Submit or Track your Manuscript LOG-IN

Lei Chen, Ling Zhu, Zhi-Wen Xu, Wan-Zhu Guo

 

Molecular Genetics of Aichivirus C (Porcine Kobuvirus) in China
...volutionary features and pathogenicity of Aichivirus C.

 

...

Hu Zenglei1 and Xiufan Liu1, 2*

 

...justify; ">Virulence and pathogenicity of Newcastle disease virus (NDV) is one of the major determinants for the clinicopathological manifestations in infected hosts. Recent studies showed that the host innate immune responses to infection play important role in the pathologenesis of NDV, and correlate with the severity of the clinical disease. Virulent strains of different genotypes induce distinct pathological manifestations in chicken organs, especially in ...

Leonard Izzard1, 2, John Stambas1, 2*

...being used to manipulate pathogenicity and immunity and as biomarkers for disease severity.

...

Shen Yang1, Guang-Zhi Tong1, 2*

... life cycles. The highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV) is a major concern for the swine industry and causes high degrees of morbidity and mortality. The intracellular signalling cascades of the innate immune system triggered by HP-PRRSV often lead to the elimination of infection. However, HP-PRRSV induces pathological changes and can cause aberrant immune responses in the host, resulting in acute lung injury and immu...

Mohammed A. Rohaim1*, Rania F. El-Naggar2, Abdulrahman M. Gamal3, Elshaimaa Ismael3, Mohamed M. Hamoud4, Sherif T. Moubarak3, Ashraf M. Metwally1, Manal M. Zaki3, Shimaa A.E. Nasr3, Samah Elsaid3, Mohamed M. Ali3, Hussein A. Hussein1 and Osama K. Zahran3

Email: mohammedvet1986@gmail.com; mohammed_abdelmohsen@cu.edu.eg

...bat the spread of highly pathogenic avian influenza (HPAIV) H5N1. HPAIV are highly susceptible to all disinfectants because they are enveloped viruses. Disinfection against avian influenza viruses at the poultry farms would significantly reduce and/or limit the chance for its transmission and outbreaks. Many disinfectants have been evaluated for their inactivation ability, but there is still a need for their evaluation under different condi...

Yongfeng Li, Mo Zhou, Xiao Wang, Libao Xie, Hua-Ji Qiu*

...V) is generally a noncytopathogenic virus in cell cultures. The development of reporter CSFV has provided an excellent option to directly detect viral replication without the use of secondary labeling. This mini-review discusses the applications of reporter CSFV in the study of CSFV biology, including efficiently screening the antivirals against CSFV and viral receptors, conveniently tracking the viral proteins in live cells as well as improving diagnostic met...

Mohammed A. Rohaim1*, Rania F. El Naggar2, Ahmed M. Helal3, Hussein Ahmed Hussein1 and Neil LeBlanc4

...gs and the intracerebral pathogenicity index (1.2), and the amino acid motif, (112KRQKR116), at the cleavage site of the fusion (F) protein indicated the emergence of PPMV-1 in Egypt. Phylogenetic analysis of the F and haemagglutinin-neuraminidase (HN) genes indicated that the isolate clustered with the PPMV-1 strains recently reported from Israel within subgenotype VIb. Our findings report the emergence of PPMV-1 in Egyptian pigeons and the potential role the...

Neha Singh and Anjana Pandey

...erous cells, detect live pathogenic organisms, and to discover novel disease biomarkers to facilitate early detection of the disease and for therapeutic purposes.

...

 John G. Bruno and Jeffery C. Sivils

...e surfaces of general nonpathogenic Escherichia coli (ATCC No. 8739) as well as alpha and gamma intimins and Shiga-like toxin 2 (SLT-2) B subunit verified that the aptamers bound proteins of the correct molecular weights for intact outer membrane proteins (OMPs), intimins and SLT-2. Some bands on the aptamer Western blots were shared between the “Big 6” non-O157 Shiga toxin-producing E. coli (STEC), E. coli O157 and related Gram negative bacteria. ...

 Ali Murad Rahoo1,2, Tariq Mukhtar3,*, Simon R. Gowen1, Rehana Kanwal Rahoo4 and Shaukat Ibrahim Abro5

...and application of entomopathogenic nematodes (EPN) depend on the use of host insects for in vivo production. As there is little information regarding relationship between nematode dosage and production of infective juveniles (IJ) of Steinernema feltiae and ability to locate hosts, therefore, in the present studies investigations were done on these aspects. A significantly greater emergence of IJ of S. feltiae from Galleria mellonella was observed with White t...

John Gachohi, Simon Karanja, Salome Wanyoike, Nduhiu Gitahi, Salome Bukachi, Kenneth Ngure

...e a slum household-based pathogenic Leptospira population dynamics simulation model. The model will be analyzed to assess the role of slum-based biotic (human and animal) and abiotic (soil, water and weather) habitats in Leptospira propagation. Influential habitats would serve as key targets for interventions. To achieve this aim, we have designed a pseudo-longitudinal survey to be undertaken for two years in Kibera slums in Nairobi city Kenya. Human and anima...

Tayiba Latif Gulraiz1, Arshad Javid1*, Syed Makhdoom Hussain2, Muhammad Shahbaz3, Irfan3 and Sharoon Daud4

...malgam of beneficial and pathogenic microbes and its pH (6.7 to 7.4), high concentration of phosphorus (4.50% and 4.33%) and nitrogen (3.26% and 2.37%) favor seed germination, enhance root growth and soil fertility.

...

Muhammad Raheel1,*, Nazir Javed2, Sajid Aleem Khan2, Hafiz Muhammad Aatif3 and Sohail Ahmed4

... exotic species of entomopathogenic nematodes (EPNs) was checked on Galleria mellonella larvae. The native species included Steinernema asiaticum and Heterorhabditis indica whereas exotic species were S. feltiae and H. bacteriophora. G. mellonella larvae were exposed to 300 IJs of each species. After inoculation at different temperatures, the reproductive potential of EPNs increased with increasing temperature and was found to be the best at 25oC. No EPNs spec...

Ahmed Samy, Wesam Mady, Naglaa M. Haggag, Samah H. Mohamed, Ebtissam N. AlShamy, M.K. Hassan

...ccount the genotypic and pathogenic characterization of H9N2 in avian species. However little is known about the impact of different strains on the innate immune response. In the present study, using quantitative real-time PCR, cytokines gene expression were examined in response to infection with two strains of Egyptian H9N2 (namely V3 and RSF/1) in chicken peripheral blood mononuclear cells (PBMC). Hemagglutinin gene sequence analysis of the two strains revea...
Waheed Anwar*, Muhammad S. Haider, Ahmad A. Shahid, Hamid Mushtaq, Usman Hameed, Muhammad Zia Ur Rehman and Muhammad Javed Iqbal
...d isolates. Additionally pathogenicity of isolated Fusarium species was evaluated against nymph and adult of Bemisia tabaci. Under controlled conditions different species of Fusarium restrained the growth of B. tabaci as compared with control.
...
Amjad Islam Aqib1, Muhammad Ijaz1,*, Aneela Zameer Durrani1, Aftab Ahmad Anjum2, Riaz Hussain3, Saba Sana2, Shahid Hussain Farooqi1, Kashif Hussain1 and Syed Saleem Ahmad1
...isolates indicating very pathogenic nature of infection in the area. Risk factors determinants were found significantly (P<0.05) associated with mastitis occurrence except frequency of milking per day. Antibiogram of Staph. aureus indicated very strong resistance to oxacillin, ticarcillin, ampicilline, amoxicillin, azlocine, chloramphenicol, mupirocin, vancomycin, cefixinme, cefuroxime, and cefotaxime. In contrast to this sulphaphenazole, gentamicin,...
Sung Kwon Park1a, Jin Young Jeong2a, Eun Seok Cho3, Yong Dae Jeong3 and Chang Seok Park4*
...a (PED) was triggered by pathogenic coronavirus causing watery diarrhea and high mortality in piglets. This post-viral syndrome results in severe economic losses in the pig industry. However, limited information on the porcine epidemic diarrhea virus-infected pigs is available. Thus, the objective of this study was to identify transcriptomes with RNA sequencing (RNA-seq) in peripheral blood mononucleated cell (PBMC) of piglets, Large White x Landrace crossbred...

Wesam Hasan Mohamed Mady 1*, Bing Liu2, Dong Huang2, A. Arafa1, M.K. Hassan1, M.M. Aly1, Pucheng Chen2, Yongping Jiang2* and Hualan Chen2

...align: justify;">The low pathogenic avian influenza viruses (LPAIV) subtype H9N2 are highly prevalent in the Middle East and are causing economic losses in the commercial poultry production sectors. Due to potential of H9N2 infections in human, LPAI H9N2 poses serious public health risk. Therefore, development of new potent and cost-effective influenza vaccines is urgently needed to safeguard poultry and to contain zoonosis. The primary goal of this study was ...
Matiyar Rahaman Khan1,*, Sabyasachi Pal2, Ghule Tushar Manohar2, Somnath Bhattacharyya3, Amit Singh4, Prahlad Sarkar5 and Samuel Lalliansanga6
...rofuse root galling. The pathogenic potential of M. incognita on passion fruit was determined; the minimum 10 second stage juvenile (J2)/200 cc soil can cause reduction of plant growth parameters and highest reproduction (R=87.27). 
...
Neenish Rana, Nosheen Ehsan, Awais Ihsan and Farrukh Jamil*
...genome sequence of human pathogenic bacteria Helicobacter pylori (H. pylori) strain 26695. Computational analysis of the genome showed 6 transcriptionally active pseudogenes that can produce stable mRNA secondary structure compared to their functional parents. Moreover it was observed that their putative protein products will be thermodynamically stable. The sequence-based predictions suggested that the pseudogenes-derived proteins may involve in...

Honnur Basha, Vinaya Hemannavar, B.Ramanujam, R. Rangeshwaran and S.Sriram 

Screening of chilli microflora and other biocontrol agents for their antagonistic effects on Colletotrichum spp. infecting chillies
...olates belonged to plant pathogenic genera like,Alternaria, Cercospora, Colletotrichum, Curvularia, Glomerella, Mycosphaerella, Phoma and Stemphylium and the other 24 isolates of fungi belonged to Aspergillus, Acremonium, Chaetomella,Cunninghamella, Geotrichum, Gliocladium, Monodictys, Mucor, Myrothecium, Penicillium, Periconia and Pithomyces. One-hundred and thirteen isolates of chilli microflora and 49 isolates of Trichoderma, 19 isolates of Bacillus sp., 34...

B. Ramanujam, R. D. Prasad, S. Sriram and R. Rangeswaran

Mass production, formulation, quality control and delivery of Trichoderma for plant disease management
...mber of soil-borne plant pathogenic fungi, suppressive effects on some root nematodes without adversely affecting beneficial microbes like Rhizobium and capable of promoting growth of certain crops. There are two major methods of inoculum production of Trichoderma spp. viz., solid state fermentation and liquid state fermentation. In solid fermentation, the fungus is grown on various cereal grains, agricultural wastes and byproducts. The solid state production ...

Rashid Pervez, Santhosh J. Eapen, S. Devasahayam and M. Dinsha

Characterization of entomopathogenic nematode, Stein-ernema carpocapsae from ginger (Zingiber officinale Rosc.) rhizosphere in India
...ey, one isolate of entomopathogenic nematode from ginger rhizosphere was collected from Faizabad district of Uttar Pradesh (India). Morphological and morphometric studies identified the isolate as Stein-ernema carpocapsae. This was further confirmed by ITS-rDNA sequences analysis. Phylogenetic was constructed for studying relationship with known isolates. Pathogenic potential of the isolate of S. carpocapsae (IISR-EPN 06) on...
Beenish Zahid1,*, Asim Aslam2, Zafar Iqbal Chaudhry2 and Raheela Akhtar2
...l changes in response to pathogenic field infectious bursal disease virus (IBDV). The Bursa of fabricius was collected from poultry flocks of Punjab Pakistan for isolation of IBD virus by inoculating in embryonated chicken eggs through chorioallantoic membrane. The two hundred birds were divided into 4 groups A, B, C and D). The birds in group A were commercial broiler chicks having maternal derived antibodies and were challenged with IBDV field isolate at the...
Muhammad Mansoor, Zaigham Abbas and Nageen Husssain*
...tibodies production. The pathogenicity and etiology of the disease has yet to be elucidated. It is presently accepted that environmental factors trigger the disease in genetically sensitive individuals. Gluten, a protein fraction commonly found in wheat grains, associated with food related disorders and a number of autoimmune diseases. We hypothesized that gluten containing diet would further exacerbate an already undergoing arbitrary immune reaction in SLE pa...

Gadeeyya G and Ratna Kumar P.K.

...relevant literature. The pathogenicity of the isolates was examined to select biocontrol agent against host weed. 
...

Wesam Hasan Mohamed Mady1*, Bing Liu2, Dong Huang2, Abdel Satar Arafa1, Mohamed Khalifa Hassan1, Mona Mehrez Aly1, Pucheng Chen2, Yongping Jiang2* and Hualan Chen2

...>The incursion of highly pathogenic avian influenza virus (HPAIV) strain H5N1 in 2006 in Egypt caused severe economic losses for both commercial and backyard poultry production sectors. Owing to public health risk, effective control of the virus in imperative. DNA vaccination is a promising new approach for the prevention and treatment of many viral diseases because of its ability to induce both humoral and cellular immune responses against antigens encoded by...
Tiansen Li1, Meiling Huang2, Zhen Wang1,Fei Guo3,Hui Zhang1,* and Chuangfu Chen1,*
...ify;">Brucella is pathogenic bacteria that cause animal and human brucellosis. Currently, the mechanism behind the pathogenesis of Brucella remains unclear. For this reason omp10 mutant was constructed to examine the impacts of the outer membrane protein 10 (Omp10) on bacterial survival, virulence, phagosome-lysosome fusion, and apoptosis induction, as assessed in appropriate in vitro (cell culture) and animal models. Results showed...

Jawad Anwar* and Zafar Iqbal 

... against phyto and human pathogenic bacterial strains. T. harzianum was grown under different conditions and their extracts were evaluated, using disc diffusion method against tomato wilt causing bacteria (Xanthomonas campestris and Clavibacter michiganensis). Extracts that resulted in strong activity were fractionated into acetonitrile and ethyl acetate followed by testing against human pathogenic bacterial strains (Escheri...
Faiz Muhammad1,*, Syed Khurram Fareed1, Urooj Zafar1, Taseer Ahmed Khan2 and Aqeel Ahmad1
...asma synoviae and nonpathogenic mycoplasmas at the same in a single PCR reaction collected from diseased chicken. Direct PCR from the clinical samples produced false negative results. Both culture and PCR were combined as culture-enhanced PCR approach. Three different DNA crude preparation methods were used and broth dilution method found simpler and most efficient for positive PCR. Primers were selected for 16s rRNA and it could detect up to 100 cfu and 2...
Zahid Latif1,*, Kathrin Blasius2-4, Tufail Hussain Tahir7, Muhammad Nasim Khan1, Ghazanfar Ali5, Ansar Ahmed Abbasi6, Abdul Rauf1, Hao Hu8 and Angela M. Kaindl2,3,4
...B1 gene as an underlying pathogenic variant for non-syndromic autosomal recessive retinitis pigmentosa.
...
Hailong Dong1, Hui Zhang2, Kun Li2, Khalid Mehmood2,3, Mujeeb Ur Rehman2, Fazul Nabi2, Yajing Wang2, Zhenyu Chang1,2, Qingxia Wu1,* and Jiakui Li1,2,*

 

...rmine the prevalence and pathogenic potential of Escherichia coli (E. coli) isolated from piglets having white score diarrhea as a result of outbreak occurred in Qinghai Tibetan Plateau in 2015. A total of 81 E.coli were isolated from 83 fecal samples. The organisms were inoculated on MacConkey agar and EMB agar and identified via biochemical tests. Polymerase chain reaction was used to detect representative virulence factors or genes, including ...
Wali Khan1,*, Noor-Un-Nisa2 and Aly Khan3
...revalence of potentially pathogenic intestinal protozoan parasitic infection in farmers, education concerned and shepherds of Swat, Khyber Pakhtunkhwa, Pakistan. A total of 1041 stool samples were examined from January 2006 to December 2008 using direct smear and concentration methods. One hundred and fifteen (11.04%) participants were found infected with one or more than one intestinal protozoans. Forty one (35.6%) of the participants were infected with singl...
Rana Fartab Shoukat1, Shoaib Freed1,*, Kanwar Waqas Ahmad1 and Ateeq-ur-Rehman2
...binary mixtures of entomopathogenic fungi, Beauveria bassiana (isolates Bb-01, Bb-10), Metarhizium anisopliae var. anisopliae (isolate Ma-11.1, Ma-2.4)and Isaria fumosorosea (isolates If-2.3, If-02) and chemical insecticides i.e., bifenthrin, lambda cyhalothrin, imidacloprid, triazophos, spinosad, pyriproxyfen and nitrinpyrum, as larvicides against C. pipiens. Highest larval percent mortality (73.3 ± 4.7) was ob...

