali Murad Rahoo1,*, Tariq Mukhtar2, Barkat Ali Bughio3 and Rehana Kanwal Rahoo4
...a, T. molitor medium and small were significantly greater (11.2, 15.2 and 11.4 IJ, respectively) than those of H. bacteriophora (2.8 IJ each per G. mellonella and T. molitor medium and 3 IJ per T. molitor small). Contrarily, there was greater emergence of IJ of H. bacteriophora than S. feltiae in all the treatments. The mean numbers of H. bacteriophora emerging from...

Rizwan Ullah Shah* and Iqbal Munir 

...ted for optimizing basal medium through somatic embryogenesis (cotyledon and hypocotyl) for callus induction followed by shoot and root regeneration of Brassica carinata. Seeds were sterilized and germinated, of which one week cotyledon and hypocotyl were used for callus formation and shoot regeneration at five different level of 1-naphthaleneacetic acid NAA (0.05, 0.1, 0.5, 1.0 and 1.5 mg/l) and 6-benzyl amino purine BAP (0.1, 0.5, 0.7, 1.0 and 1.5 mg/l), and...
Muhammad Usman Asif*, Raza Muhammad, Waseem Akbar, Mubasshir Sohail and Muhammad Awais  
...pink bollworm but showed medium response and found susceptible against jassid (0.28/leaf), thrips (2.21/leaf) and whitefly (0.31/leaf). Best yield performance (2467.8 kg/ha) was of NIA-HM-6N that showed high tolerance against sucking pests as well as bollworms. Moreover, the perusal of data showed that the population trend of all insects remained below economic threshold level (ETL) during the period of study.  
...
Umar Farooq Gohar1, Hamid Mukhtar1,*, Ali Nawaz1, Ikram-ul-Haq1 and Asad Mehmmood2
...IIB-10 was cultivated on medium containing (%, w/v): Baker’s flour, 1.5; corn meal, 2; Methyl oleate, 1.6; calcium carbonate, 0.3 and ammonium sulphate, 0.1. The cultural conditions such as incubation temperature (30°C), pH (6.5) and inoculum size and age (2%, w/v, 48 h) were optimized. The maximum cephalosporin production was achieved after 144 h of incubation. The dry mycelial mass was found to be 39.46 mg/ml. The antimicrobial activity was assesse...
Faiza Jabeen1,*, Bushra Muneer2 and Javed Iqbal Qazi3
...iry wastes in production medium both with and without nutrients at pH 7.0 for 48 h at their respective suitable temperatures. They yielded enough thermostable protein suggesting their potential in production of various enzymes and proteins in unconventional and economical substrates suitable for various industrial uses.
...

 Ping Zhang1,2, Yabin Pu1, Yu Zhang2, Jia Chen2, Kunfu Wang3, Qian Li3, Yujiao Sun3, Yuehui Ma1, Shuqing Jiao2,* and Weijun Guan1,*

...y the optimized inducing medium. After the two-step digestion and differential attachment technique, high purity MDSCs were successfully cultured. MDSCs were identified by round or short spindle cell, and gathered into clusters; The average doubling time and clone efficiency of the cells were 35.5h and 47.2%, respectively. The MDSCs makers, such as Sca-1, CD34, CD144 and Desmin, were positive expressed by immunofluorescence and RT-PCR detection, and CD45 was n...
Aisha Khalid1, Muhammad Tayyab1,*, Abu Saeed Hashmi1, Tahir Yaqub2, Ali Raza Awan1, Muhammad Wasim1, Shagufta Saeed1, Sehrish Firyal1 and Abdul Rauf Shakoori3
...of supplementation of LB medium with additional carbon and nitrogen sources was also analyzed for maximal production of recombinant protein. Higher level enzyme activity was recorded at 25°C, pH 7.0 when the cells were induced with 0.5 mM IPTG with 22h post induction incubation. Supplementation of LB medium with 1% glucose and yeast extract enhanced the production of recombinant thermostable cellulase. Enzyme show...

Arshad Farooq* and Muhammad Zafarullah Khan 

...rmers of Mardan district medium knowledge gap was observed in land preparation, improved cane varieties, row to row spacing and stoppage of irrigation before harvesting. High knowledge gap (above 50%) was revealed in cane setts treatment, depth of furrows in case of D.I. Khan district while high knowledge gap in cane setts treatment, depth of furrows and seed quantity per acre in farmers of Mardan district. The...

Waqar Akhtar1*, Munir Ahmad2, Nadeem Akmal1, Hassnain Shah1 and Asif Ali Mirani2 

...etitiveness under small, medium and large farms in the study area. Fresh Dates has more competitiveness with less PCR value 0.62 compared to dry dates with PCR value 0.75.There is also influence of farm size on cost efficiency and competitiveness level. Domestic Resource Cost (DRC) ratio less than unity reveled overall resource use efficiency in dates production, however fresh dates (0.39) had more comparative advantage as compare to dried dates with DRC value...
Hashim Ullah1, Abdur Rahman1, Rifat Ullah Khan2, Shakoor Ahmad2 and Ambrina Tariq3, Shabana Naz4,*
...ore (designated as weak, medium and healthy with BCS 2, 3 and 4, respectively) on the meat cholesterol, fat, crude protein, ash, moisture and dressing percentage of WaziriandMazaisheep. A total of 36 mature sheep of Waziri and Mazai were selected and processed for dressing percentage and meat quality through proximate analysis. Wazirisheephad lower cholesterol as compared to Mazai. With the increasing BCS, the cholesterol content was significantly increased in...
Xiaohui Yu, Shuai He, Liqiang Wang, Mengyang Kang, Yanjiao Zhu, Shuhui Wang and Xiuzhu Sun*
...nt simultaneitily in the medium. Overall, the results suggested both antioxidants (Vitamin C and Vitamin E) could increase frozen semen quality and the ability of antioxidant. Nevertheless, the effect on compatibility of the two antioxidants was better than single addition.
...

Muhammad Shafique, Nosheen Noor Elahi*, Muhammad Rashid, Amjad Farooq and Kausar Hussain Shah

...ts were grown on mineral medium that were N-free either without NaCI or with a range of NaCI (20, 50,100, 200 and 300mM). Dry weight of plants was increased at 0-50mM NaCl and decreased at 100-300mM NaCI concentration. Inoculation effectively increased the dry weights of plants at salinity levels of 0-50 mM NaCI as compared to uninoculated plants but was not effective at 200-300mM NaCI. Number and fresh weight of pods were not affected at 0-100 mM NaCI levels ...
Gulzhan Аubakirova1,*, Zhanat Adilbekov2, Assylkhan Inirbayev2 and Tanatar Dzhamanbayev1
...tial capacity, small and medium-sized lakes can produce significantly more fish with better quality if regulated and properly managed intensive-type lake farms are created.
...
Asima Azam1, Asma-Ul-Husna2, Saima Qadeer3, Qaisar Shahzad4, Rabea Ejaz1, Nemat Ullah5, Tasneem Akhtar4 and Shamim Akhter2,*
... Lactate Pyruvate (TALP) medium for about 20 h, the presumptive zygotes were randomly distributed into 6 culture groups; Group I: Synthetic Oviductal Fluid (SOF) medium alone, Group II: SOF + co-culture, Group III: Conditioned SOF, Group IV: M199 alone, Group V: M199 + co-culture and Group VI: Conditioned M199 for in vitro culture (IVC). The percentage of embryos capable of crossing 8-16 cell block and reaching morula...

Azeem Haider1, Muhammad Mohsin Alam2*, Azhar Ali Khan3 and Muhammad Asif Zulfiqar3

...the optimum fermentation medium in shake flask studies contained a carbon (glucose 4%), nitrogen (0.5% ammonium chloride), inoculation level (three disks, 0.5 cm in diameter), temperature (30 °C), incubation period (at 7 days) and initial pH 5.0. Under these culture conditions, the maximum level of xylanase activity (9.29 Uml-1), CMCase (7.37 Uml-1), laccase (13.57 Uml-1) and effluent decolorization (69.68 %) were observed on 7th day during shake flask stu...

Sajjad Ali1, Atta-ur-Rahman1 and Sher Ali2* 

...uncils were targeted for medium level analysis. Thirdly, seven sample villages are targeted for micro level. The Landsat images of 1985 and 2015 are obtained from the open source Global Land Cover Facility (GLCF). The analysis revealed that the cultivated area was 146 square kilometer in 1985. It was observed that the cultivated area in the tehsil is reduced to 91 square kilometer, by losing 55 square kilometer area from 1986 to 2015, with a rate of 1.6 square...

Muhammad Zeeshan Manzoor1*, Ghulam Sarwar1, Mukkram Ali Tahir1, Noor-Us-Sabah1, Ayesha Zafar1 and Sher Muhammad2 

...oncentration in the root medium, while each species has a critical threshold value where it was started showing negative response. Leaching fractions may help keeping salt concentration low in the root zone when irrigation water is saline. In this experiment three types of water (canal, EC = 2 and 3 dS m-1) were used as such and with leaching fraction of 10 and 20 %. This experiment was conducted in the field and RCBD design was used to make its layout. All th...
Muhammad Suleman1,*, Abu ul Hassan Faiz2, Muhammad Shahbaz2 and Ayesha Riaz3
...asks using vogel’s medium at 35°C for five days. UV irradiated A. niger has significantly increased the xylanase production as compared to parent strains. Twenty minutes exposure of A. niger was considered suitable for the production of xylanase. Wheat bran concentration (3.5%) was considered best substrate for xylanase production than corn cobs and sugarcane baggasse. Maximum xylanase production was observed at 30°C with pH 5.6. Mo...

 Li-na Li1, Sheng Li2, Ping Gui3, Jing-hui Li1, Fen Ai4,* and Li-li Cai1,*

... presence of conditioned medium from uMSCs (MSCCM). MSCCM inhibited MRC-5 cell proliferation and reduced collagen deposition as measured by CCK-8 assay, Sircol assay, qPCR and western blot. MSCCM also reduced the expression of the pro-fibrotic TGF-β1 and increased the expression of anti-fibrotic IFN-γ at both mRNA and protein levels. Furthermore, we found that MSCCM inhibited the activation of NF-κB signaling pathway induced by irradiation as ...
Nazish Mazhar Ali1, Asma Ashraf 2*, Iram Liaqat2, Bushra Mazhar2, Shaukat Ali2 and Saiqa Andleeb3
... by growing on selective medium. Antibacterial activity of different compounds was observed against the pathogenic bacterial isolates. Minimum Inhibitory Concentration (MIC) test of different kinds of honey was performed against the isolated bacterial pathogens. The antibacterial activity of leaf extract of Azadirachta indica (Neem Plant) was also checked against the pathogenic bacterial isolates. The bacterial pathogens isolated from eye infections wer...
Abdul Majeed1*, Muhammad Anwar-ul-Haq2, Abid Niaz3, Abid Mahmood4, Naeem Ahmad1 and Hafiz Muhammad Walyat Ali Khan1
...n in hydroponic and soil medium on the basis of plant photosynthetic rate, potassium (K+) and sodium (Na+) contents. Twenty wheat genotypes/varieties were grown in hydroponic culture, having different residual sodium carbonate (RSC), electrical conductivity (EC), and sodium adsorption ratio (SAR). A substantial decrease in plant photosynthetic rate, and potassium contents were noted in all varieties under salt stress. Varieties i.e. V0709...
Azra1* and Shaukat Hussain2
...oderately resistant with medium to high yielding potential. Sub cluster II includes highly susceptible genotypes with low yield potential. Sub cluster III has moderately susceptible to moderately resistant genotypes. However, genotypes of this sub cluster are high yielding. Genotype CS-2Y10, being moderately resistant, is also the highest yielding genotype.Cluster II includes moderate to highly susceptible genotypes. All genotypes in this cluster are however l...

Muhammad Abdul Rahman1*, Abdul Saboor1, Gulnaz Hameed1, Ghulam Bilal2 and Farooq Tanwir3 

...olicy actions for small, medium and large farmers. Input price mechanism, regularization of dairy sector, separate policy measures for meat and dairy animals and preservation of local breeds are few optimistic policy options to safeguard Pakistan’s dairy production system from environmental factor under climate change. 

...
Tanzeela Riaz, Fiza Sana-Ullah Khan, Farah Rauf Shakoori
...ics on mineral salt agar medium pH 7. Six isolates were found to be mannanase producers by qualitative analysis. Three isolates (MBL-SP02, MBL-CW01 and MBL-GN02) produced maximum zone of hydrolysis with maximum activity ratio. These isolates (MBL-SP02, MBL-CW01 and MBL-GN02) produced maximum units of mannanase activity, i.e., 9.474, 7.364 and 3.568 U/ml in quantitative, respectively.These best producers were further selected for optimization of cultural...
Sobia Nazir1, Muhammad Irfan1*, Muhammad Nadeem2, Hafiz Abdullah Shakir3*, Muhammad Khan3, Shaukat Ali4, Quratulain Syed2
...m size (1, 5.5 and 10%), medium volume (1, 3 and 5ml) and incubation period (3, 4, 5 days) to observed the maximum activity of cellulase using Box-Bhenken design of response surface methodology. Maximum activity of CMCase (0.700 IU/gds/min) and FPase (0.260 IU/gds/min) was observed on 4th day with inoculum size of 1% and medium volume of 1ml (for 5g substrate). The proposed model was highly significant as depicted...
Qaisar Jamal*, Akram Shah, Syed Basit Rasheed and Muhammad Adnan
... in the acidification of medium and change to viable amastigotes that could be successfully retransformed to promastigotes. Use of orthophosphoric acid for acquiring acidic medium to transform promastigotes to amastigotes proved effective. 
...
Anam Tariq, Alina Gul, Majida Atta Muhammad, Samia Falak and Naeem Rashid*
...he extracellular culture medium. Determination of the N-terminal amino acid sequence of the recombinant protein, in the extracellular medium, revealed that the 19 amino acid signal peptide was cleaved between Ala19 and Gly20. It seems probable that the signal peptide of TK0522 can be used for secretion of other recombinant proteins produced in E. coli.
...

Yousaf Ali1, Muhammad Zamin1*, Ibadullah Jan1, Shahen Shah2, Muhammad Mazhar Hussain3, Fazli Rabbi4 and Muhammad Amin

...sisting of four planting medium treatments (compost, mixture, clay and sand) and six tomato genotypes (Nadir, Money Maker, Pakit, Nagina, Roma and Rio grande) with three replications. The results revealed that the combination of compost and mixture has significant effect on shoot height, number of leaves, stem and root length, however stem diameter was significantly affected by compost and non significantly affected by genotypes. As far as the genotypes perfor...

Amna Qazi1, Ghulam Shah Nizamani2*, Muhammad Tahir Khan2, Shafquat Yasmeen2, Shahla Karim Baloch1, Muharram Ali1, Imtiaz Ahmed Khan2, Sagheer Ahmad3, Muhammad Rashid Nizamani4 and Mohammad Aquil Siddiqui

...notype as well as growth medium played significant role in inducing propagation of the sugarcane. Shoots were observed to initiate earliest in NIA-2004, NIA-2012 and NIA-1026-P7 in MS media supplemented with 1.00 mg l-1 IAA + 1.00 mg l-1 Kin + 1.00 mg l-1 BAP and 20 g l-1 sucrose. Regarding number of shoots, shoot length and number leaves of the plantlets, BL4 was seen to produce excellent results in MS media containing 1.00 mg l-1 IAA + 1.00 mg l-1 Kin + 1.00...
Weigeng Wen1,2,3, Xu Chen1,2,3, Wang Zhao1,2,3, Qibin Yang1,2,3, Jian G. Qin4 and Zhenhua Ma1,2,3,*
...weight, and females with medium size of 85-120 g showed greater fecundity (around 9000 eggs/g) in comparison with smaller and larger counterparts. This study indicates that reproductive capacity of pond-reared female P. monodon is significantly related to bodyweight with a desirable size of 85-120 g as female broodstocks.
...
Mustafa Boğa1, Kerim Kürşat Çevik2* and Aykut Burgut3
Meriem Msaad Guerfali1,*, Heitham Hamden1, Salma Fadhl1, Wafa Djobbi1, Lotfi Sillini1, Wafa Marzouki1 and Mohammed Ammar2
...>medium;">Ceratitis capitata, is a major problem for fruit production in Tunisia. Ceratitis was for long time treated with malathion as main conventional control method. Malathion upon repeated and pr...
Sikander Ali* and S. Wajiha Khalid
...ut in chemically defined medium i.e., 0.5 g/l (NH4)2SO4, 3 g/l KH2PO4, 1.5 g/l NaNO3, 0.01 g/l MgSO4.7H2O and 3 g/l inulin at pH 7. Kinetic parameters for comparing product yield coefficients of different fungal strains were applied to further optimize exo-inulinase production. The best enzyme producing culture was selected for optimization study. For this, the selected ...
Şükrü Önalan1*, Muhammed Arabacı1and Haşmet Çağırgan2
...margins were seen in TSA medium. They were alive during native examination without movement. It was observed that morphologically all isolates were Gram (+), α-hemolytic (BA), oxidase and catalase negative and were reproduced under 21, 37 and 45 °C temperatures with 0–6.5 % NaCl salinity. As a result of the examination of biochemical properties with API Rapid ID 32 Strep test, it was observed that 2 L. garvieae isolates were different fr...
Muhammad Asim1, Zaheer Ahmad2, M. Akbar Khan1, M. Adeeb Babar1, Sayyed Ghyour Abbas1,*, Muhammad Khalil Nawaz1, Kiran Aftab3 and Muhammad Akhtar4
...>medium;">Tragoportax cf. salmontanus have been recovered from the Chinji Formation of the Lower Siwalik Subgroup, Pakistan. The remains comprise horn-cores, maxillary and mandibular fragments, and isolated teeth. Having compared with the previously described bovid remains from the Siwaliks, the new material has been allocated to Tragoportax cf. salmontanus. This species is well represented in the Middle Siwa...
Shaheen Rahman1, Kafeel Ahmad1*, Niaz Ali2, Muhammad Idrees3 and Waqar Ali4
...act mannitol agar (YEMA) medium. The isolated strains were confirmed as A. tumefaciens on the basis of morphological, biochemical and pathogenicity tests. The bacterial cells were rod shaped having rounded ends. The strains were Gram positive. Results confirmed the pathogenicity of the isolated strains as shown by development of tumours on carrot and potato discs. The pathogenic potential of the isolated strains demand for proper management and control ...
Muhammad Tahir Waseem1, Abdul Majid Khan1*, Saliha Khalid1, Rana Manzoor Ahmad1,2, Ayesha Iqbal1, Muhammad Ameen1
...bers of both genera have medium to large sized body with strong hypsodonty of teeth representing grazing on coarse grasses and shrubs in the Late Miocene Siwalik habitats of Potwar Plateau. At the apex of molar, crown is narrow and represents selenodonty in Selenoportax, while a broader crown in Pachyportax which indicates strong hypsodonty. The present sample add valuable information on systematics, dental morphology and dietary habits of the La...

