Submit or Track your Manuscript LOG-IN

Sandeep Satapathy and Rupam Ghosh

...en identified as crucial mediators for clearance of influenza by up regulating several intracellular defense mechanisms. Associated with IL-6 signalling is the expression acceleration of sequestrome 1(SQSTM1) / aggrosome and colocalization of HDAC6 to the cytoplasm. The key player HDAC6 is investigated for modelling several intracellular processes that come into action to bring out the viral clearance. The shuttling of HDAC6 takes place from nucleus to cytopla...

Ye Liu2, Yulong Cong2, Yiming Shao1*

...imizing immune responses mediated by vaccines. These examples of selected studies will provide researchers some implications and inspirations for using HIV Tat to optimize immune responses of vaccines.

...

Derk Pereboom

...pulation is direct and immediate, the agent is not morally responsible. Fischer’s thought is that Plum’s non-responsibility in Case 1 can be accounted for by the conditions on mechanism-ownership, a feature of the compatibilist account of moral responsibility he and Ravizza (1998) developed, which, he correctly points out, I neglect in favor of the reasons-responsiveness component.

...

Muhammad Irshad1, Abdur Rab1, Javed Rahman2, Muhammad Sajid1, Ilyas Khan2, Sajad Ali1, Muhammad Razaq1, Sallahuddin1

...erent planting dates and media on the growth of kiwi (cv. Hayward) cuttings at Agriculture Research Institute (ARI) Mingora Swat, during 2011. The experiment was laid out in Randomized Complete Block Design (RCBD) with split plot arrangement in three replications. Planting Dates (20th Jan, 30th Jan, 10th Feb, 20th Feb and 2nd March) were allocated to main plots, whereas soil media (Silt+ Garden soil+ FYM) at the rate of 1:1:...

Dallin D. Oaks

 

...reporting a sudden and immediate confusion of languages, or even a sequence in which a confusion of languages led to a scattering of the people. Indeed, a close examination of the account seems to allow an interpretation of events that is compatible with what linguists have observed about how languages can diversify, though some challenges may still remain in reconciling assumptions about the available post-Babel time frame versus the lengthy time frame that l...

Muhammad Shah Zaman1, Ghulam Muhammad Ali2, Aish Muhammad1, Khalid Farooq2, Iqbal Hussain1*

...be used in Agrobacterium-mediated gene transformation of AtNHX1 to improve their tolerance against salinity stress.

...

Muhammad Abubakar1*, Shumaila Manzoor2, Jonas Johansson Wensman3, Emeli Torsson3, Qurban Ali1 and Muhammad Munir4

...ns which are essentially mediating protective immunity, may explain the extreme infectious nature of the virus and its host-specific pathogenesis. Moreover, understanding the nature of such circulating field viruses is essential to underpin the endemic potential of PPRV and its possible spread to the susceptible wild or domestic small ruminants.

...

Manzoor Hussain*, Miloslav Zouhar and Pavel Rysanek

...c, were cultured on agar media and tested against Meloidogyne hapla both in-vitro and in-vivo. All fungi proved to be efficient in reducing final population of northern root knot nematode M. hapla and giving vigour to the plants. In laboratory experiment, L. muscarium was the most effective against nematode eggs (95.6%) and second stage juveniles (J2) (95.8%) infection. In greenhouse experiment, similar trend was found. L....

Sana Irshad Khan1*, Zafar Iqbal2, Hamid Ullah Shah2 and Shaukat Hussain3

...s grown on two different media, i.e. Potato Dextrose Broth (PDB) and Glucose Nutrient Broth (GNB) media for active secondary metabolites. Ethyl acetate (EtOAc) extract of PDB medium gave significant results against selected phytopathogens compared to GNB medium and selected for further study. Crude (1 µg.mL-1 ) obtained from PDB medium showed 2.50 ± 0.64 mm and 1.97 ± 0.21 mm inhibition zone against X. ca...
Hafiz Aftab Ahmed1, Asif Ali2, Akbar Ali2, Salman Ahmed Abid3 and Sajid Umar4*
...lpation of the ligament, medial patellar desmotomy was performed in lateral recumbence, under local anesthesia achieved by 2% lignocaine hydrochloride. The skin was apposed with simple interrupted sutures using silk. Post-operative care was continued for five days. Clinical signs abated in all operated animals, proving that the technique employed was effective and of simple execution for the treatment of dorsal patellar fixation in bovine.
...
Sadaf Ijaz Malik1, Kiran Afshan2* and Mazhar Qayyum1
...me were sectioned in the median sagittal plane and histological slides of the worms were prepared for detailed morphological studies. Bile tissues, aspirates and blood samples of the same animals were analysed. The infection was found prevalent throughout the year but during post monsoon season it was relatively high. Morphological identification of G. expalanatum was carried out on the basis of size and shape of worm. The hematological and bile biochem...
Waqar Islam*1, 2, Madiha Zaynab3, Muhammad Qasim2 and Zujian Wu1,2
...al RNA silencing, R-gene mediated resistance and host factor related recessive resistance are categorized as most beneficial plant defense approaches used by plants. The review also briefly explains about introgression of durable resistance to generate virus resistant cultivars for economically important crops through molecular breeding techniques via utilizing advanced molecular markers involving cis and trans genetics. The review adhere recent research findi...
Mirza Imran Shahzad1,*, Anna Iqbal2, Farrah Ali1, Nuzhat Sial3, Muhammad Ashfaq4, Abul Hasanat5 and Azra Khanum6
...eria were cultured in LB media and further the culture of each bacterium was divided into three parts, the first part was centrifuged in order to collect supernatant. While the second and third parts were also centrifuged but however supernatants were discarded to get their pellets, which were dissolved in normal saline. Of this one part was taken for thaw and freeze treatment, while the second for ultrasonication treatment, before conducting antimicrobial act...

Nirbhay Kushwaha, Achuit K Singh, Brotati Chattopadhyay and Supriya Chakraborty

Recent advances in geminivirus detection and future perspectives
...and other DNA polymerase-mediated assays, and microarray detection. Of these, microarray detection provides the greatest capability for parallel yet specific testing and can be used to detect individual or combinations of viruses with sensitivity comparable to ELISA. Methods based on PCR provide the greatest sensitivity among the listed techniques but are limited in parallel detection capability even in “multiplexed” applications. Better, easier an...

 Sitansu Pan and Amrita Das

Evaluation of shelf life of some value added organic formulations of Trichoderma harzianum
.... Among the four organic media, vermicompost retained 21.3 x 10 c.f.u./g at 120 days where as leaf mold,FYMand rice bran retained 20.1 x 10 c.f.u./g, 17.3 x 10 c.f.u./g and 15.1 x 10 c.f.u. /g of substrate respectively at 120 days of incubation. When oilcake was amended with organic material, vermicompost + mustard cake produced high population of the antagonist upto 60 days.

...

B. Ramanujam, R. D. Prasad, S. Sriram and R. Rangeswaran

Mass production, formulation, quality control and delivery of Trichoderma for plant disease management
... is grown in inexpensive media like molasses and yeast medium in deep tanks on a commercial scale. Biomass from the liquid fermentation can be made into different formulations like, dusts, granules, pellets, wettable powders. Trichoderma formulations can be applied to the seed either by dry seed treatment or by seed biopriming for control of several soil-borne diseases of some field crops. Similarly, seedlings of horticultural crops and rice are treated by dip...

A. K. Chaubey and Satyandra Kumar

Bio-management of root knot nematode and root rot disease by antagonistic fungi and rhizobacteria
...bacteria isolates in PDA media plates. In in-vivo test soil was amended with antagonist and wilt fungal and bacterial isolates 2 x 106 CFU/ml and 2 x 108 CFU/ml respectively as talc formulation @ 0.2% (w/w). Twenty one days old tomato seedlings were transplanted after dip treatment in antagonist fungal and bacterial CF in earthen pots filled with amended soil. Seven days after transplanting, the seedlings were inoculated with second stage juveniles of M. incog...

M. S. A. Mamun and M. Ahmed

Integrated pest management in tea: prospects and future strategies in Bangladesh
...es ago with tremendous immediate economic gains but its abuses were not foreseen or ignored. As a consequence there arose the development of resistance to pesticides, pest resurgence and undesirable pesticide residue in the made tea as the major problems. Current trends in eco-friendly insect pest management practices emphasize the host plant resistance, preparation and application methods of new botanicals and microbial pesticide formulations, evaluation of f...

Gadeeyya G and Ratna Kumar P.K.

... different fungal growth media. The diagnostic characteristic features of each isolate were critically studied using relevant literature. The pathogenicity of the isolates was examined to select biocontrol agent against host weed. 
...

Muhammad Abid1*, Tahir Yaqub2, Arslan Mehboob3 and Muhammad Zubair Shabbir4

...in virus pathobiology by mediating virus entry and release, the present study was conducted to determine the phylogenetic relationship of currently prevailing H9N2 isolates in Pakistan. A sum of ten H9N2 AIVs were isolated from 400 suspected samples and were confirmed through serological and molecular assays. The sequence analysis of NA genes shown 99% homology with the H9N2 AIV recently isolated from Pakistan and their phylogenetic analysis revealed that all ...

Attaullah Khan1, Muhammad Shafi1*, Jehan Bakht2 and Shazma Anwar1

...tudied in sand as growth media. The results revealed that incremental increase of salinity stresses had decreasing effect on growth parameters compared with control. Highest germination (85.42% and 84.31%) was recorded from wheat varieties (Lalma-2013 and Pirsabak-2005). Minimum germination (64.40% and 73.89%), tillers plant-1(2.83 and 3.49), leaves plant-1(11.44 and 12.79), leaf area (21.47cm2 and 25.20cm2) and more days to emergence (9.92 and 8.98), was reco...

Raza Ullah1*, Qaisar Shah Safi2, Ghaffar Ali3 and Irfan Ullah

...s middlemen (market intermediaries) involved at different stages in the marketing of citrus. This study is an attempt to examine the marketing margins of the intermediaries involve in the value chain of sweet oranges of citrus group. Three villages in Bunir district are randomly selected and a total of 120 sampled respondents are selected using proportional allocation method. The findings revealed that majority of the farmer...

Jawad Anwar* and Zafar Iqbal 

...ompared to other culture media (Potato dextrose broth and yeast extract broth). Similarly maximum zone of inhibition was observed in optimized parameters like shaking flask culture, 25 °C temperature, media of pH 5 and light fermentation.The EtOAc extract exhibited the minimal value of MIC (10.41±4.50 µg/mL) against gram negative E. coli, while its acetonitrile fraction yielded (6.50±2.25 µg/mL)...
Ambreen Butt1, Uzma Malik2, Khadija Waheed3, Amna Khanum3, Samar Firdous4, Sara Ejaz5 and Fawad Randhawa2, Tania Shakoori6*

Zaheer Abbas*, Shaukat Ali, Jalal-Ud-Din and Ghulam M. Ali* 

...in MS and Chu’s N6 media produced 53.33 and 35.56% embryogenic calli, respectively. Inclusion of 5 mgL-1 silver nitrate in embryogenic medium enhanced the production of type II embryogenic calli by 54.90% compared to control treatment. Maximum regeneration (58.33%) was observed when embryogenic calli were placed on N6 medium supplemented with 60 gL-1 sucrose and 1 mgL-1 NAA for one week initially in dark and then three weeks on MS medium augmented with 2...

Sanjukta Chakrabarti1, Colin J. Barrow2, Rupinder K. Kanwar3, Venkata Ramana1*, Rakesh N. Veedu4,5 and Jagat R. Kanwar3* 

...the vascular network, is mediated through VEGF/VEGFR activation of the signal transduction pathways. Thus blocking VEGF is an efficient strategy for blocking tumor angiogenesis. Several anti-VEGF drugs have been developed over the last two decades and some are still at different development stages of pre-clinical and clinical trials. In this study, we explored the anti-angiogenic properties of three anti-VEGF molecules such as two fusion proteins, VEGF TrapR1R...
Ajmal Khan Kassi1,*, Humayun Javed1 and Tariq Mukhtar2
...ady Finger-2 showed intermediate resistant reaction while KT-458, Bhindi Punjab Selection, Arka Anamika and Bhindi Sabazpari proved to be comparatively resistant. Maximum fruit and shoot infestations were recorded on comparatively susceptible cultivars while the infestations were the minimum on comparatively resistant cultivars. As comparatively resistant cultivars viz. KT-458, Bhindi Punjab Selection, Arka Anamika and Bhindi Sabazpari suffered less damage and...
Ümit Kumbıçak, Zübeyde Kumbıçak* and Gülnare Huseynli
... X2 were intermediate in the karyotype.
...
Muhammad Siraj-ud-Din1,2, Riaz Aziz Minhas1, Usman Ali3,*, Mayoor Khan2, Muhammad Siddique Awan1, Nuzhat Shafi1 and Basharat Ahmad1
... 9.69%), Ephedra intermedia (n=25, 8.65%), Pistacia khinjuk and Ephedra gerardiana (n=23, 7.69%). Out of 36 plant species, 15 were consumed during summer (June to August), 10 in spring (April-May), six (6) in autumn (September-October) and five (5) in winter (February-March). Conservation of threatened Ladakh urial could be achieved by protecting its potential habitat and preferred food plant species.
...