Ayesha Aihetasham*, Faiza Qayyum and Muhammad Xaaceph

Qamar-un-Nisa1, Muhammad Younus2,*, Muti-ur-Rehman1, Azhar Maqbool3 and Sajid Umar4

 

... additive or synergistic pathogenic effect in the reproduction of respiratory disease if given simultaneously or three days apart.
...
Wali Khan1,*, Noor-Un-Nisa2 and Muhammad Asif Nawaz3
...of potentially important pathogenic parasitic infections particularly in remote parts of the country.
...
Ali Murad Rahoo,1,2,* Tariq Mukhtar,1,3 Shoukat Ibrahim Abro,4 Barkat Ali Bughio5 and Rehana Kanwal Rahoo6
...The suitability of entomopathogenic nematodes as biological control agents of specific target insects is affected by their level of infectivity and reproductive capacity. Therefore, in the present study the productivity of five entomopathogenic nematodes (Steinernema feltiae, S. kraussei, S. carpocapsae, Heterorhabditis bacteriophora and H. indica) were compared in Galleria mellonella larvae. The product...
Jaime Molina-Ochoa1, 2, 6,*, Edelmira Galindo-Velasco2, Ana María Rosales-Gutiérrez2, Martín González-Ramírez3, Roberto Lezama-Gutiérrez3, Wilberth Chan-Cupul3, Steven R. Skoda4, Muhammad Irfan Ullah5, Luis Jorge García-Márquez2 and  John E. Foster6
...v>...
Hina Safdar1,*, Nazir Javed1, Sajid Aleem Khan1 and Muhammad Arshad2
...ntrol potential of entomopathogenic nematodes (Heterorhabditis bacteriophora and Steinernema glaseri) against different larval instars (2nd, 3rd, 4th and 5th) of armyworm (Spodoptera litura F.) at different exposure times were evaluated. Entomopathogenic nematodes were applied at 1000 IJs/ml and larvae maintained at 25°C. Mortality was recorded upto four da...
Abdul Nabi Jatt1,*, Sarfraz Ali Tunio1, Shaista Bano Memon1, Abdul Sattar Qureshi2 and Muhammad Aqeel Bhutto
...ganic materials. Several pathogenic microbial species utilize enzymes as virulence factors to cause diseases. The aim of the present study was to evaluate enzymatic activities of the bacterial strain Shigella dysenteriae IM using API-ZYM test system. Out of nineteen different enzymes, S. dysenteriae IM strain was capable to poroduce nine enzymes, i.e., alkaline-phosphatase, acidic-phosphatase, lipase, valine arylamidase, cystine arylamidas...
Ali Murad Rahoo1,*, Tariq Mukhtar2, Ali Murad Jakhar3, Rehana Kanwal Rahoo3
...mass production of entomopathogenic nematodes (EPN) are not yet available and the development and use of EPN mainly depends on the use of host insects such as greater wax moth (Galleria mellonella) for in vivo production. Since G. mellonella may not always be available, therefore, yellow mealworm (Tenebrio molitor) could be an alternative host. Therefore, in the present studies recovery of two EPN (Steinernema feltiae and ...
Ewa Czerniawska-Piątkowska1,*, Magdalena Skibicka1, Barbara Cioch-Szklarz1, Jolanta Karakulska2, Karol Fijałkowski2 and Sonia Hiller3
...revealed the presence of pathogenic or opportunistic bacteria at the level of the average number of micro-organisms (11-50 CFU) or high (> 50 CFU), which negatively affected the health of the calves. However, in cold rearing there was recorded absence or presence of microorganisms in the nasal cavity in a small amount (<10 CFU).
...
Riyadh S. Aljumaah*, Mohammed A. Alshaikh, Abdulrahman Jarelnabi, Mutassim M. Abdelrahman and Mansour F. Hussein
...actors and to assess the pathogenic effects and economic consequences of neosporosis in camels.
...

Osama Elshazly1, AbdelSatar Arafa1, Mohammed A. Rohaim2, Ismaeil M. Reda2 and Hussein A. Hussein2*

...e hosts. Zoonotic highly pathogenic avian influenza virus (HPAIV) H5N1 of clade 2.2.1 has recently diversified into two distinct genetic subclades (2.2.1.1 and 2.2.1.2) in Egypt. This study was conducted as part of routine surveillance activities in Egypt; 5202 cloacal and oropharyngeal swabs were collected from live/dead birds, including commercial and backyard flocks, in five different locations in Egypt between the years of 2015 and 2016. All samples were s...
Ayesha Munir, Hafiz Muhammad Umer, Anjum Nasim Sabri and Imran Sajid*
...that caries isolates are pathogenic S. mutans and soil isolates belong to the genus Streptomyces. The antibiotic resistance profile of S. mutans illustrated resistance to optochin. The antimicrobial screening of Streptomyces against S. mutans showed that these strain are the prolific producers of active agents to inhibit the growth of caries causing S. mutans. The natural extracts of Streptomyces strains signifi...
Zihong Chen1, Ling Xu2, Xiaona Yang2, Yaguan Zhang3* and Yuming Yang4
...arhizium is an entomopathogenic fungal genus relevant in biological protection. A new species of the genus, collected from Taibao mountain, Baoshan City, Yunnan Province, southwestern China, was described here as Metarhizium baoshanense. It was proposed and determined based on morphological characters combined with a multigene phylogenetics analysis involving 5.8S–ITS, nrSSU, nrLSU, EF–1α, RPB1 and RPB2. In multilocus phylogeny,
Mumtaz Ali Khan1, Aneela Zameer Durrani1, Sher Bahadar Khan2, Shehla Gul Bokhari1, Ikramul Haq1,*, Imdad Ullah Khan3, Naimat Ullah4, Naimat Ullah Khan4, Kashif Hussain1 and Azmat Ullah Khan2
...cine from the prevailing pathogenic strains of Type D Clostridiumperfringens strains and evaluate its immune responses in rabbits, goats and sheep. C. perfringens were isolated from enterotoxaemia suspected sheep and goats from the endemic areas of Khyber Pakhtunkhwa Province, Pakistan during 2016. The isolates were initially identified through colony characters, Gram staining and biochemical tests. The identified isolates were quantified ...

Wasim Javaid1, Farid Asif Shaheen1*, Farah Naz2 and Muhammad Usman Raja2 

...stify;">Aptness of entomopathogenic fungi (EPF), Beauveria bassiana and Metarhizium anisopliae was evaluated to manage pulse beetle (PB), Callosobruchus chinensis by using different fungal concentrations of 1×106, 1×107 and 1×108 spores/ml in stored chickpea grains. Highest mortality (90%) of PB was observed in 72 hours through application of 1×108spores/ml of M. anisopliae compared to B. bassiana with 60% mortality. On 24 hours of expo...
Manzoor Hussain*, Miloslav Zouhar and Pavel Ryšánek
...ognita and the entomopathogenic fungus, Lecanicillium muscarium. The initial inoculum was measured before okra was seeded in the field. At harvest, the numbers of root galls, egg masses, and eggs per root system, the root weight, the final population of the second stage juveniles, and the reproduction rate were detected at the highest levels in untreated soil, whereas low numbers were encountered in soils initially treated with the fungus,
Qiang Li1,2, Guo Qiao2, Li Wang1, Jipeng Zhang1, Ruijun Li1, Ping Ni1, Yi Guo1 and Shigen Ye1,*
...plification, followed by pathogenicity determination. Results showed that the isolates belonged to 10 genera, including Vibrio (72%), Staphylococcus (9%), Pseudomonas (4%), Bacillus (4%), Vagococcus (3%), Shewanella (3%), Planococcus migula (4%), Exiguobacterium (1%), Enterobacter (1%) and Kocuria roseus (1%). Vibrio spp. and Vibrio harveyi were the predominant genus and specie...
Ali Murad Rahoo1, Tariq Mukhtar2,*, Barkat Ali Bughio3 and Rehana Kanwal Rahoo4
...div>The fitness of entomopathogenic nematodes (EPN) as biological control agents of specific target insects depends on their level of infectivity and reproductive capacity. Nematodes with higher levels of infectivity and reproduction within a specific target host may be more effective in controlling a particular insect under field conditions. The production of infective juveniles (IJ) from Galleria mellonella cadavers may differ among different species ...
Nimra Naseer, Adeela Fatima and Imran Sajid*
...sistance. Currently, the pathogenic organisms of concern are methicillin and vancomycin resistant strains of Staphylococcus aureus, Acinetobacter spp., extended spectrum β-lactamases (ESBLs) producing strains of Escherichia coli, Klebsiella spp., Pseudomonas spp. and Proteus spp. In this study, a collection of nineteen actinomycetes strains isolated from Cholistan Desert, Pakistan, were screened biologicall...

Mohsin Iqbal1, Farid Asif Shaheen1*, Farah Naz2, Muhammad Usman Raja2, Muhammad Fiaz3 and Muhammad Nadeem1 

...n current studies, entomopathogenic fungi, Metarhizium anisopliae and Beauveria bassiana were used as the bio-control agents against this economic pest and proved good alternatives to chemicals. Less number of eggs (2 per grain), more number of holes (8.3 per grain), less number of F1 adults (20.3 per jar) and more number of days (7) to 100% mortality of C. chinensis adults were recorded when chickpea grains were treated with the highest concentration of B. ba...
Zafar Iqbal*, Farah Ansar, Zil-e-Huma
...ollusca (Glochdium). The pathogenic fungal genera isolated were: Aspergillus, Alternaria, Penicillium, Mucor. Blastomyces, Rhizopus and Fusarium. Ten bacterial genera were also isolated; Aeromonas, Pseudomonas, Streptococcus, Enterococcus, Acinetobacter, Bacillus, Moraxella, Lactobacillus, Staphylococcus,. Carnobacterium. There has not been a single case of topically acquired infection among students, laboratory...

Nadia Khan1*, Abdul Waheed1, Farrukh Siyar Hamid1, Naveed Ahmed1, Zafar Iqbal2, Seemab Ali1, Madiha Bashir1 and Hina Gul3  

...ctivity against two phytopathogenic bacterial species (Clavibacter sp. and Xanthomonas sp.) and a human pathogenic bacterium (Escherichia coli) in 2016. Experiment was carried out by using complete randomized design with three replications in vitro. Phytochemical analysis reveals that the methanolic fraction of oil possesses metabolites like carbohydrates, amino acids, alkaloids, flavonoids and glycosides. To test the antiba...

 Nazish Mazhar Ali1, Saiqa Andleeb2, Bushra Mazhar1, Anum Imtiaz1, Shaukat Ali2*

Assessment of antibiogram and resistogram of pathogenic bacteria isolated from irrigated wheat field water
...concluded that irrigated pathogenic bacteria are highly resistant to heavy metals.

...
Muhammad Asad Saleem1,*, Mirza Abdul Qayyum1, Mudssar Ali1, Muhammad Amin2, Muhammad Tayyab1,3 and Sumaira Maqsood4
...PW. Combination of entomopathogenic fungus (Bb) and Nitenpyram (Nit) were found more lethal to survival of RPW. A reduction in pupation and adult emergence was recorded in the combined treatments. Moreover, decrease in weight gain, frass production and cumulative gain in size was found when larvae were treated with integrated effect of Bb and Nit. Depending on the lethal of treatment, development duration of RPW was disturbed. Integration of Bb and Nit delays ...
Huseyin Cetin1,*, Oner Kocak2, Emre Oz1, Samed Koc1, Yesim Polat1 and Kalender Arıkan2
...echanical vector of many pathogenic bacteria, fungi and parasites. The use of synthetic pyrethroid (SP) insecticides is recommended by the World Health Organization for the control of adult houseflies. Despite the fact that SPs have been used effectively, this insect has developed resistance in many regions/countries of the world. The use of synergistic substances to overcome insecticide resistance is widespread. Piperonyl butoxide (PBO) is used as a synergist...
Ali Murad Rahoo1,*, Tariq Mukhtar2, Barkat Ali Bughio3 and Rehana Kanwal Rahoo4
...ions for deploying entomopathogenic nematodes (EPN) in Pakistan can be harsh and the survival of infective juveniles (IJ) following inundative applications would be quite short. The application of EPN in cadavers may be appropriate because of the non-availability of industrially produced isolates. Therefore, in the present studies, Galleria mellonella and Tenebrio molitor were compared for invasion and production of IJ of Steinernema feltiae

Ahmed Samy1*, Hala Mohamed Nabil Tolba2, Gamelat Kotb Farag3 and Ahmed Abd El Halim1 

...olates were assessed for pathogenicity based upon the mean death time (MDT), the intracerebral pathogenicity index (ICPI) and the intravenous pathogenicity index (IVPI) in chicken. The ICPI and MDT revealed that all tested isolates were of moderate virulence (Mesogenic) in chickens. Mature chickens showed no clinical signs or death as assessed by IVPI. Pigeon in Egypt reared in free rang s...

Syed Atif Hasan Naqvi1*, Sidra Mushtaq1, Muhammad Tariq Malik2, Ummad-ud-Din Umar1, Ateeq ur Rehman1, Shoaib Fareed3, Muhammad Asif Zulfiqar

...nt. A diversity of plant pathogenic fungi has been identified and isolated from the various affected sheesham trees from Indian sub-continent, yet the actual cause of the diseases is still controversial. It is pertinent to mention here that no viruses or any bacteria has been reported from a singly tree in whole of the Indian sub-continent. Although the involvement of the insect’s species has been recorded and authenticated by various scientists reportin...

Amer Mumtaz2*, Muhammad Suhail Ibrahim1, Nouman Rashid Siddiqui2, Muhammad Naeem Safdar2, Masooma Munir2, Aqsa Qayyum2, Sahar Shibli2 and Muhammad Khalid Ibrahim3 

... for inactivation of the pathogenic organisms present in food by poration and DNA fragmentation. Ultrasounds have diversified application in meat industry, extraction of bio actives, dairy industry, Enzyme technology, fruit and vegetable juice industry, water, waste water treatment, starch modification and removal of food allergens from food. 

...

Javed Asghar Tariq1*, Bashir Ahmed2, Manzoor Ali Abro2, Muhammad Ismail1, Muhammad Usman Asif1 and Raza Muhammad1 

...c effect against another pathogenic microflora. Current studies were designed with the aim to search out such type of antagonistic bacteria from rice crop. For this purpose, soil was collected from rice growing areas of Tando Jam. The isolation from rhizospheric soil was done by dilution plate technique. Among isolated isolates, 6 representative colonies were purified, multiplied and characterized using light microscopy and other biochemical tests. The bacteri...
Sher Bahadar Khan1,2,*, Zou Geng1, Cheng Yu-ting1, Asad Sultan3, Mumtaz Ali4,5, Irshad Ahmad6 and Rui Zhou1
...ny traits with the human pathogenic isolates based on virulence gene contents that may pose a potential threat to public health.

...
Mohsan Iqbal1, Farid Asif Shaheen1, Rashid Mahmood2,*, Muhammad Khalid Rafique2, Imran Bodlah1, Farah Naz3 and Muhammad Usman Raja3
...rgistic effects of entomopathogenic fungi (EPF), Beauveria bassiana and Metarhizium anisopliae and entomopathogenic bacteria (EPB), Photorhabdus temperata and Xenorhabdus nematophila were studied as bio-control agents to manage this pest. In addition, percent conidial germination and % mortality of C. chinensis were also evaluated when B. bassiana was used with DEBBM. The minimum num...

Amany Adel, Wesam Mady*, Zienab Mosad, Fatema Amer, Asmaa Shaaban, Dalia Said, Marwa Ali Abdel Maged, Abdel-Satar Arafa, Mohamed Kamal Morsi, Mohamed Khalifa Hassan 

...solation of the H9N2 low pathogenic avian influenza virus in 2011, the virus has distributed rapidly and widely in different poultry sectors in Egypt causing severe economic losses and the problematic situation in poultry production especially with a co-infection with other circulating pathogens. In this study, 1026 confirmed positive H9N2 cases by RT-PCR out of 23182 different examined samples of different species and sectors in Egypt, with a prevalence rate ...
Zhimin Yuan1, Yan Yu2, Yanmei Wang1, Yanzhen Bu1,* and Hongxing Niu1,*
...stinal tract of bats are pathogenic to humans. Hypsugo alaschanicus feeds on insects and has a wide geographic distribution in China, and people are in frequent contact with these bats. However, assessing the gut microbiota, especially the potential pathogens, is needed for public health. Thus, this study aimed to explore the microbial diversity of the gastrointestinal tract of H. alaschanicus and to estimate the risk to humans caused by t...

Amany Adel, Wesam Mady*, Zienab Mosaad, Fatma Amer, Asmaa Shaaban, Dalia Said, Marwa Ali, Abdel-Satar Arafa, Mohamed Kamal Morsi and Mohamed Khalifa Hassan  

...solation of the H9N2 low pathogenic avian influenza virus (LPAI) in 2011, the virus has been distributed rapidly and widely in different Egyptian poultry sectors causing severe economic losses and the problematic situation in poultry production especially with a co-infection with other circulating pathogens. In this study, a total of 23182 cloacal and tracheal samples were collected from suspected cases between 2015 and 2016 and submitted to the Reference l...

Ali Mahmoud Zanaty, Naglaa Mohammed Hagag, Neveen Rabie, Mahmoud Saied, Karim Selim, Saad A. Mousa, Azhar Gaber Shalaby, Abdel-Sattar Arafa and Mohamed Khalifa Hassan 

...rmore, the intracerebral pathogenicity index (ICPI) for selected 5 virulent viruses reveals velogenic features with high pathogenicity index (1.60 to 1.74). 

...

Yasir Ali1,2*, Bashir Ahmad1, Naqeebullah Jogezai3 and Adil Hussain

... of the strains were non-pathogenic and potentially industrial strains for the production of thermolabile protease and alkaliphilic lipase 

...

Wesam Mady*, Nahed Yehia, Mohammed Hassan Elhussieny, Azhar Gaber Shalaby, Moataz Mohamed El Sayed, Neveen Rabie Bakry, Asmaa Shaaban, Abdel Satar Arafa, Afaf Abdel Baset Mahmoud and Wafaa Mohammed Hassan 

...ince incursion of highly pathogenic avian influenza virus (HPAIV) H5N8 in November 2016 in Egypt, it caused severe economic losses for both the commercial and backyard poultry production sectors. The aim of this work is to study the Situation and molecular characterization of HPAIV (H5N8) in backyard poultry production sector in Egypt. In this study, a total of 7505 samples of tracheal swabs representing 1180 backyard poultry flocks were collected based on the...
Zil-e-Huma1, 2, Abdul Malik Tareen3, Kaleem Ullah3, Tauseef M Asmat4,Abdul Samad4Asim Iqbal2, Mohammad Zahid Mustafa3*,Irshad Ahmad5 and Sadeeq ur Rahman6
...li pathotypes (enteropathogenic E. coli (EPEC), enteroaggregative E. coli (EAEC), enterotoxigenic E. coli (ETEC), enteroinvasive E. coli (EIEC), and enterohemorrhagic E. coli (EHEC). Results show that the virulent EAEC strain of E. coli was found to be the most prevalent (35%), while EPEC was identified in 15%, followed by EHEC (8%). Notably, none of the samples was found positive for EIEC. Moreover, ETEC was ident...
Hafiza Mehwish Iqbal1, Shahid Yousaf1, Salman Khurshid1*, Qurrat Ul Ain Akbar1, Saqib Arif1, Nasreen Fatima2 and Ali Murad Rahoo3
...ion to the occurrence of pathogenic diseases. Fruit samples (injured and healthy) were taken from the three different local markets of Karachi. Some of the fungal species viz. Aspergillus niger, Aspergillus flavus, Fusarium oxysporum, Rhizopus stolonifer and Alternaria alternata have been identified in citrus samples. However, major incidence was recorded for Aspergillus niger (41.6%) followed by Fusarium oxysporum (27.7%). Infected...
Irfan Irshad1, Asim Aslam1,*, Muhammad Yasin Tipu1, Kamran Ashraf2, Beenish Zahid3 and Abdul Wajid4
...rains of AAvV-1s and low-pathogenic H9N2 avian influenza viruses are presently endemic in Pakistan and repeated outbreaks are continuously being reported with high mortality in poultry and non-poultry avian species. In this study, five AAvV-1s have been pathotyped and genetically characterized from vaccinated birds collected between 2013-14. A phylogenetic analysis revealed that all the isolates belonged to sub-genotype VIIi with high similarity of 97.9 to 99....
Sabbah M. Allam, T.M. El-Bedawy, M.H. Bakr and A.E.M. Mahmoud*
...sence and count of fecal pathogenic bacteria e.g. E. coli and Salmonella spp. Forty lactating Holstein cows, weighing 550±50 kg, with an average of 20 kg daily milk yield, were randomly divided into four groups (ten in each group). Animals were fed rations containing DOP at 0, 25, 50 and 75% substitution of yellow corn grains (R1, R2, R3 and R4, respectively). Digestion trail was conducted in the last week of the experiment using Ac...
Mumtaz Ali Khan1, Aneela Zameer Durrani1, Sher Bahadar Khan2, Naimat Ullah Khan3, Muhammad Asfandyar Khan2, Kashif Prince1,*, Mahboob Ali1, Ghazunfar Rashid1 and Azmat Ulah Khan2
Abdul Hanan1, Talha Nazir1, Abdul Basit1, Shahbaz Ahmad2 and Dewen Qiu1,*
...The utilization of entomopathogenic fungi as potential microbial control against different insect pests is important due to their eco-friendly nature. The virulence potential of 3 different isolates of Lecanicillium lecanii formerly recognized as Verticillium lecanii (V-2, V-3 and V-5) with different bioassay materials (conidia, filtrate and the binary combination of conidia + filtrate) were evaluated against green peach aphid (Myzus persicae<...
Nazish Mazhar Ali1, Asma Ashraf 2*, Iram Liaqat2, Bushra Mazhar2, Shaukat Ali2 and Saiqa Andleeb3
...isolate and characterize pathogenic bacteria from eye infections. The samples were taken from corneal eye infections. The collection of samples was done from “Layton Rehmat Eye Hospital, Township Lahore”. Isolated bacterial pathogens were identified on the basis of morphological and various biochemical tests. Morphologcal tests included different staining procedures includng Gram’s staining and Endospore staining. Identification  of
Zhijun Zhong1, Rui Tu1, Xichun Wang2, Yi Geng1, Qicheng Xiao1, Yinan Tian1, Bin Wei1, Jiaming Dan1, Ya Wang1 and Guangneng Peng1,*
...nding of B. canis pathogenicity in naturally-infected pet dogs.