Arshad Farooq1*, Muhammad Zafarullah Khan2, Abdul Hassan1, Muhammad Ishaq3 and Asif Nawaz

...ts sugarcane farmers had medium knowledge gap (37%) with cane yield 70912 kgs/hectare. Findings revealed that one-year improvement in the education level of the farmers would bring likely 58 percent decrease in the knowledge gap. Similarly, a year increase in the cane farming experience of the farmers would likely bring 6 percent reduction in the knowledge gap of the farmers. The results further explained that land owners had more knowledge gap than that of te...

Jaffar Hussain1*, Syed Farman Ali Shah1, M. Zeenat Ali1 and Javad Ahmad Shah

...re. Soil is an important medium on which crops grow and obtain nutrients for their growth and improvement. For determination of macro-micronutrients and some physico-chemical properties of soil, samples were collected from different area of Jamshoro (Soman, Murad, Abadnear Kotrai Jamshoro). These nutrients are so important for crops yield and human being. The results explain that soil have low organic matter, pH is near to 7, copper content ranged was 5.82 - 8...

Ayesha Zafar1, Ghulam Sarwar1*, Muhammad Sarfraz2, Muhammad Zeeshan Manzoor1, Sher Muhammad3 and Ghulam Murtaza

...ture with pH value 8.57, medium in extractable K and scarce in P and organic matter. The selected field was sandy loam having 70% sand, 18% silt and 12% clay. The soil was prepared, leveled, and crop was sown with seed rate of 7.5 kg ha-1. Treatments included various rates of NPK {0 (control = T1), 75 % (T2), 100 % (T3), 125 % (T4), and 150% (T5) of recommended dose (150-150-75 kg ha-1) of NPK fertilizer). The experimental design was RCBD with three replicatio...

 Waqas Javaid1*, Adnan Tariq1, Iftikhar Hussain2, Sahar Noor2

AN EVOLUTIONARY APPROACH FOR CMS DESIGN
...ms
in the case of medium variety and medium volume of production. The main advantage of CMS lies in the effective
grouping of parts into families and machines in to corresponding groups as it results in minimizing the number of
intercellular moves. Over the years, a number of efficient approaches have been developed by researchers to handle
the Cell Formation Problem (CFP). Among these, a large nu...

Nabeel Maqsood1,2*, Afzal Khan1, Muhammad Khalid Alamgir2, Shaukat Ali Shah1, Muhammad Fahad3 

PTFE THIN FILM COATING ON 316L STAINLESS STEEL FOR CORROSION PROTECTION IN ACIDIC ENVIRONMENT
... properties in different mediums. 316L SS shows poor corrosion
behavior in HCL. Hard coating is often required for protection of 316L SS from wear and corrosion. In this research
paper polytetrafluoroethylene (PTFE) was coated on 316L SS by spin coating technique to modify their corrosion
resistance in acidic media containing Hydrochloric acid (HCL). The anticorrosion property of the 316L SS and PTFE
coating was studied in 40% HCL b...

Farid Ullah Khan1, Muhammad Iqbal1 

DEVELOPMENT OF A TESTING RIG FOR VIBRATION AND WIND BASED ENERGY HARVESTERS
...nd characterization of a medium scale vibration shaker and a wind tunnel
for testing of micro and meso scale vibration based, wind based and hybrid (using combined vibration and wind)
energy harvesters. The mechanical shakers used for vibration and shock testing are the most versatile, inexpensive
and easy to operate, however, due to their fixed displacement, single frequency and sinusoidal behavior, usage of
these shakers is limite...

Salman Saeed*, Akhtar Naeem Khan**, Rashid Rehan*, Sikandar Hayat Sajid**, Muhammad Sagheer Aslam*, Khan Shahzada** 

COST AND PERFORMANCE OPTIMIZATION OF PRECAST POST TENSIONED PRE-STRESSED GIRDER BRIDGE SUPERSTRUCTURES
...widely used for short to medium span bridges. The design and subsequent cost of a
bridge depends on key geometric variables such as bridge width, number of lanes, number and length of spans,
slab thickness, number and spacing of girders. Some of these variables are dictated by traffic demands and highway
geometry, while others are related to structural demands. Typically, designing a bridge usually involves experience
and expert jud...

Muhammad Zamin1*, Fazli Rabbi2, Shahen Shah3, Muhammad Amin4, Haroon Ur Rashid5, Hasnain Alam6 and Sabahat  Ali1

Performance of Lilium (Lilium elegans L.) Genotypes using Different Planting Media
...he best type of planting medium and selecting a particular genotype for District Swabi climatic conditions, an experiment was conducted in the horticulture nursery, University of Swabi, Pakistan in the year 2019. Five Lilium genotypes viz., Star gazer, Star fighter, BomiYellow, Red carpet and Yena were tested in four type of planting media viz., M1-sandy soil+ Compost (1:1; v/v), M2- sandy soil+Humic acid (20:1;v/v), M3- sandy soil+ Peatmoss (1:1;v/v), M4-sand...

Sikandar Khan*, Afzal Khan*, Muhammad Tahir Khan*, Muhammad Ali Kamran* and Abdul Shakoor*

DYNAMIC MODELING AND STARTING BEHAVIOR OF A SMALL HORIZONTAL AXIS WIND TURBINE
...Pakistan are low to medium, especially in the northern areas. It is possible to produce significant power from a small wind turbine at low wind speeds provided the turbine can be started. In this paper “BEM function” and “Aerodynamic function” are used based on the Blade element momentum theory. These Matlab functions calculate the wind turbine blade parameters and aerodynamic forces that will act on wind turbine bla...

Rafi Javed Qureshi* and Iftikhar Hussain**

INTERNATIONALIZING MANUFACTURING SMEs IN A DEVELOPING REGION: AN EXHAUSTIVE CDA-BASED EXPLORATORY APPROACH
Dibyendu Biswas1*, Shib Shankar Saha2, Shankar Biswas3 and Md. Abu Sayeed4
Outbreak of Lumpy Skin Disease of Cattle in South-West Part of Bangladesh and its Clinical Management
...rved in between good and medium quality intra-herd level hygienic environments. Five different treatment protocols were applied for recovery of the affected cows; where no significant differences were estimated among the treatment protocol in contrast to recovery from LSD. However, dexamethasone, chlorpheniramine maleate, combination of oxytetracycline and meloxicam showed apparently good results. Interestingly, most of the household in this study area never u...

Muhammad Usama Hameed*, Zulfiqar Ali Gurmani, Sajjad Khan and Allah Bakhsh 

...se). PARC-Oats exhibit a medium plant height (110-120 cm), high crude protein (36.23% over check variety S-2000), thick stem (14.86% more than check variety S-2000) and higher leaf area per plant (21.55% over check variety S-2000). The variety is drought tolerant may be grown in semiarid and arid areas having minimum rainfall up to 300 mm, highly lodging-resistant, late-maturing i.e. stay green till mid May, having up to 12 % crude protein and having green fod...
Guang-Hui Tan, Yi-Yu Zhang*, Yuan-Yu Qin, Lei Wu and Jie-Zhang Li
...ly, and both belonged to medium levels of genetic diversity. Association analysis revealed that two SNPs were significant association with at least four of seven lipid indexes. Allele A of CDS 216 A>G locus and allele T of CDS 681 T>A locus was favorable to improving meat quality, respectively. Three haplotypes and six diplotypes were identified by the combination of two SNPs. Diplotypes had dominantly affected on tested lipid indexes except for IMF. Dip...
Ayesha Noreen1, Amina Elahi1, Dilara Abbas Bukhari2 and Abdul Rehman1*

 

... pH 7 at 37 °C in LB medium after 24 h of incubation. The strain tolerated As3+ up to 40 mM and also showed resistance against Pb2+ (8mM), Cd2+ (6mM), Cr6+ (6mM), and Cu2+ (10mM). The arsenite oxidase is responsible for the conversion of arsenite (As3+) into arsenate (As5+) and the predominant form of arsenite oxidase was intracellular and its optimum activity recorded was determi...

Arifa Khan1*, Danish Anwar2, Shazia Erum3, Naveeda Riaz1, Shahid Riaz4, Tariq Rafique3 and Zafer Iqbal2

Screening of Exotic Potato Germplasm against Potato Virus PVX, PVY and PLRV through Biological and Serological Test (ELISA)
...was taller genotype with medium number of tubers and shoots plant-1 while CIP-5 was a dwarf genotype with minimum tuber yield. Genotype CIP-6 produced more number of tuber plant-1 but CIP-22 followed by CIP-10 produced the highest tuber yield plant-1. Majority of genotypes produced round shape tuber with yellow, white skin color and cream flesh. Likewise, maximum genotypes had medium to shallow eye tubers except CIP-9 and CI...

Dilshad Ahmad1* and Muhammad Afzal2

An Empirical Analysis of Economic Efficiency and Farm Size of Cotton Farmers
...of samples of 240 small, medium and large-scale cotton farmers was estimated using Stochastic Frontier Approach of district Rahim Yar Khan Punjab, Pakistan. Empirical findings of the study indicated that medium farm size cotton farmers were more allocative, technically and economically efficient (0.90, 0.94, 0.85) rather than small farm farmers (0.79, 0.92, 0.76) and large farm farmers (0.70, 0.97, 0.68). Farmers schooling y...

Amit Sharma1* and Pankaj Sood2

Sonographic Assessment of Ovarian Follicular Dynamics during Breeding and Non-Breeding Season in Gaddi Goats
...e daily counts of small, medium along with daily total number of visible follicles were observed during B season. In conclusion, ovarian follicular growth in Gaddi goats during B and NB season is characterized by wave like pattern and exhibited the seasonal differences.

...

Tahseen Ullah* and Noor ul Amin

In Vitro Antibacterial Activity of Medicinal Plant Extracts
... bacteria growth culture medium and their interactions. The plants crude extracts were having significant effects on the bacterial growth in bacteria growth medium while bacterial strains and concentrations have also significant affected the bacteria growth and zone of inhibitions by different concentration. However, the various concentration and bacterial strains were having significant effect on bacteria growth at 0.05 lev...

Qurrat ul Ain Akbar*, Saqib Arif, Shahid Yousaf, Salman Khurshid and Najmus Sahar

Effects of Flour Particle Size on Farinographic Properties of Wheat Dough
... (1000 to 1500µm), medium (500 to <1000 µm) and fine (<500 µm) fractions on the basis of particle size. All the farinographic parameters (except dough development time) were influenced by particle size of wheat flour. Water absorption was negatively related with flour particle size. Dough stability was positively related to flour particle size whereas the degree of softening was negatively related with flour particle size. However, ther...

Muhammad Zamin1*, Anees Muhammad1, Ibadullah Jan1, Hidayat Ullah1, Shahen Shah2, Muhammad Amin3 and Haroon Ur Rashid4

Production of Tuberose (Polianthes tuberosa L.) as Affected by Bulb Size and Planting Medium
...on bulb size and growing medium. To investigate the best type of planting medium and suitable bulb size for commercial production of tuberose, an experiment was conducted in the Horticulture Nursery, University of Swabi, Pakistan in the year 2019. Three bulb sizes of tuberose viz., large (2.5cm dia), medium (1.5cm dia) and small (1cm dia) were planted in three type of planting media viz., ...

Muhammad Zamin1*, Anees Muhammad1, Ibadullah Jan1, Hidayat Ullah1, Shahen Shah2, Muhammad Amin3 and Haroon Ur Rashid4

Production of Tuberose (Polianthes tuberosa L.) as Affected by Bulb Size and Planting Medium
...on bulb size and growing medium. To investigate the best type of planting medium and suitable bulb size for commercial production of tuberose, an experiment was conducted in the Horticulture Nursery, University of Swabi, Pakistan in the year 2019. Three bulb sizes of tuberose viz., large (2.5cm dia), medium (1.5cm dia) and small (1cm dia) were planted in three type of planting media viz., ...
Aatif Amin1,*, Zakia Latif2, Arslan Sarwar1, Basit Zeshan1 and Mushtaq A. Saleem1
...ir of Luria Bertani (LB) medium supplemented with 30 μg/mL of HgCl2 was designed to check the detoxification ability of the selected strains. The results demonstrated 83% detoxification of mercury by both B. cereus AZ-2 and B. cereus AZ-3, and 76% detoxification by Bacillus sp. AZ-1 (p<0.05).
...

Malik Abdul Rehman1*, Hafiz Muhammad Ehsan2, Tehseen Ashraf2, Zulfiqar Ali Gurmani3, Sajjad Khan3 and Mujahid Ali2

Effect of Growing Media on Plant Growth of Rough Lemon (Citrus jambhiri Lush.) and Poncirus (Citrus trifoliata)
... to low fertility in the medium. Overall results suggested that plant growth was better on leaf manure+silt +straw, peat mass+soil+saw dust, and leaf manure+soil+sawdust as compared to other treatments due to the use of peat and compost.

...

Ghulam Rabbani1, Uzma Javed1*, Javed Iqbal2, Ruqeah Mustafa3, Ghulam Shabbir2 and Fida Hassan Shah4

Barani Mash a Newly Developed Disease Resistant and High Yielding Mash Cultivar for Rainfed Areas of Punjab, Pakistan
...lodging, the pod size is medium and 100-seed weight is 4.73 g. It has been developed through screening from the local material. It was further evaluated in yield trials for six years from 2012 to 2016. The line 11CM-707 had higher yield than check cultivars per all replicated yield trials. In addition, it has resistance to yellow mosaic. The main yield contributing characters were number of pods per plant, number of primary branches per plant, yield per plant ...
Somia Shehzadi1, Sana Javaid Awan2, Maryam Javed1*, Asif Nadeem1 and Tahir Yaqub3
... For this purpose proper medium and supplements are required, which contain suitable growth factors for viability of ATFs. Fetal bovine serum (FBS) is used extensively in cell culture but being expensive and scarce in availability, its alternatives are needed. This study proposed autologous equine serum (AES) and adult bovine serum (ABS) to be evaluated as alternative to FBS. ATFs were cultured in DMEM-HG and supplemented with 10% FBS, 10% AES and 10% ABS. At ...
Muhammad Muhsin1, Muhammad Nawaz2, Imran Khan1, Muhammad Bilal Chattha3,Sadia Khan4, Muhammad Talha Aslam1, Muhammad Mahmood Iqbal5, Muhammad Zubair Amin6, Muhammad Ahsin Ayub7, Usman Anwar8, Muhammad Umair Hassan1 and Muhammad Umer Chattha1*
 
 
...iameter of > 2.7 mm), medium (having a diameter of > 2.3 mm to 2.7 mm), small (having a diameter of ≤ 2.3 mm) and mixed seeds. The results indicated that different sowing dates and seed size classes had a significant effect on germination, growth, and yield of wheat crop. The crop sown on 15th December took less time to start emergence (7.8 days) and resulted in maximum plant height (81 cm), grains per spike (44.5), productive tillers (321....

Mansoor Qadir1*, Yousaf Khan2, Shahid Khan3, Djamaleddine Djeldjli3 and Muhanned Ismael Ibrahim Al Firas4

...ous access of the entire medium with maximum security and spectral efficiency. This paper aims to design and analyze 2 dimensional OCDMA based coding scheme and corresponding network architecture to support high capacity Gigabit Passive Optical Network (GPON). The coding scheme is proposed by deploying diagonal eigenvalue unity (DEU) scheme at the frequency domain (X-axis) in combination with double weight zero cross-correlation (DW-ZCC) code at the time domai...
Abdul Nabi Jatt1,2*
...creased, when the growth medium was supplemented with quorum-quenching (QQ) AiiA protein. The present study, for the first time provides evidence that the QS system via AHL molecules involved in regulating the production of two different forms of an extracellular cellulase enzyme, i.e., exoglucanase and endoglucanase in marine snow associated bacterium
Huan Yang1, Tingting Li1, Huimin Zhao1,2, Xiaoyuan Zhang1, Huiyan Xu1, Yangqing Lu1, Xingwei Liang1, Shengsheng Lu1, Xiaogan Yang1*and Kehuan Lu1*
... cells with SSCs culture medium (SSCM), which is serum-free. SSCs began to proliferate on the second day and quickly formed grape-like clusters that were consistent with the morphological features of SSCs. These cells were identified as positive by immunofluorescence staining. This study successfully isolated, enriched and identified buffalo SSCs and established an effective platform to explore the mechanisms of proliferation and differentiation of buffalo SSC...
Ye Ge1, Chunmiao Zhao1, Weitian Xie2, Ying Liu2,* and Chunhou Xu1,*
... colonies in the culture medium was 18.4. The production of protoplasts lays a foundation for research in microecological preparation.
...
Iram Liaqat1*, Tahir Hussain1,2, Aisha Waheed Qurashi3, Gulbeena Saleem2Asia Bibi4, Muhammad Fiaz Qamar5,ShaukatAli1 and Ikram-ul-Haq6 
...ck colonies on congo red medium. Quantification assays such as test tubes revealed significantly (p<0.001) strong biofilm after 5 days with significantly increased planktonic cells (after 3 days) and increased loosely bound cells (after 5 days). Similarly, air liquid interface coverslip indicated significant increase in biofilm after 1 day. Comparison of antibiofilm effect using proteolytic enzymes indicated that although all enzymes resulted in significant...
Eman Khalifa1*, Riad Khalil2 and Haitham Elaadli3
...ion on Lowenstein-Jensen medium (LJ medium), Ziehl-Neelsen staining; identification by different biochemical tests and polymerase chain reaction (PCR) at 500bp diagnostic for M. bovis, as well as (2) to determine the therapeutic efficacy of the various antimicrobials (9 types) on the isolated M. bovis by using different antimicrobial sensitivity plate method. A total number of 100 samples of mastitic milk from ...