Naeem Iftikhar1, Qamar Zaman Qamar2, Usman Ali3, Muhammad Siddique Awan4, Syeda Shaista Bibi4, Riaz Aziz Minhas4*

... study recommended the immediate formulation and implementation of Cheer pheasant conservation action plan along with declaration of its potential habitats as protected area to ensure the further survival of this important species.

...

 Bushra Mazhar1, Nusrat Jahan1, Nazish Mazhar Ali1, Saiqa andleeb2, Shaukat Ali2*

...idues of rice bran based media. E. hormaechei produced 5.2 g/l of vanillin in culture media containing ferulic acid as a substrate. Optimum pH for E. hormaechei was 7 and the temperature was 30°C. Using optimum growth conditions and suitable fermentation medium, E. hormaechei can be used at an industrial level as producer of vanillin. Bioconversion of waste residues of rice bran oil to vanillin by bacterial strains is of...
Tahira Kamal1*, Saeed-Ul-Hassan Khan2, Amir Bin Zahoor3, Khalid Naeem3, Muhammad Naeem Riaz1, Siddra Tayyab Akhtar4, Ghulam Muhammad Ali1*

Aneeza Jamshed1* and Syed Amir Gillani2 

...less penetration of mass media. To develop the awareness of hepatitis C among primary grade students. A total of 150 students of primary grade among 300, of Government sector Middle School Lahore were selected through multistage cluster sampling. A quasi-experimental study was conducted in the time period of 6 months from April 2014 to Sep 2014. Data analysis was done with SPSS 20. After describing the important variables, average percentages were used to find...

 Ahmed Aziz Kurd, Amanullah, Saifullah Khan, Basharat Hussain Shah and Munir Ahmed Khetran*

... treated cuttings were immediately planted in polyethylene tubes (10 cm x 20 cm) filled with a sandy loam soil. In the control, the cuttings were planted directly in polyethylene bags without IBA application. Plants were kept in a shade house and humidity was increased manually by hand sprinkling (four times in a day). Highest rooting percentage (60%) was obtained in the cuttings treated with 3000 ppm. The maximum average number of roots per cutting (4.443) an...

Sana Qanber Abbasi1*, Ejaz Ahmed2 and Rabia Sattar1 

... 3 cc was drawn from the median cubital vein after securing aseptic measures. The blood sample was allowed to clot for 30 minutes and serum was separated. The serum was then centrifuged andpro BNP levels were estimated by ELISA using Human pro BNP kit. Patients’ history and recorded blood pressure was documented on a questionnaire. The results were analyzed using SPSS 21. One way ANOVA and Independent sample T test were applied to compare the proBNP leve...
Maryyum Khalil1, Hamda Azmat1,*, Noor Khan1, Arshad Javid2, Ali Hussain1, Syed Makhdoom Hussain3, Asim Ullah1 and Sumaira Abbas1
...ntrol group fish on both media nutrient agar (NA) and eosin methylene blue (EMB) viz. 1.8×103 and 1.56×103 (cfu ml-1) in gut contents whereas on skin only total bacterial count (0.36×103)was observed and no coliform bacteria were present while least CFU’s were counted in group 2 among skin 0.14×103 cfu ml-1 and gut 0.10×103 cfu ml-1
Nazish Shaukat1, Muhammad Javed1,Faiza Ambreen2* and Fariha Latif1
...l parameters of the test media viz. pH, dissolved oxygen, carbon dioxide, total hardness, calcium, magnesium and total ammonia were monitored on daily basis. Significantly increased peroxidase activity was observed in gills and liver of Labeo rohita after exposure to PbCl2 due to all doses as compared to the control. All results were statistically significant at p<0.05. Fish liver exhibited significantly (p<0.05) higher activity ...

  Farhat Ullah Khan, Nowshad Khan and Zaibunnisa Abdullah*

Corresponding author: farhatkhan7@gmail.com (This is part of Ph.D. work of senior author)

IMPACT OFKINNOW (MANDARIN) YIELD LOSSES ON SOCIOECONOMIC CONDITIONS OF THE FARMING COMMUNITY IN PUNJAB, PAKISTAN
...ies of study area. The immediate benefit of this study will go to kinnow growers of Tehsil Sargodha and ultimately the economic growth of the country will be increased in future by improving the cultural practices and adopting modern post harvest technologies of kinnow throughout Pakistan.

...

 Khalid Mahmood Qureshi, Fakhar ul Hassan, Qamar ul Hassan, Usman Shaukat Qureshi, Saman Chughtai and Adnan Saleem*

IMPACT OF CULTIVATION SYSTEMS ON GROWTH AND YIELD OF STRAWBERRY (FRAGARIA ANANASSA) CV. �CHANDLER�
...d i.e., standard growing media in polyethylene bags (T ), soil less media (T ), high tunnel (T ), green house (T ), 1 2 3 4 including open field condition on ridges (T ) by keeping plant to plant 5 distance of 30 cm and row to row distance of 60 cm. The study was conducted to evaluate the effects and suitability of different cultivation systems for better vegetative growth, production and fruit quality of strawberry. The res...

 Sonila Hassan, Abid Hussain*, Muhammad Azeem Khan** and Irfan Mahmood*

RURAL-URBAN RETAIL PRICES AND MARKETING MARGINS OF FRESH FRUITS AND VEGETABLES IN PAKISTAN
.... The net margin to intermediaries for potatoes, onion, persimmon, pear, banana, sweet lemon, and guava was accounted at 43%, 111.4%, 316.5%, 104.5%, 353.9%, 370.8% and 152.4%, respectively.

...

 Sajida Taj*, Muhammad Tariq Iqbal Khan**, Mazher Abbas and Arshed Bashir***

PRICE SPREAD AND MARKETING MARGINS OF CUT ROSE IN PUNJAB, PAKISTAN
...and other marketing intermediaries are quantified along the existing two marketing channels for cut flowers. In the first channel the main players were producers, wholesalers-cum-commission agents, retailers and consumers. In the second channel producers were directly linked with retailers. In Channel-I the highest consumer's price of Rs. 444.78 per 100 pieces of cut roses indicated that consumers have to pay more there. The price spread was greater in Channel...

 Sara Khalid*, Khalid Mahmood Qureshi*, Ishfaq Ahmad Hafiz*, Khalid Saifullah Khan* and Usman Shaukat Qureshi*

EFFECT OF ORGANIC AMENDMENTS ON VEGETATIVE GROWTH, FRUIT AND YIELD QUALITY OF STRAWBERRY
... included T = planting 1 media -1 (soil + silt + farm yard manure); T = planting media + 400 mgl humic 2 -1 acid; T = planting media + 200 g kg leaf manure; T = planting media + 200 3 4 -1 -1 g kg vermicompost; T = planting media + 200 g kg plant fertilizer and T = 5 6 -1 planting media<...

 Rabeea Tariq*, Khalid Mahmood Qureshi*, Imran Hassan*, Muhammad Rasheed* and Usman Shaukat Qureshi*

EFFECT OF PLANTING DENSITY AND GROWING MEDIA ON GROWTH AND YIELD OF STRAWBERRY
...e requirement of special media is very important step because plant growth is largely depended on the physiochemical properties of the growing media used. Winter strawberry production in a greenhouse using high plant densities and various media may be a viable alternative to openfield production system. Planting density can be increased thrice by using different production systems. Studies...

 Abid Hussain*, Khalid Mahmood Aujla* and Sonila Hassan**

PRODUCTION AND MARKETING OF CAMEL PRODUCTS IN SEMIDESERT AND DESERT AREAS OF PAKISTAN
...rmers and 17 market intermediaries. It is found that both camel farmers and market intermediaries were less educated. It is observed that markets for camel milk, meat, hides and hair are less established in semi desert and desert areas of the country. Mean production of milk per farm household was 5.4 and 6.5 liters per day in summer and winter seasons, respectively; however, none of the surveyed farmers reported milk sale. ...

 Sadia Tehrim*, M. Yasin Mirza** and G. Mustafa Sajid*

COMPARATIVE STUDY OF DIFFERENT GROWTH REGULATORS FOR EFFICIENT PLANT REGENERATION IN GRAPES
...inations in regeneration media were studied to determine the best combination for in vitro morphogenesis of grapevine accessions viz., 4494(1) Kowar Sufaid, 4472(12) Harker Agoon and 4492(1) Kowar Naray. When levels of benzylaminopurine (BAP) were increased in the basal MS media for culturing the grape plantlets, there was a corresponding increase in the number of shoots and root mass. Additionally, the shoot proliferation r...

 Muhammad Ali*, Ghulam Mustafa Sajid**, M. Faisal Anwar Malik*** and Kalimullah****

ESTABLISHMENT OF IN VITRO CULTURE OF GRAPES
...zed and tested on 75% MS media for germination and initial growth parameters. Accession No. 020017 (Dakh-1) exhibited highest viability (100%), shoot length (4.12 cm) -1 and nodes plant (3.8). Moreover, it was found that response of cultures to different treatments was dependent both on accession and treatment duration. In conclusion, this protocol proved to be useful in optimizing the dose and duration of the treatment of grape explants with the surface disin...

 Khalid Mahmood Aujla* and Abid Hussain*

MARKETING SYSTEM OF LIVE CAMELS IN THE DESERT ECOLOGIES OF PAKISTAN
...lage dealers/market intermediaries. The regulatory laws of livestock markets applied in Pakistan are not comprehensive and do not cover all the aspects necessary for the markets to function efficiently. It is, therefore, recommended that the proper marketing system and physical infrastructure for live camels should be developed to benefit the poor camel farmers.

...

 Tasawar Sultana*, Farah Deeba* and S.M. Saqlan Naqvi*

HIGH-THROUGHPUT AGROBACTERIUM-MEDIATED TRANSFORMATION OF MEDICAGO TRUNCATULA IN COMPARISON TO TWO EXPRESSION VECTORS
...o efficient Agrobacteriummediated transformation for a long time. The selection of Medicago truncatula as a model legume plant for molecular analysis resulted in the development of efficient Agrobacterium-mediated transformation protocols. In current study, M. truncatula transformed plants expressing OsRGLP1 were obtained through GATEWAY technology using pGOsRGLP1 (pH7WG2.0::OsRGLP1). The transformation efficiency of this ve...

 Abdul Rehman Khan*, Muhammad Mahmood–Ul-Hassan**, Rizwan Ahmad** and Anjum Munir ***

ARSENIC III TOLERANCE POTENTIAL OF FUNGI ISOLATED FROM POLLUTED AND NON-POLLUTED SOILS OF PAKISTAN
...significant role in bioremediation due to their large surface area and metal sorption capacity. In present study, arsenic (As) tolerance of indigenous filamentous fungi was explored. Fungal strains were isolated from peri-urban soils of Multan and Gujranwala irrigated with untreated industrial or municipal effluent. Some fungal strains were also isolated from non-polluted soils of Islamabad area. Arsenic (III) tolerance potential of 18 fungal isolates was test...
Aitezaz Ahsan1*, Muhammad Usman1, Ihsan Ullah2, Aamer Bin Zahur3 and Adnan Rasheed Malik4
...verse transcriptase loop mediated isothermal amplification over the last decade. These diagnostic assays vary in their sensitivity, specificity, reliability and reproducibility. Although these assays are detecting PPRV with precision but there is need to develop some cost effective diagnostic assays which would be applicable in the field conditions and in the developing countries like Pakistan.
...
Filiz Kutluyer* 
...i>. Different activation media (NaCl, 0.3%; NaHCO3, 1%) were supplemented with L-tryptophan [Control (0), 0.5, 1, 2, 3, 4 and 5 mM] for assessing sperm motility and its duration, fertility and hatching rate of eggs. The results from the present study indicated that addition of L-tryptophan increased the motility rate and duration in O. mykiss, S. rizeensis and S. coruhensis compared to control group. Highest sperm motility rate ...
Basit Zeshan1,2,*, Mushtaq A. Saleem2,Javed Iqbal Wattoo2, Mohd Mokhtar Arshad1 and Maizan Mohamed1
...4257;ed from the culture media. The immunogenicity of the protein was studied in an animal experiment on mice, in which mice were injected subcutaneously. These findings suggest that the truncated Sf200 expressed in the pET-32a (+) prokaryotic vector can be used as antigen to detect antibodies against IBV.
...
Nasir Abbas1, Muhammad Suleman1, Nazir Ahmad Khan2,*, Ijaz Ali3, Mubashir Rauf1,5 and Sadeeq ur Rahman4,*
...on modified fray’s media indicating typical mycoplasma like colonies with appearance of fried egg or nipple like characteristic of 0.1 to 1 mm in diameter with a dense raised center in the middle. Interestingly, culture positivity for broiler samples was found higher (36.8%) as compared to breeders (33.5%) and layers (29.5%), respectively. Overall, of the cultured samples, 71.19% (215/302) were confirmed as M. gallisepticum by specie specific PCR....