...
Zelle Huma1*, Ahmad-Ur-Rahman Saljoqi1 and Farman Ali2
...eshawar to collect entomopathogenic nematodes, Insect bait technique was used for Entomopathogenic nematodes collection. For this experiment, Galleria mellonella larvae were reared in the laboratory. When  samples soil were collected from different regions of Khyber Pakhtunkhwa for nematodes collection G. mellonella larvae were left in sampling jar and were collected back after 2-3 days’ post applica...
Muhammad Furqan Shahid1*, Tahir Yaqub1, Muhammad Yasin Tipu2, Asim Aslam2, Saima Yaqub1, Aziz-ul-Rahman3, Muzaffar Ali1
...ections particularly low pathogenic avian influenza virus (LPAIV) H9N2, which can bring exceptional abatement in trade of poultry products in endemic countries such as Pakistan. The current study was conducted to evaluate the infectious and antigenic potential of three different AIV (A/H9N2) variants isolated from commercial, backyard poultry and fancy birds (partridge). Commercial broiler birds were infected experimentally at the dose of 106 EID
Shaukat Ali1,*, Sadia Batool2, Fatima Javed Butt2, Sundas Nasreen1, Hafiz Muhammad Tahir1
...e, immunomodulatory, antipathogenic and anti-cancerous properties. Review based on the futuristic and modern aspects of cancer treatment, we believe that probiotics based cancer treatment would be supportive to overcome the chemotherapeutic and radiological drawback sand provides an appropriate cancer treatment strategy. Anticipating various challenges, we expect that probiotics may become a potential cancer bio-theranostic in the field of medical sciences sho...

Khaled Kaboudi* 

...ext-align: justify;">Low pathogenic avian influenza H9N2 subtype virus is considered among important respiratory pathogens in poultry worldwide. It was isolated from many species of domestic and wild birds. Infection in commercial poultry flocks causes important economic losses, related to high mortality, decrease in animal performance and aggravation of infection by other pathogens. Although H9N2 is endemic in many regions of the world, such as Middle East an...
Khursheed Ahmed, Shoaib Freed*, Rana Fartab Shoukat and Kanwar Waqas Ahmad
...of each isolate of entomopathogenic fungi were used in combination with insecticides against 5th instar nymphs of O. hyalinipennis. The combined treatment of isolates of entomopathogenic fungi and synthetic insecticides caused higher mortality of O. hyalinipennis. Moreover, the combined treatments decreased the adult emergence, male and female longevity, while increased the nymphal duration. The resu...
Bibi Nazia Murtaza1, Mazhar Saeed Chaudry2, Shamaila Inayat Nadeem1, Muhammad Shahid Nadeem3 and Abdul Rauf Shakoori4,*
...be a diseases causing or pathogenic alteration by Mutation taster and SIFT analysis. Spotting the rs112445441 in NHL is supporting the idea of cross talk between RAS-ERK-MAPK and PI13K and this could be one of the factors behind the development of resistance to the current therapy and relapse in NHL. K ras mutant isoforms, being the negative predictors for prognosis, are vital to analyse before the start of adjuvant therapy. Further studies needed to confirm t...
Erum Yawar Iqbal1*, Ashfaque Ahmed Nahiyoon1, Shahnaz Dawar2 and Shahina Fayyaz1
...ntified indigenous entomopathogenic bacteria (EPB) Xenorhabdus have been used to access their efficiency against cotton Aphid Aphis gossypii (Glov.). An efficient formulation of different parts of bacterial culture such as, cell-free supernatant, crude cell extract, bacterial culture and methanol extract in in vitro and green house condition have been exploited. The results have shown that different formulants of EPB produced significant e...
Sana Aslam1, Wayne Thomas Shier2 and Imran Sajid1*
...against a broad range of pathogenic test organisms. The partial purification and metabolite profiling using ultra performance liquid chomatography and mass spectrometric (UPLC-MS) analysis suggested the presence of a variety of bioactive compounds including totarol, kifunensine, talaromycin and clausine F. These results indicated that Kallar Kahar Lake harbors a significant diversity of actinobacterial strains which are able to produce a diverse range of biote...
Babar Khan1,2 *, Nazir Javed1, Sajid Aleem Khan1, Nasir Ahmed Rajput1, Muhammad Atiq1, Abdul Jabbar1, Abdul Rehman3, Anam Moosa1 and Muhammad Amjad Ali1*
...font-size: small;">Entomopathogenic nematodes (EPNs) are considered as very effective biological agents against several soil dwelling pests. The following research demonstrates the reproductive potential of EPN specie Steinernema kraussei against last instar larvae of four lepidopteran insects, wax moth (Galleria mellonella), pink bollworm(Pectinophora gossypiella), eggplant fruit borer (Leucinodes orbonalis) and armyworm (Spodop...

Muhammad Zeeshan Nazar*, Ayyan Umer, Zahid Mahmood Sarwar, Faiz Ullah Faiz and Sikandar Hussain 

...s susceptible to various pathogenic diseases. Among the all bacterial diseases of B. mori, flacherie is injurious disease that is initiated by entomo-pathogenic bacteria, Bacillus thuringiensis var. sotto (Bts). The impact of this infectious disease is weight loss, reduction in cocoon quality as well as quantity and source of infestation for healthy larva. In current study, the 3rd instar larva of B. mori were fed on the lea...
Şükrü Önalan1*, Muhammed Arabacı1and Haşmet Çağırgan2
...e is one of the main pathogenic agents in rainbow trout farms in Turkey. Twenty-two L. garvieae isolates obtained from different regions in Turkey were evaluated phenotypically in the study. In all isolates, cream colored, bright, round and S-type colonies with smooth margins were seen in TSA medium. They were alive during native examination without movement. It was observed that morphologically all isolates were Gram (+), α-hemolytic (BA), ox...
Murtala Muhammad, Ting Zhang, Siyu Gong, Jing Bai, Jiansong Ju, Baohua Zhao* and Dong Liu*
...in 2016. We isolated the pathogenic bacteria (HNM-1) from the infected A. sinensis and identified its identity by conventional physiological, biochemical, and molecular techniques. Virulence and pathogenesis of the disease were determined by intraperitoneal injection of the etiological agent to the healthy A. sinensis. Physiological and 16s rRNA molecular analysis identified Streptococcus iniae as the causative agent of the disease ou...
Shaheen Rahman1, Kafeel Ahmad1*, Niaz Ali2, Muhammad Idrees3 and Waqar Ali4
...>A. tumefaciens. The pathogenicity of the isolates was confirmed by in vitro carrot and potato discs inoculation assays. A total of seven strains of A. tumefaciens were isolated on yeast extract mannitol agar (YEMA) medium. The isolated strains were confirmed as A. tumefaciens on the basis of morphological, biochemical and pathogenicity tests. The bacterial cells were rod shaped having rounded ends. The str...

Iram Fatima1*, Imran Pasha1, Ambreen Saddozai2, Shahid Nadeem3, Amer Mumtaz4 and Saqib Jabbar4 

... plate count checked and pathogenic count was calculated in CFU/g and CFU/ml, mean CFU for E. coli and TPC was (3.39×104 to 3.15×105). Total 47.9% samples of spices were found adulterated for eight different adulterants tested. Sugar samples were free of any adulteration while in beverages two other adulterants were found in 22% of samples. Analysis of variance (ANOVA) under two way factorial indicated signif...
Saira Saleemi1*, Zafar Iqbal1, Abdul Nasir Khalid2
...nfirmed by isolating the pathogenic fungus from affected skin, gills, fins, heart, liver, kidney and intestine of fish and culturing it on four different culture media; Malt extract agar (MEA), Corn meal agar (CMA), Sabouraud dextrose agar (SDA) and Potato dextrose agar (PDA). The inoculated culture plates were incubated for 5-8 days at 28-32 oC. The fungal growth in the form of colonies of different shapes and colour appeared in agar plates. Four <...

Hafiz Abdul Ghafoor1*, Muhammad Afzal1, Muhammad Luqman2, Muhammad Arshad Javed2, Syed Wasim Hasan3 and Muhammad Zeeshan Majeed

...mbination with the entomopathogenic fungus Beauveria bassiana (@ 1x108 conidia mL-1). First experiment was conducted in March 2016 and 2nd was performed from November 2016 to March 2017 in a citrus (Citrus reticulata cv. kinnow mandarin) orchard. In first year field experiment, there was a significant impact of all treatments on the reduction of mealybug infestation (F9, 39 = 39.10, P < 0.001; HSD at α = 0.05) as compared to control plants. Results of...

Kajol, A. H. Bhat, Aasha and A. K. Chaubey

Biochemical and molecular characterization of Photorhabdus akhurstii associated with Heterorhabditis indica from Meerut, India
...urther, we evaluated its pathogenicity against Galleria mellonella and Helicoverpa armigera. The LD50 value of strain DH3 against G. mellonella larvae at 48 hours was 8 IJs/larva for 50% larval mortality whereas in Helicoverpa armigera it needed 13 IJs/larva, to kill 50% of the larvae.

...

M. Rufai1† , A. A.Wahab2 , Q. O. Adeshina1 , J. C. Umehokoh1 and O. O.Ologunro1

Occurrence of entomopathogenic nematodes in Osun State, Southwestern Nigeria
... the occurrence of entomopathogenic nematodes (EPNs) was determined in three senatorial districts of Osun State in relation to soil texture, vegetation, moisture and pH. A total of 110 soil samples were randomly collected from various cultivated fields in different locations. The soil samples were baited twice using last instar larvae of the Galleria mellonella (greater wax moth) for presence of entomopathogenic nematodes. F...

Muhammad Riaz1*, Naureen Akhtar1, Salik Nawaz Khan1, Muhammad Shakeel1,2 and Ateeq Tahir1

Neocosmospora rubicola: An Unrecorded Pathogen from Pakistan Causing Potato Stem Rot
...e confirmed Koch’s pathogenicity postulates. Association of N. rubicola causing stem rot in potato is never reported before in Pakistan.

...
Muhammad Khan1, Tehmina Ameer Khan1, Aziz Ud Din2, Muhammad Fiaz Khan1, Irfan Ullah3,*, Kalim Ullah4, Sadia Tabassum1,*
...6S-rRNA gene are the pathogenic mutations associated with HCM in Pakistani population.
...
Muhammad Rizwan1*, Bilal Atta1, Ana Maria Marino de Remes Lenicov2, Roxana Mariani2, Arshed Makhdoom Sabir1, Muhammad Tahir3, Misbah Rizwan4, Muhammad Sabar1, Ch. Muhammad Rafique1, Muhammad Afzal5
...n vectors of severe rice pathogenic diseases in the Oriental and Paleartic regions. Laodelphax striatellus was recorded on rice for the first time in Pakistan. Among alternate hosts, Trifolium alexandrium, Leptochloa chinensis, Helianrhus allus, Medicago polymorpha and Sorghum bicolor were recorded for L. striatellus, while Leptochloa chinensis, Helianrhus allus, Medicago polymorpha, Sorg...

Tahseen Ullah* and Noor ul Amin

In Vitro Antibacterial Activity of Medicinal Plant Extracts
...for multidrug resistance pathogenic plants and human bacterias. 

...

Shishir Sharma* and Laxmi Prasad Joshi

Current Insights on Stemphylium Blight of Lentil with its Management Strategies
...athogens, their effects, pathogenicity, integrated disease management approaches, and future views.

...
Faheem Ahmed Khan1*, Sarzamin Khan2, Qurat-ul-Ain3, Saqib Ishaq1Muhammad Salman1, Abdul Rehman1, Ikram Ullah4, Kalsoom5 and Johar Jamil5
...rmance, immunity against pathogenic microbes for production of quality meat.
...
Wenyou Huang1, Dan Yü1, Song Huang1,2, Jian Xiao2, Ping Qi2, Anhua Song2* and Zhen Huang1*
...l;">The ability of entomopathogenic fungi to be applied for pest control in field applications is often hampered by negatively active abiotic factors including high temperature, desiccation and UV irradiation. Selecting isolates with high UV tolerance and virulence is important in improving the efficacy and utility of fungal insect pathogens as insect biological control agents for use under field conditions. UV-irradiation of Metarhizium lepidiotae, cou...
Iram Liaqat1*, Tahir Hussain1,2, Aisha Waheed Qurashi3, Gulbeena Saleem2Asia Bibi4, Muhammad Fiaz Qamar5,ShaukatAli1 and Ikram-ul-Haq6 
...inarum,is a host specificpathogenic bacterium of fowl typhoid, one of the most important diseases of poultry that increases the death rate and reduction in eggs production. Bacteria forms the complex structural colonies enclosed in a sticky matrix known as biofilm. Various antimicrobial approaches used to treat gastrointestinal infections are usually ineffective due to biofilm formation. The purpose of this study was to (1) compare biofilm formation of three <...
Laura Alejandra Arriola-Mosqueda1, Yadira Jiménez-Lara2, Eugenia del Carmen Prieto-Avella1, Carlos Ricardo Cruz-Vazquez3, Roberto Montesinos-Matias4, Mauricio Valencia-Posadas2, Ana Martha Cruz-Avalos5, Jaime Molina-Ochoa6,7 and César Andrés Angel-Sahagún2,*
...ae. We evaluated the pathogenicity on the eggs and larvae of all tested strains of R. sanguineus at day 3 and 7. The LC50 of four strains of M. anisopliae was determined by Probit analysis, and a chi-square test was used to determine the relationship of LC50 with variable radial growth and germination at 18 and 24 h. Germination at 18 h and 24 h ranged from 83.8–92.5% and 89.5–100%, respectively. The average ...
Saba Shabeer1, Riffat Tahira2 and Atif Jamal3*
 
... the world, amongst them pathogenic species can attack plants at different stages causing considerable damage amounting to millions of rupees. One of the plant pathogenic fungi is Fusarium spp. Fusarium species are very well-known soil-inhabiting fungi that cause many economically important diseases of crops.Many species are included in the Fusarium genus, which are not only

Salma Javed and Samreen Khan*

...mstances to control many pathogenic soil-borne fungi because this is the first study conducted on the subject experiment in Pakistan.

...

Muhammad Arslan Ibrahim1*, Aneeqa Aleem2, Farkhanda Manzoor2, Shahbaz Ahmad1, Hafiz Muhammad Zahid Anwar1, Talia Aroob2 and Mansoor Ahmad3 

...se of 4µl of entomopathogenic NPV suspension containing 4×106 polyhedral inclusion bodies (PIB) was tested as a mortality factor against the late larval instars of S. frugiperda when natural mortality tends to decrease after each successive instar. The single-sex method was adopted in the construction of the life table. The ratio of mortality in the late instars (3rd to 5th) was greater than the early instars because of entomo...
Arsalan Rasheed1, Tahir Usman2,*, Sadaf Niaz1, Irfan Khattak2, Saira Gul2, Nawab Ali1,Naimat Ullah Khan2, Hazrat Ali2, and Mian Saeed Sarwar2
...re not considered highly pathogenic to humans until severe respiratory syndrome broke out in China during 2003. Middle East Respiratory Syndrome, Severe Acute Respiratory Syndrome, and novel Corona Virus Disease (nCOVID-19) or Severe Acute Respiratory Syndrome-2 have increased the interest in this viral family. The Coronavirus-19 is a novel strain that was recently discovered in Wuhan (China) in December 2019. Studies revealed that reservoir of all the three f...

Qaiser Shakeel1*, Rabia Tahir Bajwa1­, Yasir Iftikhar2, Mustansar Mubeen2, Muhammad Luqman3, Waqas Ashraf1 and Ifrah Rashid4

...llium digitatum, a plant pathogenic fungi responsible for ginger soft rot. Petri dish were used to conduct bioassay through poisoned food technique with triplicates. The crude extract of all the plants showed a better inhibitory effects on the pathogen’s (P. digitatum) mycelial growth rather than fungicides. Among all the plant extracts, the best result was showed by garlic extract with 87% of mycelial growth inhibition followed by moringa with 82%, the ...
Iqra Muzammil1, Muhammad Ijaz Saleem1, Amjad Islam Aqib2,*, Ambreen Ashar3Syed Ashar Mahfooz1, Sajjad ur Rahman4, Muhammad Shoaib4, Muhammad Aamir Naseer1, Imran Khan Sohrani1, Javeed Ahmad1, Razaullah Saqi1, Fizzah Laeeq Lodhi1 and
Qaisar Tanveer5
...sk of contamination with pathogenic strains of Staphylococcus aureus. The current study was designed to investigate prevalence of pathogenic strains of S. aureus, assessment of risk factors, and in-vitro antibiogram of non-biofilm producing S. aureus (nbpSA) and biofilm positive S. aureus (bpSA)from mastitic goats. The purposive sampling technique was applied to collect n=200 milk samples f...