Ch. Muhammad Rafiq1, Qasim Raza1*, Awais Riaz1, Misbah Hanif2, Wajiha Saeed2, Shawaiz Iqbal1, Tahir Hussain Awan1, Syed Sultan Ali1 and Muhammad Sabar1

...ress applications. Under medium to high osmotic stress levels, mean germination time, germination index and seed vigour index (SVI) of SA primed seeds were better than non-primed seeds. Remarkably, SVI of all SA concentrations under -0.2 MPa osmotic stress was surprisingly improved as compared with control and other osmotic stress levels, indicating a ‘drought-escape strategy’ in rice seeds under low osmotic stress level. Overall, our results indic...
Sara Sultan Alomran1, Muhammad Nasir Khan Khattak1,2, Amir Ali Khan1,2*, Sallam Hasan Abdallah2, Abeer Maher Fayyad1 and Khalid Bajou1,2
...>medium;">Unraveling molecular mechanisms that govern adipocyte formation will lead to a greater understanding of obesity and subsequent treatment. In the current study, we assessed the effects of miR-22-3p, a non-coding RNA, on adipocyte differentiation from telomerase-transformed Mesenchymal Stromal Cells (iMSC3). The transfection of iMSC3 with miR-22-3p suppressed adipocyte differentiation as evident by reduction in lipid content and...
Ahmed Saud Alsaqufi1, Sheikh Mustafizur Rahman2,3*, Roshmon Thomas Mathew2, Yousef Ahmed Alkhamis1,2, Md. Moshiur Rahman3,4 and Muhammed Aslam Pathiri2
... larvae were appeared as medium brown color (76%) in tanks having PVC, whereas many of them were light brown (61%) in non-PVC tanks. Taken together, the study suggests that C. gariepinus larvae should be reared in completely dark condition to enhance their overall production.
...

Saima Naz1*, Ahmad Manan Mustafa Chatha2, Saba Saeed1

...mical parameters of test medium were monitored regularly. The observed mean LC50 and lethal concentrations for Cirrhinus mrigala were 55.85 ± 2.84 and 128.44 ± 9.25 mg L-1, respectively. On the other hand, for Labeo rohita, mean values of LC50 and lethal concentrations were calculated as 56.42 ± 2.51 and 120.98 ± 7.18 mg L-1, respectively. Cirrhinus mrigala had lower LC50 but higher lethal dose. Two fish were different in size as we...

Muhammad Ahsan1*, Aneela Ramzan1, Muhammad Nafees1, Adnan Younis2, Muhammad Amin1, Gulzar Akhtar3, Khansa Saleem1 and Azka Sabeeh1

...sugar (T2) provide ideal medium for enhancing the post-harvest attributes of Rosa hybrida cv. Freedom.

...

Mian Muhammad Arif* and Malik Muhammad Shafi

...major groups i.e. small, medium, and large size farms. It is evident from the results of partial budgeting that the average total cost per flock of small size broiler poultry farm was 1468290 rupees while the total average cost per flock of medium and large size broiler poultry farms were 2485249 and 4792247 rupees respectively. Feed was the major cost component of the broiler farms with more than 60% share in the total cost...

Iftikhar Jan* and Sahib Alam

...uction in corn meal agar medium by using ELISA technique. The results showed that isolate AFS32 produced highest level of total aflatoxin (230.78 µg Kg-1) while isolates AFS5, AFS17, AFS25 and AFS33 produced no aflatoxin. These nonaflatoxigenic isolates were considered as isolates of interest and could be used as biocontrol agent in agricultural fields for prevention of pre-harvest aflatoxins production in different crops.

...
Asmaa A.M. Abd El-Ghani *; Ahmed B.M.; Abdel-Raouf A. ; Nagwa S. Ata* and H.A. Hussein
El-Dougdoug K.A.1, Sofy A.R.2, Rehab A. Dawoud3 and Korkar H.M.4
...n
storage MS medium supplemented with 40, 50, 60 and70 gL-1 at 10, 15 and 20ᴼC.
The highest survival percentage 100% with recorded with 40 and 50gm sucrose
concentrations at 10, 15 and 20°C while 70 gL-1at 20°C recorded the lowest
survival percentage, 70.5% sucrose at 12 months. The lowest shoot length and roots
number were recorded with 40 and 50gm sucrose conc.especially at 15°C for 12...

Aya El-Turkey1, A. K. El-Attar1, A. E. Aboulata1, B. Othman2 and K. A. El-dougdoug2

...ferred into regeneration medium and genetically transformed with the HSV-2gD-PB21 binary vector through Agrobacterium co cultivation. Agro-inoculated tomato plants were tested for the HSV-2gD insertion and transcription using both PCR and RT-PCR and the results were successful in getting insert-containing tomatoes against HSV-2gD. Specific expression of the introduced antigen construct at the RNA level was detected by RT-PCR, using specific primers for the HSV...

Rehab A. Dawood1; Entsar A. Nassar2; and K.A. El-Dougdoug 3

...>Potential osmotic of MS medium is a new method for Potato virus Y (PVY) elimination using tissue culture technique. Osmotherapy refers to culture meristem – tip and stem nodes at MS medium saturated with sucrose. Stem nodes of potato were successfully stored for up to 12 month at osmo-preservation medium supplemented with sucrose 50, 60 and 70 gl -1 at 210C. The survival percentage ...

Samah A. Mokbel, Soad H. Taha, Mahmoud M. Abd-El Hamid, Ali H. Hamed

... either in vitro culture medium or in vivo (greenhouse). The presence of the virus was evaluated by ELISA technique. Results demonstrated that application of 1000 mg/L lactoferrin by spraying or combined with tissue culture proved to be an effective method for PVX-inhibition as compared with other concentrations. Also, results of antiviral activity of lactoferrin at concentration 1000 mg/L showed great potential as phytotherapeutic source to produce quality an...
Zahid Mahmood Sarwar1*, Ayub Iqbal Malik1, Maryam Suhail2, Shafqat Saeed3, Muhammad Umair Sial3, Waqar Jaleel4, Muhammad Nadir Naqqashand Qamar Saeed1
...ently with Hoyer’s medium. A key to the species of the genus Spodoptera from Pakistan is also given here. Taxonomic review of Noctuidae becomes superlative and very essential with this contextual the state of Pakistan. This was selected to the taxonomic study of Noctuidae. This research is initiative clue for further description, illustration and classification of unidentified species of the genus Spodoptera from Pakistan.
...

Moazama Batool1*, Sajid Abdullah2, Huma Naz3, Mubashar Hussain4, Sadia Maalik1, Sajida Mushtaq1, Tanveer Ahmed5 and Laiba Shafique6

...llowed by Cr and Cd test mediums. The FI by C. marulius was significantly higher as 12.83±0.07 g in Cr followed by Cd (12.14±0.05 g) and control (9.57±0.364) medium. However, FI by W. attu was higher in control (15.30±0.40) followed by Cr (13.08±0.06) and Cd (11.98±0.03) exposed mediums. The cumulative FI by W. attu was greater than C .marulius in ...
Song Jiang1,2,3, Xianbin Mo1,2, Falin Zhou2,3, Jianhua Huang2,3, Qibin Yang2,3, Lishi Yang2,3 and Shigui Jiang2,3*
...ively, which varied from medium to high heritability. The estimated heritability of body weight and transformed survival were 0.46 ± 0.10 and 0.32, respectively, which showed high heritability level. The estimates of genetic parameters might be overestimated because the common environmental effect was not included in the estimation model due to convergence problem. The results showed that there was a high genetic correlation (0.84-0.92) between Diet A a...

Masudul Haq Wani and Arshad Bhat*

...align: justify;">Through medium density almond cultivation, production of almond in world has increased many folds from 1034 MT in 1995 to 3214 MT in 2019. The contribution of India to the total almond production in 2019 was merely 2.45 per cent. However, domestic demand is increasing every year, with the result, the country is importing almond to the tune of more than Rs.9.2/- billion annually. Varis is reported very productive and quality wise retains high s...
Chao-Qun Shi1, Hong-Ying Lin1, Jin-Qing Zheng1, Fan Yang1, Kwame Ayisi Lartey1, Dan-Ju Kang1, Hwa-Chian Robert Wang2, Ravi Gooneratne3*and Jin-Jun Chen1*
...li + 10 mg/kg TFCO), medium dose (E. coli + 40 mg/kg TFCO), and high dose (E. coli + 160 mg/kg). TFCO was administered by gavage 3 h post intraperitoneal (i.p) E. coli injection. Serum IgM, IgA, IgG, TGF-β1 mRNA expression in duodenal villi, and histopathology of duodenum were also studied. TFCO significantly increased the IgA and IgG concentration (P<0.05), reversed the intestinal mucosal damage caused by E. c...
Amjed Ali1, Muhammad Tayyab1,*, Sehrish Firyal1, Abu Saeed Hashmi2, Asif Nadeem3, Shagufta Saeed1, Ali Raza Awan1 and Muhammad Wasim1
...5. Supplementation of LB medium with various carbon sources including wheat bran, rice bran and molasses could increase the enzyme production from 25 to 43.7, 44.3 and 49 µmole/min whereas the nitrogen sources including tryptone, peptone and yeast extract could enhance the enzyme production from 25 to 40.21, 41 and 43.76 µmole/min, respectively. The highest β-lactamase production was recorded when the LB medium<...
Zheng Yan1,2,*, Shuang Liu2, Ai-Qing Liu2 and Hai-Yan Wang2
...eptide given to the low, medium, and high dose groups were 1.5, 5.0 and 10 mg/animal per day, respectively. Then, skin elasticity was measured using a cutimeter dual MPA 580. The concentraions of three type of collagens, hyaluronic acid and hydroxyproline in skin tissue were also determined. The results indicated that the oral administration of elastin peptide greatly improved the skin elasticity, accompanying with significantly upregulated expression of hyalu...

Nazeer Ahmed Lashari1*, Saghir Ahmed Sheikh2, Aijaz Hussain Soomro2 and ShamsuddinTunio3

...gel consistency (mm) was medium and soft with the gel distance values of 92.00 in BS-385 when packed in cotton bag for 9 months however, it was 48.00 after 3 months when packed in nylon bag. The statistical analysis showed that there was substantial variance between the varieties. Culinary superiority parameter such as WAR was ranged between 2.3 (DR-82 and IR-6). Volume expansion ratio was 0.8 in DR-82 and 5.70 in IR-6 in cotton bag. Present study concludes th...

Murad Ali* and Said Wahab

... fresh and in-use frying mediums (upto five hours) of each Tallow, Ghee and Oil were collected and the whole frying process was properly monitored throughout. All the samples were analyzed for TPM and Acid value at the time of collection with the help of oil testometer DOM-24. A 100 ml of sample from each of the frying mediums was collected and transferred to the Biochemistry Laboratory, University of Malakand for further an...
Qazi Muhammad Noman1, Farhan Mahmood Shah1, Khalid Mahmood2 and Muhammad Razaq1*
...>medium;">Fruit flies (Diptera: Tephritidae) species pose a significant threat to mango and citrus production worldwide including Pakistan. In the present study we identified and monitored the population dynamics of fruit flies species using male attractants Attrex® (methyl eugenol 98%, evyol group) and static Spinosad® (spinosad 2% and methyl eugenol 51%, target group) in mango and citrus orchards at diffe...
Nasir Ali Tauqir1, Asim Faraz2*, Muhammad Arif1, Abdul Rehman1Imtiaz Hussain1, Abdul Waheed2, Gabriele Marino3 and Michela Pugliese3

 

...ogenous diets with high, medium and low levels of lysine, methionine and threonine concentrations (% of crude protein) were formulated and represented as high essential amino acids (HEAA), medium essential amino acids (MEAA) and low essential amino acids (LEAA) concentrations, respectively. The study lasted for 100 days; first ten days were given for the adaptation to new diets while every six days after every month of the r...

Nawab Khan1, Ram L. Ray2, Muhammad Ihtisham3*, Badar Naseem Siddiqui4*, Muhammad Khayyam5, Raheel Anjum6 and Simplice A. Asongu7

...d 45% of respondents had medium-sized landholding, and they had excellent farming knowledge and apple growing experience. Furthermore, a non-significant association exists between age and adoption, and a significant association between landholding and awareness about recommendations has been found. A non-significant association existed between apple-growing experience and awareness/ adoption of recommendations. It is recommended that apple growers need direct ...

Syeda Shazia Bokhari, Aisha Waheed Qurashi*, Roheela Yasmeen*, Fouzia Yasmeen, Nabeela Nayab, Uzma Rafi

...eart Infusion (BHI) agar medium showed positive results and EPS contents showed higher carbohydrate content as compared to Protein contents. It was found that the microbes associated with earthworm (L. terrestris) have significant potential of adherence and can be exploited as a bioinoculant formulation for improving soil fertility. 
 
Novelty Statement | The study is novel in its design as it is p...
Farah Deeba1, Hafiz Abdullah Shakir1, Muhammad Irfan2, Muhammad Khan1 and Javed Iqbal Qazi1*
...d on chitinase producing medium (CPM) from soil samples collected from local termites’ influenced areas. Of all these, three isolates gave positive test for chitinase screened on the bases of clear zone on CPM following chitinase assay. The best chitinase producer was selected and identified as Bacillus subtilis employing 16S rRNA gene sequence identification technique. B. subtilis yielded highest chitinase on CPM at pH 7 with 3% inoculum s...

Md. Sanjid Hasan1, A K M Humayun Kober1, Eaftekhar Ahmed Rana2, Md Saiful Bari1,3,4* 

... (94%) except a few were medium-scale (6%). Very few farms used quarantine and isolation shed (6%) for the disease affected cows. Among the risk factors identified; type of farm, floor type, quarantine facility, isolation shed used, adequate drainage facility were statistically significant (P ≤ 0.05) to causing both SCM and udder lesions. Predominant causal agents isolated were Staphylococcus sp 186 (70.4%), Streptococcus sp 146 (55.3%), Bacillus sp 62 (23....

Arshad Farooq1, Abdul Hassan1, Muhammad Ishaq2, Asif Nawaz3*, Iltaf Ullah4 and Hidayatullah5

...rs of both districts had medium knowledge level (35.19%). The lowest knowledge level of the sample farmers was found in early maturity (short duration) maize (OPVs) varieties (26.67%), IPM techniques (25.84%), wheat on ridges/seedbed (24.17%), heat and drought tolerant maize (OPVs) varieties (20.84%), heat and drought tolerant wheat varieties (20%) and organic farming (16.67%). Knowledge index revealed that both districts’ farmers had 35.71% knowledge le...
Stefan Pratama Chandra1, Yoanes Maria Vianney1, Theresia Liliani Christie2, Merlyn Wongso2, Melisa Widjaja2, Deok-Chun Yang3, Se Chan Kang4, Manar Fayiz Mousa Atoum5,6 and Johan Sukweenadhi1*
...t (100 g, 150 g, 200 g), medium volume (12 L, 13 L, 14 L), medium formulation (“A”, “B”), and incubation temperature (15 °C to 20 °C and 21°C to 25 °C). Based on the biomass yield and ginsenosides content, it was concluded that the optimum growth condition was 150 g of the initial inoculum grown in 13 L of media using formulation B and incubation at 21°C to 25 °C. In the long-t...
Yang Yang1,2, Ji Shao1,2, Mingxu Zhou3,4, Qiangde Duan1,2, Xinyi Zhang1,2 and Guoqiang Zhu1,2*

...e added into the culture medium, respectively, and co-cultured with ETEC strain C83902. ETEC strains were stimulated by exogenous and endogenous long-chain and short-chain AHL molecules, respectively, and their biological characteristics, such as growth characteristics, biofilm formation ability, and adhesion ability to piglets intestinal epithelial cells IPEC-J2 were observed under the influence of the AHLs described above. Real-time PCR was used to detect th...

Kusuma Adhianto*, Satria Ibnu Lenanto, Akhmad Dakhlan, Muhamad Dima Iqbal Hamdani 

... which is categorized as medium positive, a phenotypic correlation of 0.27 which is a low positive value, and an environmental correlation of 0.47 which is a high positive value. The results of this study indicate that environmental factors have a major influence on goat performance. Based on the results of research, it can be concluded that selection of female Saburai goat based on weaning weight would improve yearling weight, and also improvement of environm...

Aly M. Ghetas1*, Dalia M. Sedeek1, Hanaa S. Fedawy1, M.A. Bosila1, Hoda M. Mekky1, Kh. M. Elbayoumi1, 3, Mohamed M. Amer2 

...ngal species on specific medium. A total of 19 purified fungal isolates have been identified morphologically. Aspergillus isolates were the most identified (42%), followed by Trichosporon (10.5%), Penicillium (10.5%), Fusarium (5%), Candida (1%) and non-identified isolates (26%). Furthermore, the obtained 8 Aspergillus isolates were further morphologically identified into A. fumigatus which was most frequent species identified (4/19 of total) and (4/8 of Asper...

Muhammad Shoaib1*, Muhammad Nawaz2, Muhammad Ilyas3, Muhammad Shafique1, Imran Khan1*, Muhammad Talha Aslam1, Muhammad Sultan Ali Bazmi4, Muhammad Arshad5, Ghulam Ahmad4, Muhammad Irfan6, Muhammad Umer Chattha1 and Muhammad Umair Hassan1

...seed (more than 2.7 mm), medium seed (less than 2.7 mm) and small seed (less than 2.3 mm). The various seed sizes and rates significantly affected performance of wheat crop. For seed sizes maximum LAI, CGR, plant height (94.32 cm) productive tillers (PT) (364 m-2), thousand grain weight (TGW) (42.67 g), biological yield (BY) (10.61 t ha-1), grain yield (GY) (4.49 t ha-1) and harvest index (HI) (41.94%) was obtained with 150 kg ha-1 seeding rate and lowest LAI,...

Semra Okur Gumusova1, Gul Fatma Yarim2, Cuneyt Tamer1,*, Ayris Salt2 and Gokhan Inat3

...ls than negative control medium (p<0.001). However, SOD and GPx levels in IPNV infected cells were lover than negative control cells medium (p<0.001). These results indicate that, cell damage in RTG-2 cell line, that is caused by IPNV is assosiated with oxidative stress.

...