Ejaz Ashraf1*, Hafiz Khuram Sharjeel1, Raheel Babar2, Muhammad Junaid1, Qamar Iqbal3, Rabia Rasheed1 and Nosheen Fatima1 

...verage, less use of multimedia, unavailability of training facilities to EFS, manifold duties assigned to extension officers and top-down dimension of planning of implementation of extension approaches were main weaknesses. The steps like effective evaluation of extension system, use of democratic nature extension approaches, and training facilities to EFS could improve working efficiency of Extension Field Staff and extension approaches thereby. 

...
Muhammad Tariq Zahid1, Farah Rauf Shakoori2, Soumble Zulfiqar3, Khalid A. Al-Ghanim4 and Abdul Rauf Shakoori3,4*
...nological tools for bioremediation.
...
Muhammad Umar1, Mubashar Hussain1,*, Ghulam Murtaza1, Farid Asif Shaheen2 , Fatima Zafar1
... on electronic and print media could be effective conservation strategies during the period of their stay in Pakistan.
...
Mousa O. Germoush1,*, Mohsen G. Al-Mutary2, Ahmad R. Al-himaidi3, Muath G. Al-Ghadi3, Daisaku Iwamoto3,4, Yousef Al-anazi3, Aiman Ammari3, Javed Ahmad3,5, Abdulaziz Al-Khedhairy3,5
...tro maturation (IVM) media with proportions 0%, 10%, 20% and 40%. Oocyte maturation was assessed in different treatments and then cumulus-oocyte complexes were used for in vitro fertilization. Relative quantitative expression of mRNA transcripts related to apoptosis (Bax and Bcl-2), embryo development (LAMA1, IL-6 and FGF4) and stress (HSPB1) were examined. The results showed that 10% and 20% SFF supplementation exerted no effect on maturation and c...

Habibullah* and Sahib Alam  

... main plot factor. The immediate effect of biochar was assessed on maize crop integrated with four levels of N viz. 0, 100,150 and 200 kg/ha applied as sub-plot factor. The residual impact of the previously applied biochar levels coupled with fresh applications of N at the rate of 0, 80, 120 and 200 kg/ha was assessed on subsequent wheat crop grown on the same plots. The soil physicochemical properties were evaluated in the beginning, reproductive stage and at...
Leila A. Kaimbayeva1,*, Elena S. Malysheva2, Rashit Kazikhanov3 and Saule R. Kazikhanova4
...s old female red deer, immediately processed for isolation of muscular fibers and were evaluated for the pH, water-binding power, activities of tissue enzymes and microstructure changes. The results of chemical analysis revealed the nature of protein substances, altered рН value of the meat and the intensity of glycolysis. All these parameters were indicative of autolysis process in the meat. The levels of water-binding capacity and structural-mech...
Hafiz Azhar Ali Khan1,*, Waseem Akram2, Sumi Lee3, Shakir Manzoor1, Syed Rajab Ayub1, Khalil Ur Rehman1, Shinawar Waseem Ali1, Muhammad Bilal Chattha1 and Sumaira Maqsood1
...tion bioassays. Based on median lethal concentration (LC50) values, all the strains of S. oryzae and R. dominica were more susceptible to spinosad than T. castaneum strains. The resistance ratios (RRs) of field strains at LC50 values were in the range of 2.24 to 3.24 fold for T. castaneum, 3.33 to 9.00 fold for R. dominica, and 1.73 to 3.45 fold for S. oryzae. The results revealed a variation in s...

Safdar Ali1*, Obaidullah Shafique1, Tariq Mahmood2, Muhammad Amir Hanif1, Ijaz Ahmed3 and Bashir Ahmad Khan

...e plants or nanoparticle-mediated gene. Biofuel production from biomass is estimated to speed up using nanotechnology. Researchers and manufacturers have to demonstrate that the application of nanotechnologies have no harmful effect on the atmosphere against the anomaly based only on small amounts of toxicological research and concerns about the safety of nanomaterials.

...
Muhammad Shahbaz Aslam1, Iram Gull1, Zaigham Abbas2,* and Muhammad Amin Athar1
...n stimulated genes which mediate its anti-proliferative and anti-angiogenic properties. Similarly, Thymosin alpha 1 (Tα-1) helps to fight against different infections such as cancer and hepatitis with its immune modulating properties as well as through its direct action on target cells. The recombinant expression of some proteins in E. coli produces inclusion bodies which are misfolded proteins. The objective of this study was soluble expression o...
Thomas W. Clark
...the brain processes that mediate choice and behavior. Where the soul once presided, there are, it turns out, only neurons in fantastically complex structures which somehow maintain the coherent psychological and behavioral pattern – character, beliefs, desires – that constitutes each of us as a person. The feeling of being a singular self that owns these characteristics is real enough, but there’s no indivisible thing to which that feeling re...
Muhammad Nazar Aftab1, Ahmed Ali1, Muhammad Asad1, Sadia Fatima2 and Furhan Iqbal2,*
...ects of AlCl3 mediated toxicity on the hematobiochemical profile of male albino mice. Eight week old male albino mice were used as experimental animals and were divided into two groups. First group was treated with 80mg/Kg body weight of AlCl3 for 16 days while control group was treated with saline solution for the same period of time. Complete blood count were determined in both experimental treatments at the end of dose supplementation....
Nausheen Irshad1,*, Imran Yousaf1, Tariq Mahmood2 and Muhammad Saeed Awan1
...lf-defense. Therefore, immediate conservation measures are needed to protect the species. The other aspects of leopard ecology like habitat requirement, food and major threats are yet to be identified and addressed.
...
Nadeem Munawar, Iftikhar Hussain and Tariq Mahmood*
...ep ploughing of fields immediately after harvest of crops would destroy the rodent burrow system and may expose animals to increased predation by raptors and other predators.
...
Xi-wen Chen1,2, Qian Wang1,3, Miao Yin1, Zhong-hui Pu1,2, Ai-wei Guo3, Lian Li 1,3, Wen-tao Luo1,3 and Xiong-qing Wang1,*
...verse transcription-loop-mediated isothermal amplification (RT-LAMP) assay to detect PRRSV. Four primers were designed targeting the ORF5 gene of PRRSV were designed. Reverse transcription and amplification of the viral RNA using AMV reverse transcriptase was optimal at a constant temperature of 65 °C. The output of the RT-LAMP assay was visualized using 1% agarose gel electrophoresis or color change after the addition of the SYBR Green I dye. The RT-LAMP ...
Masood Nizam Tabassum1*, Muhammad Ather Khan2, Saira Afzal3, Amir Gilani4, Abdul Wahab Gureja5, ShafaqTabassum6
...of 15 and 100 years. The median and mode of ages was 27 and 15 years, respectively. The most common age group was 15-24 years that comprised of 473(42.23%) of the cases. A total of 529(47.23%) patients were male and 591(52.77%) were female in this study. In male and female cases, frequency of cases was decreased as age increased. Both male and female cases had almost similar distribution of age. There were 830(74.11%) cases those belonged to Lahore while ...

Syed Muhammad Hassan Raza1*, Syed Amer Mahmood1, Veraldo Liesenberg2 and Syed Shehzad Hassan1  

...SB attacks and to take remedial measures accordingly 

...
Fouzia Hadi Ali1, Farhat Naz2, Aban Abid Qazi3
 
...o examine the sequential mediation of WLB and vitality at work between the relationship of positive psychological capital and WP.
Methods: A cross-sectional study was conducted at 80 hospitals in the province of Punjab. The stratified sampling design was employed to select a sample from the population. Out of 80, a total of 53 hospitals were consented to participate in the study. A structured questionnaire was administered to a sample of 110...
Muhammad Sarfraz*, Shahida Hasnain
...> | Screening of plasmid mediated AmpC beta-lactamases (AmpC) has clinical significance due to developing resistance of clinical pathogens against several beta-lactam antibiotics. This study was conducted on 11,725 specimens collected from hospitalized and non-hospitalized patients from July 2013 to June 2016. API 20E system has been used to identify K. pneumoniae and E. coli; preliminary screening for AmpC beta-lactamase production was done by c...
Şehriban Çek Yalnız 1,* and Erdal Yilmaz2
...regression in mammals is mediated by apoptosis, which is a natural occurring cause of cellular death. However, its function in fish is largely unknown. In order to discuss the possible role of apoptosis in fish ovarian follicular atresia and postovulatory regression, the pre and postovulatory follicles (POF) of the freshwater teleost, Clarias gariepinus were observed by light microscopy. The germinal vesicle and the cytoplasmic organelles of the oocyte ...

Asif Nawaz* and Muhammad Zafarullah Khan 

..., it is suggested that immediate in-service training should be provided to them in the identified competencies and also it might be included in the curriculum of the Field Assistants diploma course. 

...

Aneel Salman1, Muhammad Iftikhar ul Husnain1, Inayatullah Jan2*, Muhammad Ashfaq2, Mudassar Rashid1 and Usman Shakoor1 

... like education, role of media, and government policies that can affect farmers’ choices to adopt climate resilient farming practices.  

...
Tahira Jamil*1, Mohammad Asghar1, Fatma Husain1, Haq Nawaz Bhatti2
...secondary metabolic intermediate initiated by anion moiety (acetate) through polyketide chain reactions. The current work was put away to investigate the potency of Pleurotus strains for statin formation by cultivating them on lignocellulosic substrates (wheat straw, rice straw, banana stalk) in SSF for 8 days. Among Pleurotus species (P. nebrodensis, P. sepidus, P. spodoecus), P. spodoecus expressed best statin format...

Umair Riaz1*, Muhammad Ali Kharal2, Ghulam Murtaza3, Qamar uz Zaman4, Sana Javaid4, Hina Ahmed Malik3, Humera Aziz3 and Zafar Abbas1 

...take of nutrients and by mediating the transport and distribution of different hormones. Caffeic acid is actively involved in plant physiology and mechanisms of stress tolerance primarily utilized by plants for the synthesis of lignin which ultimately thickened cell walls and plant become resistant to ion toxicity sodium and heavy metal stress. It also reconciles the absorption of high energy radiations in mesophyll cells under drought stress, mechanism involv...

*Nageen Fatima1, Sadia Murawwat1 and Syeda Ameena Rizvi1

EVALUATION OF IMAGE COMPRESSION TECHNIQUES: AN IMPLEMENTATION OF TRUE COMPRESSION ON 2-D IMAGE
...dely use in advance multimedia, communication and graphical systems is used to minimize storage requirements and transmission cost. It increases transmission rate by decreasing redundancy of image data in either lossy or lossless compression means. In this research work, comparison of compression techniques is done using Compression Ratio (CR) and Bit-Per-Pixel (BPP) ratio as performance parameters. Image compression by Huffman encoding, Embedded Zero tree Wav...

 Sumera Siddique1,†, Hafiz Abdullah Shakir1, Javed Iqbal Qazi1*, Amtul Bari Tabinda2, Muhammad Irfan1

Screening of some agri-wastes for economical cultivation of Candida tropicalis SS1
...is SS1 was cultivated in media containing 2% pulverized peels of apples, mangoes, water melon and bagasse singly as well as in eleven different combinations. The media were inoculated with 1% (w/v) suspension of 24 h old yeast cultured in nutrient broth. The strain grew best in water melon (WM) at pH 7.0 and 37 °C under non agitation conditions. The proximate analysis revealed that the water melon peels showed the highes...

 Muhammad Tahir Waseem, Muhammad Awais Sarwar, Rana Manzoor Ahmad, Abdul Majid Khan*

Newly discovered fossil remains of Selenoportax vexillarius from Hasnot, locality of Siwaliks of Pakistan
...and moderately developed median basal pillars while the crown in all specimens is slightly narrow at the bottom and broader at the apex.

...

 Bushra Siyal1, Sanjota Nirmal Das1, Rafia Rehana Ghazi2, Aly Khan3

Heterotestophyes gibsoni sp.n. (Trematoda: Heterophyidae) from the bird little tern (Sternula albifrons) in Sindh, Pakistan
...vary pre-testicular, sub median, equal in size to anterior testis. Uterus profuse with loops in hind body,
between the genital atrium and anterior testis. Vitellaria follicular, commence at little distance below the genital
atrium, extend up to the hind body above the testes, eggs are oval shaped and double walled.

...