Muhamamd Rizwan1*, Muhammad Arshad2, Muhammad Kashif3, Aneela Zameer Durrani4, Asghar Abbas5, Tanveer Ahmad6, Muhammad Nadeem7 , Kinza Khan8

...antibiotic resistance in pathogenic bacteria, enhance their pathogenicity and can survival in host body. 
 
Novelty Statement | CRISPR Cas system is an integral part of prokaryotic immune system that provides protection against viral infection and involved in genome editing, bacterial virulence and antibiotics resistance.
...

NawalM. Abdulla1, M. Haroun1*,Mohamed A. Shalaby2and Ahmed A. Elsanousi2

...eveal virus identity and pathogenicity. Both NDV
isolates were found to be velogenic strains. Real time reverse transcriptase polymerase
chain reaction (rRT-PCR) used as a confirmatory technique, successfully amplified and
detected cDNA fragments corresponding to the NDV RNA extracted from amnioallantoic
fluids (AAF). Sequence analysis and phylogensis of the NDVQF13 strain using 150bp
primer sets reve...
RehamM. El-Bakrey1, Shimaa M.G. Mansour2, Mohammed A. El Sisi1 AndAmal A.M. Eid1
...e utilized.

...

Amany Adel1, Abdelsatar Arafa1, Hussein A. Hussein2 and Ahmed El-Sanousi 2

Rafia Ahsan1, Saif Ullah1, Ijaz Yaseen1, Faisal Sohail Fateh1, Muhammad Fayyaz1, Shahzad Asad1, Atif Jamal1, Muhammad Sufyan2 and Muhammad Zakria1*

...ae (Xoo) through PCR and pathogenicity on susceptible host. The results indicate that BLB is continuously present in rice growing areas of Pakistan specially in Basmati area of Punjab for last many years. There is need to introduce resistant Basmati varieties to reduce the inoculum level and yield losses.

...

Ayman S. El-Habbaa 1, Gabr F. El-Bagoury1, Samar F. El-Adaway2, and Susan S. El-Mahdy2

Hussein A. Hussein, Maha Khedr, Reem A. Suliman, Marwa F. Mohamed, Mounir D. El
Safty
...>
spread of highly pathogenic H5N1. Determination of the optimal antigen content of avian influenza virus
vaccines is urgent to reach protective antibody titers and reduce virus shedding.
Methods: Groups of one-day old commercial broiler chicks were divided in to 8 groups 1, 2 and 3 were
vaccinated with a prepared vaccine contain 500HAU of H5N1 reassortant antigen; while group 4, 5 and 6
were vaccinated wit...
Dalia M. Omar1, Nermeen A. Marden1, Lamiaa M. Gaafar1, Elham A. El-ebiary1, Khalid El-Dougdoug2, Badawi Othman2, Abd Elsattar Arafa3, Hussein A. Hussein4

Tahsin S. Shoala1, Ahmed K. El-Attar2, Ahmed I. Abd El Maksoud3

...rtant potato
pathogenic virus worldwide. PLRV belongs to genus Potyvirus, transmitted by aphids and
widespread in most potato growing areas globally, that causes huge losses in potato crop
production. PLRV management became a challenge due to the economic importance of potato
(Solanum tuberosum L.), the fourth largest staple crop in the world. Our research was aiming
to manage PLRV In-Vitro.
Ahmed A. ElWakil1, Ausama A. Yousif2 , Adel A. Fayed3, Ibrahim M. elsabagh2, Mahmoud
El Gamal2, Omnia H. Refaei3
...rent known commensal and pathogenic microorganisms that
have been reported to replicate in ticks (e.g. Staphylococci, streptococci ) In addition, the analysis
revealed a LSDV sequence output that was nearly equal to sequence output of different bacteria
known to replicate in ticks.
Conclusion: The modified RT-PCR assay used to detect the polyadenylated LSDV DNA polymerase
mRNA in combination with data...
Asma Chaudhary1, Qurat-ul-Ain Ahmad1, Afia Muhammad Akram1, Mehwish Iqtedar2 and Javed Iqbal Qazi3,*
... with well-renowned fish pathogenic bacterium Vibrio anguillarum. Positive control-C2 as well as experimental groups was challenged with V. anguillarum intraperitoneally. Probiotic treated feed with antibacterial potential against V. anguillarum was administered to experimental fishes in different groups; G1 (soon after challenge for 30 days), G2 (for 15 days prior and 30 days after challenge) and G3 (for 15 days prior to challenge). The s...

Hafiz Muhammad Tahir*, Iram Liaqat*, Junaid Nadeem, Hammad Aamir and Shaukat Ali

... against selected common pathogenic bacteria (Esherichia coli, Salmonella typhimurium SJW1102, and Staphylococcus aureus ). According to the study, the DgS and DSS solutions of egg-sac silk exhibited no inhibitory potential by either of the two methods. However, application of web silk using the DSS treated discs showed no growth inhibition compared to the DgS treated discs, where increased inhibition zones were observed against all three bacteria. This study ...
Madiha Nawaz and Shoaib Freed


... local isolates of entomopathogenic fungi on 2nd nymphal instar of P. solenopsis under laboratory conditions by immersion method. Three entomopathogenic fungi; Beauveria bassiana (isolates Bb-01, Bb-08), Metarhizium anisopliae (isolates Ma-11.1, Ma-2.1) and Isaria fumosorosea (isolates If-2.3, If-02) showed percent mortalities of (61.0%, 85.0%), (78.0%, 56.0%) and (52.0%, 54.0%) with LC...

Samreen Khan*, Salma Javed, Tabassum Ara Khanum, Nasira Kazi

...stify;">Abstract | Entomopathogenic nematodes are one of the perfect biological control agents against many insect pests all around the world. In this regard, to collect data about entomopathogenic nematodes regarding their presence and distribution in remote areas such as one of the southern district Lakki Marwat of Khyber Pakhtunkhwa province. Extensive surveys carried out in the months of October 2019 to February 2020. To...
Yang Yang1,2, Ji Shao1,2, Mingxu Zhou3,4, Qiangde Duan1,2, Xinyi Zhang1,2 and Guoqiang Zhu1,2*

...uge economic losses. The pathogenicity of E. coli is closely related to its virulence factors, which are strictly regulated in vivo, and the quorum sensing system is involved in this process. To study the effect of quorum sensing signal molecule acyl homoserine lactone (AHL) on the biological characteristics of Enterotoxigenic E. coli (ETEC), gene lasI of Pseudomonas aeruginosa which is responsible for the synthesis of long s...

Asmaa G. Mubarak1*, Mona M. Mustafa2, Mohamed W. Abdel-Azeem3, Dina N. Ali2 

...well as, to assess their pathogenic potential and antimicrobial resistance. Out of 150 chicken meals collected randomly from various restaurants and food shops including, shish-tawook, pane, and shawerma (50 for each), 10% were contaminated with Salmonella with the acquisition of shish-tawook (14%). On the other hand, 100 hand swabs that were assembled from food handlers working in the same places yielded 13 Salmonella isolates, at the time 4 isolates wer...

Rehman Shahzad1, Saba Irshad1*, Malik Saddique Mehmood1 and Faisal Amin2

...uting to the increase in pathogenicity of the circulating H9N2 virus.

...

Mustafa Ozan Atasoy

...le tool owing to its non-pathogenic characteristic, relatively higher transgenic capacity, and enabling the DIVA strategy. Numerous bivalent and multivalent HVT constructs have been generated by various methods and some of these constructs have been made commercially available so far. The efficacy of HVT-vectored vaccines has been assessed either individually or in combination with other vaccine formulations; hence, the optimal competence of these vaccines aga...

Xiaoli Cai1,2, Saeed Ahmed3, Zhixin Lei1,*, Jianping Wu1,* and Taolei Sun1,2,*

... justify;">Intracellular pathogenic bacteria cause chronic, persistent and latent infections. The treatment for intracellular infection faces many challenges, such as targeting bacteria with antimicrobial drugs and resistance to multidrug (MDR). The present study delivers a possible elucidation to this problem via Nano Drug Delivery. Nanomaterials are relatively small as compared to ordinary antibiotics. The nanoparticle has unique physical and chemical proper...

Irshad Ahmad1,2*

...l agents including entomopathogenic fungi, nematodes as well as adopting the regulatory methods of domestic and international quarantine. This paper provides updated information about IPM, which look like a promising paradigm that can be adopted for the control of red palm weevil.

...

Amjad Ali Channa1, Mansoor Tariq1*, Zaheer Ahmed Nizamani1, Nazeer Hussain Kalhoro2 

...re highly contagious and pathogenic viruses that caused severe disease in poultry and are potentially zoonotic. Since last decade the outbreaks of AIVs have been increased globally including Pakistan. Therefore this study was conducted to determine the prevalence of avian influenza H5, H7 and H9 viruses in broilers at Karachi, Pakistan. A total of 1920 samples, including each of 960 blood samples and tracheal swabs were collected from broilers and tested throu...

Hams M.A. Mohamed1, Mona A. El-Zamkan2* 

...s comprises a variety of pathogenic and commensal bacteria that show a surprising capacity for adaptation to new hosts and antimicrobial resistance, resulting in the spread of infection all over the world, leading to huge health loss. A total of 100 raw milk samples collected from small scale producers, farmers and markets at Qena city, Egypt, were examined for the presence of Streptococcus species. The preliminary identification was confirmed by using VITEK&r...

Ramy S. Yehia1,3, Essam A. Shaalan2* and Hashem M. Al-Sheikh1 

... of some diseases. Entomopathogenic fungi, particularly Beauveria bassiana and Metarhizium anisopliae, and botanical oils have shown potential as synthetic insecticides alternative for house fly control. In the present work, local isolates from both fungi as well as their mixtures with essential oils were evaluated against house fly larvae under laboratory conditions. Batches of house fly larvae (25 individuals per replicate and 4 replicates per dose of fungi)...

Sajjad Khan*, Naila Chand, Abdul Hafeez, Nazir Ahmad 

...omorphology and selected pathogenic bacteria in broiler chickens. A total of 160 day-old Ross chicks were assigned to four groups, containing 0, 0.5,1 and 1.5% GA along with basal feed for 42 days. A completely randomized design (CRD) was followed during statistical analysis while difference in means was calculated through Tukey’s test. Results indicated that supplementation of GA at 1.5% significantly (P<0.05) improved feed intake, body weight gain, ...

Sonali Menamvar1,2,3, Kirubakaran Vinod Kumar1, Veeregowda Muniveerappa Belamaranahally2, Yella Narasimha Reddy3, Rathnamma Doddamane2, Shrikrishna Isloor2, Ramesh Poojari Thimmaiah2, Gurrappanaidu Govindaraj1, Bibek Ranjan Shome1, Vinayagamurthy Balamurugan1* 

...is caused by serovars of pathogenic Leptospira. A pilot study was conducted in some of the dairy farms located in Telangana and Andhra Pradesh, endemic states of India, during 2017 to investigate the seropositivity of bovine leptospirosis in dairy animals and associated risk factors at the farm level. The semi-structured questionnaire was designed as per the literature and used to collect leptospirosis associated risk factors along with serum samples from eigh...

Evrim Sönmez

...ing the effects of entomopathogenic fungi on pests in recent years, researchers have also focused on fungi in fighting pests. These fungi, which are sold as bioinsecticides in the market, are generally preferred by producers who want to engage in organic or environmentally sensitive agriculture. Although there are a large number of sources in literature on the mortality rates of Beauveria bassiana’s A. obtectus, studies on the effects on the biology of t...

Roshana Mukhtar1, Shaheen Shahzad1*, Sajid Rashid2, Maryam Rozi2, Madiha Rasheed3, Imran Afzal4 and Pakeeza Arzoo Shaiq5

...ne to identify potential pathogenic sequence variants. CEP patients were identified using successive clinical tests. Blood samples of patients were collected and processed for genomic DNA extraction followed by Sanger sequencing to identify pathogenic mutations in UROS gene. Sequence analysis revealed a pathogenic missense mutation (c.935T>C [p. L237P]) in the exon 10.The sequence was f...

Kafeel Ahmad*, Muhammad Siqaf, Gul-E-Rana Abid, Ramla Somayya and Umama Qasim

...esistance genes to other pathogenic bacteria through horizontal and vertical gene transfer which could make them superbugs and non-curable through antibiotics. Hence, proper hygienic conditions should be maintained in order to stop the spread of these bacteria to human population.

...

Mona M. Osman1, Kamelia M. Osman2, Manal Abu Elmakarem Mohamed1, Mahmoud E. Hashad2, Jeeser Alves Almeida3, Alaa Saad4, Octavio Luiz Franco5,6, Heba N. Deif 2* 

...actors implicated in the pathogenicity of Mycoplasma arginini (M. arginini) and Mycoplasma ovipneumoniae (M. ovipneumoniae). It shed light on the current knowledge gap in the role of two potential virulence determinants viz H2S production and catalase activity, for their possible roles in biofilm formation, antibiotic resistance and hemolytic activity of M. ovipneumoniae. The recovered sheep isolates of M. arginini and M. ovipneumoniae were examined bacteriolo...
Yang Yang1,2, Hong Zhou3, Ji Shao1,2, Xinyi Zhang1,2, Pengpeng Xia1,2, Mingxu Zhou4,5, Qiangde Duan1,2 and Guoqiang Zhu1,2*
...8ab△hcp1/phcp1), their pathogenic differences were compared, and the function of hcp1 was discussed from the aspects of growth curve, biofilm formation, adherence, invasion, cytotoxicity, and so on. The results showed that hcp1 of the T6SS did not influence bacterial growth and biofilm formation. In F18ab△hcp1, bacterial motility, adherence and invasion towards the intestinal porcine enterocyte cells (IPEC-J2) were reduced significantly, and the cytotoxici...
Emtenan M. Hanafi1*, Fouad M. Tawfeek2, Walid S. El Nattat1, Moetazza M. Alshafei3, Seham S. Kassem3, Kawkab A. Ahmed4, Enas N. Danial5, Hagar Elbakry3, Hoda S. El-Sayed2
...microbial effect against pathogenic bacteria while, it kept probiotic bacteria alive. The animals fed on HFD showed elevated lipid profile, leptin, oxidative markers and low level of testosterone and the epididymal Spermatozoa had low sperm viability and higher abnormalities than control group. Feeding the microcapsules (G2,G3) improved the animals’ health condition. Animals in G2 showed good spermatozoa profile while, those fed SP (G3) showed low sperm ...

Mohamed. E. Taha1, Mohamed S. Ahmed2, Ahmed I. Ahmed2, Amany Adel3, Salama Rehab4,5*, Nabila Osman2** 

...ough the strains are low pathogenic, the presence of mammalian binding amino acid markers indicated their public health concern. Overall conclusion indicated that AIV (H9N2) still circulates among poultry farms in the Southern Egypt. Furthermore, isolated strains were closely related to strains of Israel, Middle East and Asia.

Keywords | Avian Influenza, H9N2, Broiler chickens, Real Time RT-PCR, Sequencing. 

...

Rizwana Abdul Ghaffar* and Kamil Nadeem

...yers. This causes severe pathogenicity in the intestine as a result the pigeon shows signs and symptoms of illness. Pathological studies of tissues from infected intestine reveal several changes from the normal architectural organization of tissues. The most common findings were massive congestion, cellular infiltration, atrophy, hypertrophy and dystrophy of cells and disintegration of cellular layers, fibrosis, necrosis and dilation and proliferation of blood...

Nishant Shah1*, Rakesh Kumar Yadav1, Anil Gautam1*, Shambhu Shah1 and Mohan Kumar Gupta2

...serotype 078: K80:H9) at pathogenicity amount (9.4 x 105 cfu E. coli per bird) was done and morbidity and mortality rate was also recorded. The significantly minimum ammonia (ppm) was recorded in CRH (30.53±0.77); however, the maximum ammonia (ppm) was recorded in RH (49.78±0.42) with that compared to SD (33.42±0.25) and RS (43.22±0.56). Similarly, the mortality rate due to colisepticemia was recorded minimum in CRH (68.75%), howeve...

Sri Melia1*, Indri Juliyarsi1, Yulianti Fitri Kurnia1, Evy Rossi2, Hurriya Alzahra3

...cterial activity against pathogenic bacteria such as E. coli, Pseudomonas, Listeria inokua and Klebsiella pneumonia. Base on the phylogenetic analysis, the bacteria isolated were closely related to Limosilactobacillus fermentum, a probiotic bacteria candidate.
 
Keywords | Lactic acid bacteria, Limosilactobacillus fermentum, Antimicrobial, Probiotic
...

Xinjun Zhang1,2, Pengyong Wang1,2, Huimin Ju1,2, Yanhong Wang1,2, Yang Yang1,2* and Guoqiang Zhu1,2*

...text-align: justify;">Uropathogenic Escherichia coli (UPEC) is a common pathogen of urinary tract infection. To investigate its characteristics and explore the interaction between UPEC and human urinary bladder cancer T24 cells, 7 canine UPEC strains were isolated from dogs in Yangzhou, China. The adhesion-encoding genes (iha, fimH, papA, papC, papG allele I, papG allele I’, papG allele II, papG allele III, focA, focG, sfaS), virulence-associated genes (...
C.A. Angel-Sahagún1, J.E. Ortega Palomares1, A.A. Hernández-Rangel1, C. Cruz-Vázquez2, R. Montesinos-Matias3, M. Valencia-Posadas1 and A.M. Cruz-Avalos4*
...tudy was to evaluate the pathogenicity of Metarhizium anisopliae (Ma) and Beauveria bassiana (Bb) isolates, obtained from adult Ctenocephalides canis, the dog flea, under laboratory conditions. Nine, monosporic cultures were isolated. Each were pathogenic when exposed by immersion at a concentration of 1x108 conidia/ml, causing between 10-100% mycosis at ten days post-inoculation. Four isolates identified as Bb9, Bb6, Ma9 an...

Xiangli Dong1,2, Shilin Mikhail Borisovich2, Jiji Li1,*, Jianyu He1, Zeqin Fu1, Yingying Ye1, Julia N. Lukina3, Olga V. Apalikova4 and Jianshe Zhang1

...RC2 in defending against pathogenic bacteria challenge and the innate immune response in the large yellow croaker. These findings also provide a foundation for the preparation of a Vibrio vaccine.

...

Hanan Saad El-Samahy, Amani Abd El-Naby Hafez, Mohamed Talat Ragab, Disouky Mohamed Mourad*  

H. A. Aidaros1*, S. S. Khalafallah1, M. S. Diab2, Nehal K. Alm Eldin2, Halla E.K. El Bahgy1 

...od to reduce the risk of pathogenic bacteria and reduce the use of antibiotics.

Keywords | Poultry farms, Hygiene, Enterobacteriaceae, Antimicrobial Resistance, Resistance gens. 

...