Nazakat Nawaz1, Nasir Mahmood Cheema2*, Malik Muhammad Yousaf3, Muhammad Jahanzaib1, Mubashir Ahmad Khan1 and Muhammad Munir4

...ustify;">A high yielding medium duration Virginia semi spreading decumbent-2 groundnut line PG-1090 (BARD-479xICGV-87387) was developed at Oilseed Research Program, National Agricultural Research Center (NARC), Islamabad. The line was evaluated along with six other promising lines and checked across the country. Selection following pedigree method was continued up to F5 generation. The generations, F2 to F5 were raised for consecutive selection as single plant...

Abid Hussain1*, Saifullah Khan2, Shamas Liaqat3 and Shafiullah4 

...ities in use of light to medium type of machinery, adoption of innovative technologies to harvest and use water, use of recommended agricultural production technologies, and through development of related infrastructure. It would require strenuous medium to long term efforts and substantial investments. Similarly, forest land with wood and non-wood products and grazing pastures along with farming and toursims realted
...

Majid Hussain1, Syed Makhdoom Hussain2, Razia Iqbal3, M. Mudassar Shahzad4,*, Syed Zakir Hussain Shah3, Afia Muhammad Akram4, Nisar Ahmad5 and Muhammad Zubair ul Hassan Arsalan2

... was higher (p˂0.05) at medium levels of CA supplementation (2%, 3% or 4% levels) compared to extreme levels (1% and 5%). Maximum body crude protein and crude fat contents were observed in C. mrigala fed 2 % and 3% CA supplemented diets, respectively. Moreover, fingerlings fed CA acidified diets showed significant improvement (p< 0.05) in hematological parameters compared to control diet. Comparison of treatments showed maximum values of RBCs (2.83×1...
Thobela Louis Tyasi1*, Lebo Trudy Rashijane1, Kwena Mokoena1, Kagisho Madikadike Molabe1, Madumetja Cyril Mathapo1, Victoria Rankotsan Hlokoe1, Lebelo Joyceline Selala1, Masixole Maswana1 and Lubabalo Bila2
... and albumen weight than medium and large eggs. While large eggs had a higher egg diameter and shell index.

...

Bridget Adah1*, Clara Kwanashie2, Haruna Kazeem2 and Samuel Mailafia1

...JH) enrichment and basal medium, and identified using dark field microscopy. A total of two hundred (200) blood samples and two hundred (200) urine samples each were collected from pigs in Kaduna state, Nigeria. A total of 9 (4.5%) of the cultured samples were positive for the Leptospira organisms and % isolation from blood sample was 7 (3.5%), while 2 (1%) came from urine samples. Our results demonstrated that the total prevalence of Leptospira organisms in p...

Jiang Wu*

...ively inoculated into LB medium, the OD600 was adjusted to 0.5, and the initial bacterial concentration was adjusted to about 5×108 CFU/mL. T. officinale were dried in a hot air oven, and chemical substances in the dried powder were separated using Soxhlet extraction method with light petroleum as organic solvent. The antibacterial properties of T. officinale extracts against foodborne pathogens were evaluated by agar diffusion method. Sub-inhibitory con...

Amreen Zahra1, Mushtaq A. Saleem1*, Hasnain Javed2 and Muhammad Azmat Ullah Khan3

...4 cells was seen in both medium high and very high viral load categories with a frequency of 19.23% and 76.92%, respectively. Taken together, current study highlights the increased prevalence of HCV co-infection in HIV infected IDUs with lower CD4 count. These results strongly support an immediate investigation of multiple viral infections routine IDUs to guide the eradication of these fatal viral diseases.

...

Shorouk Aladdin Helmy1, Hossam Mahrous Ebeid2*, Mohamed Ahmed Hanafy1, Adel Eid Mohamed Mahmoud1, Reham Roshdy Ali El-tanany1 

...bated in a rumen culture medium collected from sheep in a 3 (sources of clay), 4 (levels of clay), and 3 (protein sources) factorial design. All rations were prepared to be iso-nitrogenous. The results illustrated that humic acid addition had made a significant difference on the amount of degradable dry matter (dDM, g/kg DM), total gas production, per (ml) and (g/kg DM) for the 3 protein sources (soybean, sunflower, and cottonseed meals). All protein sources r...
Mudassar Jehan1, Masroor Ahmed Bajwa2, Mohammad Masood Tariq2, Asim Faraz3*, Abdul Samaad2, Jameel Ahmad1 and Yousaf Hassan Barozai2
...size is concerned, it is medium sized, having fat tail and inhabits in the Northern regions in Balochistan. Molecular studies are the base of breed characterization. Hence, nearly 25 unrelated (including both male and female) animals of Balochi breed were sampled for DNA extraction. Some specific markers (15 out of available 30 SSR markers) were employed in the present study to highlight genetic polymorphism. The PCR was utilized for amplification of individua...
Paulus Klau Tahuk*, Oktovianus R. Nahak T.B., Gerson F. Bira, Adrianus Manek, Donatus Manek, Tobias Y. Purnama, Emanuel Bubun, Bergias Subay
...2 ration which contained medium protein and high energy (13% CP and 72% TDN); and T3 ration which contained high protein and high energy (15% CP and 72% TDN). The level of Gliricidia sepium leaves in each treatment ration was also different, where T1 contained 10% of, T2 contained 20% of Gliricidia sepium leaves, and T3 contained 31% of Gliricidia sepium leaves. Results of the study indicated that the dry matter and organic matter intake were relatively the sa...

Syeda Rubab Zaidi* and Safdar Ali Mirza

...uring this study culture medium and different parameters such as incubation period and inoculum size were optimized and inducers were employed for enhanced production of laccase. Partial purification was accomplished through Ammonium-Sulphate precipitation and for further purification gel filtration and anion exchange methods were used along with protein estimation. The purified fraction was then subjected to enzymatic characterization to find its thermal stab...
Bulkaini*, Syamsuhaidi, Yusuf Sutaryono, Djoko Kisworo, Sukirno, Sukarne, Tapaul Rozi
... size categories 77.67%, medium size 17.51% and small size 4.81%, while quality, which includes quality I, was 63.06%, quality II was 32.68%, and quality III was 4.26%. Broiler chicken pure meat products circulating in the traditional markets of Lombok and Sumbawa were respectively 54.21% and 57.83%. Conclusion: Carcass characteristics and pure meat production of broiler chickens circulating in traditional markets on the islands of Lombok and Sumbawa have met ...

Alsi Dara Paryuni1, Soedarmanto Indarjulianto2, Tri Untari3 and Sitarina Widyarini4*

...ud’s dextrose agar medium. Hair and skin scraping were conducted at the day-1 (pre-treated with ketoconazole). Subsequently, infected cats were treated with topical application of 2% ketoconazole cream, twice a day for 21 days. Results showed that all of cats positive infected with Microsporum canis. Feature of the skin of cats infected by Microsporum canis demonstrates erythema, scale, crust, and circular alopecia. At day-21, antifungal treatment not on...

Xiaowei Huang1, Jinji Wang1, Zhun Yu2, Minghua Duan1* and Zhe Lin1*

...normal saline), and low, medium, high dose of ASP groups (9.0, 18.0 and 36.0 mg/mL, 2.0 mL/kg·d, intragastric gavage once a day for 14 days). On the 15th day, all other groups received 60Co γ-ray irradiation with a total dose of 4.0 Gy except the normal group. The levels of NO synthase (NOS) and NO in serum, the contents of malondialdehyde (MDA) and superoxide dismutase (SOD) in kidney of each group were detected with ELISA after 24 h of irradiati...

Syed Wajahat Husain Jaafry1* and Amber Fatima2

...lants exist through many mediums like damage induced warnings, call for predators, root secretion, and volatile signaling. We found that most of the research has been executed in a controlled environment with a continuous supply of nutrients and water; more field studies should be conducted to assess the behavior of related/ non-related conspecifics. Furthermore, not many studies have focused on kin related plant communication via volatile signals, protein int...

Mohammed A. Almujtaba1, Turky Omar Asar2, Salma Naqvi3, Vikas Kumar4, Fahad A. Al-Abbasi1, Abdulbasit I. Al-Sieni1 and Firoz Anwar1*

...ence of zinc in alkaline medium of Zamzam.

...
Muhammad Jalees
... With the use of digital medium, the telecom industry in Pakistan can utilize its website platform to attract the customer’s demand and its supply chain revenue to achieve a competitive advantage.
...

Umar Farooq Gohar, Attia Majeed, Bushra Muneer* and Hamid Mukhtar

...ers such as fermentation medium, pH, temperature, inoculum size, carbon and nitrogen sources were optimized to attain maximum production of podophyllotoxin. The maximum production of 566.23µg/ml was achieved with yeast extract sucrose broth medium with 15% and 5% supplementation of glucose and peptone as carbon and nitrogen source, respectively at pH 5.5 and temperature 25ºC. The endophytic fungi emerging as an al...

Ghulam Qadir1, Khalil Ahmed1*, Muhammad Ashfaq Anjum1, Quais Muhammad Affan2, Muhammad Zaighum Mushtaq3, Muhammad Amjad Qureshi4, Amar Iqbal Saqib1, Hafeezullah Rafa1, Abdul Wakeel1, Ghulam Shabir1, Muhammad Rizwan1, Muhammad Qaisar Nawaz1 and Muhammad Faisal Nawaz1

...lants can grow under the medium salinity and sodicity level of (6 dS m-1 + 25 SAR). However, biomass yield decreased linearly with increasing levels of salinity and sodicity and a maximum reduction of 63.25% for Podeena, 48.15% for Hina, 54.74% for Qulfa, 32.87% for Methi, 59.77% for Dill and 45.18% for Kalwanji was recorded at the highest level of salinity + sodicity (ECe 8 dS m-1 + SAR 35).

...

Husmaini1*, Sabrina1, Firda Arlina1, Linda Suhartati1, Yozella Martilova2 

... resistance be used as a medium for LAB growth. This study aims to determine the effect of probiotics Lactococcus plantarum and Pediococcus pentasaceus using a purple sweet potato carrier on laying hen’s performance and egg quality. This study used 210 layers of medium-type laying hens, Strain Isa Brown, 38 weeks old. The method used was an experiment with a completely randomized design (CRD) with seven treatments and...

Nuraini Nuraini*, Yuliaty Shafan Nur, Ade Djulardi, Robi Amizar, Yesi Chwenta Sari

...e 1 that 100% tofu dregs medium was the best treatment to improve the nutrient content of the Tenebrio molitor caterpillar. Stage 2 concluded that the Tenebrio molitor caterpillar could be used up to 12% in laying quail rations (substituted 100% fish meal) and maintain the same egg production as control.
 
Keywords | Commercial ration, Tofu dregs, Tenebrio molitor, Nutritional content, Quail egg production
...

Zayed M.A1, M.F. Shehata1, I.M. Ismail1, Mona Mohammady1, M.A. Radwan2*  

...up (G1), nine lambs in a medium weaning weight group (G2), seven lambs in a high weaning weight group (G3) (17.5±1.1, 22.7±1.0 and 28.4±1.1 kg, respectively), and raised for around seven months in an individual housing system. Subcutaneous fat thickness, muscle depth, muscle width, and muscle area at the 12th thoracic vertebrae were measured two times using the ultrasound scan. Body weight and measurements were recorded. All Barki lambs we...
Ahmed H. Massoud1, Mohamed S. Ahmed2, Moustafa Saad-Allah1, Aly S. Derbalah1, Ashraf Albrakati3* and Ehab Kotb Elmahallawy4*
...he control ones, whereas medium and high doses treated rats exhibited adverse signs and symptoms of toxicity. The results also depicted that cymoxanil was the most toxic of the tested pesticides, followed by Malathion and metalaxyl. The obtained histological lesions were correlated with the increased level of biochemical enzymes in target organs. Additionally, hepatotoxicity and nephrotoxicity were obvious in rats treated with cymoxanil, meanwhile, neuronal an...

Habib Ullah Habib1, Malik Muhammad Akram2, Mujahid Ali1*, Tahir Mehmood3, Muhammad Manzoor4, Maqsood Ahmad3, Hasseb Ahsan1, Muhammad Mazhar Iqbal3, Malik Abdul Rehman5, Muhammad Mohsan1 and Ahsan Mohyo ud Din6 

...ze fruits, the weight of medium size, the weight of small size fruits, number of fruits per plant, number of small fruits per plant, number of medium-size fruits per plant, and number of large size fruits per plant. The maximum number of medium-size fruits (15%) was observed at 15% water depletion level with a 50% NPK level. However, the minimum number of medium

Ahmad Nadeem1,2 and Rubina Arshad1,2,*

...illus plantarum specific medium and non-selective media were used for isolation of LAB from plant cuttings. A total of seven isolates were isolated on the basis of colony morphology on De Man Rogosa Sharpe (MRS) agar plates, Gram staining, biochemical tests and molecular characterization. The co-culturing of LAB isolates with fungal cultures (in vitro) showed that among seven LAB isolates, only three possessed antifungal activity. One promising wild type isola...

Nuraini Nuraini*, Yuliaty Shafan Nur, Ade Djulardi, Robi Amizar, Yesi Chwenta Sari 

...e 1. Effect of different medium compositions on the production and nutritional content of Tenebrio molitor larvae. Phase 2. Effect of Tenebrio molitor larvae in the diet on broiler performance. Phase 1 used a completely randomized experimental design (CRD) with six treatments and three replications. The treatment variations were treatments A (100% Concentrate), B (100% Chicken Manure), C (50% Concentrate + 50% Rice Bran), D (50% Concentrate + 50% Chicken Manur...

L. Yue, S. Ahmed†, Q. Liu and H. Jian

...rol treatment containing medium (L.B). In the green house experiments Fosthiazate had significant increased the root length, shoot length and reduced the number of root-knot nematode galls on tomato roots followed by biocontrol agent S. rubrogriseus and Bacillus sp., as compared to the untreated control treatment after 60 DPI and 90 DPI.

...

Reem R. Tahon, Nora A. Shaker* 

... dark green in males and medium brown with light brown patches in females. The cephalothorax was found to have three pairs of biramous maxillipeds. The pereion was connected to five pairs of uniramous pereiopods, the cheliped, three pairs of walking legs, and the last swimming leg. The abdomen of the male was narrow rostrally with a small telson; while the mature female had a broad triangular abdomen with convex sides and a telson with a small broad base. Male...

Farwa Batool1*, Riaz ur Rehman1, Samia Ikram2 and Maham Zahara3

...ly better in alternative medium for the growth of A. commutatum, D. deremensis and A. elatiors. The leaf compost + silt + sawdust + sand (2:1:1:1) is recommended for better yield in foliage plants.

...

Sofiane Tamendjari1,2*, Farida Bouzebda Afri1,2, Lina Chaib1, Hebib Aggad3, Zoubir Bouzebda1,2 

...d. Modified Baird-Parker medium was used for enumeration and isolation of strains, free coagulase and thermonuclease tests were performed as well as other biochemical tests. Antibiotic susceptibility testing was performed to evaluate the resistance of S. aureus to antibiotics. Finally, statistical processing was performed using the STATISTICA 7 software (Statsoft, France). The percentage of samples contaminated with S. aureus was 32.22%, and the average load o...

Abdul Hadi Wasil1,2*, Jasmin Arif Shah1, Nur Bahiah Mohamed Haris1, Sardar M. Hashimi3 and Khal Mohammad Ahmadzai4

.... The results revealed a medium level of knowledge and attitude, and a high level of practice toward organic fertilizer adoption among the almond smallholder farmers. The finding showed that 97.4% of the farmers used cow manure and 20.7% used poultry manure. About 62.9% of the farmers used 0.67-1.08 tons of organic fertilizer per acre and all (100%) farmers used it in the fall season. The result further showed that friends, family members and radio are the mai...
Chalothon Amporn1, Somchit Guntaprom1*, Sarawut Duongmawong1, Wilasinee Srisanyong1, Sirikanda Thanasuwan1, Phalita Koonnadilokpot1, Dechawut Bunyaluk2, Juggrid Jugsumrit3, Jakrit Yaeram4, Chompunut Lumsangkul5
...as the control. IVF-TALP medium was used to fertilize the mature oocytes which subsequently underwent culturing in a simple culture medium (KSOM). The results showed that percentage of matured oocytes, fertilized oocytes, 8-16 cells developments, blastocyst in 100 µM cysteine group (73.00%, 54.79%, 30.14%, and 17.81%, respectively) were higher than the control group (48.00%, 37.50%, 18.75%, and 10.42%, respectively) an...

Aiman Al-Mufarji, Shaker Al-Suwaiegh, Abd El-Nasser Mohammed*

...rtum periods. The small, medium and large ovarian follicles were recoded postpartum on day 18, and corpora lutea (CL) were recorded on day 21. Collection of blood samples from ewes and lambs were performed at -8 weeks and -4 weeks pre-partum, parturition, +4weeks, and +8weeks postpartum. The blood samples were analyzed for blood and metabolic profiles, liver enzymes, and minerals. The results indicated that ewes suffered from thermal stress during the study an...

Saba Iqbal1, Salman Khurshid1*, Hafiza Mehwish Iqbal1, Qurrat-Ul-Ain Akbar1, Aqeel Ahmed Siddique3, Saqib Arif1, Shahid Yousaf2, Masooma Munir4, Abdul Karim Khan4, Shazia Arif5,  Abdul Ahad6 and Muhammad Arif7

... samples belonged to the medium and hard wheat classes. The correlation coefficients (r) evaluated for medium wheat class and hard wheat class were 0.92 and 0.70, respectively. Thus, the NIR spectroscopy technique showed better performance for grains possessing medium hardness. Since the NIR technique is rapid, reliable and does not require expertise for operation, it has a great potential...

J. Salma and F. Shahina

...255, 255);">. Soya flour medium gave the highest population as compared to other media. The minimum multiplication was found in corn flour medium. As compared to cultured separately, the production of infecti ve juveniles increased approximately two fold in assemblage medium. In vivo production of IJs in 

Tae-Kyung Eom1, Jae-Kang Lee1, Dong-Ho Lee1, Ho-Kyoung Bae1, Hyeongyu Ko1, Kyu-Jung Kim1, Sung-Cheol Jung2, Jong-Hwan Lim2 and Shin-Jae Rhim1*

Jie Chen, Qinghua Qiu, Yanjiao Li, Xianghui Zhao, Lanjiao Xu, Xiaowen Xiong, Qingqi Wen, Mingren Qu and Kehui Ouyang*

...erformed in high-glucose medium (4500 mg/L glucose, HGM) or low-glucose medium (1000 mg/L glucose, LGM). Lipid contents in adipocytes were determined by oil red-O staining. Autophagy, adipogenic differentiation and fat metabolism were evaluated by western blot. Subcutaneous pre-adipocytes proliferation rate, differentiation degree and lipid accumulation were higher than that of visceral pre-adipocytes both in HGM and LGM. In...
Hafiz Abdullah Shakir1*, Iqra Javed1, Muhammad Irfan2*, Shaukat Ali3, Muhammad Khan1, Farah Rauf Shakoori1, Javed Iqbal Qazi1 and Muhammad Abrar Yousaf1
... physical parameters and medium components were optimized for maximum tannase production employing Raoultella ornithinolytica in solid state fermentation (SSF) using corn (Zea mays) leaves as substrate to reduce its production cost. The maximum tannase production was obtained with 60% initial substrate moisture contents, tap water as enzyme extraction medium with 2 mL volume, 45°C incubation temperature, pH 7, 300 µ...