 Maleeha Manzoor1,2*, Ruijuan Ma2, Hafiz Abdullah Shakir1, Fouzia Tabssum1, Javed Iqbal Qazi1

Microalgal-bacterial consortium: a cost-effective approach of wastewater treatment in Pakistan
...utrient cycling and bioremediation of organic
pollutants, heavy metals and many other contaminants. The biodegradation approach of involving consortium might
attain self-sustaining level and may prove technically cheaper and advance technology. It will finally help in dealing
the dual mission of producing valuable metabolites and pollutants/nutrients removal from wastes/wastewaters.
Agricultural wastes/residues generated abundantly ...

 Mohsin Arshad1, Muhammad Irfan*2, Asad-Ur-Rehman1, Muhammad Nadeem3, Zile Huma3, Hafiz Abdullah Shakir4, Quratulain Syed3

Optimization of medium and substrate for CMCase production by Bacillus subtilis-BS06 in submerged fermentation and its applications in saccharification
...n
using different media (medium 1 (M1), medium II (M-II), medium III (M-III) &
medium IV (M-IV)).Of all these tested substrates, sugarcane bagasse was found to
be the most suitable substrate for CMCase production. The effect of shaking on the
production of CMCase demonstrated that sugarcane bagasse gave maximum
CMCase activity (8.0 ± 0.32 IU) after 48h of fermentation period at 37oC with
agitation speed of 1...

Akshay Sharma*, Mohit Mahajan, Madhumeet Singh and Pravesh Kumar 

...sis of genital tubercle, median raphe, scrotal and penis impression. With the aid of ultrasonography and color Doppler technique, it is possible to determine the twins’ zygosity and viability. 

...

Saman Fatima* and Shazia Iram 

... colonies on generalized media, i.e. potato dextrose agar, from which six fungal colonies were also isolated and studied further. Under molecular approach direct DNA was isolated from the infected skin of sampled fruits by using CTAB method. The pathogens being identified through classical approach includes: Penicillium sp., Aspergillus flavus, Aspergillus niger, Alternaria sp., Lasiodiplodia theobromae, Fusarium sp. After sequencing of DNA the pathogen specie...
Shaher Bano1, Sarah Ghafoor1,* and Nadia Naseem2
...esigned to understand T3-mediated regulation of TGF-α expression during postnatal salivary gland development as it is currently unknown.Twelve male rats were taken at week three and twelve at week seven and divided into control and experimental groups. Control rats were given normal saline while experimental rats were given T3 at a dose of 1mg/kg body weight. All the animals were sacrificed on 15th day. Weight of each rat was calculated at the...

Nighat Seema1*, Muhammad Hamayun1, Husan Ara1 and Raham Sheer Khan

...ctable P and K in growth media compared to soil samples before experiment and after experiment in control samples. In case of micronutrients, only copper was decreased in endophytic treated soil, whereas iron, zinc and manganese did not follow any specific trend with or without drought stress. Hence, it is suggested that all these endophytic fungi should be evaluated under open field drought stress conditions before final recommendation for agronomic purpose.&...
Peng Song1,2, Wei Feng2, Haiying Shi2,Jinsheng Zhao3, Renmin Liu3 and Wei Xu2,*
... or 5 mg/L Sudan I in LB media at 37°C for 10 h, and reduction of the dyes was monitored. The preferable pH for the decolorization of Amaranth by ts17 strain was between pH 6.0-9.0, and with the optimum pH at 7.0. The promotion effect of NaCl on the decoloration of Amaranth up to 5% (w/w) content, and the inhibition action appeared at 7% NaCl. The maximum decolorization concentration of the Amaranth reached 1450mg/L. Mg2+ and Fe3+ cou...

Syed Amjad Kamal Jan* and Naushad Khan 

... level, followed by intermediate level. Similarly, in category of family size the number in above 15 category was found more than the other categories followed by 8-15 category. The Cob Douglass Production function result indicate the constant value 5.434 and found significant which shows that if other variables remove from the model then production of rice will be 5.434 Kg per acre averagely of the respondents. According to analysis Farm Size, Tractor hours, ...
Ajmal Khan Kassi1,*, Humayun Javed1 and Tariq Mukhtar2
...ater as compared to intermediate resistant and comparatively susceptible varieties. Contrarily, hair densities on leaf midrib and leaf lamina were comparatively less in case of comparatively resistant varieties as compared to intermediate resistant and comparatively susceptible varieties. With one exception in each category, no significant differences were observed regarding area, moisture, thickness of leaves and fruit leng...

 Muqader Shah1,*, Hafsa Zaneb2, Saima Masood2, Rifat Ullah Khan1, Salahud Din1, Shakirullah3, Imad Khan2, Ambrina Tariq4 and Habib ur Rehman5

... thickness, diameter and medial canal diameter increased significantly (P<0.01) in T6. However, tibiotarsal index decreased significantly (P<0.01) in T5. In conclusion, Zn and probiotic ameliorated the negative effect of HS. However, the bone parameters were not greatly affected by HS and the supplements.

...

 Sohaib Afzaal1, Usman Hameed2, Nasir Ahmad3,*, Naeem Rashid3 and Muhammad Saleem Haider1

...also isolated from these media. Among the tested strains maximum amount of lactic acid (26.457 mg/mL) was produced by the lactobacilliafter 48 h growth in skim milk broth, while the least (12.131 mg/mL) was produced by pediococci. These LAB strains are being studied for their probiotic properties and good quality indigenous starter cultures from them are anticipated to be employed in food industry.

...
Bibi Nazia Murtaza1,2, Azhar Qayum3, Shamaila Inayat Nadeem1, Naif Awdh Al-Maliki4, Abdulaziz Alamri4 and Abdul Rauf Shakoori2,5,*
...transient process of GAP-mediated GTP hydrolysis becomes altered when the Kras gene is mutated. The most common Kras mutations are found in codon 12 and 13 and 61. Some other noncanonical mutations have been reported in codon 11, 14, 15, 17, 18, 19, 20, 22, 27, 30, 31, 117, 146 and 154. We aimed to demonstrate the conformational changes induced in two novel K RAS variants, p.E31K and p.G138V, identified in two CRC patients, which may account for transformative...

Arshad Farooq* and Muhammad Zafarullah Khan 

...gh various types of mass media should be launched for reducing the knowledge gap and to equip the cane farmers with latest technology. 

...
Junli Sun1,2,3, Lin Bai1 2, Xiaogan Yang1,2, Yangqing Lu1,2, Shengsheng Lu1,2,* and Kehuan Lu1,2,*
...zed 60 the spent culture media of porcine parthenogenetic embryos experienced different types of microopetation using Raman spectroscopy. The results showed that Group II with the puncture of egg zona and plasma membrane had the highest cleavage rate and blastocyst rate of porcine parthenogenetic embryos, which was significantly higher than Group I with intact oocytes (P<0.05) and Group III with the puncture of zona and plasma membrane and aspiration egg cy...
Syeda Shazia Bokhari*, Ghashia Qayyum, Uzma Rafi and Aisha Waheed Qurashi
...theoughwhich earth worms mediate the process for improving soil fertility. The present study was undertaken for the improvement of soil fertility using microbes isolated from internal and external parts of Lumbricus terrestris Isolates were identified through different biochemical tests and morphological characterization. Bacterial strains were screened and those showing positive results for their adherence ability, autoaggregation and coaggregation res...
Rana Waqas Arshad1, Asim Aslam1, Muhammad Saeed Imran1, Kamran Ashraf2 and Raheela Akhtar1,*
...h immune complex or intermediate plus vaccines. Consistently, histopathological lesions of IBD were less evident in live vector vaccine group in comparison to other groups. In addition live vector vaccine improved the feed conversion ratio (FCR) by keeping the bird healthy and by decreasing the immunosuppression. These results indicated that live vector vaccine has overall positive impact in terms of immunity, histopathology of bursa of Fabricius and FCR. Thes...

Umar Hayat1, Khalid Khan2, Saima Liaqat3* and Balach Rasheed

...s campaign through print media and electronic media. It is also recommended to conserve water through the construction of dams and proper irrigation system may be managed on new footings to irrigate more lands to achieve the ultimate objectives of economic growth in Pakistan.

...

Sadaf Rahim and Mudassar Iqbal* 

...g two different nutrient media including Glucose Peptone Yeast Broth (GPYB) and Potato Dextrose Broth (PDB) and the effect of organic extract was investigated against selected insects’ pest. From this study it was found that the mycelial extract of T. harzianum fermented on PDB showed enhanced insecticidal mortality (73% and 76%) against Diuraphis noxia and Tribolium castaneum respectively while the extract obtained from GPYB med...
Saeed Murtaza1,*, Nazir Ahmad2, Muhammad Asif Raza3, Muhammad Saleem Akhtar1, Muhammad Mazhar Ayaz4, Muhammad Ali5 and Rais Ahmed6
Asima Azam1, Asma-Ul-Husna2, Saima Qadeer3, Qaisar Shahzad4, Rabea Ejaz1, Nemat Ullah5, Tasneem Akhtar4 and Shamim Akhter2,*
... and conditioned culture media, on in vitro development of Nili Ravi buffalo embryos. Oocytes were obtained from the ovaries of slaughtered buffaloes within two hours after slaughter and brought to laboratory. After in vitro maturation (IVM) in Tissue Culture Medium-199 (TCM199) for 24 h and fertilization (IVF) in Tyrode’s Albumin Lactate Pyruvate (TALP) medium for about 20 h, the presumptive zygotes were randomly distributed into 6 culture...
Salahud Din1,*, Saima Masood1, Hafsa Zaneb1, Habib Ur Rehman2, Saima Ashraf1, Imad Khan3, Muqader Shah4 and Syed Abdul Hadi1
...roximal row, lies on the medial side of the tarsus and bears trochlea at either end. The central and the fourth tarsals are joined to form a large bone which is extended across the entire width of the tarsus and articulates with all bones of the tarsus. The first tarsal is a rectangular piece of bone sited on the posteromedial surface of the hock. The second and third fused tarsal bone resembles the central but is smaller an...
Ghaleb Adwan*, Sami Bdir and Kamel Adwan
...nsidered one of the intermediate hosts for digenetic trematode cercariae. Digenean larvae were obtained from M. praemorsa snails that were collected from Palestine. Cercaria melanopsi palestinia I and III were identified as a xiphidiocercaria belonging to the microcotylae sub-group and as a microcercous cercaria, respectively. Phylogenetic analyses based on sequences of the ITS2 region of the nuclear rDNA revealed that C. melanopsi palestinia<...
Ali Mujtab Shah1,2,3, Muhammad Naeem2, Muhammad Giasuddin Shah2, Muhammad Haaroon2, Quanhui Peng1 and Zhisheng Wang1,*
...s, each of 5 calves. The median birth weight (kg) ± S.D of calves fed by ST, NP and NS were recorded as 28.68±1.16, 28.44±0.67 and 28.56±1.13, respectively. Results of this study showed that the serum IgG levels and body weight gain were significantly (p < 0.05) different among the groups, the greater levels were observed in ST (15.74±0.29 mg/ml) as compared to NF (11.52±0.72 mg/ml) and NS (10.36±0.36 ...

Muhammad Noman, Yong Tong Mu*, Muhammad Mohsin, Aamir Mahmood Memon and Muhammad Talib Kalhoro

...ficient management and immediate steps to conserve this fishery resource for future generations.
...

Naveed Afsar* and Muhammad Idrees 

...f farmers was electronic media and the overall regression analysis of the climate change perceptions reveal that climate change is happening and long-term mean temperatures have been increased with a significant decrease in the long-term mean rainfall over the past decades. The study recommends that farmers should be trained well to more appropriately tackle the menace of climate change, extension workers should be made sure to visit the farmers in their field...
Muhammad Aslam Farooqi*, Bakhtawar Irsa, Sajjad Ali, Asif Sajjad, Muhammad Waqar Hassan and Sohail Akhtar

 

...aluate the toxic impact, median lethal concentration (LC50) of each tested insecticide was determined. The results obtained, revealed that all insecticides were highly toxic after 24 hours of exposure at maximum concentration. Acephate and lymda-cyhalothrin showed the maximum toxicity with their LC50 of 83.96 and 139.07 ppm, respectively while diafenthiuron and profenofos were moderate in toxicity with LC50 values of 150.53 and...
Ambreen Leghari1,2, Asghar Ali Kamboh2,*, Shakeel Ahmed Lakho1, Faiz Muhammad Khand1, Kanwar Kumar Malhi2,3, Iqra Bano Chandio4, Seema Baloch5 and Jan Mohammad Shah4
...ng the Lowenstein-Jensen media. An overall prevalence of 34.38% was recorded by rapid test that was higher (P< 0.001) than SITT (3.13%) and culture test (2.50%). A somewhat higher prevalence was recorded in Hyderabad district (SITT 3.75%, Rapid 36%, culture 3.75%) as compared to Tando Allahyar district (SITT 2.5%, Rapid 32%, culture 1.25%). In Hyderabad district, rapid test showed a significantly higher (P< 0.05) prevalence in male than females. Similarl...
Ping Jiang1 , Zhihui Zhao1, 2, Xiaohui Li2, Mengyan Wang2, Lixin Xia2, Yang Cao3, Runjun Yang2 and Xibi Fang2*
...d transient transfection mediated-RNA interference technology to specifically knockdown expression levels of the endogenous gene ABCA1 in bovine mammary epithelial cells (BMECs) to analyse the effect on intracellular triglyceride (TG) content by quantitative real-time polymerase chain reaction (qRT-PCR), Western blot, cell TG Assay and RT2 Profiler PCR array. The results showed that ABCA1 knockdown reduced the TG content in BMECs. On the other hand...