Aulia Nurul Saputri, I Komang Gede Wiryawan, Dilla Mareistia Fassah*, Dewi Apri Astuti 

...inhibition zones against pathogenic bacteria (E. coli and S. typhimurium). All isolates showed no hemolysis activity. Three isolates (A3, A4, and B1) are molecularly identified as Enterococcus faecalis which showed a potency as probiotic candidate. We conclude that Enterococcus faecalis is a potential probiotic that can be isolated from BSF larvae.

Keywords | 16S rRNA Gene; BSF Larvae; Chicken Manure; Lactic Acid Bacteria; Palm Kernel Meal 

...

Marat Kuibagarov1, Assylbek Zhylkibayev1, Dinara Kamalova1, Anara Ryskeldina1, Nurdina Yerzhanova1, Yerlan Ramankulov1, Alexandr Shevtsov1*, John A Angelos2  

...IBK based on recombinant pathogenic factors have been evaluated as alternatives to whole cell vaccines. Pilin is one candidate antigen for M. bovoculi, and is a key pathogenic factor necessary for attachment of M. bovis to the surface of the eye epithelium. To evaluate pilA diversity amongst Kazakh isolates of M. bovoculi, the pilA gene sequence was determined for 35 isolates of M. bovoculi. Ten genotypes (gNA1-gNA10) were ...

Yasemin Yıldırım Meşepınar and İlker Kepenekci*

...sect pests are the entomopathogenic nematodes (EPNs) in the families Steinernematidae and Heterorhabditidae. This study assessed the effects of EPNs (Nematoda: Steinernematidae) species [Steinernema feltiae (Balıkesir isolates) and Heterorhabditis bacteriophora (Çanakkale isolates) (Nematoda: Heterorhabditidae)] detected in our country (Turkey) against the larvae and pupae of P. operculella in greenhouse-pot experiments. S. feltiae was the most effecti...

Reza Aghnoum*, Hamid-Reza Sharifi, Masoud Ghodsi and Ahmad Zare Fizabadi

...A practices on non-plant pathogenic nematodes is not well understood. This study was carried out to determine the effect of CA on population density of fungivorous (Aphelenchus avenae) and free-living nematodes under four crop rotation patterns. The experiment was arranged as a split plot in randomized complete block design with three tillage systems (conventional tillage, minimum tillage and no-tillage) as the main plots and three level of crop residue retent...

Hams M.A. Mohamed1*, Katreen K.G.2, M.W. Abd Al-Azeem1, Faysal A. Wasel2, Ahmed M. Abd-Eldayem3 

... forming capability. The pathogenicity of L. monocytogenes, particularly virulent, drug-resistant and biofilm-forming strains, is highlighted in this study and can result in a public health danger when present in raw milk. Therefore, it is essential to keep an eye on bacterial resistance in the setting of food production.

Keywords | Listeria spp., L. monocytogenes, Virulence genes, Biofilm, antimicrobial resistance 

...

Sara Magdy Hashim1, Elshaimaa Ismael2, Mohamed Tarek3, Faten Fathy Mohammed1*, Fatma Amer Abdel Reheem3, Rawhia Esawy Doghaim1 

.... 

...
Chunlan Shan1, Chaoying Liu1, Qin Lu1, Guowen Fu2, Syed Aftab Hussain Shah3, Rana Waseem Akhtar4, Ru Zhao2, Libo Gao2, Chang Liu2, Shushu Miao2, Hongdan Wang2 and Hong Gao2*

 

...xt-align: justify;">High pathogenicity island (HPI), a critical genomic element of pathogenic Yersiniabactin (Ybt) carries out synthesis, regulation, transportation as well as virulence. As a virulent determinant for the E. coli, the role of HPI in Saba pig was explored to provide some perspective about disease association. This is the first study in which 44 E. coli superior serotype strains were isolated and identified fro...

H. M. Hassan† and S. A. Ibrahim

...ith two species of entomopathogenic nematodes, Steinernema carpocapsae and Heterorhabditis bacteriophora were tested against cotton leaf worm Spodoptera littoralis. All tested insecticides caused less mortality to the tested entomopathogenic nematodes. Magic smart significantly surpassed other insecticides causing the mortality of 11.6 and 13.8 % to the entomopathogenic nematodes S. carpoc...

A.H. Choshali1, S. Rezaee2, S. Jamali3, H. Reza3, Zamanizadeh4 and F. Rejali5

...nificant decrease in RKN pathogenicity factors (number of galls, eggs, egg sacs and J2) in both tolerant and susceptible cultivars. Inoculation of susceptible roots with AMF significantly reduced the nematode pathogenicity factors. Also the results indicated that the activity of both enzymes increased in the plant with AMF compared with the cucumber roots inoculated with M. incognita alone. Cucumber mycorrhizal roots showed ...

F. Shahina†, K. Nasira, K. Firoza and Y. I. Erum

..., soil, marine and entomopathogenic nematode species described and reported during last sixty nine years (1952-2019) from Pakistan. The information compiled in this paper came gradually from many and diverse sources. It is the product of the efforts of several authors who contributed to gather knowledge on the biological diversity through systematics and faunistic studies. Information published in different scientific journals, newsletters, reports, book chapt...
E. Yavuzaslanoglu1†, U. Gozel2, C. Gozel2 and M. Aydogdu3
...istribution of the entomopathogenic nematodes in apple growing areas in
Karaman province, Turkey and their efficacy on Galleria mellonella (Lepidoptera: Pyralidae). Soil samples were
collected from 130 apple orchards in April 2012 and 2013. Entomopathogenic nematodes were found in 25 samples
(19.23%). Entomopathogenic nematodes species isolated: Heterorh...

A. M. Rahoo1,2,†, T. Mukhtar3, S. R. Gowen2, B. Pembroke2 and M. A. Rahu4

...ditions.
...

A. M. Rahoo1,*, †, T. Mukhtar2, S. I. Abro3, S. R. Gowen1 and B. A. Bughio4

... chemicals, use of entomopathogenic nematodes
(EPNs) is among the viable alternatives. The successful management by EPNs is dependent on their establishment in
soils, infectivity, persistence and pathogenicity for longer periods. In the present study, emergence of Steinernema
feltiae infective juveniles (IJs) from infected Galleria mellonella cadavers was monitored under moist and dry

Ahmed S.M.H. EL Roby

...ne exotic isolated entomopathogenic
nematodes (EPNs) against sugarcane mealybug Saccharococcus sacchari under laboratory conditions (27 ± 2 °C,
RH 65 ± 10%). The EPNs used in the study are Steinernema sp. (strain: AT4), Steinernema sp. (strain: EMB),
Heterorhabditis bacteriophora (strain: EKB20), Heterorhabditis sp. (strain: EIK) and Steinernema glasri (strain:
New Jersey). The bioassays were ca...

I. Kepenekci1†, S. Toksöz2, T. Atay1 and I. Saruhan2

...div>Six species of entomopathogenic nematodes (EPNs) (Steinernema feltiae, S. carpocapsae and Heterorhabditis
bacteriophora) isolated from Turkey [S. feltiae (Aydin isolate), S. carpocapsae (Black sea isolate), H. bacteriophora
(Aydin isolate) and H. bacteriophora (Çanakkale isolate)] and from Kyrgyzstan [S. feltiae(KG3) and H.
bacteriophora (KG81)] were tested for the control of black timber bark beetle, Xylosandrus ...

I.K.A. Ibrahim1 and Z. A. Handoo2

...n rice plants.

...

F. Shahina† and G. Mehreen

...n this study seven entomopathogenic nematode Steinernema isolates were examined using genetic analysis by ITS
rDNA and 12S mtDNA. Phylogenetic analysis of these isolates was inferred by using four different methods i.e.,
Maximum Evolution (ME), Maximum Likelihood (ML), Maximum Parsimony (MP) and Neighbor Joining (NJ)
based on the two makers. Sequence composition and phylogenetic analyses of these isolates showed closeness wi...

I. Kepenekci

...l of 82 species of entomopathogenic nematodes (EPNs) has been identified worldwide belonging to
Steinernema (65), Neosteinernema (1) and Heterorhabditis (16). This number is going up in parallel to new
investigations. Five species of Steinernema and three Heterorhabditis species were identified in Turkey. There are
only a few literature supports about detrimental effects of Turkey origin EPNs on maleficent groups having

F. Shahina†, K.A. Tabassum and M.A. Habib*

...genous
entomopathogenic nematodes (EPNs) isolates have positive results. Four EPN isolates viz., Steinernema
pakistanense, S. asiaticum, S. feltiae and Heterorhabditis indica were assessed for their infectivity against the
cotton bollworm complex in field. EPNs cultured on Galleria mellonella L. and stored in distilled water at 5 °C,
were kept at room temperature for 24 hrs before use. The number of bollworms...

Rinat Islamov*, Dinara Turegeldieva, Altyn Rysbekova, Kuralay Sarmantayeva, Victor Semenuyk 

...out. To do this, several pathogenic bacteria and viruses from the Federation of European Laboratory Animal Science Associations (FELASA) were selected. The main methods of testing biological samples from laboratory mice and rats were realtime polymerase chain reaction and enzyme-linked immunosorbent assay. A high prevalence of some pathogens among conventional laboratory animals used by some academic institutes and universities of Almaty has been shown. Rodent...

Najam-ul-Sehar Afshan1*, Javeria Majeed1, Abdul Rehman Niazi1, Saima Khanum2, Maria Riaz1, Muhammad Fiaz2 and Shaila Anjum

...b, Pakistan, during phytopathogenic surveys in 2015–2020. The causal fungus was observed and identified on the basis of morpho-anatomical and molecular analyses. This is the first report of powdery mildew infection caused by Erysiphe necator var. necator from Punjab and Khyber Pakhtunkhwa provinces of Pakistan.

...

Hina Safdar1,2*, Nazir Javed2, Sajid Aleem Khan2, Muhammad Zeeshan Majeed3, Arif Mehmood3 and Muhammad Arshad4

...t-align: justify;">Entomopathogenic nematodes (EPNs) are effective biocontrol agents against different insect pests. However, very little work has been done in Pakistan on the symbiotic bacteria associated with EPNs and their metabolites. In this laboratory study, two bacterial isolates i.e. Xenorhabdus spp. associated with EPN Steinernema glaseri (Steiner) (Steinernematidae) and Photorhabdus spp. associated with EPN Heterorhabditis bacteriophora (Poinar) (Het...

Dina N. Ali1*, Sayed H. Elhabtey2*, Manal M. Amin1  

...life may be shortened by pathogenic and spoilage bacteria, which are prone to contaminating food. This suggests that bio-preservatives may be used during the cheese-making process. So, this research was done to determine how well moringa oil (MO) and its nano emulsion (Nano-MO) work on some food poisoning bacteria inoculated into white cheese in vitro and in vivo. Prepared (Nano-MO) had the Z-average diameter of 76.04±51.13 nm and polydispersity index (...
Hagar Magdy Ahmed1, Mohamed Mahrous Amer2*, Khaled Mohamed El-Bayoumi1, Ahmed Ali El-Shemy3, Mohamed Abd El-Rahman Bosila1, Gomaa Abd El-Rhim Abdel Alim2
...al broiler chickens. The pathogenicity studies parameters included the effects on protection, growth performance and clinico-pathological changes. The results indicated that, immunostimulants can keep maternal immunity longer where lector® was the best; the decline in HI titers also indicates that bird groups not contract ND natural infection. The results of performance parameters after immunostimulants administration and challenged with IBDV at 14-days of...

Nachaat Sakr

...s of host resistance and pathogenic variation of FHB species need to be identified. Although barley and wheat are crucial crops in the dried Mediterranean area, there is insufficient information about their resistance to head blight infection and aggressiveness of Fusarium species. A 3-year (2019 to 2021) experiment was conducted under arid Mediterranean conditions to measure disease reactions, i.e., FHB incidence (DI, Type I resistance), FHB severity (DS, Typ...

J. Salma and F. Shahina

...lecting strains of entomopathogenic nematodes for mass production on large scale to provide protection to crops against insects.

...

A. N. Mahar, N. D. Jan†, A. Q. Mahar and S. R. Gowen

...b(255, 255, 255);">Entomopathogenic nematodes Steinernema carpocapsae

Ghada A. Ibrahim1*, Mohamed Sayed Helal1, Nahed Abd Elhafeeze Kamoura2, Mohamed Samir3,4, Amira Mohamed Mazid5, Mohamed F.M. Farag6

...re one of the dominantly pathogenic bacteria that involved in bovine respiratory infections. Its spreading problem is growing rapidly especially it could combine resistance with high-level of virulence traits that make it is more difficult to be treated. This study provides insight into the respiratory infections by Klebsiella spp. and its MDR profile in bovine cases, as well as the potential target genes that were involved in the links between virulence deter...
Syeda Fakhra Waheed1, Asim Aslam1*, Muti-ur-Rehman Khan1, Kamran Ashraf2 and Beenish Zahid3
...equired to determine the pathogenicity of the IBDV reassortant and development of new policies for IBDV intervention in the country.

...

Tanvir Ahmed1, Sachchidananda Das Chowdhury1, Bibek Chandra Roy1Shubash Chandra Das1*, Khan Md. Shaiful Islam2, Bipul Chandra Ray1, Sukumar Saha3 

...e enhancer, reducing the pathogenic bacteria load, and boosting the immune response. PB may be a suitable alternative to AGP.  

...

Meng Wang, Dongliang Zhou, Huixia Li, Chunqin Wu,Yan Zhao and Houqiang Luo*

...lays a vital role in the pathogenic mechanism of bacteria by participating in bacterial adhesion, biofilm formation, and contributing to the ability of nutrition acquisition a nd environme ntal adaptability. T5SS is a vital factor in the gradual reduction of antibiotic effectiveness, so the system has been the target of alternative antimicrobial strategies based on small molecules and antibodies. This review mainly introduces the discovery history of the bacte...

Asmaa A. M. Abdel-Ghany1, Ahmed N. El Taweel2, Yassmin Moatasim2, Nagwa S. Ata1, Amany Adel3, Ayman Hany El-Deeb4, Ahmed Kandeil2, Mohamed A. Ali2*, Hussein Ali Hussein4* 

... />  

...

Bambang Hartoyo1*, Tri Rachmanto Prihambodo1,2, Wahyuningsih3, Sri Rahayu1, Fransisca Maria Suhartati1, Muhamad Bata1, Efka Aris Rimbawanto1

...ve tract and decrease in pathogenic bacteria with 5 x 10-7 cfu log-1 Lactobacillus population recommendation.
 
Keywords | Intestinal, Microorganism, Feed efficiency, Mix model, Systematic review
...

Md. Rashedul Islam1, Abul Farah Md. Hasanuzzaman1*, Md. Latiful Islam2, Ghausiatur Reza Banu1 

...ce and load of total and pathogenic bacteria in the different components of the mud crab hatchery. Selective agar media, a series of biochemical tests, and bacteria isolation kits were used for the isolation and identification of bacteria. The genus Vibrio, Aeromonas and Pseudomonas were identified in different components of the larval production line in the hatchery. V. mimicus, V. parahaemolyticus, V. harveyi and V. alginolyticus were the major species ident...

Lipigwe Lauya1*, Peace Nkiruka Okeke2, Chukwudi Chizorom Ibeh1, Bello Ozovehe Banimoh1 and Nanma Tongnan Cosmas1

...p of HIV-2 patients, the pathogenicity of the HIV-2 virus, and the clinical picture of the disease depending on the sex of individuals.

...

Abdulaziz A. Alaqil

...The infection with avian pathogenic Escherichia coli (EC) causes a great economic loss in the poultry industry. The current study aimed to investigate the effect of propolis (PR) inclusion in the diets of broiler on the immunomodulation and productive performance after challenge with EC infection. Four hundred broiler chickens (Cobb500, 1-d-old) were randomly distributed in equal numbers in 40 battery cages (10 birds per cage). Every ten cages were placed in a...

Abdulaziz A. Alaqil*

...s persuaded by the avian pathogenic Escherichia coli threatens egg production and costs the poultry business significantly in lost revenue. This investigation was carried out to determine the beneficial effects of dietary Lactobacillus acidophilus (LA) on laying hens exposed to endotoxic shock induced by intravenously injection of lipopolysaccharides (LPS). A total of one hundred twenty, 40-week-old, laying hens from the Hy-line breed were allocated at random ...

Abdur Rauf1*, Farooq Jan1, Muhammad Qayash2, Zia-ul-Islam3, Rizwanullah1, Ikramullah Khan1, Muhammad Shuaib4, Muhammad Khalid5 and Samrin Gul6

...fungal species. The four pathogenic bacteria (Micrococcus luteus, E. coli, Staphylococcus aureus, Bacillus subtilis) and two fungi (Aspergillus flavus and Aspergillus niger) were examined. The above-mentioned various ethanolic crude extracts of H. eichwaldii revealed the highest potential (15.82±0.40), (18.12±0.56), and (17.41±0.51) against S. aureus, a moderate activity (13.31±0.64), (15.43±0.52), (14.35±0.64), (11.34...

Atef M. El-Sagheer1*, Aline F. Barros2, El-Sayed M. Abd El-Aal3, Mohamed M. Gad4, Doaa S. Mahmoud4 and Amr M. El-Marzoky3

...is mainly to clarify the pathogenic effects of both nematodes (Radopholus similis and Meloidogyne incognita, alone or in combination), as a histological modification in root tissues under natural conditions of banana cultivation. R. similis was observed in the cortical parenchyma as a feeding site, and for the first time, the feeding site extended to the vascular cylinder. In roots infested with M. incognita only, the laceration of the feeding site in the inne...

Nadia Jabeen1, Abdul Mubeen Lodhi1*, Rehana Naz Syed1, Muhammad Ali Khanzada2 and Alia Gul3

...asmiellus scandens being pathogenic was found mostly on the trunk of trees and is a semicircle convex-shaped basidiocarp. The species were studied for morphological characteristics. For molecular characterization, DNA extraction was performed from the samples using a kit , and PCR amplification  was done using ITS4 and ITS1F  primers designed from the conserved regions as described in the previous studies. The amplified PCR products were sequenced fr...

Saddam Hussein Mahmoud* and Shaimaa Nabhan Yassein

...tors that were linked to pathogenicity and the severity of infection. There findings suggest that poor sanitation and a reduction in goat health and nutrition were to blame for the high morbidity incidence of mycotic mastitis in Iraqi goats. 
 
Keywords | Goats, Dairy industry, Mycotic, Mastitis, C. albicans, virulence factors, Yeast’s virulence and biochemical indices
...

Gang Liu*, Na Xu, Zhizhong Gong and Jiahui Feng

... lakes. Nine potentially pathogenic species were identified across all samples, and the relative abundances of potential pathogens were significantly higher in the Shengjin Lake samples than in the Caizi Lake samples. These findings suggest that the gut fungi were highly sensitive to the diets of the geese at both lakes. Potential pathogenic species of A. erythropus should be further studied.

...