Alsi Dara Paryuni1, Soedarmanto Indarjulianto1, Tri Untari2, Sitarina Widyarini3*

Noor Rahmawati, Alfi Rumidatul* and Sopandi Sunarya

...t and sengon wood to PDB medium increased the growth and production of bioactive compounds extracted from fungal cultures. A fungal endophyte extract in ethyl acetate from all media used produced antioxidant compounds with high activity. Antibacterial activity was obtained from the extract of fungal cultures grown on PDB plus Sengon wood floor on day 6 for P. aeruginosa and E. coli, and day 3 for B. subtillis. In general, the three media used in this study enc...

Shabana Noureen1, Shirmeen Ijaz2, Saad Ullah3, Iqra Shafique Abbasi4 and Shakeel Ahmad5*

...st famous and well-known medium for communicating breaking news and digesting bite-sized content and communicating directly with the users in real-time. Currently, it has been used to communicate mental illnesses as well. To examine symptoms and major themes of social anxiety discussed on Twitter A qualitative research design was used in the current research. NCapture was used to randomly select 500 tweets of social anxiety published from 1st January 2022 to 3...

JAVERIA NEHAL1, ARIF MUHAMMAD KHAN1, AZHAR ABBAS KHAN*2, MUHAMMAD MUBIN3, HAFIZ MUHAMMAD TAHIR4 & JAVED IQBAL5

...n loop grown in nutrient medium. Pure bacterial culture of Xanthomonas axonopodis were used for detection by standard PCR. Xanthomonas axonopodis was diagnosed by amplification of 16S rDNA. A fragment of ~1.4 kb was amplified and cloned for sequencing Out of three markers used (K1F-CIT/ K1R-CIT, K2F-CIT/ K2R-CIT, K3F-CUT/ K3R-CIY) K3F-CUT/ K3R-CIY gave best results repeatedly. So this primer pair can be used for identification/diagnosis of Xanthomonas axonopod...
 
 ANSA KHALID, UZMA HAMEED* AND IKRAM-UL-HAQ 
... Pakistan. Sucrose-based medium, supplemented with vancomycin and tetracycline, was used for the selective growth of Leuconostoc species. The obtained isolates were screened by using the shake flask method. The isolate IIB-C9 was selected for the parametric optimization as it gave the maximum activity. Among the 10 different fermentation media screened for enzyme production, maximum dextransucrase activity (9.96 U/ml) was obtained by bacterial strain II...
 
 ANSA KHALID, UZMA HAMEED* AND IKRAM-UL-HAQ 
... Pakistan. Sucrose-based medium, supplemented with vancomycin and tetracycline, was used for the selective growth of Leuconostoc species. The obtained isolates were screened by using the shake flask method. The isolate IIB-C9 was selected for the parametric optimization as it gave the maximum activity. Among the 10 different fermentation media screened for enzyme production, maximum dextransucrase activity (9.96 U/ml) was obtained by bacterial strain II...
 
 MONIS HUSSAIN SHAH1*, RIAZ UR REHMAN2, RIAZ ALI SHAH1, RIZWAN RAFIQUE3, MUHAMMAD USMAN4, SAJIDA BIBI5 AND SADIA YASEEN
...excellent when placed in medium level of 6-Benzyleadenin (20-40ppm with 10-15g/l of Sucrose). The results of 6-Benzyleadenin (20-40ppm with 10-15g/l of Sucrose) are recommended to common retailers for extended storage life of gerbera cut-flower prior to sale. The present substrate is easy to use and non-toxic for extending the vase life/freshness of gerbera cut flower. 
...

Muhammad Akram¹,²*, Rashid Mahmood³, Fahim Arshad4 and Umer Farooq Gohar5

...ere cultured on MS basal medium supplemented with 0.1, 0.5, 1.0, 2.0, and 5.0 µM thidiazuron (TDZ). As a result, 100% callus induction was achieved on the medium containing 1.0 µM TDZ. Notably, calli grown on 1.0 µM TDZ exhibited greater potential for shoot regeneration and proliferation in the growth regulator-free MS liquid medium (95.25%) as compared to the solid

Fang Chen

...were stored in RPMI-1640 medium, which was supplemented with 10% fetal bovine serum, 100 µg/ml streptomycin and 100 U/ml penicillin and kept in humid air containing 5% CO2 at 37°C. The cell assay was performed when the cells were in the logarithmic growth phase. In the cultured H69/apatinib, the IC50 of apatinib was greater than 30nM, while it was about 13μM in H69 parental cells (P<0.05), indicating that the anti-apatinib SCLC cells were succe...

Najamuddin Solangi1*, Mushtaque Ahmed Jatoi1, Adel Ahmed Abul-Soad2, Abdul Aziz Mirani1, Muhammad Aslam Solangi3 and Ghulam Sarwar Markhand1

....3%) and Ajwa (84.3%) on medium comprising of 2,4-D (2.0 mg L-1), 2iP (0.5 mg L-1). Medium comprising of 0.05 mg L-1 2,4-D, 2.0 mg L-1 2iP, 3 g L-1 activated charcoal induced significantly highest somatic embryos in cvs. Begum Jungi (83.3%) and Ajwa (82.6%). Somatic embryos induced in calli after nine months of initial culture were categorized into repeated and non-repeated. Medium compris...

Mahpara Fida Ahmed1, Abdul Hanan2* and Sher Ahmed2

...zes viz: large (8-11 g), medium (5-7 g) and small (less than 4 g) were used. In the second experiment, five treatments (T1 to T5) of row to row and plant to plant distance/spacing viz: T1= 15 cm, T2= 20 cm, T3= 25 cm, T4= 30 cm and T5= 35 cm were used. The results indicated that only large corms produced the flowers while medium and small corms failed to produce flowers. Large corms emerged out in less (46) days, survived hi...

Rogia SA Gomez*, Said H Mbaga 

.... However, for small to medium-scale producers the profitability has been hampered by high incidences of diseases and costs associated with their control. This study aimed to assess the biosecurity practices adopted by broiler farmers in the Pwani region, Tanzania. A structured questionnaire was administered to 78 broiler farmers complemented with on-site observations. Data collected were related to the socio-demographic characteristics, the structure of broi...

Muhammad Zeeshan Siddiqui1, Mujahid Ali2*, Shoaib ur Rehman3, Shahid Iqbal4, Malik Abdur Rehman5, Hafiz M. Tayyab Khan4, Muhammad Ali6, Muhammad Azher Nawaz4 and Saqib Ayyub1

...r emergence, the growing medium was supplied with the lowest NaCl level 2, two medium levels 4, 6, and the highest salinity level was 8 dS m-1 and was compared with the control (1.5 dS m-1 considered as normal). The Hoagland solution was applied every week as a nutrient solution. High sodium contents lead to sodicity. Finally, selected genotypes displayed significantly dissimilar responses toward the concentration of sodium ...

Monis Hussain Shah1*, Riaz Ur Rehman2, Riaz Ali Shah1, Farwa Batool3, Rizwan Rafique4, Muhammad Usman5, Sajida Bibi6, Sadia Yasin7 and Samida Qamar8

...of flower, no. of large, medium and small size of bulbs and number of bulbs harvested. The bulbs were harvested and stored at 5±2oC (In Refrigerator). The morphological attributes of plants were observed better in cv. Antarctica and Oxford. The research was repeated during the subsequent years. The variable response was observed in various varieties of tulip in Rawalpindi climate. The cv. Antarctica and Oxford were observed as best performer wise all th...

Beenish Shahid1* and Muhammad Ijaz Khan2

.... The supplementation of medium with E2+rhFSH+hCG or E2+rhFSH+hCG+insulin also showed a significant increase in the meiotic maturation rate after 24 h (P<0.01 and P=0.04 respectively) and a significant decrease in the degeneration of the oocytes (P=0.001). The addition of insulin was not found to be effective for in vitro maturation. It is concluded that the addition of E2+rhFSH in culture media was found to be the best combination of hormones for in vitro ...

Lianci He1, Dingxi Bai2, Chenxi Wu2, Yizhu Zhong2, Shi Chen2, Xinru Bao2, Jing Gao2*, Chaoming Hou2*

...an Congee group (SXC-L), medium dose Shenxian Congee group (SXC-M), high dose Shenxian Congee group (SXC-M), fluoxetine hydrochloride group (influenza group, FLU) and chronic fatigue syndrome (CFS) group. In addition to the CON group, the remaining five groups established CFS rat models through forced swimming test and chronic restraint stress. After 28 days, the three groups received different concentrations of SXC (1.62 g/ml, 0.81 g/ml and 0.41 g/ml), FLU gr...

Yakun Ge

...nd cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum, 50μunits/mL penicillin and 50μg/mL streptomycin, maintained at 37°C and 5% CO2 in a humid incubator environment. Quantitative analysis of ROS was performed using flow cytometry and median fluorescence intensity detection. Cell proliferation was detected by MTT method. Combined treatment promoted the production of ROS. The cell viability of the combined treatment group was lower...

Rashid Saraz1, Saiqa Amur1, Zia-ul-Hassan1*, Naheed Akhter Talpur1, Inayatullah Rajpar1, Muhammad Sohail Memon2, Muhammad Nawaz Kandhro3, Khalid Hussain Talpur1 and Nizamuddin Depar4

.... Slightly to moderately medium-textured soils were dominant, followed by heavy clays. Majority of soils had high to excessively high salinity (56%) followed by the soils having medium salinity (38%), slightly (46%) to medium alkaline (38%) pH, high (44%) to medium (39%) organic matter content, while soils with low organic matter content was comparativel...

Jaisy Aghniarahim Putritamara1*, MB Hariyono1, Budi Hartono1, Hery Toiba2, Hamidah Nayati Utami3, Moh. Shadiqur Rahman2, Tina Sri Purwanti1

...nning a micro, small, or medium enterprise (MSME) in the beekeeping industry (with business sizes determined based on the number of workers, assets, and turnover as stipulated in the Law of the Republic of Indonesia No. 20 of 2008 concerning MSMEs. The second criterion is having been in business for at least ten years. The findings show that IC mediates CKM in achieving CA. There are also positive impacts of CKM on IC, IC on CA, and CKM on CA. The results indi...

Saddam Hussein Mahmoud* and Shaimaa Nabhan Yassein

...rmation, and chromogenic medium. Hemolysis, phospholipase activities, and biofilm formation were among the virulence tested factors. Hemolysis and phospholipase activities were detected in 76.2% and 83.33% of C. albicans isolates, respectively, while biofilm formation was detected in 100% of C. albicans isolates. The diagnosis was confirmed using 25 of the most virulent C. albicans isolates, by polymers chains reaction (PCR) to detect the KER1 gene revealed th...

Abdel-Khalek El-Sayed Abdel-Khalek1*, Abdelaziz M. Sakr2, Wael M. Nagy2, Hesham S. Abou-Serie2, Entesar Z. Eliraqy2

...xidant capacity of sperm medium after cryopreservation. Tris-egg yolk extender with different levels (0, 4, 8, 12, and 14 mg/ml) of propolis ethanolic extract (PEE) were used. Semen was collected once/week for 20 weeks from five buffalo bulls aged 3.5–5 years. The collected semen was pooled and distributed into five equal fractions, each fraction was diluted with Tris-extender at each level of PEE (PEE0, PEE1, PEE2, PEE3, and PEE4). Semen was gradually d...

Ijaz Ahmad1,5*, Haihong Hao1, Pascal Sanders2, Zafar Iqbal3, Saeed Ahmed4, Farhan Anwar Khan5, Zahir Shah5, Muhammad Ibrahim6 and Lingli Huang1

...78.33%, and 77% for low, medium and high concentration samples. The intraday and inter day relative standard deviation were less than 15%. The Cefquinome were found to be stable for more than 3 month at -70oC (degree symbol) and more than 24 h at 4oC. The present method has been applied successfully for the pharmacokinetics study in cattle. After intramuscular administration, the mean peak serum Concentrations (Cmax) was found 2.95μg/mL and achieved after (...

Asif Sadam1*, Rahmat Ullah Khan2, Karim Gabol2*, Muhammad Awais3,4, Mohammad Ismail1, Sajid Mahmood1, Muhammad Aslam4 and Hamidullah5

... used for the killing of medium-sized and large mammals (golden jackal and wild boar) in the study area. Summer appeared to be the best season for hunting. The interviews with locals revealed that the main purpose of trading and hunting of waterhen includes hunting for entertainment purpose, high economic value of waterhen meat in black market, use as a food item and medicine and game hunting. The local politicians, criminal groups and village headmen provide ...

Erni Damayanti1,2, Herry Sonjaya2*, Sudirman Baco2, Hasbi Hasbi2, Ekayanti Mulyawati Kaiin3

...GF concentrations in the medium of 2-cell to 16-cell ranged from 0.8539 ng/mL-0.2838 ng/mL. The concentration of FGF2 in follicular fluid is 0.629 ng/mL, while the concentration of FGF2 in maturation media, culture media 2 cells, 4 cells, 8 cells and 16 cells respectively, namely 0.032 ng/mL, 0.015 ng/mL, 0.011 ng/mL, 0.009 ng/mL and 0.008 ng/mL. In conclusion, EGF concentration was found more in follicular fluid and culture media and was not found in maturati...

Xiaowei Huang, Yajie Wang, Jia Zhou, Junxiu Liu, Zhe Lin and Ruili Li*

...jiao slurry), SBG high-, medium- and low-dose (SBG-H, SBG-M, SBG-L) groups. After 21 days of intervention, the changes of thymus and spleen indexs were compared, the levels of white blood cell (WBC), red blood cell (RBC), hemoglobin (Hb), hematocrit (HCT) and platelet count (PLT) in peripheral blood were detected, and the changes of hemorheology were observed. Serum levels of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), nitric oxide (NO),...

Nwafili Sylvanus Anene, Ibinabo Jessica

... added to transportation medium as anti-stress. There is the need to train catfish farmers’ on biosecurity measures and record keeping to further drive the growth of aquaculture production in Nigeria.


 

...
Sami Ullah1, Choudary Ihtasham Ali1, Umar Ijaz Ahmed1*, Shoaib Nasir1 and Amjad Masood2
...on the choice of cooking medium. In this study, we have utilized a well-structured and pre-tested questionnaire for data collection from 250 respondents of District Multan. We have employed the logit model to examine the effect of various factors on choice variables. The results indicate that health concerns, urban locality, age, education, family size, and income significantly influence the preference for oil over vanaspati ghee. At the same time, the taste h...

Muhammad Hasnain1*, Ghulam Mustafa2, Asif-ur-Rehman3, Ali Raza4, Abrar Ahmad4, Taj Muhammad4, Muhammad Rafiq Shahid4, Umair Faheem5, Muhammad Shahid4, Muhammad Akram4 and Muhammad Kashif Nadeem5

...rs. It produces small to medium-sized fruits that are flavorful, fragrant, and well-suited for preserving. Assessment of the pre-harvest amino acids application on the postharvest life of mangoes cv. ‘Rataul No. 12’ was done. The effect of amino acids on mango cultivar ‘Rataul No. 12’ with the objective of studying and improving fruit retention, yield, or qualitative and quantitative changes in physio-chemical characteristics during rip...

Mahmoud Abdelhady Metwally1*, Mona Abdelftah Ali1, Farouk Abdelmohdy1, Mohamed Kassab1, Tarek Kamal Abouzed2 and Khalil Fathy Abou-Easa1

...he impact of conditioned medium harvested from BMMSCs on carcinogenesis. This study investigated the effect of BMMSCs-conditioned medium (BMMSCs-CM) on the hepatoma cell line HepG2 and described the underlying molecular mechanisms involved. We isolated BMMSCs and identified them using flowcytometry and culture characteristics, then prepared BMMSCs-CM. HepG2 cells were treated with various concentrations of BMMSCs-CM for up t...

Muhammad Altaf1*, Arshad Javid2, Abdul Majid Khan3, Sadia Nazer4, Irfan5, Khalid Javed Iqbal6, Muhammad Sultan Haider7 and Sana Ashraf7

...at preferences of large, medium and small mammals varied significantly. A decrease in mammalian diversity was observed from forest habitat to urban landscapes. Indian wild boar, Asiatic jackal, Indian fox, jungle cat, Indian pangolin and long-eared desert hedgehog preferred forested areas as well as slightly modified habitats while northern palm squirrel, house mouse, house shrew and rat species preferred human habitations. Similarly, a few species like small ...

Erni Damayanti1, Herry Sonjaya2*, Sudirman Baco2 and Hasbi Hasbi2

... were matured in TCM 199 medium, were fertilized and were cultured using CR1aa medium for 48 h. After 48 h of culture, the embryo developed into 2, 4, 8 and 16 cells. Furthermore, it was grouped based on the stage of development, each of which was re-cultured for 48 h. After that, its development was re-evaluated and H2O2 measurements were taken. The 2-cell embryo was not able to reach the morula, while stage 4-, 8- and 16-c...

Putu Henrywaesa Sudipa1*, Hapsari Mahatmi1, Ketut Tono Pasek Gelgel1, I Gusti Ketut Suarjana1, I Nengah Kerta Besung1, Romy Muhammad Dary Mufa2 , I Wayan Sukernayasa3 

...uo;s dextrose agar (SDA) medium and identification was performed macroscopically by observing colony growth and microscopically using the tape smear method stained with Methylene Blue stain. The results showed that 32 fungi belonging to seven genera were isolated from 22 Bali cows. The prevalence rates of Aspergillus, Fusarium, Cladosporium, Curvularia, and Candida, Mucor, and Penicillium spp. were 41, 25, 19, 6, and 3%, respectively. These data add important...