Illahi Bux Bhatti1, 2*, Imran Khatri2, Maqsood Anwar Rustamani2 and Riffat Sultana

...per leaf 62.43%.The intermediate treatment was T9 (Biological control + Chemical control) in which recorded 0.78 nymphs + puparia with 58.73% mortality, followed by T4 (Chemical control) in which recorded 0.84 nymphs + puparia 55.56% mortality and T1 (Cultural control) in which recorded 0.93 nymphs + puparia with 50.79%. However, there is no significant difference between treatments i.e., T1 and T8, T2 and T3 and T6 and T9. The results indicated that, all cont...

Muhammad Shahzad Akbar*, Maria Aslam, Muhammad Rehan Khalid, Shahid Iqbal, Muhammad Luqman and Muhammad Zeeshan Majeed 

...concentration (LC50) and median lethal time (LT50) values were calculated for each treatment using log-dose probit analysis. Results revealed a mortality response of termites directly proportional to the extract concentration for all treatments. The floral extracts of basil (O. basilicum) and Tecoma (T. stans) exhibited maximum termite mortality (i.e. 55.5 and 50.0%, respectively) with minimum LC50 and LT50 values, followed by the extracts of chrysanthemum (G....

Hala Rajab1, Muhammad Sayyar Khan1*, Safdar Hussain Shah1 and Syed Mehar Ali Shah2 

...Murashige and Skoog (MS) media containing BAP 3 mgL-1 and developed roots in ½ MS media supplemented with IBA 3 mgL-1 in case of OSCAR cultivar. Successful selection of transgenic lines was achieved using selective antibiotic kanamycin 50 mgL-1. NtSAT4 gene integration into the plants genome was confirmed by PCR using the NtSAT4 gene specific primers. The positive transgenic lines were successfully acclimatized to so...

Betül Ayça Dönmez, Sarbesh Das Dangol and Allah Bakhsh* 

...eved from transformation mediated by AGL1 strain in cv. Desiree, and about 23 % from LBA4404 strain in S. chacoense M6. This study will further aid in the development of transgenic stable transgenic potatoes, especially in diploid cultivars. 

...
Hanif Ullah1, Muhammad Inayat Ullah Khan2, Suleman3, Sawar Khan1,Salma Javed4, Abdul Qadeer1, Mohsin Nawaz1, Sardar Azhar Mehmood4
...Dir Lower, which needs immediate attention to take preventive measures. 
...
Hafiza Sadaf Zahra1, Asia Iqbal2, Sayyeda Hira Hassan1, Hafiz Abdullah Shakir1*, Muhammad Khan1*, Muhammad Irfan3, Chaman Ara1, Shaukat Ali4
... The most important ALAN-mediated epigenetic changes include methylation of DNA and acetylation of histone, which are significant for growth, development and progression of BC. DNA hypermethylation of promoter CpG islands inhibits transcriptional activity by methyltransferase enzyme which results in inactivation of tumor suppressor genes (TSG), while in hypomethylation, demethyltransferase enzyme causes the activation of oncogenes by promoting transcriptional ...
Honghua Wang1,2, Summia Perveen1,2, Shucheng Shao1,2, Kun Wang1,2 and Fei Yin1,2,*
...ding a number of vesicle-mediated transport, cytoskeletal and extracellular secretion-related proteins. These results provide a platform to study tomont cell characteristics and provide a further understanding of cyst wall formation and mechanisms.
...
Bibi Nazia Murtaza1, Mazhar Saeed Chaudry2, Shamaila Inayat Nadeem1, Muhammad Shahid Nadeem3 and Abdul Rauf Shakoori4,*
...tol-3-kinase (PI3K) mediated or Ras/PI3K/PTEN/Akt/mTOR is one of the major effector pathways in the pathogenesis of Non-Hodgkin Lymphoma (NHL). Binding of growth factors/ mitogen/cytokine or interleukin to EGFR leads to Ras induced RAF-MAPK cascade activation. PTEN protein is involved in the negative regulation of PI3K pathway. Mutations in upstream kinases, growth factor receptors or intrinsic members of cascades can lead to induce or promote cancers. Nu...
Erum Iqbal*, Nasir Mehmood, Nasira Kazi and Shahina Fayyaz
... or truncated without submedian lobes, tail ventrally curved with pointed or acute terminus. P. sindhicus n. sp.,is characterized by stylet 20-21µm long; vulval lips not protruding with advulval flap; female head with small submedian lobes; tail ventrally curved with finely to broadly rounded terminus. Detailed taxonomical studies of new species have been incorporated herein with measurements, descriptions, illu...

Asif Yaseen1, Muhammad Israr2*, Allah Bux Khan1, Ahsan Javed3, Nafees Ahmad4 and Zia Ullah

...ting channels (with intermediaries) is still profitable, high value marketing channels appeared more attractive alternative, having been shown to offer increased net income to smallholder citrus growers. Findings showed the importance of production experience and know-how of quality issues are the significant determinants of farmers’ reliance on high value marketing channels. To this end, policy makers need to give due consideration to certain exogenous ...

Saleem Ashraf1, Raheel Saqib2*, Zakaria Yousuf Hassan3, Muhammad Luqman4 and Abdur Rehman5  

...h gap by soliciting intermediaries’ role in the citrus marketing process. Total 120 randomly selected citrus growers were interviewed face to face and collected data were analysed using Statistical Package for Social Sciences. Findings affirmed that middleman, processing factories and friends/relatives were the foremost intermediaries in citrus marketing. Majority of growers (94.16%) preferred selling their pre-harvest...

Yousaf Ali1, Muhammad Zamin1*, Ibadullah Jan1, Shahen Shah2, Muhammad Mazhar Hussain3, Fazli Rabbi4 and Muhammad Amin

...dquo;Impact of different media on germination and emergence of tomato genotypes)” was conducted at National Agriculture Research Council (NARC) Islamabad, during June to August 2018. The experiment was laid out in Randomized Complete Block Design (RCBD) consisting of four planting medium treatments (compost, mixture, clay and sand) and six tomato genotypes (Nadir, Money Maker, Pakit, Nagina, Roma and Rio grande) with three replications. The results revea...

Nosheen Noor Elahi1, Muhammad Shafique1, Muhammad Imtiaz2, Umer Farooq3* and Muhammad Rashid1 

...sence of PGPR inoculated media and nitrogen in different salinity levels (20, 50, 100, 200 and 300mM NaCl). The biomass production of the varieties CM91 and CM98 increased at 20-100mM NaCl concentrations but drastically decreased at higher levels. While in varieties CM44 and CM2000 a gradual decrease of biomass with increasing salinity levels were observed. Number of pods, flowers and fresh weight of pods were not affected at salinity levels of 0-50mM and decr...
Muhammad Asif Gondal, Qazal Waheed, Sana Tariq, Waseem Haider, Aisha Khan, Qudsia Rasib and Haroon Ahmed*
...arious reasons like intermediate hosts for many trematodes and bio-indicator. Snails are cosmopolitan in distribution and diversity of habitat to perform ecological performance is abosolute. The freshwater malacological information is sparse within Pakistan specifically in the foothills of Margalla hills. Therefore, the present study was designed to evaluate the habitat preference of freshwater snails to environmental factors. However, only 3 species of snail ...
Erum Yawar Iqbal1*, Ashfaque Ahmed Nahiyoon1, Shahnaz Dawar2 and Shahina Fayyaz1
... the surrounding culture media. New species proficiency was evaluated in comparison with other indigenous isolates and resulted in most efficient at 30ºC after 24h and proved to have good effectiveness as biological control agent and can be easily used instead of live bacteria in future formulations.
...

Mahfooz Khan* and Himayatullah Khan 

...epartments should take remedial measure to address the concerns needs of the rural people. 

...
Abdurakhim Kuchboev1, Mehmonjon Egamberdiev2, Rokhatoy Karimova1, Oybek Amirov1 and Mitsuhiko Asakawa3,*
...dences in gastropod intermediate hosts from Fergana Valley, Uzbekistan. Larvae of D. dendriticum were detected in 28 (10.7%) out of 262 Xceropicta candacharica, and 8 (9.7%) of 82 Angiomphalia gereliana. Brachylaima sp. larvae were found in 3 (1.6%) of 95 Pseudonapaeus sogdiana. The total number of larvae per snail varied from 8 to 110 individuals. Alignment of the first four sequences of 28S rDNA was revealed a 99-100% simil...

Amna Qazi1, Ghulam Shah Nizamani2*, Muhammad Tahir Khan2, Shafquat Yasmeen2, Shahla Karim Baloch1, Muharram Ali1, Imtiaz Ahmed Khan2, Sagheer Ahmad3, Muhammad Rashid Nizamani4 and Mohammad Aquil Siddiqui

...tions of shoot induction media and three disparate recipes of rooting media. It was seen that both of the factors i.e. genotype as well as growth medium played significant role in inducing propagation of the sugarcane. Shoots were observed to initiate earliest in NIA-2004, NIA-2012 and NIA-1026-P7 in MS media supplemented with 1.00 mg l-1 IAA + 1.00 mg l-1 Kin + 1.00 mg l-1 BAP and 20 g l-...
Wen Xiong1,2*, Qitao Zeng2, Dangen Gu1 and Yinchang Hu1*
...(t-test, p<0.05). The median value of b was 3.15 and 50% of the b values ranged between 2.95 and 3.31.
...
Godwin Ikechukwu Ngwu1*, Maria Ifeyinwa Ngwu2, Fabian Chukwuemenam Okafor1, Aruh Ottah Anaga3 and Christopher Didigwu Nwani1
...after 24 h exposure. The median larvicidal concentration LC50 values of the extract were 1.24 ± 0.09g/L and 2.81 ± 0.14g/L for 4th instars larvae of both laboratory-reared and field-collected mosquito larvae respectively. Further research is recommended on the isolation of the active ingredients of I. stolonifera for use in effective control of mosquito.
...
Jiantong Feng, Xueping Wen, Yahong Guo, Yingying Ye*, Jiji Li and Baoying Guo
...reover, results from the median-joining network, plot of STRUCTURE and the UPGMA trees were similar to pairwise Fstvalues. Results from AMOVA indicated that the genetic variation of M. lamarckii populations was mainly from the variation within populations (COIII: 93.27%, 12S rRNA: 92.32%). The results of neutrality tests combined with the mismatch distribution indicated recent population expansion of M. lamarckii on large spatia...

Jie Yang

...ovel mechanism of miR-16-mediated apoptosis through extracellular-regulated kinase pathway.
...

Muhammad Shakeel1,2*, Salik Nawaz2, Yasar Saleem3, Shazia Shafique2, Ateeq Tahir2 and Muhammad Riaz2

... it needs government and media assistance for creating awareness for its health benefits and crop production technology. 

...

Muhammad Usman Saleem, Nadeem Iqbal, Shawaiz Iqbal*, Usama Bin Khalid, Adila Iram, Muhammad Akhter, Tahir Latif and Tahir Hussain Awan 

...Irrigation was applied immediately after sowing and after 24 hours pendimethline was sprayed as pre-emergence weedicide. The irrigation was repeated about 4-5 days after pre-emergence weedicide application and afterwards about 3-5 days interval till tillering phase and then 5-7 days interval till crop maturity. The overall results indicated that paddy yield was 20% higher under DSR as compared to TPR. Moreover, during 2017 in Punjab Province, Pakistan, more th...
Hui-Ying Chen1,2*, Ping-Chuan Yin1,2, Ya-Nan Lu1,2, Hai-Yun Li1,2*and Yang Shan3
...nsidered to be partially mediated by the induction of apoptosis in cells. However, the underlying molecular mechanisms of aspirin in the prevention of cancer are yet to be fully elucidated. In the current study, the GSE115660 microarray dataset was downloaded from the Gene Expression Omnibus database to identify key genes in aspirin-damaged yeast cells following redox injury. Differentially expressed genes (DEGs) were subsequently identified and functionally e...