Tahir Rasool Qamar1, Sanaullah Iqbal1*, Muhammad Nasir1 and Habib-ur- Rehman2

... Enzymatic activities of pathogenic bacteria were lowest in this group and were significant (p≤0.05) when compared to group G2. Percentage of total aberrant crypt foci (ACF) inhibition was also higher (30.14%) in group G4 as compared to group G3 (18.55%). Elevated levels of short chain fatty acids were observed in chicory root powder groups particularly in G4 which having significant higher levels of acetate and butyrate compared to group G2. Group G4 also ...

Muhammad Ilyas Riaz1, Masood Rabbani1*, Sohail Raza1, Ali Raza Awan2, Aleena Kokab1 and Iqra Nazir3

... interference, and human pathogenic potential. In this study, we have developed a Brucella abortus pUC19-K-UP-DN plasmid cassette for the construction of ΔpurD deleted mutant by deleting the purD gene which is responsible for de novo purine synthesis. For this, the pUC19-K-UP-DN plasmid cassette was initially constructed using pUC19, kanamycin, and purD upstream and downstream fragments. Then the cassette was electroporated into electro competent Brucell...

Asifa Majeed*, Amir Rashid, Palvasha Waheed, Asma Faryal, Aden Razaq and Ayesha Maryam

...y was designed to detect pathogenic genetic variants in APOA1 and ABCG1 genes associated with dyslipidemia in type 2 diabetic patients. A total of ninety subjects of both genders, aged between 30-70  years were randomly selected and further divided into a diabetic dyslipidemia group, a diabetic group and a healthy group. Genomic DNA was extracted from peripheral blood and subjected to the polymerase chain reaction using primers of the APOA1 gene and ABCG1...

Imran Nadeem1, Qurban Ali1, Muhammad Kamil Malik1*, Asad Aslam1, Imran Tariq2, Muhammad Bilal Bin Iqbal1, Muhammad Faheem Akhtar1, Sikander Ali3, Muhammad Jawad Saleem1, Muhammad Zubair3 and Aqsa Abbas1

...Capsule lures, one entomopathogenic fungus, “Beauveria bassiana, and one noval insecticide, e.g., Radiant 120 SC (Spintoram), were evaluated to check the percentage infestation reduction of Pectinophora gossypiella under field conditions under the RCBD design. The results showed that the effectiveness of the traps was excellent in the early days but declined as time went on. The results showed that Pb rope traps had maximum control over the pink boll wor...

Muhammad Nadeem1, Jamshaid Iqbal2, Tariq Mustafa3, Gul Rehman2, Muhammad Faisal Shahzad2, Muhammad Younas4,5*, Aftab Ahmad Khan6, Ameer Hamza2, Abdul Ghaffar1 and Muneer Abbas1

...agement technique. Entomopathogenic fungi (EPF) are currently used as biocontrol agents and are alternatives of synthetic insecticides in sustainable agriculture. The bio-efficacy of entomopathogenic fungi (EPF); Metarhizium anisopliae (PacerMA), Verticillium lecanii (Zimm) (Mealikil-VL), Isaria fumosorosea (Wise) and Beauveria bassiana (Bals) (Racer-BB) were investigated against the mung bean thrips, Megalurothrips distalis...

Orooba Mohammed Saeed Ibrahim1*, Rawaa Saladdin Jumaa2, Nibras Zeyad Yahya1 

Nurul Fajrih1,2, Komang Gede Wiryawan1*, Sumiati1 and Suraya Kaffi Syahpura3

...um and L. rhamnosus) and pathogenic bacteria (E. coli and Salmonella). Bacterial growth Media using control media without sugar sources, MRS + glucose media, and MRS + banana corm extract (BCE) media. Based on the results of the study, BCE contains glucomannan by 33.59% with a yield of 14.15%, and in vitro test results show that BCE is only able to be fermented by the lactic acid bacteria but not by pathogens. In addition, BCE can be utilized as a source of ca...

Frah R Kbyeh1*, Ahmed N. Abedsalih2 

... also have a role in the pathogenicity of the resistant Escherichia coli 0157: H7 strain. Resistance Escherichia coli 0157 H7 for antibiotics decreases the cure rate. Repurposing Food and Drug Administration (FDA) approved medications against the contributing factors is a novel method to overcome this scarcity. The analgesic medication diclofenac was reported to have anti-virulence action against resistance Escherichia coli O157 :H7. This study aimed to demons...

Kanda Yanuar Muhamad1,3, Trioso Purnawarman2, Chaerul Basri2* 

...ay potentially introduce pathogenic agents and facilitate their spread in Indonesia. The knowledge and awareness of importers and traders play a crucial role in mitigating the emergence of such potential risks. This research aimed to assess the level of knowledge among importers and sellers of reptiles concerning diseases that may be transmitted by these animals. A survey was conducted involving 113 employees working in reptile import and sales businesses all ...

Sidra Hafeez1, Tayyaba Sanaullah2, Hafsa Naeem3, Mah Noor Hassan4, Muttalib5, Farhana Kausar6, Muhammad Salman Hameed7*, Muhammad Anayat Ullah8, Abdul Samad9, Memoona Bashir10 and Sadaf Shabbir11

...’s postulates, the pathogenicity test was performed. CTAB method and Internal Transcribed Spacer region were applied to isolate and amplify the fungal genomic DNA respectively, by using universal primers ITS1/ITS4. The analysis of polygenetic of an amplified product revealed that black rot caused by D. bryoniae in pumpkin.

...

Nafissa Sahel1*, Fadela Chougrani2, Abderrahim Cheriguene3 and Zineb Hamani1

.... All samples tested for pathogenicity were negative for pathogenic germs.

...
Amany M. Reyad1*, Aya Maher Rabie1, Reda Mohamed Taha1 and Khalid El-Dougdoug2
...l methods of controlling pathogenic bacteria in which they have a high ability to self-reproduce, host specificity, and develop with their bacterial hosts. The most common pathogenic bacteria were isolated from fresh meat and identified using the VITEK II automated system. Phages specific to Escherichia coli, ...
Morcos Ibrahim Yanni1* and Eid Elsaid Abdelaziz2
...ne plays a role in viral pathogenicity, the detected variance in nucleotide and amino acid identities of the P gene in our local circulating isolates over the years confirmed the anticipation of distinction in the pathogenicity of such isolates. All vaccinal strains have a genetic distance from field Dakahleya, Beheira, and Alexandria isolates (ranging from 88.2% to 88.9% for the China human rabies vaccine AG)
Hagag, N.M.*•, Arafa, A.*; Shalaby, M. A. ** El-Sanousi, A. A. **and Aly, M. M. 
...-align: justify;">Highly pathogenic avian influenza (HPAI) caused by influenza A H5N1 virus, poses a significant threat to the poultry industry and humans in Egypt. Since it was first recognized in 2006, the disease has become enzootic in poultry throughout Egypt and still circulates in the poultry population, so the ability to rapidly recognize AlVs in biological specimens is critical for limiting further spread of the disease in poultry. Application of molec...

Omarl , Dalia M.; El-Ibiaryl , Elham A.; Sadik2, Atef S.; Abdel-Ghaffar2, Mamdouh. H. and Othman2, Badawy A.

...r determination of their pathogenicity in specific pathogen free (SPF) 4-6 week old chicken. All the Al isolates proved to be HPAI viruses where the Intravenous Pathogenicity Index (IVPI) score for them were 2.1, 2.5, 2.3, 2.2 & 2.3 and their titers in ECE were 10.1, 9, 9.3, 9.3 and 10 Logo10 EID50/ ml for 2006, 2007, 2008, 2009 and 2010 isolates respectively.

...

Sofyl *, A.R.; Soliman , A.M.; Mousal, A.A. and El-Dougdoug , Kh.A.

... cachexia isolate in the pathogenic domain (P) tend to influence the pathogenicity of the HSVd-EG. Finally, the genetic diversity and evaluation of entropy power for the Egyptian cifrus gummy bark agent and HSVd-citrus populations registered in GenBank, were viewed against the phylogenetic backgound of CVd-II variants including the noncachexia (CVd-IIa) and the causal agents of severe (CVd-IIb, CVd-IIc), more moderate (Ca903...

El-Dougdoug, Kh.A.; Rezk , A.A.; Dawoud, Rehab A. and Sofy, A.R.

...lieved to control viroid pathogenicity. Finally, this constitutes the first isolation and identification of CSVd from diseased Chrysanthemum plants in Egypt

...
Arafa, A ; El-Kanawaty, Z; Hassan, M.K; Anwar, H.K  and  Mona M.Aly 
 
...06 an epidemic of highly pathogenic avian influenza (HPAI) virus Of subtype H5N1 affected all commercial poultry sectors as well as rural and backyard level in Egypt. This outbreak also was extended to include the zoo birds In Giza zoo. This study records the isolation and characterization of H5Nl virus from different species of the zoo birds and also studies the immune states of the vaccinated birds after application of H5Nl vaccine for the first time one mon...

Madbouly, H.M; Orkhan, M.H**; Nagwa El-khoty

...-align: justify;">Highly pathogenic avian influenza (Al) H5N1 strains have been isolated during February 2006 from infected chicken located at El-Qanater El-Khiria center, Qaluobia, Eypt. These isolates were molecularly characterized and compared with those H5Nl strains isolated during January 2007 from the same locality. The strains isolated from infected chicken during 2006 were closely related to A/ty/Turkey/l/05 strain which had been isolated from tur...

Abd Elwanis, N.D.; Abou El Khair, M.A.; Afaf H. Amin; Azab, A. and A.O. Abd El Rahman

...en prepared from the low pathogenic avian influenza (LPAI) virus A/Turky/CA/209092/02, H5N2 for the first time in Egypt. Virus strain from which the vaccine seed virus has been prepared was derived from the USDA, Ames Iowa, USA. The specific characters of this strain were studied; It was found that the best virus dilution of Al virus for egg inoculation was 10-3 to 10-4, the peak virus titer was obtained 72 hours post inoculation, the predilection sites of the...

A. A. El-Kholy1, S. Vilcek2 and A. M. Daoud1

... 6/9 BVDVs that were cytopathogenic. Direct sequencing of the RT-PCR amplicons revealed an extreme nucleotide sequence homology (≥ 98%) among all tested Egyptian isolates versus the local vaccine strain. sequence alignments showed variable identity (74% - 93%) of the Egyptian vaccinal strain versus reference laboratory and vaccinal strains of BVDV. Clustering and phylogenetic analyses suggested that these Egyptian vaccinal and field BVDVs are low-Kinetic va...

H. A. Hussein1, N.A. Mohamed2, F.M. Mohamed2 and M.A. Shalaby1

...ic effect (CPE). The cytopathogenicity of the isolates were different when these viruses were inoculated on BVDV-free and-infected cell lines. To study the discrepancies on the growth behavior of the local isolates, the viruses subjected to further passages on MDBK cells infected with non-cytopathic (NCP) strain of BVDV which was homologues (pair) to their genotype (type I). After four passages on cell culture. The local isolates demonstrated enhancement in th...

H.A. SULTANl, H.A. HUSSEIN2, and F.F. EL-KHAYAT3

...s-based AC-ELISA and the pathogenicity of some representative infectious bursal disease virus (IBDV) field isolates were studied. Of the selected 22 IBDV -positive bursal samples, 59.1% (13/22) were typed as classic IBDVs and 40.9% (9/22) were of variant IBDVs. The majority of IBDV variant antigens detected (89% Of IBDV variants) were related to IBDV Del/E variant strain and one sample (11% of IBDV variants) was related to RS593 strain. The

Tarek Refaay, E.A. Elshafiee, Hayam A. Mansour and Maha A. Sabry*

 

...lusion, the detection of pathogenic MDR E. coli O157:H7 in food samples, food handlers and food equipment in some touristic cities in Egypt poses a serious risk to public health. Therefore, it is recommended to focus on identifying practices which increase the risk of food contamination, and on implementing measures to improve the sanitary conditions in the food outlets in touristic cities.

...

Sajjad Khan*, Naila Chand, Abdul Hafeez and Nazir Ahmad

...omorphology and selected pathogenic bacteria in broiler chickens. Day-old 200 Ross male chicks were allotted to five groups each subdivided in four replicates with ten birds per replicate. Similarly, five different types of feed i.e., diet A as control while B, C, D and E having 1.5% GA, 30mg/kg BS, 1.5% GA+30mg BS and 0.75% GA+15mg/Kg BS respectively, were offered during 42 days of experimental trial. Statistical analysis was performed by SPSS following CRD d...

Wahid Hussein El-Dabae*, Eman Shafeek Ibrahim, Eslam Gaber Sadek, Mai Mohamed Kandil

...s checked. Intracerebral pathogenicity index (ICPI) of the attenuated strain was 0.2, the mean death time (MDT) was 120 hours and infectvity titer was 7 log10 EID50/ml compared to 1.97 ICPI, 36 hours MDT, and 9.5 log10 EID50/ml of the original strain. The attenuated AOAV-1 was protective in vaccinated chicks by means of HI antibody response and protection from heterologus virulent challenge while showing little to no residual pathogencity. Histopathological in...
Sijie Jian1,2,3,4, Wei Sun1,3, Jia Chao1,2, Na Rong1,4, Xiang Liu1,2,3,4* and Chen Chen1,2,3,4*
...as fluorescens are major pathogenic bacteria in freshwater aquaculture and cause huge economic losses. The outer membrane lipoprotein Slp of A. hydrophila has potential applications in fish vaccines. Slp bioinformatics analysis showed that anti-Slp serum might provide cross-protection to resist bacterial infection in fish. Slp was obtained by molecular cloning, expression and purification, and the expression conditions were optimized. In mice immunized with Sl...

Hongsen Xu*, Xiaoni Wang, Tie Tian, Changyu Zhao, Denghang Yu and Jun Liu

...ological characteristic, pathogenicity and drug sensitivity of this bacterium. The results of this study will provide scientific guidance for the effective prevention and control of muscle turbidity of P. clarkii.

...

SEHRISH MUSHTAQ1, MUHAMMAD SHAFIQ1, MUHAMMAD ASHFAQ*1 FAIZA KHAN1, SOHAIB AFZAAL1, UMMAD HUSSAIN1, MUBASSHIR HUSSAIN1, RASHID MUKHTAR BALAL2 & MUHAMMAD SALEEM HAIDER1

...) to check the growth of pathogenic fungi compared to controls. Aureobacterium liquifaciens (27.66%), Acinetobacter sp. (25.66%), Bordetella pertussis (26.63%) also showed equal potential for inhibition. In contrast remaining isolates Enterobacter cloacae (19.33%), Azomonas agilis (17%) and Kurthia sp. (19%) were less efficient as compared to the others. Bacterial endophytes are colonized inside plants and have antagonistic potential for fungal pathogens. Thes...

ZUBIA RASHID1, ZULFIQAR ALI MIRANI2, SITWAT ZEHRA1, SYED MUDDASSAR HUSSAIN GILANI3, ARIF ALI CHISHTI1, ABID AZHAR1 & SADDIA GALANI1*

... and reduced (p<0.05) pathogenic bacterial (E. coli and Campylobacter spp.) population versus AB and CON group. Overall, statistical profiling of gut bacteria depicted numerically increased beneficial bacteria in PFA group (79%) followed by AB (72%) and CON (65%) in chicken gut. In conclusion, due to increased animal performance and maintained balanced gut microflora tested phytogenic feed additives of this study might be regarded as potential alternatives ...

Nadir Ali Birmani1*, Ramesh1, Shakeel Ahmed Memon2, Raheela Noor Memon1, Badar Alam Samejo3 and Mehtab Ali Mahar3

Habibeh Jabbari

...only differences between pathogenicity populations.

...
Muhammad Atif Raza1, Muhammad Tariq Javed2, Muhammad Fiaz1*, Muhammad Shakeel3, Muhammad Shahbaz Ul Haq2, Amna Kanwal2, Syeda Maryam Hussain1 and Muhammad Zubair Siddiqi4
...hoid has revolved into a pathogenic hazard to the poultry industry and extensive use of antibiotic is leading to the induction of antimicrobial resistance in microorganism. Main aim of this study was to find out substitute of antibiotic against Fowl Typhoid in broiler in terms of immunological, serum biochemistry and lipid profile parameters. Broiler chicks (Age = 1 d and n = 90) were kept under uniform management conditions. Chicks were divided randomly into ...

Muhammad Ilyas Riaz1, Masood Rabbani1*, Sohail Raza1, Ali Raza Awan2, Aleena Kokab1, and Rida Haroon Durrani1

...rted drawbacks including pathogenic potential for humans and excreted in body fluids of vaccinated animals. In the present study, we constructed a more attenuated B. abortus ΔpurD mutant by deleting the purD gene from the RB51 strain through site-directed mutagenesis. For virulence attenuation comparison with the parent RB51 strain, the constructed mutant was evaluated for attenuation estimation and clearance in BALB/c mice. The B. abortus ΔpurD mu...
Danish Riaz1,2, Syed Makhdoom Hussain2*, Majid Hussain3, Muhammad Zubair-ul-Hassan Arsalan4 and Eman Naeem2
...ive function against gut pathogenic microorganisms. The purpose of this study was to examine the effects of supplementing Catla catla fingerlings fed a diet including sunflower meal (SFM) with probiotics (Protexin®) on growth performance, nutritional digestibility, and hematological indicators. Six test diets and one control diet (0 g/kg) were formulated before the beginning of the experiment, with varying amounts of probiotics (0, 0.5, 1, 1.5, 2, 2.5 and ...

Amir Afzal1*, Sairah Syed1, Hafiz Husnain Nawaz2, Ruqeah Mustafa1, Marjan Aziz1, Madeeha Khan1, Azra Khan3, Uzma Javed1, Attiq Ur Rehman4, Rubab Altaf 5 and Qamar Shakil6

Roshan Ara1, Muhammad Ali Khanzada1, Amir Khan Korai1*, Abdul Mubeen Lodhi, Anam Mehwish Khanzada1, Khalid Hussain Qureshi1, Shakal Khan Korai2*

Parvez Khawaja, I.A. Hafiz and M. I. Chaudhry
...fer to the environment a pathogenic fungus, Beauveria bassiana (Bals.) Vuill. Was tried against the larval stages of the pest. The fungus displayed its pathogenecity by killing 72.5-97.5% larvae in various treatments as against 50% natural mortality in check treatment. The method can safely be used against the pest on larges scale....