Ferry Lismanto Syaiful1*, Jaswandi Jaswandi2, Mangku Mundana2, Ilham Ilham2, Novirman Jamarun1, Efrizal Efrizal3

...arturition. The research medium used was green bean seeds. Then use urine and water samples. The urine samples used in this study were 120 samples. The dosage uses the ratio of mixing urine and water 1:12 mL, 1:14 mL, and 1:16 mL. The variables of this research are accuracy, sensitivity, and the phases of local buffalo pregnancy. This research shows that the level of local buffalo on the days-21; 42; 63 after AI is 7.50%; 55%; and 70%. The accuracy of local bu...

Raed Hussein Salih Rabee1, Yahya Sabah Abdulameer1, Walla Farhan Obed1, Noor R Abady1, Adnan Mansour Jasim1*, Firas Hussein Albawi1, Mohammed Jasim Jawad2, Ahmed Samir Abukhomra3

...ing it on MacConkey agar medium. In this study, a total of one hundred chicken chicks were reared, and on the tenth day of the experiment, they were divided into five equal groups:NCG: This group represented the control and was given normal drinking water. T1: The chickens in this group were orally inoculated with E. coli at a dose of 0.5 ml containing 6x108 CFU/ml of E. coli. T2: The chickens in this group were orally inoculated with E. coli at a dose of 0.5 ...

Ehtesham Khan, Talha Ahmed, M. Irfan Anis* and Syed Ahsan Rehman

...ture as soil is just the medium for the plant for nutrients ingestion. As nutrients are supplied in an air water culture in the form of mist directly to the roots. This type of farming uses the micro elements from the nutrient solution in the form of mist in a more efficient way than from soil. In this paper a goal of an automated aeroponics farming is advances in which focus is on eliminating present agricultural problems of Pakistan like water shortage, pest...
Waheed Ahmad1, Muhammad Tayyab1*, Bushra Muneer2*, Abu Saeed Hashmi1, Mansurud Din Ahmad3, Shagufta Saeed1, Muhammad Nauman Aftab2, Sehrish Firyal1, Muhammad Wasim1, Muhammad Azam4, Muhammad Talha5 and Ali Raza Awan1
...S-4S using Luria Bertani medium and it was used as supplement in poultry feed trial. The data were statistically analyzed by Multivariate Analysis of Variance. For feeding, 150 day-old broiler chicks were divided randomly into 5 groups having 30 chicks each. Group A served as negative control, group B, C and D as experimental groups which were supplemented in the basal diet with 2500, 5000 and 7500 IU/kg of locally characterized thermostable protease while gro...

Ying Chen1, Chao-Zheng Li2, Zhun Yu3, Jia Zhou4, Yan Xu4, Zhe Lin4, He Lin4* and Xiao-Wei Huang4*

...LZ, 20 mg/kg), VAP high, medium, low dose (VAP 300, 200, and 100 mg/kg) groups. After 21 days of intragastric administration, the electrocardiogram (ECG) changes in each group were detected. The activities of lactate dehydrogenase (LDH) and creatine kinase-MB (CK-MB) isoenzymes in serum, and superoxide dismutase (SOD), malondialdehyde (MDA), glutathione peroxidase (GSH-Px) and catalase (CAT) in myocardial tissue were detected by ELISA. Hematoxylin and eosin (H...
Hina Mumtaz, Muhammad Zeeshan Majeed*, Muhammad Afzal, Muhammad Arshad, Arif Mehmood and Muhammad Qasim
...48 h of application. The medium dose rate of abamectin (4000 ppm) and chlorantraniliprole (600 ppm) also showed 100% larval mortality at 48 h of application. In semi-field and field conditions, chlorantraniliprole showed 100% larval mortality at 48 h, while abamectin and chlorpyrifos showed 87–89% and 94–81% larval mortality respectively in semi-field to field conditions after 72 h of application. Overall study results demonstrate the effectiveness...
Rabiea Pervaiz, Shaista Bano*, Sarfraz Ali Tunio, Abdul Nabi Jatt and Aisha Amber Soomro
...zoidal colonies on solid medium. The present study was aimed to explore antibacterial properties of B. pseudomycoides isolated from the rhizosphere soil of the indigenous Mangifera indica (mango) plant. Identification of the isolated strains was determined by sequencing their 16S rRNA genes. The isolates identified as B. pseudomycoides were screened for their antibacterial potential. In order to circumvent the trouble created from rhizoidal colony morphology o...
El-Dougdoug. K.A.1, Mervat, M. Fath Alah2, Reham A. Hassen3,Rehab A . Dawoud2
...antlets were found by MS medium treated with culture filtrates based on reduction of PVY infection, disease severity, biochemical changes accompanied to induced resistance (the high level of endogenous salicylic acid, protein content, chlorophyll contents and peroxidase and polyphenol oxidase activities as well as

Mansour, Abeer E.M.; Khodeir, M.H. and Hussein, A.M.H.•

...bottle in the inoculum's medium and the third batch received 1gm of mono basic sodium glutamate (MSG) /liter. Titration of individual bottles and pooled harvests of FMDV and complement fixing antigen revealed that CaC12 and MSG induced higher values than that obtained with the blank control batch where Ca C12 potentially facilitate the adsorption and penetration of FMDV to BHK cells increasing the virus attachment to the cell receptors. On the other side, MSG ...

El-Dougdoug2, Kh.A; Ghalyl, M.F. and Tahal , M.A.

...lycerol asparagine broth medium and the culture supernatants obtained were filtered through 0.45 pl filter. These isolates were tested in two experiments for their ability to control a Cucumber mosaic virus (CMV). In the 1st experiment, One half of leaves of Chenopodium amaranticolor were treated with culture filtrate (CF) followed by CMV inoculation on both halves. In the 2nd experiment, The first pair of Cucumis sativus leaves were teated CF with CMV mechani...

Ahmed*, Amal A.; Khatab*, Eman A.H. ; Dawood*, Rehab A. and Ismeil*, Amira .M.

...re . Murashige and Skoog medium (MS ) supplemented with (0.2 mg/L BA ) and (Img/l BA and 0.5 mg/L kinetin ) were used for proliferation and micropropagation of the infected shoot clumps respectively. The plantlets were rooted in MS medium supplemented with (1.5 mg/l NAA ) . Plantlets regenerated from meristem measuring 0.1 mm and 0.2 mm yielded (90 and 80 % ) for CLV and (92 and 80 ) for CarVMV virus-free tested plantlets re...

El-Sayed • l , Eman H; Mahfouze , Sherin A.; Shaltout ,A. D.; El-Dougdoug3 ,Kh. A. and Sayed1 , R. A.

...stem were cultured on MS-medium supplemented with different concentrations of 2, 4-D (2, 4 and 6 mg/l) 6-Benzylaminopurine (6, 7 and 8 mg/l), and Sodium Aide ranging from (1, 2 and 3 mg/l) for induction of mutation. In vitro screened plants after rooting were hardened and acclimatized in the glass house and were shifted into the field. Field screening was carried out against two different isolates of (BBTV and BMV) by using syringe method of inoculation. It wa...

El-Tabakh, SAA l ; Abdel Wahab, KSE; Badr, AF   and Helal, IG  

...dified minimum essential medium (DMMM) as growth medium with 10% fetal calf serum and antibiotic mixture (IOOU penicillin and 100 mgm streptomycin/ml) and subcultured at 3-4 days. HepG2 cells were maintained throughout the experiment in Ham F-12 medium maintenance medium with 2% fetal calf serum; 1000 IU penicillin and 1000 mgm streptomycin antibiotic mi...

Sabry Y. M. Mahmoud; Maher H. Hosseny and Mamdouh H. Abdel-Ghaffar

... (RBV); it is showed the medium rate of virus elimination (30.0 - 42.9% virus-free plantlets) when added to the tissue culture media. Several stems including axillary buds were excised from the potato plants grown for 45 days and electric-shocked treated. Stems were directly connected to the electrodes of power supply or indirectly by immersion of plant tissue in electrified  water in a wide range of intensity-time. Axillary buds excised from electric-sho...

Sahar, A. Youssef t ; M.M.A. Al-Dhaher 2 and A.A. Shalaby 

...tip culture. Woody plant medium supplied with benzylamino purine (BAP) (1.5 mg/L) for shoot proliferation, and Indol butyric acid (IBA) (0.05 mg/L) for plants rooting. Before acclimatization, the plantlets were submitted to DAS-ELISA and RT-PCR in order to evaluate virus eradication. GFLV- and GLRaV-l-free plants (92.5 and 95 %, respectively) were obtained from the optimum size (I mm) of meristem tips (as indexed by DAS-ELISA). Of these, 85 and 87.5 % plants w...

M.A. Abo-EInasr l, Kh.A. EL-Dougdougl, M.H. El-Kattan2 and L.A. Salem2

...s other chemicals gave a medium ability to induce SAR and gave varied values.

...

S.A. Sidaros1; R.A. Omar; S.A. El-Kewey l and Samaa Abd El-Khalik2

...tems were cultured on MS medium amended with 0.5 mg/L BA (Benzyle adenine). The best size for virus elimination and survival plants was 3 mm long whereas 5 mm long produced highest survival plants without virus elimination and I mm long failed to produce survival plants in two of the tested three cultivars. The suitable medium was MS + 0.5 mg/L BA that produced 33.3% survival plantlets whereas MS + 0.1 mg/L NAA + 0.5 mg/L BA...

Makmun1, Imam Mujahidin Fahmid2, Muhammad Saleh S. Ali2*, Muhammad Yamin Saud2, Rahmadanih3

...ness were small farmers, medium farmers, large farmers, farmer groups, poultry shops, the Animal Husbandry Department, Ministry of Agriculture-Directorate General of Livestock and Animal Health, feed/medicine companies, egg collectors/middlemen, local traders, inter-regional/island traders, and cooperatives. The growing demand for chicken eggs and the rapid capital turnover that is the primary incentive for business actors to pursue the chicken farming industr...

Nurlan Akhmetsadykov1*, Tanatar Kydyrov2, Moldir Akhmetzhanova1, Gulnazi Akhmetova3, Maxat Berdikulov4 

... From a 500 ml of growth medium, a total of 3.4 mg of recombinant protein was successfully obtained. A recombinant GM6 antigen of T. evansi encoding a 30 kDa polypeptide was developed, which has diagnostically significant sensitivity in the enzyme immunoassay at a dilution of 1:6400 with sera of horses and donkeys infected with trypanosomosis. The proposed test system can be used for diagnosis of trypanosomosis in the early stages of the disease. 

...
Saliha Bashir*, Muhammad Shafique, Muhammad Shahzad, Muhammad Sohail Anjum and Ahmad Ali Shahid
...%). Contrarily, light to medium brown skin color was recurring (55%) in Punjab whereas lighter skin color prevailed in KPK (69%). Furthermore, Fuchs’ crypts were significantly correlated with contraction furrows in both populations. Likewise, crypts were significantly associated with Wolfflin nodules and furrows were significantly related to conjunctival melanosis and pigment spots in KPK sample set. Based on unique iris patterns, these phenotypic traits...

Rahmat Rahmat1, Muhammad Yusuf2*, Abdul Latief Toleng2, Herdis Herdis3, Athhar Manabi Diansyah2, Hasrin Hasrin4 

...ould be used as a sexing medium and maintain characteristics sperms with any concentrations, and can change the proportion of spermatozoa effectively from the natural proportion of spermatozoa.  

...

Haseeb Zafar1, Asghar Ali Kamboh1*, Zain-Ul- Abideen1, Muhammad Kamran Taj2, Sibtain Ahmad3 , Umbreen Zafar2 

...e agar) and differential medium (MacConkey’s agar) plates and incubated at 37°C for 24 hours. After isolation, organisms were further identified through Gram staining, and different biochemical tests. Among the total samples, 92(61.33%) showed positive growth of E. coli whereas 58(38.6%) samples were negative for E. coli. Source-wise distribution results showed that E. coli was mostly isolated from water samples (88%) followed by cecal samples (80%),...

Xiangmei Chen, Burie Bao* and Mo Degema

...tformin group, and low-, medium- and high-dose camel placenta groups. A high-fat and high-sugar feed combined with intraperitoneal injection of STZ dissolved in a citric acid-sodium citrate buffer was used to establish a rat model of hyperglycaemia. Metformin hydrochloride tablets were used as a positive control to detect fasting blood glucose. The contents of glycated haemoglobin (HbALc), insulin (INS) and glucose (GLUC3) as well as the protein expression and...

Muhammad Nadeem1, Muhammad Naveed2,3*, Muhammad Shafiq2, Irfan Rasool2 and Muhammad Afzal Zahid2

...cm tall, semi-erect, and medium in canopy spread. Its grains are light brown, ram-headed, medium in size with a 100-seed weight of 25 g. Adoption of this cultivar across different climatic regions of Punjab, and other provinces could contribute in attaining self-sufficiency in local chickpea production as well as plummeting import bill.

...

Peixia Yu1*, Lijun Bo2 and Xueyin Song1

...(NS) I/R group, and low, medium and high dose Fen groups, where in high dose group: Fen1:2μg/kg; Fen2:4μg/kg; Fen3:6μg/kg. The measured items included heart rate (HR), mean arterial pressure (MAP), left ventricular developed pressure (LVDP), ±dp/dtmax, malondialdehyde (MDA), superoxide dismutase (SOD) activity, creatine phosphokinase MB (CK-MB) and cardiac troponin-I (cTnI). The total apoptotic cardiomyocytes, B cell lymphoma 2 (Bcl-2) and Bax ...

Cut Intan Novita1,2, Kartini Eriani3, Amalia Sutriana4, Tongku Nizwan Siregar5,6*, Ni Wayan Karja7

...roups: the vitrification medium group without Bovine Pituitary Extract (BPE, GibscoTM) (1 ml PBS + 0.5 M sucrose + 30% ethylene glycol) and with BPE addition (1 ml PBS + 0.5 M sucrose + 30% ethylene glycol + BPE 30 μg/mL). Each group was separated into three vitrification times of 0, 7, and 14 days with three replications. The results showed that adding BPE to the vitrification medium increased the number of intact follic...

Moazama Batool1*, Saima Naz2*, Sheeza Bano1, Sadia Nazir3, Ghulam Abbas4, Ahmad Manan Mustafa Chatha5, Maria Lateef2 and Fatima Yasmin2

...ncentrations in the test mediums and carbon dioxide, sodium, potassium, and electrical conductivity. On the contrary, a negative correlation was established between dissolved oxygen levels and both fish species in the test environment. These findings contribute to understanding the differential responses of Catla catla and Labeo rohita to the toxic effects of lead, nickel, and cadmium mixture.

...

MADIHA AFTAB1, ARIFA TAHIR*1, TAYYABA ASIM1 & IRFANA MARYAM2

... obtained by using AFM02 medium containing g/L: sawdust, 5.0; glucose, 5.0; peptone, 6.0; MgSO4.7H2O, 0.25; KCl, 0.5; KH2PO4, 0.025. Optimized conditions for maximum enzyme yield were inoculum size 2.5%, Temperature 25˚C, pH 4.5, incubation period 7 days and moisture content 60%. Eleven different inducers were evaluated but FeSO4.7H2O showed maximum enzyme production (2156±0.57 U/mL/min). By using these statistical techniques more than 13 folds increas...

HANNANA MARYAM, SANA MAQSOOD & SIKANDER ALI*

...when the parameters like medium volume, buffer pH (7.0) and incubation temperature (37°C) were optimized. Antimicrobial potential of laterosporulin was also exploited using various techniques. Minimum inhibitory concentration (MIC) and critical dilution assays (CDAs) were performed for exhibiting bacteriocin inhibitory potential against various indicator strains including Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa and Azotobacter sp. I...

MUHAMMAD SHRAFAT ALI1, UZMA HAMEED2* & IKRAM-UL-HAQ3

...ion of B. subtilis in NB medium followed by 24-48 hours incubation in a shaking incubator at 30°C. Spore staining and microscopy were performed at different time intervals to find out the sporulation status and time required for the completion of sporulation. However, sporulation of the Bacillus strain completed after 22 hours and the total viable count (TVC) was found to be 8.3 x 1023 CFU/ml (OD 1.872). Similarly, optimization of temperature (30°C) an...

Aspen Abutalip*, Batyrbek Aitzhanov, Assiya Mussayeva, Vladislava Suchshikh, Natalya Yegorova

...on results in a reaction medium from two crosses or more. This was done by isolating the pathogen during microbiological cultivation. Therefore, the high correlation (r=0.76, P<0.05) between the results of express testing and the detection of the pathogen by bacteriological cultivation, as the main diagnostic method of emphysematous carbuncle, allows recommending its use if it is necessary to diagnose the disease in pasture conditions quickly. 
...
Sanaullah Sattar1, Ali Hussain1,2*, Javed Iqbal Qazi2, Arshad Javid1 and Shahid Mehmood1
...ormed in water as liquid medium and the processed clay as the solid medium without and with the provision of Postgate B medium. After 60 days of anaerobic incubation, corrosion rate (CR) and average percent weight loss (APWL) of the steel pieces were calculated. Higher CR and APWL were observed in the liquid medium (water) than in the solid

Khalid Ali1, Asif Tanveer1, Naila Farooq2, Tasawer Abbas3*, Ghulam Sarwar2, Muhammad Ather Nadeem4, Ishtiaq Hassan3, Muhammad Mansoor Javaid4, Anees-ul-Hussnain Shah5, Bilal Ahmad Khan4 , Ali Raza6

...t sizes including small, medium and large. Results revealed that R. capitata can germinate over a wide range of salt stress but as the salinity level was increased to 250 mM the germination percentage and seedling growth decreased significantly. Larger seeds have more potential to germinate and grow vigorously at an increased salt concentration as compared to medium and small seeds. Salt stress caused 40-73%, 59-96% and 40-1...