Muhammad Medrar Hussain*, Asad Jan* and Sayyar Khan Kazi 

...1. Through Agrobacterium mediated transformation, OsTZF8 gene (pBIG-Ubi-OsTZF8) was successfully transferred to rice calli. From these rice calli transgenic plants were regenerated and established in greenhouse. For the evaluation of OsTZF8 gene role in drought stress tolerance, two weeks old rice seedling were subjected to drought stress. OsTZF8-OX transgenic indica line A and B displayed 69% and 64% survival rates respectively compared to 33% of control. The...
Saira Saleemi1*, Zafar Iqbal1, Abdul Nasir Khalid2
...n four different culture media; Malt extract agar (MEA), Corn meal agar (CMA), Sabouraud dextrose agar (SDA) and Potato dextrose agar (PDA). The inoculated culture plates were incubated for 5-8 days at 28-32 oC. The fungal growth in the form of colonies of different shapes and colour appeared in agar plates. Four Aspergillus spp.; Aspergillus terreus (8.40%), A. flavus (17.06%), A. fumigatus (24.02%) and A. niger (...
Fehmina Ashraf1*, Muhammad Irfan2, Hafiz Abdullah Shakir1, Shaukat Ali3, Muhammad Khan1
...e etc. Both laccases and mediators have been used in different process like delignification of pulp. Laccases from bacterial species are used in dye decolouration and biobleaching processes. This review article describes the whole overview of laccases.

S. Ahmed† , L. Yue, Q. Liu and H. Jian

Evaluation of media for mass production and fermentation of Pseudomonas spp. for integrated management of cereal cyst nematode (Heterodera avenae)
...rces in various types of media compositions was made to optimize the fermentation and mass production of Pseuodomonas spp. Among all the media compositions, the suitable media containing carbon and nitrogen sources were found as media No.9 (Corn flour 50g/L, Glucose 8g/L, Soybean Cake Powder 20g/L, Wheat bran 20g/L, NaCl 4g/L) followed by No.10 (Corn flo...

Mahmood Alam Khan1, Muhammad Yaseen1, Mujahid Khan*2, Amjad Khan1 

TEMPORAL VARIATION IN GROUND WATER QUALITY DUE TO URBANIZATION. CASE STUDY: DISTRICT PESHAWAR, PAKISTAN
...br /> of Peshawar and remedial measures are needed in future.

...

Nabeel Maqsood1,2*, Afzal Khan1, Muhammad Khalid Alamgir2, Shaukat Ali Shah1, Muhammad Fahad3 

PTFE THIN FILM COATING ON 316L STAINLESS STEEL FOR CORROSION PROTECTION IN ACIDIC ENVIRONMENT
.../> resistance in acidic media containing Hydrochloric acid (HCL). The anticorrosion property of the 316L SS and PTFE
coating was studied in 40% HCL by electrochemical corrosion test and potentiodynamic polarization curves at room
temperature and compared. The morphology of uncoated and coated substrates were examined by scanning electron
microscopy (SEM) while the compositional analysis performed through energy dispersive x-ray spectrosco...

Sajjad Ali1, Muhammad Shahzad Khattak1, Daulat Khan1, Mohammed Sharif2, Hamad Khan1, Asmat Ullah3,
Abdul Malik1 

PREDICTING FUTURE TEMPERATURE AND PRECIPITATION OVER PAKISTAN IN THE 21ST CENTURY
...refore, preventive and remedial measures are required to minimize the impacts of projected warming by formulating
long-term management and control policies for all sectors. 

...

Suhaib*, Shahid Maqsood*, Sikandar Bilal Khattak*, Misbah Ullah*, Rehman Akhtar*, Rashid Nawaz*, Iftikhar Hussain*, Abdul Shakoor**, Khizar Azam** 

SINGLE FACILITY LOCATION SELECTIONPROBLEM FOR A PAKISTAN BASED ICE CREAM COMPANY: A CASE STUDY
...n optimization technique median method is applied to a
real world problem of a multinational ice cream company’s factory located in Lahore, Punjab (province) Pakistan,
with an objective of minimum overall cost between a warehouse and destinations. The company wanted to locate the
warehouse in Khyber Pakhtunkhwa (KPK), province in order to meet the demand in KPK on time and reduce the
travelling cost between the warehouse and d...

Muhammad Naveed Anjum1, Abdur Rehman1*, Muhammad Niamatullah Khan1, Raheel Saqib2, Mohammad Fayaz3 and Iqbal Javed4

Impact of Microfinance on Socioeconomic Status of Farmers in District Dera Ismail Khan
...create awareness through media.

...

Muhammad Zamin1*, Fazli Rabbi2, Shahen Shah3, Muhammad Amin4, Haroon Ur Rashid5, Hasnain Alam6 and Sabahat  Ali1

Performance of Lilium (Lilium elegans L.) Genotypes using Different Planting Media
...in four type of planting media viz., M1-sandy soil+ Compost (1:1; v/v), M2- sandy soil+Humic acid (20:1;v/v), M3- sandy soil+ Peatmoss (1:1;v/v), M4-sandy soil+Potting soil (1:1;v/v). in randomized complete block design (RCBD) with 3 replications. The lilium genotype Bomi Yellow performed well in terms of maximum plant height (72cm), highest number of flowers (5.4) and least days to flowering (45.92 days). However, maximum number of leaves (53.3) were recorded...

Nisar Mohammad*, Mohammad Mansoor Khan* Noor Mohammad*

CHARACTERIZATION OF TALC-CARBONATE ROCK OF MINGORA EMERALD MINES, DISTRICT SWAT, KHYBER PAKHTUNKHWA, PAKISTAN

Inayat Ullah*, Shah Khusro**, Saeed Mahfooz**, Azhar Rauf**

IMPACT OF NETWORK SCALABILITY ON THE PERFORMANCE OF RIP AND IGRP FOR EMAIL SERVICES
...rst (OSPF) and Intermediate System to Intermediate System (IS-IS) are link-state routing protocols. Both RIP and IGRP are using different metrics to evaluate best route to a destination in the network. RIP uses a simple metric value of hop-count while IGRP uses a composite metric. A composite metric consists of several attributes like bandwidth, delay, reliability, Maximum Transmission Unit (MTU) and load...

Ahmad Khan1*, Yasir Mehmood2

RESOURCE MANAGEMENT FOR MACHINE TYPE COMMUNICATION AND INTERNET OF THINGS IN MOBILE NETWORKS
...nbsp;implemented in intermediary node called aggregation node. Small memory (buffer) is used to held the small packets for some time. When the buffer capacity is achieved the accumulated packet is sent to receiver. Furthermore, a timer mechanism is used for avoiding huge delays of the aggregated packets. Simulation results (graphs) show that significant enhancement in spectrum utilization can be achieved.
...

 Muhammad Naeem Khan Khattak1, Hamidullah1, Shehryar2

PROBLEMS, ANALYSIS AND RECOMMENDATIONS OF THE AUTOMOTIVE VENDOR INDUSTRY OF PAKISTAN—I
...rsquo;s discussions, and media releases has unveiled some daunting facts pertinent to automotive vendor industry of Pakistan. The salient outcomes of the analysis are presented. On the basis of the analysis and interview results, comprehensive recommendations are also provided for the automotive vendor industry of Pakistan.
...

Mohammad Enamul Hoque Kayesh1,2*, Mohammad Tufazzal Hussan3, Md. Abul Hashem2,4, Mohammad Eliyas5 and A.K.M. Mostafa Anower1

Lumpy Skin Disease Virus Infection: An Emerging Threat to Cattle Health in Bangladesh
...ke strategic plans and immediate control measures for LSD outbreak control and prevention in Bangladesh. In this review article, we will focus on epidemiology and modes of LSDV transmission, and its effective control and preventive measures to reduce or eradicate the LSDV infection from a recently infected country like Bangladesh. In addition, we will highlight on impacts of LSD outbreaks in cattle industry of Bangladesh, and necessity of farmers’ awaren...

Mehwish Liaquat1*, Arshad Mahmood Malik1, Muhammad Ishaq1, Hafiz Muhammad Qasim Ashraf2 and Ismara Naseem

...d seedlings in coco peat media. The experiment was executed according to completely randomized design (CRD) with four replications. Analysis of variance (ANOVA) was performed on the data. Significant changes were observed in growth parameters among different tomato varieties. Data were collected on germination percentage after two days interval. The results revealed that the germination percentage (100%) was higher in Cherry Tomato. The seedling root length (3...
Maryam Yousaf1, Naveed Shahzad2, Zeeshan Mutahir1 and Moazzam Ali1*
...MRP-1, drug efflux pump, mediated resistance in prostate cancer cells. Drug sensitive (PC-3/Wt) and epirubicin resistant (PC-3/Res) prostate cancer cell lines were used in this study. Our data revealed that PC-3/Res cells had high expression of MRP-1 mRNA and protein in comparison with PC-3/Wt cells. MRP-1 was found distributed between intracellular and cell surface pools in PC-3/Res cells and was capable of drug efflux as shown by doxorubicin and epirubicin e...
Jam Nazeer Ahmad1,*, Samina J.N. Ahmad1,2,*, Mubashir Ahmad Malik1, Abid Ali1, Muhammad Ali3, Ejaz Ahmad1, Muhammad Tahir2 and Muhammad Ashraf2
...phagus pest therefore, immediately; control measures should be adopted to stop its further spread and infestation in Pakistan.
...
Fei Wang1, Xianlai Zhang1, Youbao Zhong2, Xiaoen Tang3, Xiaofen Hu1
ShanShan Yang1, Shengwei Zhong1, Zuohong Zhou1, Jin Liu1, Xu Yuan1 
and Yong Li1*
...estine as a key role and mediate the neuroendocrine and mucosal immune system as an information molecule due to the high expression of VIP. It will provide the basis for clarifying the biological function of VIP in pigeons.
...
Yan Zhou1,2, Hai Xia Han1,2, Qiu Xia Lei1,2, Jin Bo Gao1,2, Wei Liu1,2, Fu Wei Li1,2, Jie Liu1,2 and Ding Guo Cao1,2*
...ce for egg production in mediating the synthesis of yolk protein precursors. To better understand the effects of VLDLR on reproduction in chickens, the haplotypes and diplotypes based on three genetic mutations (NC_006127.2:g.8467G>A, NC_006127.2:g.12321G>A and NC_006127.2:g.13876A>G) were constructed, and the associations of diplotypes with reproduction traits were assessed, their effects on gene expression were evaluated also. As a result, three hap...

Tahseen Ullah* and Noor ul Amin

In Vitro Antibacterial Activity of Medicinal Plant Extracts

Muhammad Zamin1*, Anees Muhammad1, Ibadullah Jan1, Hidayat Ullah1, Shahen Shah2, Muhammad Amin3 and Haroon Ur Rashid4

Production of Tuberose (Polianthes tuberosa L.) as Affected by Bulb Size and Planting Medium
...n three type of planting media viz., M1(Sandy soil+ Compost; 3:1; v/v), M2 (Sandy soil+ Humic acid; 20:1; v/v) and M3 (Sandy soil + Potting soil; 3:1; v/v) in Randomized Complete Block Design (RCBD) with 3 replications. Significant differences were found in all the agronomic and floral characteristics of tuberose for both planting medium and bulb sizes. Tallest (43.08 cm) plants, maximum number of leaves plant-1 (22.17), florets spike-1 (22.79) and number of b...

Muhammad Zamin1*, Anees Muhammad1, Ibadullah Jan1, Hidayat Ullah1, Shahen Shah2, Muhammad Amin3 and Haroon Ur Rashid4

Production of Tuberose (Polianthes tuberosa L.) as Affected by Bulb Size and Planting Medium
...n three type of planting media viz., M1(Sandy soil+ Compost; 3:1; v/v), M2 (Sandy soil+ Humic acid; 20:1; v/v) and M3 (Sandy soil + Potting soil; 3:1; v/v) in Randomized Complete Block Design (RCBD) with 3 replications. Significant differences were found in all the agronomic and floral characteristics of tuberose for both planting medium and bulb sizes. Tallest (43.08 cm) plants, maximum number of leaves plant-1 (22.17), florets spike-1 (22.79) and number of b...

Md. Sahidur Rahman

Origin and Spillover of Coronaviruses: Prospects of One Health Action
...ay have acted as an intermediate host. Wild trade, ecotourism, destruction of wild habitat, and other anthropogenic activities disrupt the human-wildlife barrier which leads to the spillover process. In these circumstances, a One Health approach is crucial to implement multisectoral collaborative action among physicians, veterinarians, wildlife experts, epidemiologists, environmental scientists, and microbiologists to curb the COVID-19. One health encourages j...
Sher Bahadar Khan1, Mumtaz Ali Khan2,*, Hameed Ullah Khan3, Sher Ali Khan4, Shah Fahad5, Faheem Ahmad Khan6, Irshad Ahmad7, Nighat Nawaz8, Sidra Bibi9 and Muhammad Muneeb10
...ing enrichment and plate media followed by confirmation through multiplex PCR. Isolates were tested for 15 antibiotics using disc diffusion method followed by detection of their respective antimicrobial resistant genes. Overall prevalence of Campylobacter jejuni was 14% being higher in Peshawar division (21%) followed by Bannu division (16%), Malakand division (13%) and Hazara division (8%). Over all highest antibiotic resistance was found against AMX (...