Pavana Jyothi Vanjavaka1, Mouradam Veerasami2, Mohana Subramanian Bhaskaran2*, Vijay A.K.B. Gundi1*

...CPV) is a contagious and pathogenic virus in puppies and dogs. It was first reported in 1978; however, it was later replaced by three antigenic variants at different periodic intervals that now circulate globally with random strains. This particular study aimed to determine the genetic changes in the VP2 gene, which are responsible for creating different antigenic variants, and to understand their impact on pathogenicity. In...
Javairia Mehboob1, Syeda Hafsa Ali1*, Fahima Ashraf Kasi1, Syeda Ayesha Ali2, Safa
Farooqi3, Muneeza Arbab4,
...ic nanoparticles against pathogenic
bacterial strains (Staphylococcus aureus, and Escherichia coli) and Plant pathogenic fungal
strains (Aspergillus flavus and Aspergillus niger). Our results confirmed the formation of
AgNPs with size <100 nm. Antibacterial activity of lavender mediated AgNP was highly
significant, followed by artichoke mediated AgNP and Alkanet AgNP. Howeve...

Zara Naeem1, Khajista Jabeen1*, Muhammad Khalid Saeed2, Sumera Iqbal1

...L.) Pers. against target pathogenic mycotoxin producing fungal species (Trichoderma viride Pers., Trichoderma harzianum Rifai. and Cladosporium cladosporioides (Fresen.) G.A. de Vries. For this purpose, different concentrations viz. 2%, 4%, 6%, 8%, and 10% of methanolic leaf extract were prepared and tested for their antifungal potential in a completely randomized design. All the applied concentrations of S. halepense leaf extract inhibited the growth of all t...

Muhammad Nadeem1, Jamshaid Iqbal2, Muneer Abbas1*, Niaz Hussain1, Muhammad Tariq Javeed1, Abdul Ghaffar1, Muhammad Irshad1, Muhammad Aslam1, Gul Rehman2 and Shahar Yar Ahsan1

...ernel extract, the entomopathogenic fungus Beauveria bassiana and synthetic insecticides (acephate and chlorfenapyr), were tested individually and in various combinations for managing thrips (Megalurothrips distalis). A mungbean genotype, 13TM-04, known for its comparative resistance, was chosen for these trials. The treatments, whether applied alone or in various combinations, showed significant differences in efficacy when compared with each other. A combina...

Endy Triyannanto1, Danung Nur Adli2, Diah Pratiwi3, Lukman Hakim3, Selma Noor Permadi3, Taufik Kurniawan3, Angga Maulana Firmansyah3, Lina Ivanti3, Dinar Suksmayu Saputri3, Mohammad Miftakhus Sholikin4, Hari Hariadi5, Tri Ujilestari3, Teguh Wahyono3* 

...ugh it can decontaminate pathogenic microbes, gamma irradiation can affect the texture, change color, increase oxidation parameters, and reduce the sensory parameters of pork products.  

...

Suhair Sh. Al-Siraj1, Jihan M. Badr2 and Dalia M.A. El-Masry3*

...nanoemulsion may prevent pathogenic microorganism-induced deterioration and provide antibacterial agents for gram-positive and gram-negative bacterial infections.
 
Keywords | Plant extract, Bay leaf, Nanoemulsion, Antibacterial, Pathogenic bacteria, Gene expression, Resistance
...

Desak Putu Mas Ari Candrawati*, I Gede Mahardika, I Gusti Nyoman Gde Bidura, Ni Wayan Siti

...lood lipid profiles, and pathogenic bacteria in intestines. Synbiotic comprised a combination of prebiotics Moringa oleifera leaves and probiotics yeast culture in a ratio of 1:1 (g/g). The results of in vitro analysis contained probiotics Saccharomyces spp. of 1.7 x109 cfu/g. Broilers used were 200-day-old chicks (DOC), divided randomly into 4 treatments with 5 replications, each consisting of 10 broilers. The control (treatment A) was given basic feed withou...

Ying Zhong1,3,4, Jingni Chen1, Chunping Huang1, Huaiyuan Jin1, Jinlu Huang1, Lining Zhao1, Yi Geng3, Guiping Wang1,4 and Xueqiao Qian1,2*

...ntified seven strains of pathogenic bacteria from ponds with outbreaks of acute hepatopancreatic necrosis at a L. vannamei farm in Zhuhai, China. Among the seven bacteria strains, one strain was isolated from aquaculture water, two strains were isolated from hepatopancreas, and the other four strains were isolated from juvenile shrimp. The results of 16S rRNA sequencing and biochemical identification showed that all seven pathogenic
Sohaila Fathi El-Hawary1, Nermeen M.L. Malak2, Reda A. Gomaa3, Hesham Z. Tawfeuk3, Suzan Ismail4, Nady Khairy Elbarbary5*
... species are significant pathogenic bacteria found in fish that induce gastroenteritis, a major public health issue. The present research investigated the occurrence, virulence gene detection, antibiotic resistance profile, and the antibacterial influence of lemon juice and pomegranate peel extract on V. cholerae and V. parahaemolyticus. Samples were 150 fish (30 of each Nile tilapia, Nile perch, sardine, Mugil cephalus, and Sea bass) from fish s...

Ibrahim Ali1,2, Hanan Mohamed Fathy Abdien1*, Wael Kamel Elfeil1, Mohsen Mohamed Zaky ElDemerdash1, Mohamed Ali Zain El-Abideen2,3, Walid Hamdy Kilany2,3

Bunga Rimta Barus1, Masfria Masfria2*, Aminah Dalimunthe3, Sovia Lenny4

...aphylococcus aureus is a pathogenic bacterium capable of causing wound infections. This study aimed to evaluate the effectiveness of gel formulations containing the ethyl acetate fraction obtained from red ginger leaves in facilitating the healing process of excision wounds. The study utilized 30 male Wistar rats, divided into six groups with five rats each, to ensure robust statistical analysis. The ethyl acetate fraction was extracted using a detailed macera...

Mohamed Ahmed Abaza1, Amany O. Selim2, Mona Abdallah3, Shimaa A.E. Atwa4, Hala El Daous5, Mona Abd-Allah Abd-Elrehim6, Mohamed M.S. Gaballa7, Reda R. Fathy1*

...he highest prevalent and pathogenic multi drug resistant bacterial strain.The assessment parameters were clinical signs, post-mortem lesions and histopathological picture which showed effective role of ZnO-NPs as bacterial inhibitor in the treated groups compared to control one. Quantitative analysis showed that ZnO-NPs significantly lowered gross lesion scores in the liver, cecum, colon, spleen, heart, and lungs compared to the E. coli-infected group. These f...

Ashraf Samir Hakim1*, Doaa Diab Khalaf1, Engy Farahat1, Mohammed Darwish Mohammed1, Wahid Hussein El-Dabae1, Khaled Abd El-Hamid Abd El‑Razik2, Amany Nabil Dapgh3, Ehab Ali Fouad4, Hussein Ahmed Abuelhag1

...f multidrug resistant uropathogenic E. coli (UPEC) which causes community-acquired UTI in pets and human community has been monitored. The current study aimed to investigate the prevalence of shared uropathogenic E. coli serotypes isolated from companion animals and human as well as assessed their virulence determinants which implemented in pathogenesis and severity of infection via phenotypic and molecular methods. Besides ...

Yawar Abbas1, Muhammad Sajid2*, Musharraf Hussain3, Shahida Batool1, Saeed Ur Rehman1 and Jamil Ahmad1

... which appear to be more pathogenic and transmissible. While similar to smallpox virus, mpox virus was first reported in human during 1970 and since then remained endemic in Africa. First time in 2022, numerous cases were reported in various parts of Africa, as well as in the Northern and Western Hemispheres. Given the wider spread, changing dynamics and host spectrum, we aim to provide critical view of zoonotic nature of mpox virus in human, taxonomical posit...
Sultan Çobanoğlu1, Waheed Anwar2*, Muhammad Asim Javed2 and Hafiz Azhar Ali Khan3
...te the efficacy of entomopathogenic fungi using two concentrations (4×104 and 4×108 conidia/ml): Beauveria bassiana, Metarhizium anisopliae, Trichoderma longibrachiatum and Verticillium lecanii, against the adult female of T. urticae strains (red and green) using leaf-disc bioassay method. Their corrected mortalities were also calculated using Abbot formula. Results indicated that the concentration 4×108 conidia/ml of Trichoderma longibrachia...

Nahed Yehia1*, Rania I. Mohamed2

...stify;">However, the low pathogenicity of avian influenza (H9N2), can have significant economic losses in poultry farms associated with other viral and bacterial infections. The purpose of this research is to study the genetic evolution and pathogenicity of the H9N2 virus during 2022. The forty tracheal samples were gathered from broiler chicken farms from 5 governorates (El-Dakahlia, El-Sharqia, Alexandria, Al-Qalyubia, and...

Naglaa A. El-Taib1*, Asmaa T. Talayea2, Hanan R. Ghanayem3

...isk control of recovered pathogenic bacteria Therefore, From the food safety point of view new formulation are highly required to control VBNC E. Coli. In addition, PAM-q PCR is considered a rapid method in detecting the VBNC organism. The potential influences of VBNC E. coli O157 on human health were discussed and the better ways to clean surfaces that human touch.
 
Keywords: Escherichia coli O157:H7, Chlorine, Hydrogen peroxide,...

Shaymaa Jabbar Hassoon1*, Hiba Ibrahim Ali2, Ayat Jasim Mohammed3, Oras Salman4

...obial properties against pathogenic isolated bacteria and offering a novel way in the combat alongside bacterial contagions.
 
Keywords | Silver nanoparticles, Cinnamon bark, Fresh sheep meat, Antimicrobial activity, Staphylococcus aureus, Escherichia coli
...

Yasser Asaad Hameed Al-Shareef, Firas Hussain Kadim Abawi*

... determinant of ND virus pathogenicity by the analysis of the fusion protein cleavage sites, phylogenetic analysis sand compared genomics of NDV isolates to publish sequences. Isolates characterized here showed 90.37% sequence similarity to the Iranian isolate Asil/IR/AAA158/2019 (MN370894.1) within velogenic clusters. Taken together, clinical, genetics and molecular biological approaches identified velogenic strains of NDV in poultry which breach the immunity...
Mat Zin Ain-Auzureen1, Maizan Mohamed1, Tan Li Peng1, Mohd Faizal Ghazali2, Choong Siew Shean1, Kamaruddin Mardhiah3, Najiah Musa4, Nora Faten Afifah Mohamad5, Chai Min Hian2 and Ruhil Hayati Hamdan1*
... V. alginolyticus pathogenicity and evaluating antibiotics misuse for the development of sustainable disease control methods.
...

Qasim H.A. Aljboori* and Saadoon Murad Saadoon

... more susceptible to the pathogenic fungus F. solani infection severity (32.08%). A study proved that sulphur was effective in reducing the Effect of F. solani to an acceptable level or at least to a level where further control with the fungicide Benomyl is more successful and less expensive.

...

Lubna M. Abdul Kareem*, Ali B. Al-Deewan

...ntamination of milk with pathogenic microorganisms. Serratia marcescens is a significant but less studied bacteria in public health. This pathogen causes milk contamination and infects humans and animals. However, studies are less common and therefore, this study aims to investigate Serratia marcescens in raw, pasteurized, and mastitis milk. Additionally, to identify how resistant Serratia is to antibiotics, whether the isolates contain beta-lactam resistance ...

Rico Anggriawan1,2*, Widya Paramita Lokapirnasari1, Sri Hidanah1, Muhammad Anam Al Arif1, Diyah Ayu Candra2  

...antibiotics destroy both pathogenic and non-pathogenic bacteria in the digestive tract and can leave residues in tissues, probiotics enhance digestive health. They adhere to and form colonies on the intestinal epithelium, thereby minimizing the attachment and replication of pathogenic bacteria. In conclusion, probiotic microorganisms produce enzymes such as lipase, amylase, and protease, w...

H.A. Abdul-Ratha1*, Sahar Mahdi Hayyawi2, Essam F. AL-Jumaily3

...lm is the most important pathogenic agent of different diseases and it is difficult to be treated due to the product of the biofilms that caused resistances against antibiotics. The biofilm acts as a barrier to create a stable internal environment for bacterial cell activity and protects bacterial cells from adverse conditions including extreme temperature and antibacterial drugs. The aim of the current study is to evaluate the effect of purified acidocin (alo...

Bashir Ahmed and Salma Javed* 

...ally neem oil, and entomopathogenic nematodes (EPNs) in urban agriculture within Karachi, Sindh, Pakistan. A survey conducted across twenty local markets revealed that neem oil was the only biopesticide available, highlighting a significant gap in the accessibility of eco-friendly pest management options amidst prevalent chemical pesticide use. Soil samples collected from various plant types on the University of Karachi campus successfully isolated Steinernema...

Widya Paramita Lokapirnasari1*, Nanik Hidayatik2, Eka Pramyrtha Hestianah3, Himatul Ilma Silfia4, Muhammad Aviv Firdaus4, A. Sherasiya5, Andreas Berny Yulianto6, Mirni Lamid1, M. Anam Al-Arif1, Ertika Fitri Lisnanti7, Zein Ahmad Baihaqi8, Tabita Dameria Marbun9

Shahbaz Ahmad1*, Mubashar Iqbal1, Arshad Javaid2, Muhammad Bilal Chattha3, Muhammad Ashfaq4, Tajamal Hussain5 and Sumra Ashraf1

...ensitivity of nine entomopathogenic fungal (EPF) strains to three plant-derived oils viz. coriander-oil (Coriandrum sativum), caster-oil (Ricinus communis) and taramira-oil (Eruca Sativa) and to assess the impact of these oils on the pathogenicity of EPF strains against melon fruit fly (Bactrocera cucurbitae Coquillett) maggots. Under the laboratory conditions, EPF strains namely Metarhizium anisopliae (F 52), Metarhizium pi...

R. Umamaheswari*, P. Prabu, M.S. Rao, B.M. Kavya and G. N. Grace

...inst a multitude of phytopathogenic microbes and nematodes. Bacillus amyloliquefaciens IIHR BA2 (Indian Institute of Horticultural Research, Bacillus amyloliquefaciens 2) is one such potential bacterial bioagent that demonstrated effective nematicidal activity against root knot nematode, Meloidogyne incognita, a major biotic constraint in successful crop production. This study aims to decipher the mechanism of action of B. amyloliquefaciens IIHR BA2 against M....

Muhammad Shahid1*, Aamir Ghafoor1*, Masood Rabbani1, Hassan Mushtaq1 and Mumtaz Ali Khan2

...e to emergence of nephro-pathogenic strains in field is a major problem. This study evaluated cross protection of commercial IBV vaccines against field isolates. A total of 160, day-old chicks were equally divided into four groups. Group A was vaccinated with a single dose of H120 strain IBV vaccine, group B with two doses (days 02 and 15) of H120 strain, group C with two doses of heterologous strains (H120 on day 02 and 4/91 on 15) while group D kept unvaccin...

Faturrahman1,3*, N.L. Nakadira1, N. Anjani1, B.N. Fajriah1, B.F. Suryadi1, A.A.M.N. Kasman2, T.W. Setyaningrum1

...to inhibit the growth of pathogenic bacteria using the paper disk method, as well as for their capacity to hydrolyze protein, amylum, lipids, and cellulose. Moreover, the degree of pathogen inhibition and macromolecule hydrolysis was determined by the size of the clear zone formed. The results showed that a total of 27 isolates were found, with a distribution of 5 (18.51%), 7 (25.93%), 5 (18.51%), 8 (29.63%) and 2 (7.41%) isolates in the proventriculus, duoden...
Hadda Kareche1*, Ola Elbohy2 and Janet M. Daly2
...atural reservoirs of low pathogenicity avian influenza (LPAI) viruses. This review focusses on the epidemiological situation and the spread of LPAI viruses of the H9N2 subtype in poultry in North African countries including Morocco, Egypt, Algeria, Tunisia, and Libya. Although H9N2 virus infections do not typically cause severe disease in poultry, they can result in significant economic losses to the poultry industry. Furthermore, the H9N2 subtype has zoonotic...

Dadile M. Abdulrahman 1 Abdullahi M. Daskum 1 Kura M. Abdulrahim 1 Abubakar M. Dadile 2 Hajja Amma 3

Volume 1, Issue 1, November and December 2017, Pages 3-13
...e and gram negative skin pathogenic bacteria including; Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus pyogenes, and Pseudomonas aeruginosa were studied using agar well diffusion and broth dilution assays. Agar well diffusion assay for aqueous garlic extract (AGE) was characterized with zones of inhibition ranging from 4.40 – 3.80cm, 4.13 - 3.57cm, 3.40 – 2.67cm for S. aureus, S. epidermidis and Strep. pyogenes, respectively, howe...

 Ning Jiang Chengming Tian Xinlei Fan

Volume 2, Issue 1, January and February 2018, Pages 14-16
...amily, with most members pathogenic to Myrtiflorae and Fagaceae plants. This family was established in 2006, basing on Endothia-Cryphonetria complex, Amphilogia, Chrysoporthe and Rostraureum (Gryzenhout et al., 2006). Further studies increased 17 genera in this family depended on DNA sequence data, supported by morphological evidence.

...

 Qin Yang Xinlei Fan

Volume 2, Issue 1 January and February 2018 Pages 17-18
...ogists, studying of phytopathogenic Diaporthe spp. is therefore particularly important to work on wide range of plant diseases (e.g. grapes, sunflowers, soybean, and various diseases associated with ornamentals and forest trees). The taxonomy of Diaporthe spp. has recently been reviewed in several impactful studies (Udayanga et al., 2011; Gomes et al., 2013).

...
Volume 2, Issue 2, March and April 2018, Pages 34-36
...ver, resistance of phytopathogenic fungi to synthetic fungicides must be considered. According to Bouwmeester et al., (2009), the use of new mechanisms for plant disease control is basically required, however, recent development of nanopesticides can help to control many plant diseases. Sekhon, (2014); Ahmed and Lee, (2015) later added that the use of nanoparticles (NP) is considered as a promising alternative way to control phyt...

 

Ahmed M.F.A

Volume 2, Issue 2 March and April 2018 Pages 37-47
...n: justify;">, and their pathogenicity were confirmed on date palm seedlings in the greenhouse. These fungi cause economic losses in date palm yield and a wide range of other cultivated plants. Many different antagonistic isolates (bioagents) i.e. 

Ayesha Bibi 1 Muhammad Junaid 2 Musharaf Ahmad 3

Volume 2, Issue 6 November and December 2018 Pages 167-174
Habtamu Tedila1*; Addisu Assefa1; Feto Haji
Novel Research in Microbiology Journal (2019), 3(1): 190-203
...epresent the most common pathogenic species especially for Aspergillus flavus and A. fumigatus. A. flavus produces aflatoxins which act both as toxins and carcinogens, and can potentially contaminate foods.

 

Ibtissem Ben Salem1; Yosra Abdelkhalek1; Houssem Nabli3; Neji Tarchoun2; Naima Boughalleb-M’Hamdi1*

Novel Research in Microbiology Journal (2019), 3(1): 232-242
....

...