Iqra Haider Khan1, *Arshad Javaid1 and Nadeem Shad1

...ut in malt extract broth medium. In general, all the concentrations of the four
organic solvent fractions significantly controlled the growth of A. versicolor. There were 71–
100%, 59–100%, 65–100% and 69–100% decline in the biomass of A. versicolor due to nhexane,
chloroform, ethyl acetate and n-butanol fractions, respectively. It is concluded that
different fractions of leaf extract of C...
Zahid Mahmood1, Mohammad Salim2, Nowsherwan Zarif1, Zahid Rauf1, Muhammad Naqash1 and Ahmad Hussain3
...ng and compression, with medium hardness; Eucalyptus citridora was hard with medium to very high strength properties, Eucalyptus camaldulensis was high in both density and compression strength, low and very low in bending and elasticity respectively having medium hardness. Paulownia catalpifolia and Paulownia fortunei both were low in strength. Furthermore, Euca...
G. M. Nasir
...ao and Anjir wood may be medium in strength as the fibers are comparatively thin-walled. In order to increase service life, preservative treatment of wood before utilization may be necessary for all the studied species because of larger size or higher frequency of wood rays. Lasura, Shreen, Dhak, Tun and Ritha wood can be easily treated with chemicals and seasoned as the vessels are sufficient large in diameter whereas, Kao and Anjir wood may be somewhat diffi...
Tanvir Hussain, Zahid Rauf and G. M. Nasir
...hat Kasunder wood may be medium, Geiray better and Quercus wood may be good in strength. The wood of all the species may be less resistant to biological agents however, the seasoning and preservation behaviour of the woods may be slow. Based on the results of strength properties the wood of Fraxinus xynthoxyloides and Alnus nitida can be used in making items where minimum forces and loads act on the wood. Quercus wood has very good machini...
Ghulam Mustafa Nasir, Tanvir Hussain and Khalid Hussain Sulangi
...an wood may be better or medium in strength due to longer, thick-walled or narrow lumened fibers. The wood of all the studied species may be somewhat non-durable because of higher frequency or larger size of wood rays and need preservative treatment before utilization in order to increase service life. Tut, Siris, Anjir, Willow, Kiker, Kangar Robinia, Gurgrua and Barh may be easy to season and preserve owing to higher frequency or larger size of vessels howeve...
Ghulam Mustafa Nasir and Hakim Shah
...oth were found to have a medium value of average annual ring width....
Zahid Rauf and Syed Jawad Raza
...ood for manufacturing of medium strength requiring furniture articles, cabinet work, etc. Moreover, results of the pulping characteristics showed that, small sized timber, like tree branches, wood shavings, sawdust, etc., of the species could also be used as raw material for pulp and paper manufacture....
Ghulam Mustafa Nasir and Khalid Hussain Solangi
..., the fibers were short, medium in diameter, wide lumened, fairly thick-walled and occupied about one third volume of the wood. The vessels were medium in frequency, smaller in diameter and engaged minimum volume of the wood. The wood rays were medium in frequency, a bit larger in size and occupied almost one third wood volume as fibers. The axial parenchyma was abundant and also occupied ...
Ghulam Mustafa Nasir
...s. The Apple wood may be medium in strength and comparatively soft because of thin-walled and wide lumened fibers. The wood of all the studied species may be non-durable due to higher frequency or larger size of wood rays and need preservative treatment to increase the service life. The process of wood seasoning and preservation may be slow because of small to medium diameter of vessels however Mulberry and Ash wood could be...
Ghulam Mustafa Nasir
.../i> wood, the fibers are medium in length and reasonably thick-walled. The vessels are small in diameter and lower in frequency. The wood rays are higher in frequency and a bit larger in size. The wood may be better in strength and can be used for various wood products. Preservative treatment of wood before utilization may be required to increase the service life. However, the process of preservation and seasoning of wood may be slow. ...
Ghulam Mustafa Nasir
..., Alstonia and Jacaranda medium and that of Sohanjna weak in strength on the basis of fiber morphological characteristics. The wood of all the studied species may be somewhat non-durable because of higher frequency or larger size of wood rays and need chemical treatment before utilization. However, Neem, wood may not require preservation due to its chemical composition. Preservative treatment and seasoning of wood of all the studied species (except Sohanjna) m...
Tahir Laeeq1, Tariq Mahmood2 Mohammad Amin3 and Khurshid Alam4
...e. gentle slope (0-30%), medium slope (30-60%), and steep slope (>60 %). A transect line of 100m length was laid along each treatment and replicated 5 times. On each transect line the infiltration rate (cm/hr) was determined with the help of double ring infiltrometer at mid point. Similarly for soil bulk density and soil moisture contents percent, undisturbed soil samples were collected using Galvanized iron sampler of 6cm in length and 5 cm in diameter. Resul...
Amjad Ali Ch., Javaid Ahsan, Tariq Mehmood, Shahzad Fazal, Punjab Forestry Research Institute, Faisalabad and Nowsherwan Zarif
...ght large farmers, eight medium farmers, sixteen small farmers and thirty two landless persons were interviewed. At Govt. level, all range personnel were also interviewed. The number of livestock kept was highly correlated with the size of landholdings of people. Major source of income was from livestock rearing. For grazing purpose, the dependence of people on vegetation of Govt./state owned Rakhs varied from 74-99.9 percent. More than 52 percent forage requi...
Tanvir Hussain
... Murashige & Skooge (MS) medium, Gamborgs B5-salt (B5)and Basal nutrient medium (BNM) alone and in combination with Auxins and Cytokinins. It was found that only the axillary buds gave good response to all media. For callus initiation, same ex-plants and media (alone and in combination with callus initiators) were tried but callus formation was not observed. Aseptically grown young plants were then transferred to hydroponic ...
Ghayyas Ahmad, Anwar Ali, Miskeen Ali and Irfan Akhtar
...the production of low to medium quality timber. This long term study, covering almost the complete rotation length of the Hybrid poplar, was conducted to find out the effects of three different intensities of pruning i.e. pruning upto ½ height, pruning upto ⅓ height and no pruning, on its diameter and height growth rate. The Randomized Complete Block Design was used. Data were analysed using the Analysis of Variance procedure and the Duncan multiple...
Nasreen Fatima, Tanveer Ahmad Qureshi and Kanwar Muhammad Suleman
...d for the manufacture of medium density particleboard. The panels of particleboard were manufactured from the flakes of ailanthus wood at compression ratio 1.1 and 1.2 with board density 733 and 784kg/m3. Physico-mechanical properties of the boards indicated that a quality particleboard can be manufactured from ailanthus wood. At compression ratio 1.1, strength properties i.e. MOR 446kg/cm2, MOE (48348kg/cm2, SWR 155 kg exceede...
G. M. Nasir and Noreen Fatima
..., Lasura and Jand may be medium and Gul-i-Nishtar light in strength. Due to abundant axial parenchyma, higher frequency or larger size of wood rays, the wood of all the studied species need preservative treatment before their utilization. The vessels are larger in diameter in Gul-i-Nishter, White Siris, Pipal and Lasura wood, and these can be easily seasoned and preserved. Whereas, in Phulai, Black Siris, Ipil Ipil and Jand, the vessels are
Iqbal Mahmood and Tanvir Ahmad Qureshi
...ombax ceiba) were of medium movement (3-4.5%) while deodar (Cedrus deodara), babul (Acacia nilotica), shisham (Dalbergia sisso), black siris (Albizzia lebbek), white siris (Albizzia procera) and mango (Mangifera indica) displayed small movement (< 3.0%).

Key words: Wood species, Tangential Movement, Radial Movement.

...
Aman Ullah Bhatti, Shamsher Ali and Farmanullah Khan
...ept one sample which was medium in subsoil. About 83% in the surface soil and 94% in the subsoil of the samples were found low (<1%) in organic matter. Soil K was found in adequate amount with low variability having CV=6.81% and 6.43% in surface and sub-surface soil, respectively. In the field of agricultural crops (wheat) the CV values for EC and P were 34.9 and 49.98% for surface and 32.02 and 29.48% for sub soil, respectively. Based on critical level, soil ...
Khalid Hussain and G. M. Nasir
... the fibers were longer, medium in diameter, wide lumened and fairly thick-walled due to that the wood may be relatively better in strength. The vessels were lower in frequency but quite larger in diameter and the wood can be seasoned without any difficulty. The wood rays were medium per unit area and in size. The axial parenchyma was abundant, occupied approximately one third volume of the wood for the reason; the wood may ...
Tanvir Hussain, G. M. Nasir and Ayaz Khan Marwat
...that that the wood is of medium strength and may be used in furniture, flooring and construction where medium strength is required, however, chemical treatment of the wood before utilization with preservatives is prerequisite and can favour its endurance against biological deteriorates. Moreover, pulp and paper products may also be manufactured from this species....
Wali-ur-Rehman
...nfested by the pest from medium to heavy at Singal (60-80%), Jaglot, Sherqilla and Ghich (50-70%) each, while its damage on P. alba ranged from 5 to 30% in these areas....
M. Mohiuddin and R. Ara
... bag containing a sowing medium of nursery soil and cow dung (3:1), was determined. Seeds of all three species, soaked in water for 24 hours before sowing and sown directly in polyethylene bag, showed best germination percentages. The results of the study suggest that longer water soaking period of seeds and sowing in polyethylene bag with high temperature could be recommended for better seed germination of all three species studies....
Mohammad Ayaz
.... Mazri fibers being medium long can supplement hardwood and non-woody pulps as pulp furnish. At present low and scattered supplies and competition from traditional uses are the technical and economic constraints in it's utilization as a raw-material for pulp and paper....
Shaukat Ali
...s minimum in N stressed medium while number of nodules were a little less than maximum. Root weight increased significantly with 100 ppm of nitrogen while there was slight increase in nodulation. Frequent application of N resulted in increase in root weight while a reduction in the number of nodules was recorded. Phosphorus fertilization increased root weight but there was no effect on the number of nodules with phosphorus alone....
Wali-ur-Rehman
...oss rated as heavy (8%), medium (8%) and Light (11%)....
Muhammad Shabir Mughal
...erms. It is dioecious, medium sized, evergreen tree, bark reddish-brown to grey, vertically fissured, exfoliating in fibrous strips. Leaves of two kinds; one sharp and needle like and the other flat and feather like or scale-like, closely pressed, with a large oblong elliptic glands in the center of the back. Flowers unisexual, the male at the tips of the branches, the female terminating short side branchlets. Flower appears between May and June an...
K. M. Siddiqui
... under four consecutive medium-term (five year) plans. The first three Five-Years Plans (1955-70) were implemented while the Fourth Plan (1970-75) had to be scrapped due to separation of the former East Pakistan. Thus, the country had to resort to adhoc planning on an annual basis and it continued for six years (1972-78). Again since July 1, 1978 the medium-term plans i.e., Fifth, Sixth and Seventh Five-Year Plan ...
Mohammad Arif Chaudhry and Ashraf Hassan Chaudhry
...wn pigmentation on solid medium. Though Qmod medium proved to be the best for isolation but it showed maximum growth on P+N and tween-80 media, in 28 days. In the absence of combined nitrogen, the strain CN5 fixed nitrogen showing acetylene reduction assay (ARA) and was found highly sensitive to higher concentration of NaCI (500mM in yeast extract-dextrose medium). This strain gave ...
Wasif Hussain Bokhari
... iebbek (Siris) is a medium sized fast growing tree, native in Asia which was named after Albizzi, an Italian naturalist of the 18th Century (Parker, 1921). Its natural range extends from latitudes 8° N to 32° N through eastern Pakistan, India, Bangladesh, Siri Lanka, Burma, Afghanistan, Iran, Iraq and Egypt. There are extensive plantations of Siris in Nepal and in central and southern India (NAS, 1983). Siris is characterized by a spreadin...
J.O. Adegbehin, S. Nokoe, J. A. Okojie and G. O. Otegbeye
...cies within the low and medium altitude areas (600 - 1200m) of that part of the country. Growth data from permanent sample plots from the Northern parts of the country showed that, on average site, P. caribaea var. hondurensis attained a top height of 23.4m at a reference age of 20 year and that a maximum mean annual increment (M. A. I) of 24.2m3/ha/yr could be obtained at age 30 with an overbark total volume production of about 726m<...
Rehana Perveen, Mehmood Akram and Ihsan Ilahi
...entina on Knop's medium supplemented with 1mg/1 of NAA exhibited vigorous growth when transferred to MS medium supplemented with 1 mg/1 both of Naphthalene acetic (NAA) and Benzyl amino purine (BAP). The effect of varying concentrations of NAA &BAP alone and in combination with each other was studied on further growth and differentiation of the callus. At NAA 1 mg/1, BAP 0.5 mg/1 NAA 0.5 mg/1 roots developed a...
Q. N. Javeed, Rehana Perveen, Imtiazul Haq and Ihsan Elahi
...s was studied. Basal medium used was that of Murashige and Skoog's. The effect of auxins, kinetin, coconut milk and casein hydrolysate was studied on induction and further growth of callus. Auxins were NAA (0.05, 0.1, 0.5 and 1.0 mg/1). Cytokinin used was BAP (1.0mg/1). Our results indicated that size of the explant, presence or absence of apical bud, controlled conditions of light and temperature are important factors in callus formation. A successful ...
Wali-ur-Rehman and M. Ismail Chaudhry
...ern aspects was 506 with medium defoliation while in most shady places and deep nullahs defoliation was either light or negligible with lowest population (208 per tree). An average population of 1788,794, 571and 208 larvae per tree, respectively caused complete, heavy, medium and light defoliations....
M.A. Quraishi, A. Khalique, Shahida Perveen and Perveen Akhtar
...s. Caragana is a medium sized bush growing on gritty sites while Pervoskia is a herb with bulbous thick tap root, lush green and a dominant colonizer of river beds and leaves (Zellar and Beg, 1969)....
Mohammad Hafeez
...>Acacia modesta is a medium sized thorny deciduous tree with a bushy rounded crown and drooping branches. Bark is rough with numerous irregular cracks. Sap wood is generally white and heartwood is dark brown. Leaves are broadly ovate or obovate, oblique and abtuse. Flowers are pale in colour.
It is a very slow growing tree. It obtains a height from 20 to 30 feet. It occurs more or less gregariously in dry hills up to 4,000 feet. It is found in various...

Ahsan Abbas Abro1, Imrana Khushk1, Abdul Nabi Jatt2, Chaudhary Haider Ali3, Abdul Sattar Qureshi1*, Farah Naz Talpur4, Safia Bano1

...ated in molasses mineral medium with tryptone as the nitrogen source for 5 days at 37 °C and 6.0 pH, strain produced a maximum lipase concentration of 29.39 (U/mL). Effect of metal ions, pH, pH stability, temperature, and thermostability on lipase activity were examined. Transformation of used oil into biodiesel was carried out by employing lipase produced in the current work. Maximal fatty acid methyl ester formation was noted after 18 h, 45 °C, and a...

Hafiz Ishtiaq Ahmad1, Jinlong Zhang1, Fuxun Luo1, Owais Iqbal2 and Yuying Wang1*

...ong into a solid culture medium. The plants were subjected to various LED spectra for a duration of 14 hours each day and continuous subsequent 100 days. The experiment was completely randomized design with nine treatments and each treatment have ten replications. The SPSS statistics software was used to analyses experimental data. In addition, the result of the current study revealed that the plant height, leaf length, leaf width and root number were signific...

Nasir Ali Tauqir1*, Asim Faraz2, Muhammad Imran Babar3 and Irfan Shahzad Sheikh3

...greater (p<0.05) with medium levels (N20P20 and N25P25) of P and NP fertilizer as compared to control. The extent of DM, CP, NDF, ADF and hemicellulose digestion and rate of degradation was increased in response to P and NP fertilization. However, the lag time of DM, CP, NDF, ADF and hemicellulose of oat fodder was the inverse because it decreased in repose to medium level of P and NP fertilization as compared to control....
Shorouq Mohamed Omara1, Ibrahim Saad El-Shamaa1, Emad Abd-Elaziz Abd-Allah2, Assmaa Abd-Allah Fathy3, Essam-Eldin Tharwat4, Mohammed Hamdy Farouk5* and Ibrahim Mahmoud Abd El-Razek1*
...cluded a control culture medium and other three LC supplemented media (2, 3 or, 4 mM LC). All LC treatments had higher COCs percentages at the metaphase II (MII) compared to the control group. The 2 Mmol LC treatment had the highest percentage of oocytes maturation rate at metaphase ΙΙ (47%) compared to the control group (33.3%). The same treatment had a higher percentage of cleaved embryos (75.4% vs 64.9%) and blastocyst rates (43,4% vs. 31,5%, resp...

Gunel Arzuman Ramazanova1, Gulnara Fakhreddin Abbasova2*, Khalsa Ibrahim Nasibova3 and Sait Engindeniz4

...d to artificial nutrient medium and multiplied. In the study, the intensity of spread of the disease, disease severity index and yield losses were determined according to years and varieties. In addition, income losses caused by yield losses were also analysed. According to results of the study, the highest yield loss rate in 2022 and 2023 occurred in the Umid variety (69.55% and 78.03%). The average yield loss of three varieties in 2022 was calculated as 43.1...

Iffat Ara Mahzabin, Mohammad Maruf Hasan*, Saifur Rahman, Md. Asaduzzaman Sarker and Md. Yeakub Ali

...spondents (86.68%) had a medium level of satisfaction, while 9.16% had a low and 4.16% had a high level of satisfaction regarding services provided through the fisherman ID card. Furthermore, providing rice during ban season, forming fishermen cooperative societies, and taking a lease of government open water bodies were the essential services received by the respondents using their ID cards. Among the selected characteristics of the fishermen, credit received...

Rejvi Ahmed Bhuiya1, Md. Ruhul Amin2 and A.K.M. Kanak Pervez2*

...f the farmers are in the medium category regarding RCT adoption. A linear regression model was applied to determine the relation between the adoption of RCTs and socio-demographic factors. The more educated and trained, the more exposed to extension services, the media, and organisations were, and the more likely they were to avail of resilient climate adaptation technologies in dealing with recurrent and more severe drought in the Barind region (p≤ 0.05). ...

Mohammed Nasir Uddin1, Maimona Monir Jhilam1, Most Zannatun Nahar Mukta1, Zujaja Wahaj2, Mohammad Maruf Hasan1* and Samiha Khan3

...pondents reported facing medium-level problems. The most prominent problem reported by the respondents was ‘lack of technical knowledge’. It is recommended that necessary steps, such as providing credit and training, to resolve these problems should be taken to ensure an improved quality of life for wetland farmers.

...