Malik Abdul Rehman1*, Hafiz Muhammad Ehsan2, Tehseen Ashraf2, Zulfiqar Ali Gurmani3, Sajjad Khan3 and Mujahid Ali2

Effect of Growing Media on Plant Growth of Rough Lemon (Citrus jambhiri Lush.) and Poncirus (Citrus trifoliata)
...the influence of growing media (peat mass, compost, soil, silt, sand, sawdust and leaf manure) in 14 different combinations of growth media to check for plant growth of rough lemon and poncirus rootstocks. Five plants per treatment were growing in black polythene bags filled with the required media using a Completely Randomized Design with three replications. Data of stem length stem diame...

Muhammad Yaseen1*, Muhammad Luqman1*, Zahoor Hussain2, Usman Saleem3, Asif Nawaz1, Tahir Munir Butt4 and Muhammad Umer Mehmood1

Assessment of Knowledge Level and Information Sources of Vegetable Growers regarding Tunnel Farming in District Sargodha
...tions of matric and intermediate, growing vegetables up to 5 acres, and depicting agriculture as the main source of income. Tomato, pepper, and cucumbers were the highest grown crops in the study area. Variables of site selection, land preparation, and sowing of seeds got a quite satisfactory response. Replantation of nursery and distance between plants and rows of plants were also answered quite satisfactorily. Farmers do not know how to overcome the increasi...

Taqi Raza1*, Sergio de Los Santos Villalobos2, Muhammad Shehzad3, Shakeel Imran4 and Derly José Henriques da Silva5

PGP Characterization of Rhizobacteria Associated with Apple Gourd (Praecitrullus fistulosus L.)
...ly changing the color on media. While, in the case of enzyme production test, almost 90%, of isolated strains confirmed the amylase and pectinase production activities and 36% confirms the protease activities. Similarly, 82% and 45% of isolates confirmed the solubilization of zinc (Zn) and phosphorus (P) respectively. Almost, the entire isolated strains were given positive results for ammonia (NH4), nitrogen fixation, and indole acetic acid (IAA). Furthermore,...
Tehreem Zahra1, Muhammad Irfan1, Muhammad Nadeem2, Misbah Ghazanfar1, Qurratulain Ahmad3, Shaukat Ali4, Farzana Siddique5, Zarina Yasmeen6, Marcelo Franco7
...th optimum conditions of media containing 5% substrate concentration, 0.05% peptone and KH2PO concentration of 0.5% with pH 5.0 at incubation temperature of 30C. The model proposed was found significant. The cellulase produced could be potentially used in industries especially for b...
Muhammad Aamir Naseer1, Amjad Islam Aqib2*, Ambreen Ashar3Muhammad Ijaz Saleem1, Muhammad Shoaib4Muhammad Fakhar-e-Alam Kulyar1, Khurram Ashfaq1, Zeeshan Ahmad Bhutta1 and Shagufta Nighat5
...lates at resistant, intermediate, and sensitive cadre were noted against Vancomycin, Oxacillin, Amoxy clavulanate, and Linezolid. Same pattern was observed when tested against Oxytetracycline, Gentamicin, Cefotaxime, Fusidic acid, and Ampicillin. The study concluded hiked biofilm character in S. aureus with prevailing significant risk factors and heightened change in antimicrobial resistance by all isolates which demands immedia...
Neelam Pery1*, Fatima Ijaz1, Nayab Batool Rizvi1, Munawar Ali Munawar1 and Muhammad Imtiaz Shafiq2*
...ber of T-cell and B-cell mediated signaling pathways ranging from cytokine expression and antibody production to the bone resorption and cartilage destruction. We propose a dual trap to control this pathogenesis in the form of dual JAK3/BTK inhibitor. Using the computer-aided drug designing techniques, we developed dual JAK3 and BTK inhibitors based on quinoxaline derivatives which show appreciable dual inhibition in enzyme assays. To our knowledge, this is th...
Arifa Khan1*, Arsalan Bashir1, Shazia Erum2, Jabar Zaman Khan Khatak1 and Aish Muhammad3
Effects of 6-Benzylaminopurine and Indole-3-acetic Acid on Growth and Root Development of Banana Explants in Micropropagation
...d in vitro containing MS media and different BAP and IAA combinations. The results showed banana varieties exhibited differences for the shoot and root development and also for the number of shoots and leaves. Wiallium-8818 hybrid gave more shoots (7.33) when the concentration of BAP and IAA was 2.5 and 1 mg L-1, respectively. Alike, Wiallium-8818 hybrid produced the longest shoot (12.20 cm) with more leaves (6.23) at 1 mg L-1 of each BAP and IAA. But Pisang v...

Yuan Xing, Congming Tan, Yan Luo and Wenjun Liu* 

... immune and inflammatory mediators, qRT-PCR technique. Quercetin significantly (P<0.001) reduced IgE levels in the asthma mice serum. Inflammatory cells in the mice BALF are significantly reduced in a dose-dependent manner through quercetin. Quercetin (P<0.05) significantly reduced the level of TNF-α, IL-1β, IL-4 and IL-5 cytokines and increased the level of IFN-π in allergic asthma mice caused by OVA. In contrast, there was no significant ...
Ayesha Alam1,* and Labeeb Ali2
...itis A virus, are common mediators of the diseases in human beings. Including respiratory disorders, bronchiolitis, digestive tract disorders, pneumonia and conjunctivitis. Additionally, traces of COVID-19 were also found in sewage water sources in some countries like Italy bringing attention towards analysis of sewage water. Based on information from cited literature it is estimated that an individual handling sewage water have approximately 1% chance of beco...
Aamer Sharif1,*, Muftooh Ur Rehman Siddiqi1 and Riaz Muhammad2
...y (52.54%) is maximum at median rotational speed and median torque applied on shaft. Also water vortex height and output power decreased as torque increased on turbine shaft.
...

Inam Ul Haq1*, Humara Umar2, Naeem Akhtar3, Muhammad Azhar Iqbal2 and Muhammad Ijaz1

Techniques for Micropropagation of Olive (Olea europaea L.): A Systematic Review
...e micropropagation like; media preparation, culture establishment, shoot and root proliferation and acclimatization which would be applied for micropropagation of olives at Barani Agricultural Research Institute (BARI), Chakwal. Resultantly, olive expansion through micropropagation can be predicted in near future for sustainability of olive sector in Pakistan.

...

 Shuanping Zhao, Lei Xu, Hai Jin and Yutang Jia*

...gt;A belonged to an intermediate level of genetic diversity (0.25<PIC<0.5), and SNP g.2213C>G belonged to a low polymorphism level (PIC<0.25). LD (Linkage disequilibrium) analysis showed that SNP g.1694T>A and g.2213C>G had a strong linkage (r2>0.33), a total of four different haplotypes were constructed and the frequency of the main haplotypes AAG accounted for over 61.2 % of the total individuals. Association analysis indicate...
Ghazanfar Ali and Riffat-un-Nisa Awan*
...ic discipline along with mediating effect of CTD and CTS in the relationship between CTIPs and AA. A sample of 320 final year science students of BS programs, was selected from three selected universities and surveyed through a questionnaire. The results of data analyses revealed gender wise differences in perceived level of CTIPs, CTS and AA in favor of female students. Students of physics were found better in CTS and students of chemistry were found better i...
Eman Khalifa1*, Riad Khalil2 and Haitham Elaadli3
...ethoprim while were intermediate sensitive to both of erythromycin and norfloxacin but on the contrary were sensitive to amikacin; cefotaxime; clindamycin and streptomycin. It can be concluded that M. bovis can be the causative agent of mastitis in Egyptian Buffaloes and could be a potential risk for zoonotic transmission to man as well as economic losses. So, strict hygienic regulations and novel diagnostic tools should be used for prevention and detec...

Dilara Devranoglu, Ilksen Tavaci, Gonul Filoglu and Ozlem Bulbul*

...graded samples. The intermediate eye colors were predicted to be brown or inconclusive. The degradation by aging bloodstains or UVC exposure, is differently affected the prediction accuracy depending on the informativeness of the SNPs. This study showed that the prediction of the eye color is highly accurate for the blue and brown eye colored individuals. However, the IrisPlex prediction accuracy could be influenced by the old and degraded samples.

Muhammad Yaseen1, Xu Shiwei2, Yu Wen2, Muhammad Luqman1*, Raheel Saqib3, Muhammad Ameen4, Sadia Hassan5 and Tahir Munir Butt6

...ivate sector, electronic media, print media, and information communication technologies (ICTs) gadgets to get the latest information necessary for agricultural productivity. This study aimed to explore the patterns of farmers to access and receive information from different sources. A well-structured and expert reviewed interview schedule was used to collect data from farmers from Huailai county. A total of 122 interviews we...
Ahsan Numan1,4, Abdul Basit Qureshi2, Fehmeda Farrukh Khan3,Faisal Masud3,Ijaz Ahmad4, Kamran Ashraf5, Nisar Ahmad5, Muhammad Shahbaz Yousaf 4, Imtiaz Rabbani4, Hafsa Zaneb6 and Habib Rehman4*
... of four sensory nerves (median, ulnar, peroneal and sural) and four motor nerves (median, ulnar, peroneal and tibial) were measured. Results demonstrated significant differences in all electrophysiological attributes of motor nerves except tibial nerve of the DSP patients compared to DMT2 patients in the short duration group. Similar results were noticed for sensory nerves except ulnar nerve in DSP patients. For long durati...

 Amjad Ali1*, Pirzada Jamal Ahmad Siddiqui1, Naveed Ahmad2,Shabir Ali Amir3, Rafaqat Masroor3,Seema Shafique1 and Zaib-un-Nisa Burhan1

...via print and electronic media for a sustainable ecotourism. Further, to better understand the effects, regular monitoring monitoring and scientific research (environmental, biological parameters) is recommended.
...
Saira Batool1, Safdar Ali Shirazi1 and Syed Amer Mahmood2*
 
 
...ion), 16.51% in the intermediate range and 13.44% in highly eroded zones of the total Chakwal watershed area. Chakwal watershed is a rainfed and semi-arid with a drainage contributing area of 6524 km2. The RUSLE factors were calculated through vulnerable erosion zones remote sensing datasets demarcated by GIS. Computed soil erodibility, rainfall erodibilty, topographic-length-slope, crop management and conservation factor reveal interesting results ...

Syed Mazuan, Syed Mohamed, Insyirah Ishak, Dzolkhifli Omar and Norhayu Asib*

...ow rate, produced volume median diameter of 80μm, and achieved spraying productivity of 2.58 hectares’ land size (approximately 350 oil palms) per man day. The study was to evaluate the efficacy of chlorantraniliprole (Altacor® 34.9WG), Bacillus thuringiensis kurstaki (DiPel® ES), cypermethrin (Hextar Cyper 5.5EC), flubendiamide (Takumi® 20WG) and B. thuringiensis MPOB Bt-1 (Ecobac-1 EC). The insecticides application rate was based on the ...
Li Shengqing1,2,3, Zhang Xiyun2,3, Liu Shengcai2,3, Hu Guoyuan2, Fan Yuxia2,Liu Huaixin2, Wang Tingting2 and Zhang Yanming1*
...tic analyses. The lethal median dose (LD50) values of intragastrically and orally administred type D botulinum toxin in wild plateau pikas, plateau zokors, and Microtus fuscus are calculated through Horn’s method and the improved Karber method. The ability of the toxin to prevent and control rodent damage is assessed through plot experiments. The safety of type D botulinum toxin toward nontarget animals, such as yaks, Tibetan sheep, dog...
Muhammad Naveed1, Asif Nadeem1,2*, Maryam Javed1, Muhammad Fahad Bhutta3 and Ruqayya Bint Khalid1
...d factor (MGF), is a key mediator of signal transduction within mammary gland and uterine epithelial cells. It is a member of placental lactogen (PL) and interferon-tau (IFN-τ) signal pathway. It is also the main mediator of growth hormone. When cells encounter growth hormones and cytokines, STAT5A is activated to regulate gene transcription. STA5A has an important role in fertilization, embryonic survival and milk produ...
Arsalan Rasheed1, Tahir Usman2,*, Sadaf Niaz1, Irfan Khattak2, Saira Gul2, Nawab Ali1,Naimat Ullah Khan2, Hazrat Ali2, and Mian Saeed Sarwar2
...th variation in the intermediate host i.e. civet cats for Severe Acute Respiratory Syndrome, dromedary camel for Middle East Respiratory Syndrome and bat or pangolin for Severe Acute Respiratory Syndrome 2. Numerous well-known corona viruses are circulating in animals that have not yet infected humans, while previously identified viruses could only be the tip of the iceberg, possibly with more novel and severe zoonotic events unfolding. Coronaviruses can be co...
Saba Afzal1, Sohail Raza1,*, Masood Rabbani1, Sehrish Firyal2, Imran Altaf1 and Zahra Naeem1
...al inhibition assays and median tissue culture infectious dose (TCID50). The results showed that 2.5 µM concentration of the ivermectin is non-toxic to the Vero cells. At this concentration, PPRV titre was significantly reduced (p < 0.001) by two log to 103.0 TCID50/0.1 mL as compared to virus control 105.5 TCID50/0.1 mL. Moreover, the ivermectin exposure after the viral attachment and entr...
Md. Alal Hossen1, Mohammad Amzad Hossain1*, A.K.M. Munzurul Hasan1,2, Bipresh Das1, Sohel Mian1, Mohammed Mahbub Iqbal1
 
...as firmly adhesive and immediately after spawning the average diameter of fertilized eggs were 0.48±0.01 mm. After fertilization, the first cleavage stage of M. gulio occurred within 40 min. The distinctiveness of blastomeres was progressively dropped and morula, blastula, and gastrula stages were found at 3:40 h, 4:20 h and 5:00 h, respectively after fertilization. The larvae-initiated hatching at around 21:00 h after fertilization and total length of ...
Yawang Sun, Yongjiang Wu, Jingbo Chen, Zili Wang, Juncai Chen, You Yang and Guozhong Dong*
...e Fanconi Anemia pathway mediated genes for activating cellular DNA repair pathway alleviated DNA damage at high LPS levels.
...