 

Muhammad Junaid1*; Ayesha Bibi2; Musharaf Ahmad3; Muhammad Ali4; Yousaf Noor5

Novel Research in Microbiology Journal (2019), 3(2): 314-325
... on the agar plates; and pathogenicity assays, about 29 isolates were guessed to be R. solanacearum. To further confirm the identity of these isolates, a species-specific primers-mediated Polymerase chain reaction (PCR) was carried out. Two specific primers i.e. forward primer: 5'GTCGCCGTCAACTCACTTTCC3', and reverse primer: 5'GTCGCCGTAGCAATGCGGAATCG3', were used for amplification of the 281bp band. Twenty five isolates out of the 29 were genetically confirmed ...

 Waithaka, P.N.1*; Mwaura, F.B.1; Wagacha, J.M.1; Gathuru, E.M.2; Githaiga, B.M.2

Novel Research in Microbiology Journal (2019), 3(3): 351-365
...agonism against selected pathogenic microbes, and cytotoxicity assay using Brine shrimp lethality test. Totally, 138 actinomycetes isolates were obtained from all the soil samples. Four isolates showed the highest potent potential against selected bacterial and fungal pathogens. The selected actinomycetes were coded; PAN 30, PAN 37, PAN 41, and PAN 154, and preserved at 4°C for further analysis. The difference in yield of the antimicrobial metabolites betw...

 

Ahmed Ali1*; Ahmed I. Abd El-Mawgoud2; Al-Hussien M. Dahshan1; Azza A. EL-Sawah1; Soad A. Nasef3

Novel Research in Microbiology Journal (2019), 3(4): 415-427
...ultry.

...

 

Shaimaa A. Elbadri1*; Marwa S. Fathi1; Amira E. Abdel Hamid1; Hanaa A. ElGendy2

Novel Research in Microbiology Journal (2019), 3(4): 428-439
...y against many different pathogenic microorganisms. This study aimed to study the potential antibacterial and anti-biofilm effect of Lactobacillus acidophilus ATCC 4356, against the growth and biofilm formation of pathogenic P. aeruginosa. Cell free supernatant of L. acidophilus was tested to inhibit the growth; biofilm formation, and on preformed biofilms by 35 different clinical strains of P. aeruginosa, using agar well di...

 

Mahmoud H. Abd El-Aziz1*; S.I. Behiry2; H.A. Younes2; Karrar A. Hamza2

Novel Research in Microbiology Journal (2019), 3(4): 440-452
...irus Y (PVY) is a highly pathogenic virus, causing enormous economic losses in potato (S. tuberosum) crop. Three isolates of PVY were obtained from naturally infected potato plants showing mosaic; yellowing and vein necrosis symptoms, during 2017-2018 growing seasons at certain locations of El-Beheira and Alexandria governorates, Egypt. PVY could be easily transmitted mechanically by aphids. Detection of the PVY- 3 in different organs of infected Nicotiana glu...

Hafsa Zaib1; Rabia Kanwar1; Nishat Zafar1*; Sultan Ali1

Novel Research in Microbiology Journal (2019), 3(6): 526-534
... the prevalence of major pathogenic bacteria isolated from hospital inanimate surfaces. Random swab samples were taken from inanimate surfaces and apparatus used in daily treatment of patients from the major hospitals in district of Faisalabad, Pakistan. These swab samples were cultivated on suitable culture media including; nutrient agar, MacConkey’s agar and blood agar to isolate the bacterial pathogens. Identification of the bacterial cultures was car...

 

Bahauddeen Dandashire Salisu1*; Ibrahim Raubilu Almajir2

Novel Research in Microbiology Journal (2020), 4(1): 653-665
...ion to other potentially pathogenic fungi. Therefore, more stringent prevention and control methods are required to reduce the contamination levels, to avoid loss of poultry lives and possible transfer of carcinogenic mycotoxins to humans along the food chain.

...

Wafa H. Alamshani*; Faisal Al-Sarraj; Mashail A. Algamdi

...ed by the
uropathogenic Escherichia coli and Klebsiella pneumonia, making treatment more difficult.
Recurrent UTIs can be effectively treated with long-term antibiotics; however, they can have
several adverse side effects, and sometimes they may generate antibiotic-resistant strains. Due
to these downsides, alternative remedies based on plant extracts are increasingly being
considered for the preventi...

Souvik Roy1*; Dibyanshu Shaw1; Tiyas Sarkar1; Lopamudra Choudhury2

... of antibiotic-resistant pathogenic microbial strains is a
great matter of public health concern; however, mycotoxins are not to be forgotten as well.
According to the statistical analyses, mycotoxins contaminate up to 25 % of the world’s food
supply and contribute to a substantial amount of food spoilage. These toxins, which are
secondary metabolites of certain species of pathogeni...

Andrei V. Kozlov1,2; Artem V. Lyamin1; Aleksei A. Neilenko1; Anna V. Yanchenko1; Alena A. Ereshchenko1,2*

...Porphyromonas gingivalis pathogenicity factors into the brain tissue through the outer
membrane vesicles and/ or as part of the bacterial cell structures leads to neuro-inflammation
and accumulation of the amyloid plaques. It is concluded that focusing on this bacterium as a
risk factor for Alzheimer’s disease development will help to develop an effective therapy and/
or a set of preventive measures.
...

Dmitriy V. Alekseev; Artem V. Lyamin; Karim A. Kayumov

...ntraditional
pathogenic bacteria; as in the cases of cystic fibrosis; chronic obstructive
pulmonary disease (COPD), inflammatory bowel diseases, etc. Emergence of these
complications is caused by several disorders in the ecosystem; constituting the human body
and its microbiota. It is reasonable to extrapolate some ecological principles of the bacterial
community's assembly in the humans; as there is ...

Mahmoud Abou-Alhmd Soliman

...syringae pv. tomato. The pathogenicity of the
bacterial isolate was confirmed by molecular identification through detection of coronatine
production and 16S rDNA analysis. The obtained nucleotide sequence was deposited at
GenBank with accession no. OQ117369.1 and designed as P. syringae pv. tomato strain Pst1-
MAS. The tomato plants only produced the typical bacterial speck symptoms among the tested
s...

Salwa M. Masoud1; Hend A. Refat2; Nada S. Sayed2; Mohamed K. Abd-El Aal2; Ahmed A. Dosocky2; Zeinab S. Mohammed3; Mohamed A. H. Abdel Wahab3; Dina M. Mekawy3; Ali I. Ali4; Basma A. Atya4; Katren T. Welliam4; Rehab M. Abd El-Baky1, 5; Zeinab S. Hashem1*

Novel Research in Microbiology Journal (2020), 4(5): 1005-1014
...ug resistant clinical uropathogenic O157:H7 and non-O157 E. coli isolates, E. coli O157:H7 ATCC 43894, E. coli NRRL B-3008 and, Pseudomonas aeruginosa ATCC 27853 strain, but showed no activity against Klebsiella pneumoniae ATCC10031 and Staphylococcus aureus ATCC 6538. This study revealed that bacteriophages could act as effective alternatives of antibiotics especially against multidrug resistant bacteria; however, further in-vivo and shelf stability studies a...

Zeinab, S. Hashem1*; Rehab, M. Abd El-Baky1,2

Novel Research in Microbiology Journal (2021), 5(1): 1091-1105

 

Bala, N. Umar1*; Jibril, Adamu1; Muhammad, T. Ahmad2; Kabiru, H. Ahmad3; Ochuko, Orakpoghenor4; Bashir, S. Aliyu5; Nuhu, Mohammed6; Aliyu Sada1,7

Novel Research in Microbiology Journal (2021), 5(2): 1162-1175
...this, the protective and pathogenic aspects of the human immunity have not been fully elucidated. Recent attempts conducted by several published research works have focused on information derived from the immune responses to the severe acute respiratory syndrome-related coronavirus diseases (mainly; SARS and MERS). However, these works lack sufficiency due to variations in the transmissibility, virulence, host-virus interactions and the immune evasion mechanis...

Rutuja S. Patankar1; Vasudeo P. Zambare2,3*; Mohanadoss Ponraj4

Novel Research in Microbiology Journal (2021), 5(5): 1371-1391
...new multi-drug resistant pathogenic microbes.

...

Bijay Kumar Shrestha1*; Manita Tumbahangphe1; Jenish Shakya1; Sujata Chauhan1

Novel Research in Microbiology Journal (2022), 6(4): 1614-1634
...ings and communities. Uropathogenic Escherichia coli (UPEC) is the causative agent of most of the UTIs, such as pyelonephritis and cystitis. The infectious complications may cause acute renal failure affecting both the healthy and renal transplant patient's. The untreated patients with UTI may exhibit septicemia and bacteremia. Furthermore, the multidrug resistance patterns of UPEC may result in severe septic shock. Factors that contribute to the pathogenesis ...

 

Vinita C. Patole1*; Jayashri G. Mahore1; Tanaji D. Nandgude1; Anil Gutte1

Novel Research in Microbiology Journal (2022), 6(4): 1659-1669
...nd inhibit growth of the pathogenic bacteria such as E. coli in the vagina. In vitro evaluation of the anti-bacterial potential of ACV against E. coli showed a potent antibacterial activity, recording a zone of inhibition diameter of 32.9 ± 0.5 mm; however, no zone of inhibition was observed against Lactobacillus acidophilus. Turbidimetric analysis was used to ensure growth of the bacteria in a simulated vaginal fluid (SVF) by using a nephelometer as a ...

 

Fatma Ahmed Abdel Aziz1; Gamal Fadl Mahmoud Gad1; Ahmed Mohamed Kamal El Shafei2; Reham Ali Ibrahem1*

Novel Research in Microbiology Journal (2022), 6(5): 1725-1741
...ssed growth of about 147 pathogenic bacterial spp. The predominant isolated bacteria were Staphylococcus aureus (44.89 %), followed by Coagulase negative Staphylococci (29.9 %). On the contrary, Esherichia coli, Pseudomonas aeruginosa, Proteus sp., Streptococcus pneumonia, Klebsiella sp., and Haemophilus influenzae, were the least detected bacterial spp. Most of the bacterial isolates tested in this study exhibited high resistance to Amoxacillin-Clavulanic, Su...

 

Sara A. Alshaikh*; Tarek El-Banna; Fatma Sonbol; Mahmoud H. Farghali

Novel Research in Microbiology Journal (2024), 8(1): 2285-2302
...

...

 

Sharma S.; Gupta V.; Yadav M.; Sain D.; Rahi R.K.; Neelam D.K.*

Novel Research in Microbiology Journal (2024), 8(2): 2354-2369
...epts of epidemiology, uropathogenic, diagnosis, prevention, and treatment of urinary tract infections (UTI) in humans. One of the most frequent infections that affect people is UTIs. During childhood they are equally common in boys and girls, and after that, they are more common in girls. In both of the general population and hospital environment, women frequently experienced at least one UTI in their lifetime. The existence of bacteriuria and pyuria are the 2...

 

Simiat O. Jimoh1*; Faizah R. Adebowale2; Kifayat O. Asafa-Adedimeji2, Ramat B. Badmos-Oladapo2; Taiwo A. Sorunke1

Novel Research in Microbiology Journal (2024), 8(3): 2452-2468
...idues, and eradicate the pathogenicity and risk associated with Pseudomonas aeruginosa alginate. Preliminary screening for alginate production revealed the presence of different alginate products. High-performance liquid chromatography (HPLC) confirmed the existence of varying alginate concentrations, such as sodium alginate (2.42754×10-1g/ 100 ml), calcium alginate (1.09597×10-1g/ 100 ml), acid alginate (1.39420×10-2g/ 100 ml), alginate olig...
Frank G. Cedeño-Lozano1, Freddy Zambrano-Gavilanes2 and Felipe R. Garcés-Fiallos3*
 
...icrosclerotia (n=20) and pathogenicity of two Macrophomina isolates on COCKER seedlings were determined. After the data were subjected to a two-way ANOVA, the Tukey test separated the means (P ≤ 0.05). All the plants analyzed presented charcoal rot and presence of microsclerotia, mainly in hypocotyls. Only vascular damage in hypocotyls was higher in COCKER 310 plants compared to those of the other genotype. A significant interaction between va...

I Wayan Wisaksana Yasa1, I Wayan Teguh Wibawan2, Okti Nadia Poetri2*

...udy aims to evaluate the pathogenicity and immunogenicity of the IBD virus 098 Bogor ‘19 as a candidate for IBD live vaccine master seed through the bursal-body-weight ratio (BBWR), index of bursal-body-weight ratio (IBBWR), bursal lesion scoring (BLS), and IBD antibody titre evaluation. The IBD master seed candidate should be safe and have good immunogenicity responses. Thirty Specific Pathogen Free (SPF) chickens were divided into three groups of 10 ch...

Mahfouz M.M. Abd-Elgawad

...ign: justify;">The entomopathogenic nematode (EPN) products are developing to control crop pests. Yet, their commercialization is limited to few niche markets. Meanwhile, mounting concern over chemical acaricides - because of environmental pollution, human safety, and developing tick resistance to acaricides has promoted EPNs as their replacements. Such replacements will widen EPN uptake and further stimulate the organic product market. Safe/effective manageme...

Salwan A.Z.J. Allobawi1*, Ali Ajil Al-Haidery2, Malik H. Karem2 and Adeeb Kitab Abdul Zaid Al-Shafiee3

..., and Bestor 10EC on the pathogenic interactions of soil-Borne non-target organisms. The results showed these pesticides stimulated the growth of certain fungi, including Aspergillus terreus and Aspergillus clavatus. Specifically, the application of Spartan and Appland increased the prevalence of A. terreus and Botrytis cinerea, while Bestor enhanced fungal growth to percentages of 53.78%, 74.15%, 30.92%, 45.31%, 8.95%, and 51.94% on solid culture media (PDA)....
Intan Noor Aina Kamaruzaman1*, Siew Zee Ong2, Iman Natasha Sofea Jafri2, Dayangku Umi Aqilah Pengiran-Isa2, Mohamad Sabri Abdul-Rahman3, Mohd Farhan Hanif Reduan2, Thilini Nisansala1, Soon Heng Goh1, Siti Nur Haslina Mamat2, C.W. Salma C.W. Zalati3, Sazaly AbuBakar4 and Shih Keng Loong4*
...), which are known to be pathogenic Leptospira species in cattle and humans. One sample cannot be sequenced due to poor yield and quality. Furthermore, the kidneys that were PCR-positive showed significant histopathological lesions of bovine leptospirosis, consisting of interstitial nephritis, glomerular atrophy and tubular necrosis. In conclusion, the present study demonstrated the presence of L. borgpetersenii and L. interrogans in local cattle and this is a...

Xiao Li, Wen Liu, CaiYi Chen and Shaoming Lu*

...lysis also confirmed the pathogenicity of the variant.The similarity index of superimpose 3D structure of wild-type and mutant DNAAF2 protein was just 14.81%. A current genetic study identified a homozygous variant of DNAAF2, which results in infertility in a Chinese male patient. This study will also assist in genetic counseling of Chinese families at risk of PCD.

...

Onifade Sururoh Joy1,2, E.F. Aluko2,4, Olowe Rita Ayanbolade1,3 and Olugbenga Adekunle Olowe1,2*

...y a critical role in the pathogenicity of H. pylori, promoting cellular damage and immune evasion. Transmission occurs predominantly through fecal-oral and oral-oral routes, but growing evidence suggests a potential animal source of transmission, complicating the epidemiology of the infection and its control. Clinically, H. pylori infection presents with a range of symptoms, from asymptomatic colonization to severe conditions like peptic ulcers and gastric can...
Fayaz Khan1, Aziz Uddin1, Hisham N. Altayb2, Bibi Nazia Murtaza3
Sajid Ul Ghafoor1, Faisal Imam4, Saima Iftikhar5, Sadia Tabassum1
Khushi Muhammad1* and Muhammad Shahid Nadeem2
...ovel to CAD. Score based pathogenicity analysis of tRNA variants with MSeqDR, MitoTIP, HMTVar and PON-mt-tRNA have suggested that the variants were either likely or possibly polymorphic. Molecular docking studies of variants have shown significant difference in their structure, binding position and binding affinities with corresponding amino acyl tRNA synthetase. In silico results with structural abnormalities and molecular docking studies reflecting a failure...

Jia-lue Hua1,*, Peng-fei Wang2,*, Ye-ping Song3, Meng-lei Ding4, Li-ling Wang3 

...ted this mutation may be pathogenic. The expression and distribution of GLRB were not significant between the mutant and wild types. Our results suggest that the novel GLRB mutation may cause hyperekplexia. In addition, we also tried to explore the possible pathogenic mechanism of this mutation. It is essential to conduct more genetic and functional research to improve the understanding of this disease.

...

Miao Yin1,2,3,4, Xi-Wen Chen1,2,3,4, Zuo-Jie Xie1,2, Cong Wang1,2, Zhi-Chao Song1,2 and Jun-Qiao Chen1,2

... miRNA regulation of the pathogenic mechanism of PEDV porcine epidemic diarrhoea virus.

...

Yahya Sabah Abdulameer1*, Dhurgham A. A. Al-Sultany2, Ali Kumait Alawadi2

... reducing the numbers of pathogenic bacteria in the ileum and preserved the beneficial bacteria. Pathological bacteria in ileum were increased in T3, T4 (p<0.05). We conclude that transportation periods of 1.5 to 3 hours post-hatch do not adversely affect production, immune response, or intestinal microbiota in broiler chicks. However, if the period is increased from 6 to 12, it may affect production, immune response, and intestinal microbiota. The findings...

Temitope A. Olanipekun1, Fiyinfoluwa Demilade Ojeniyi2,3, Oyelayo Itunuoluwa Celestina3, Adeola Deborah Ayanyinka1, Abiona Olaide Habeeb1, Olowe Rita Ayanbolade1, Olusola Ojurongbe1,3, Oluyinka Oladele Opaleye1,3 and Olugbenga Adekunle Olowe1,3*

Wahyu Widodo1*, Adi Sutanto1, Imbang Dwi Rahayu1, Ivar Zekker2, Bayu Agung Prahardika3,
 Apriliana Devi Anggraini1, Trisakti Handayani1 and Yuanara Augusta Rahmat Adikara4 
 
...min can inhibit and kill pathogenic bacteria in the digestive tract of Super Kampong chickens. The purpose of this study was to evaluate aromatic galangal (Kaempferia galanga) extract. Aromatic galangals from Lumajang Regency, East Java Indonesia – a high curcumin content of 39.5 µg g–1 used in this study. The concentrations of 0.78 %, 1.56 %, 3.12 %, 6.25 %, 12.50 %, 25.00 %...

Shakir Ullah1*, Lubna Shakir2, Mohammad Sohail3, Azmat Noreen3 and Laila Aziz3

..., offering both targeted pathogenic effects on insect pests and safety for non-target organisms.

...

Pakistan Journal of Weed Science Research

December

Vol.30, Iss. 4, Pages 162-215

Featuring

Click here for more

Subscribe Today

Receive free updates on new articles, opportunities and benefits


Subscribe Unsubscribe