Afnan Ahmed Allhyani1, Mohamed Baeshen1, Nagwa Thabet Elsharawy2,3

...ty acids. It is the best medium for the growth of microorganisms and highly perishable food items. That increases the demand to find safe materials, extending the shelf life of meat. The study aims to examine Moringa oleifera extracts as natural preservatives by examining its antibacterial effect by (aquas & ethanolic) extracts by different concentrations (1.25, 2.5, 5, 7.5, 10, 12.5 & 15) cc against six foodborne microorganisms (Listeria monocytogenes...
Niaz Hussain1, Muneer Abbas1*, Abdul Ghaffar1, Muhammad Aslam1, Mudassar Khaliq1, Khalid Hussain2, Muahammad Nadeem1, Muhammad Irshad1, Zubeda Parveen1, Fiaz Hussain3 and Azhar Mahmood Aulakh4
...semi-erect growth habit, medium canopy, higher yield potential and resistance to Ascochyta blight and Fusarium wilt diseases. This first report on the “Thal-2020” chickpea variety highlights its promising traits, including high yield potential, disease resistance, and adaptability to various conditions. “Thal-2020” offers future benefits such as enhanced productivity, reduced pesticide use, and improved economic returns for farmers. Its...

Ngele Blessing Alfred, Agba Mary-Ibenreh Ogaboh*, Bassey Rosemary Anietie and Egeh Ajah Egwu

...s utilized as the growth medium. Detergent solutions with concentrations of 1g/l, 2.5g/l, and 5.0g/l were prepared, with deionized water as the control (0g/l). Maize seeds were sown in germination trays and irrigated with these solutions to assess the effects on germination, growth performance, oxidative stress enzyme activities, and chlorophyll content. The detergent concentrations did not significantly affect the germination and growth of maize. However, fre...

Ferry Lismanto Syaiful*, Jaswandi Jaswandi, Mangku Mundana, Zaituni Udin 

...mine the optimal culture medium and culture duration for in vitro fertilization techniques. The culture media used include TCM-199 medium supplemented with both B-O (Brackett Oliphant) medium (HEPES, without the use of 5% CO2) and modified B-O (mB-O) medium (without HEPES, with 5% CO2). For the oocyte maturation stage, the culture period was 24 hours, wh...

Mustofa Hilmi1,4, Zuprizal2, Nanung Danar Dono2, Bambang Ariyadi3*

...particles, nutrient agar medium, Man’s Rogosa Sharpe Agar, Man’s Rogosa Sharpe Broth, bacterial cultures of Lactobacillus acidophilus ATCC 4356, and Lactobacillus sp. FNCC 0020, Salmonella typhimurium ATCC 700720, Escherichia coli FNCC 0091, tetracycline, and 70% alcohol. Antibiotic sensitivity testing employed the Kirby-Bauer and optical density 600 techniques to assess microbial growth inhibition and the minimum inhibitory concentration (MIC). Th...

Pangesti Nugrahani1*, Hery Purnobasuki2, Arif Nur Muhammad Ansori3, Jatuporn Anuchai4 and Anugerah Dany Priyanto5,6

...position of the planting medium, consisting of five treatments: full MS without BAP (MS0), ½ MS without BAP (½MS0), ¼ MS without BAP (¼ MS0), ½ MS supplemented with BAP at 3 mg L-1 (½ MSB), and ¼ MS supplemented with BAP at 3 mg L-1 (¼ MSB). The results revealed that the timing of shoot, root, and leaf initiation was not significantly altered by any of the treatments. However, shoot and root lengths were ...
Dyana Louis Anak Peter, Elldiwirna Saimen, Lucky Poh Wah Goh, Mohd. Khalizan Sabullah, Rahmath Abdulla, Jualang Azlan Gansau and Roslina Jawan*
... in the glucose-free MRS medium supplemented with nonistarted at 8.83 × 106 CFU/mL (before fermentation) and increased to 8.67 × 108 CFU/mL (24 h) and slightly decreased to 2.55 × 108 CFU/mL (48 h). Result also demonstrated that the viable cells count in a medium supplemented with bambangan, noniand mung bean significantly increased with increasing concentrations (0.5 &ndash...

Aimen Raza1, Muhammad Muzamil Ijaz1,2*, Adnan Younis1, Nasir Ahmad Khan3, Ahsan Akram1, M. Abdul Salam khan2 and M. Nadeem4

...ed substrates as growing mediums for ponytail palm production. The research was conducted at Lalazar Nursery, Gardening Wing Estate Management, University of Agriculture, Faisalabad. There were eight treatments and each treatment was replicated three times, with three plants each. Different plant-based materials, including leaf compost, coco peat, and peat moss was used to ensure the quality growth and development of the ponytail palm. The experiment was arran...

Rehmat Ullah, Riaz Ahmed*, Muhammad Tahir, Abdul Majid Nasir and Mushtaq Muhammad

...e allocated to small and medium farm owners. Also, the current policy of the State Bank of Pakistan—which allocates about 90 percent of agricultural farm credit to small and medium farmland owners—aligns perfectly with the findings of this study. This policy should be maintained with a robust monitoring mechanism to ensure the effective allocation and utilization of funds.

...
Sanaullah Sattar1, Ali Hussain2*, Javed Iqbal Qazi2, Arshad Javid1 and Shahid Mehmood1
... nutrients of Postgate B medium. For the purpose, SRB strain was isolated from a highly polluted wastewater stream flowing in Lahore, Punjab, Pakistan. The bacterial isolate was motile, Gram-negative, non-spore former and identified as Desulfovibrio vulgaris after 18 S rRNA gene sequencing. The corrosive action of the bacteria was assessed in a 60-day trial of anaerobic incubation. After an incubation period of 60 days, it was found that CR was significantly h...

Arshad Javaid1*, Freeha Anjum1, Aneela Anwar2, Mahrukh Asif1, Sadia Ahmad1 and Malik F.H. Ferdosi3

...xtract broth as a growth medium. All the applied concentrations of the extract exhibited significant antifungal activity and declined P. oryzae biomass by 45–56% over control. The extract was analyzed by GC-MS to identify the possible antifungal constituents. Sixteen compounds were detected in the root extract in GC-MS analysis. Among these, three compounds namely neotigogenin (29.30%), hexadecanoic acid, methyl ester (19.70%) and cis-13-octadecenoic aci...

Bushra Shaikh1*, Naeem Tariq Narejo2, Faheem Saddar3, Muhammad Hanif Chandio4, Majida Parveen Narejo5, Urooj Imtiaz2, Athar Mustafa Laghari4, Ghulam Abbas5 and Shahnaz Rashid5

...z., small (10.0-15.0 cm) medium (15.1-30.0 cm) and large (40.0-70.0cm) for the determination of feed preference. The results of the investigations revealed that the food fondness of B. bagarius was detected as highly carnivorous (Piscivorous) displayed higher preferences for fish (46.6 %) seconded by insect larvae (20 %) and 3rd preferred was debris (15.4 %). For breeding analysis values of ova diameter were found to be ranged between 0.55-1.0 mm, the gonadoso...

Wiranut Thannithi1, Payungsuk Intawicha1, Nattamaporn Kongmuang1, Wilasinee Inyawilert2, Attapol Tiantong3, Sureeporn Saengwong1*

Roheena Abdullah*, Kinza Nisar, Afshan Kaleem and Mehwish Iqtedar

...and found to be the best medium. Different parameters including time and temperature of incubation, pH, Inoculum size, volume, carbon and nitrogen sources were also tested. Optimal enzyme production was obtained at 72 h, 30C, pH5.5, Iml inoculum, 50ml volume and 1.5% lactose and 1% yeast extract.

...

Hangyu Lin1, Minhui Chen1, Hao Yang1, Xinying Xia1, Huaying Zhou1, Xi Song1 and Tao He1,2*

...0.38 μg MeHg into the medium, and the concentration of MeHg in water was kept relatively stable in the next 150 min. This study indicates that the bioaccumulation of MeHg in the body of zooplankton can be quantified by AIEgen effectively, and the main process of MeHg accumulation by rotifers in water may via passive transport.

...
Jinlong Cheng1, Jianglan Pei1, Qiaoyun Xu1, Jian Gao1, Zanna Xi1
Jialiang Ouyang1, Mengzhi Wang1,2*, Junliang Yin2* and Wenju Zhang3*
...nal and external culture medium was collected at 0, 3, 6, and 24 h to measure pH and VFA concentration to evaluate conditions in vitro, research showed pH at 3 h was significant higher than that at other different time, and pH at 24 h was lower than that in the other three groups; The concentration of acetic acid, propionic acid and butyric acid in culture fluid indicated that the concentrations of acetic acid, propionic acid, butyric acid group and control gr...

Atsmarina Widyadhari1, Chaerul Basri2*, Etih Sudarnika2

...mulation areas with low, medium, and high levels of dairy cattle population density. Disease transmission was simulated using the mathematical model susceptible-exposed-infected-recovered or dead-vaccinated-culled (SEIRVC) through three HRPs of 7, 14, and 21 days. Each scenario was then paired with five alternative control programs, namely (1) cull of infected and exposed animals (CIE); (2) cull of infected animals and pre-emptive culling of susceptible animal...

Andi Mushawwir1*, Lovita Adriani1, Ronnie Permana1, Eli Sahara2

...n contrast, the sites at medium altitudes, ranging from 750 to 850 meters above sea level, were in Sumedang and South Subang, where the average temperature was 24°C, and the humidity was 65%. The study, which lasted for six months, aimed to assess the effects of heat stress on various stress markers, including malondialdehyde (MDA), cholesterol, total iron binding capacity (TIBC), and carbonic acid (H2CO3) levels. Additionally, it examined how heat stress ...

Amirreza Amirmijani Mahdieh Sadeghian Behanz Karimi

Volume 2, Issue 6 November and December 2018 Pages 105-113
...tato dextrose agar (PDA) medium. Recovered fungal isolates were purified by single spore method. Morphological characteristics of each isolate were recorded. Results of identification recorded that about seven fungal species including; Alternaria alternata, A. tenuissima, Arthrinium arundinis, Cladosporium cladosporioides, Clastospora gossypii var. polymorpha, Fusarium oxysporum and F. verticillioides were obtained. To the best of our knowledge, this is the fi...

Muhammad Junaid Musharaf Ahmad Saifullah A.

Volume 2, Issue 6 November and December 2018 Pages 138-146
...trazolium chloride (TTC) medium, were used for biovars determination. Results indicated that all PCR-confirmed R. solanacearum isolates belonged to race-1 and biovar-3. However, two isolates i.e. (

Ayesha Bibi 1 Muhammad Junaid 2 Musharaf Ahmad 3

Volume 2, Issue 6 November and December 2018 Pages 167-174
...wn on Nutrient agar (NA) medium. 34 isolates out of the 47 exhibited Clavibacter michiganensis subsp. michiganensis like cultural characteristics when grown on Yeast extract-Dextrose-CaCO3 (YDC) medium. However, 27 isolates only out of these 34 were confirmed to be Gram positive. Pathogenicity of the 27 Clavibacter michiganensis subsp. michiganensis isolates were confirmed using cotyledon, young seedlings and old seedlings a...

Sebnem Bukavaz

Novel Research in Microbiology Journal (2019), 3(1): 185-189
...populously rhl-producing medium, the proteose- peptone ammonium salts (PPGAS).

...

 

Ibtissem Ben Salem1; Yosra Abdelkhalek1; Houssem Nabli3; Neji Tarchoun2; Naima Boughalleb-M’Hamdi1*

Novel Research in Microbiology Journal (2019), 3(1): 232-242
...d the antagonists on PDA medium was made, which led to the inhibition of the pathogens mycelial growth. According to results generated for fennel seed-borne fungi, direct confrontation of the five pathogens (Botrytis cinerea, Sclerotinia sclerotiorum, Cladosporium cladosporiodes, Cladosporium link and Bispora sp.), with Aspergillus niger and Penicillium digitatum showed an inhibition of radial growth above 50%. For lettuce; the highest inhibition was recorded ...

 

Muhammad Junaid1*; Ayesha Bibi2; Musharaf Ahmad3; Muhammad Ali4; Yousaf Noor5

Novel Research in Microbiology Journal (2019), 3(2): 314-325
...trazolium chloride (TTC) medium. Based on colony morphology of R. solanacearum on the agar plates; and pathogenicity assays, about 29 isolates were guessed to be R. solanacearum. To further confirm the identity of these isolates, a species-specific primers-mediated Polymerase chain reaction (PCR) was carried out. Two specific primers i.e. forward primer: 5'GTCGCCGTCAACTCACTTTCC3', and reverse primer: 5'GTCGCCGTAGCAATGCGGAATCG3', were used for amplification of ...

 

Abd-Elhalim, B.T.1*; Gamal, R.F.1; Abou-Taleb, Kh.A.1; Haroun, A.A.2

Novel Research in Microbiology Journal (2019), 3(6): 558-578
...dues, added to the basal medium as different carbon sources. Results showed that 2% blackstrap sugar cane molasses was the most efficient carbon source for CuNPs biosynthesis, when incubated for at 30°C for 24 h using shaking speed of 120 rpm. The biosynthesized CuNPs has a size of 66.12 nm at a concentration of 19.2 mg\ l, and maximum surface plasmon peak (SPR) of 0.85.

...

 

Safaa M. Ali1*; Nadia A. Soliman2

Novel Research in Microbiology Journal (2019), 3(6): 590-597
...re in Luria-Bertani (LB) medium. The plasmids were isolated and then tested using universal primer (M13), to detect the fragment size and sequence for the Polymerase Chain Reaction (PCR) products. This study establishes an effortless and professional method for cloning of recent cellulase genes through ecological metagenomes. In the outlook, the metagenomic guide approachs may be functional to the elevated selection of novel cellulase from the environment.

...

Muhammad Waqas1*, Shahid Mehmood1, Muhammad Shabir Shaheen1 and Saeed Ahmed2

...dilution (2660ME+13%CP); medium diluted diet (MED) or 10% dilution (2520 ME+12% CP); extra diluted diet (EXT) or 15% dilution (2380ME+11%CP). Each replicate was allocated 400 birds randomly. Birds were offered (diluted) grower diet from 4 to 19 weeks. The impact of said treatments were checked through growth and production parameters along with economic appraisal of diet formulation. The findings revealed that MED diet produced maximum body weight uniformity, ...

 

Noura Sh. A. Hagaggi

Novel Research in Microbiology Journal (2020), 4(4): 907-920
...40oC and pH 8 and 9 in a medium containing 25 % (w/v) NaCl and 1 % (v/v) olive oil as a lipid substrate. This lipase was partially purified, highest lipase activity was obtained in 80% ammonium sulfate saturation, and in fraction eight of the Sephadex G-200 gel filtration chromatography. Lipase displayed wide spectrum of activity within a broad range of conditions including salinity, temperature and pH, it was optimally active at 25 % (w/v) NaCl, 40°C and ...

Bikash Chandra Behera1; Bijay Kumar Sethi1; Sonali Mohapatra2; Hrudayanath Thatoi3; Rashmi Ranjan Mishra1*

Novel Research in Microbiology Journal (2021), 5(3): 1241-1255
... on potato dextrose agar medium (PDA) from mangrove soil through serial dilution, and then were streaked on the skim milk agar medium for qualitative screening of protease production. Out of 13 fungal spp.; only 7 spp. were able to produce proteolytic zones through the proteolytic assay. The Relative enzymatic index (REI) value (Zone diameter/Colony diameter) of all the fungal isolates that produced proteolytic zones on skim...

 

P. I. Orjiakor*

Novel Research in Microbiology Journal (2021), 5(3): 1269-1282
... %) amended mineral salt medium after 14 d of incubation. The rate of biodegradation was significantly (p< 0.05) increased with increasing the medium concentration, inoculum size, agitation speed and nitrogen sources. The most significant biodegradation efficiencies were obtained at a pH of 7.2, temperature of 37 °C, an agitation speed of 200 rpm, an inoculum concentration of 10 %, paint concentration of 2 %; when yea...

Noha M. Mahmoud1*; Samah S. El-Kazzaz1

Novel Research in Microbiology Journal (2021), 5(6): 1415-1430
...using CHROMagar COL-APSE medium. Colistin MIC was estimated for Col-R Enterobacteriaceae using the broth microdilution (BMD) assay. Bacterial isolates were screened through the Polymerase chain reaction (PCR) for the existence of mcr-1 and mcr-2 genes. The fecal carriage of Col-R among the studied patients was 16.8 %. About 72 Col-R bacterial isolates were recovered. Col-R Enterobacteriaceae were predominant and were detected in 89.7 % of the bacterial isolate...

 

Hend M. Radwan; Nagwan G. El Menofy*; Sahar M.R. Radwan

Novel Research in Microbiology Journal (2024), 8(4): 2510-2525
...acteria which provides a medium for gene transfer. Stressors like high concentration of hydrogen ions, antibiotics, and minerals can start and spread AMR in wastewater. Antimicrobial agents are present in the environment in varying amounts depending on the antimicrobial class and their frequent use. Evolution of antibiotic- resistant bacteria (ARB) poses a significant public health risk; especially in healthcare facilities and hospital’s wastewater. Adva...

Danh Mo1*, Nguyen Van Thu2

... procedure of simplified medium (S_iv) by eliminating trypticase, minerals and reducing solutions and replacing them with rumen fluid from slaughterhouses of cattle with unknown dietary histories. The results showed that the dietary OMD, total digestible nutrients, and ME values significantly (P<0.05) increased according to the rise of the SF supplement. Still, the digestible fiber had a significant (P<0.05) decreasing trend. The OMD and ME values (n=24)...

Anwar A. Maki* and Asaad M.R. Al-Taee

...aq, using a mineral salt medium (MSM) complemented with 1% methanol as the only carbon and energy source. Genetic identification of the promising bacterium was performed using the 16S rDNA gene and identified as Methylorubrum pseudosasae AAZ2 (OR226418.1). MxaF gene that encodes for the methanol dehydrogenase enzyme was also detected, confirming the identification of PPFM. Growth was achieved in MSM medium supplemented with ...
Zaheer Abbas, Muhammad Saleem, Muhammad Yousuf Rafiq, Hafiz Shahzad* and Aqeel Ur Rehman
...y fluid through a porous medium with variable inclination and permeability. For simplification, let us assume that permeability varies in a quadratic parabolic form. The Brinkman model is applied to the porous medium to effectively regulate the flow. The impacts of viscous dissipation are also incorporated into the energy equation. The exact solution for velocity and temperature fields is obtained using the direct integratio...

Journal of Engineering and Applied Sciences

December

Vol. 42, pp. 01-48

Featuring

Click here for more

Subscribe Today

Receive free updates on new articles, opportunities and benefits


Subscribe Unsubscribe