Muhammad Shakil Ahmad1*, Muhammad Afzal1, Sylvain Nafiba Ouedraogo2 and Muhammad Zeeshan Majeed1

...and Sante exhibited intermediate values. Minimum feeding preference and susceptibility to S. litura was shown by the native potato cultivars Faisalabad Red and Faisalabad White with minimum food consumption, larval weight gain, RGR, RCR and ECI values, and hence are recommended to indigenous potato growers for commercial cultivation in areas where S. litura threatens potato crop.

...

Amar Iqbal Saqib, Khalil Ahmed*, Muhammad Khalid Bhatti, Ghulam Qadir, Muhammad Qaisar Nawaz, Muhammad Ashfaq Anjum, Abdul Rasul Naseem, Aftab Ahmad Sheikh and Belqees Akhter

...tudy was undertaken to remediate hazardous effects of brackish water on rice-wheat crops through practicable and economical methods in two different textured soils. Treatments were: (A) Types of soils. 1) sandy loam, 2) clay loam, (B) Remedial strategies, 1). canal water, 2) saline-sodic tube well water (continuous), 3) three irrigations of tube well water and two of canal water in a cyclic manner (short cyclic use), 4) tube...

Ahmed A. Kheder

...verse-transcription loop-mediated isothermal amplification (RT-LAMP) assay which is one of the most promising molecular diagnostic techniques was applied. The amplified products were analyzed using amplification curves and electrophoresis. In this study SLRSV was characterized and detected with DAS-ELISA and molecular diagnostic techniques the obtained results concluded that the virus was varied due to locations, also all tested cultivars were susceptible to v...

Syed Muhammad Sulaiman, Nazir Ahmad and Nazir Ahmad Khan*

...collected samples were immediately weighed, and 10 plants were subsampled from each sample for morphological evaluation. Ten plants were weighed and separated into stem and leaves portion, subsequently weighed and analysed for dry matter (DM) content. The remaining samples were air dried, ground and analysed for chemical composition and in vitro digestibility (IVDMD) and in vitro gas production (IVGP). The results revealed large variability (P < 0.001) in D...

Fahrauk Faramayuda1,2*, Totik Sri Mariani3, Elfahmi1,4 and Sukrasno1

...enk and Hildebrandt (SH) media can proceed to the suspension culture stage because it showed brighter fluorescence spot than other callus and plant extracts, especially for rosmarinic acid. This research provides new information about secondary metabolites in callus derived from two varieties of O. aristatus on various growth media.

...
El-Dougdoug K.A.1, Sofy A.R.2, Rehab A. Dawoud3 and Korkar H.M.4
...t tips on
MS media containing high sucrose concentration at low temperature. Shoot tips and
subculture 1st of banana plantlets were preservedsuccessfully for 12 months on
storage MS medium supplemented with 40, 50, 60 and70 gL-1 at 10, 15 and 20ᴼC.
The highest survival percentage 100% with recorded with 40 and 50gm sucrose
concentrations at 10, 15 and 20°C while 70 gL-1at 20°C recorded the l...

Yasser F. Elnaker 1, Mohamed El-Tholoth 2, Sahar Saber 3, Amira A- Elsaid4, Mohamed A. Saad 3, Emad E. Younis 5

...ssively transferred cell mediated immunity in protection of calves against infection with LSDV.

...

Walaa Abd El-Fatah S. Metwally1, Ismail M. Reda2, Ahmed A. El-Sanousi2, Mohamed Abd El-Khalek Ali2

... results of testing cell mediated immunity revealed that the prepared vaccines containing 350 HAU/dose induced significant high lymphocyte cells followed by 256 HAU/dose followed by 100 HAU/dose. The challenge test revealed that the prepared vaccine in the ratio of 30% Chicken strain of AI plus 70% Duck strain of AI containing 350, 256 and 100 HA unit/dose showed protection reached to 85%, 80% and 30% respectively. In conclusion, the study highlight the add va...

1Mona A. El-Manzalawy, 2Abeer A. Boseila , 3Hanan M. El Zahed

...ut gel vaccine show intermediate level of antibodies. Moreover, the values of ED50 of the developed vaccines as well as the Alum vaccine alone were not exceed 0.02 which lies within the permissible level.

...

Radwa M. Shafie 1 and Soha S. M. Mostafa2

...oculated algal synthetic media were used as control. Findings revealed that the mixture of the three algal filtrates gave the highest percentages of inhibition. Lower inhibition effect was produced by culture filtrate of N. muscorum and S. platensis, respectively in particular in plants treated with algal filtrates by mixed with virus inoculum immediately before inoculation. Spraying plants with the algal filtrates 24 hrs. b...
Huda S. Darwish 1, Om-hashem M. El-Banna2, Mohamed S. Abbas3, Hoda M. Waziri 1, Maisa A. Awad1
...iv>into a tissue culture media, induced plants were checked for resistance to ToRSV by ELISA. ISSR
reaction was used to confirm the DNA variations.
Results: ToRSV was transmitted mechanically into11 plant species and cvs., belonging to 6 families
while 3 plant species and cvs. from 2 families gave negative results with DAS-ELISA and were
symptomless. Treated plant with different concentrations of NaN3and EMS show...

Tahsin S. Shoala1, Ahmed K. El-Attar2, Ahmed I. Abd El Maksoud3

...d in Murashige and Skoog media (MS media). Four weeks later, potato plants were
tested for PLRV using RT-PCR technique, and all of the plants were PLRV positive. MS
media were prepared, autoclaved, and active natural materials (Glycyrrhizic acid ammonium
salt (GAS), Glycyrrhizic Acid (GA), Curcumin (CU) and Rosmarinic Acid (RA) were
sterilize...

Nadeem Anwar1, Muhammad Luqman2*, Shaoib Nasir3, Moazzam Sabir1, Hafiz Bashir Ahmad4 and Saleem Ashraf5

...d about the role of intermediaries and termed these intermediaries as profit-making group indenting the share of farmers. The Harvesting behavior of the farmers is significantly affected by the area under citrus cultivation. The results also indicated that product marketing and harvesting behavior of citrus growers is positively associated with a unit increase in area under citrus cultivation. The analysis of Socio-economic ...
Maimoona Imran1,2, Soumble Zulfiqar2, Hafsa Saeed2 and Farah Rauf Shakoori1*
... all kinds of life. Bioremediation is considered as the best possible solution among the existing ones to reduce this kind of pollution. In the current study, copper resistant Klebsiella pneumoniae strains KW and CC were investigated for their bioremediation potential. Maximum uptake of Cu++ by mid log phase cultures of KW and CC was 19.26 and 28.77µg per mg cell dry weight, respectively. The strains ...
Kai Jin1,2,3, Chen Chen 1,2,3, Xinyu Sun1,2,3, Caiye Zhu1,2,3, Mahmoud F. Ahmed1,2,3,4, Qisheng Zuo1,2,3, Jiuzhou Song4 and Bichun Li1,2,3*
...ransgenic goats by sperm-mediated gene transfer (SMGT). The expression of SCD1 gene and fatty acid metabolism genes in goat mammary gland tissues and muscular tissues was aligned with GEO database, and tested by qRT-PCR. F1 transgenic mice were mated and then the target genes and protein expression level in F2 transgenic mice, as well as fat content in F1 and F2 transgenic mice muscle were examined. Successful...
Aftab Raza Khan1, Azhar Abbas Khan2*, Javed Iqbal3, Arif Muhammad Khan4, Zeshan Hassan2, Hafiz Muhammad Aatif2 and Umbreen Shahzad2
...font-size: small;">Human-mediated wildlife reshuffling has raised concerns over the conservation of insects and predatory birds. Globally the population of grey francolin Francolinus pondicerianus is the Least Concern in the Red List of Endangered Species of Fauna and Flora of the International Union for Conservation of Nature (IUCN). However, its population has been significantly reduced in the desert ecosystem of Bhakkar (Punjab) Pakistan. The study w...
Iram Liaqat1,*, Safdar Ali Mirza2, Sumera Sajjad3, Shaukat Ali1,*, Muhammad Faiz Qamar4 and Ikram Ul Haq5
...xhibit biofilm formation mediated by flagellum-mediated motility. Type III protein secretion systems of several gram-negative bacterial pathogens use flagella to invade foreign surfaces, host tissues and substrates. Flagellar biosynthesis and function in Salmonella typhimurium isregulated by >50 genes. Bioinformatics analysis of flagellar assembly in S. typhimurium identified several conserved structural ele...

Khaliq Dad1, Muhammad Nawaz2*, Muhamamd Ibrahim3, Fengliang Zhao4, Rumsha Hassan2, Humaira Nawaz5, Muhammad Usman Saleem6, Kinat Javed2, Ayesha Komal2 and Hajra Naz2

... toxicity such as phytoremediation phytostabilisation, rhizofilteration, phytoextraction. This review paper has summarized the impact of Cd on soil, plants and humans and strategies to remove or minimize its toxicity by applying some low cost and environmental friendly techniques. 

...
Ayman Balla Mustafa1, Abdalla Elgenaidi1, Aldukali Alkeskas1, Asim Faraz2,*, Ahmed Eisa Elhag3, Mohanad Bashari4 and Bernard Faye5
...e-camels were selected immediately after calving and assigned to two equal groups, early lactation (GY) and mid lactation (GD). Both groups were managed together at the same environmental conditions under intensive system. Collection of milk samples started at second week postpartum and continued biweekly interval up to end of 4th month postpartum. The total fat, protein, lactose, solid non-fat (SNF) and density percentages were determined by automa...
Aqsa Shahid1, Saima Muzammil1, Farhan Rasheed2,Bilal Aslam1, Muhammad Akhtar Ali3, Syed Zohaib Haider4, Masroor Ellahi Babar4, Muhammad Saeed1, Umair Waqas1 and Mohsin Khurshid1,*
Amjed Ali1, Muhammad Tayyab1,*, Sehrish Firyal1, Abu Saeed Hashmi2, Asif Nadeem3, Shagufta Saeed1, Ali Raza Awan1 and Muhammad Wasim1
...β-lactamase from Hi-media kit available in the market. The β-lactamase from current study was found suitable for its use as positive control in antibiotic susceptibility testing and this enzyme will be utilized for the development of antibiotic susceptibility testing kit at domestic level in near future.
...

Shahid Hameed Khan Khalil1, Adnan Shakeel1, Ghani Akbar1, Muhammad Asif2, Ashraf Khan3* and Zafar Islam1

... treatments through bioremediation. Four irrigation treatments were applied by using potable and wastewater in different ratios. These treatments were T1, T2, T3 and T4 (100% treated wastewater, 66% treated wastewater and 34% potable water, 34% treated wastewater and 66% potable water and 100% potable water respectively). In treatment T1, the highest yields and crop water productivities of capsicum were 46.43 tons/ha and 9.43 Kg/m3 in 2017 while 46.56 tons/ha ...

Ayesha Gul1, Mohammad Sayyar Khan1*, Mazhar Ullah1 and Iqbal Munir3

...e calli were grown on MS media and were then transferred to different PEG concentrations (0%, 2.5%, 5% and 7.5%). Data was taken after 30 and 60 days of treatment. Relative growth of call showed significant decrease after 30 and 60 days. Control had maximum relative growth (3.33), while calli on 7.5% PEG showed the least growth rate i.e 1.33. Similarly, non-stressed control calli had higher water content i.e. (20%) while 7.5% stressed calli showed lowest water...

Hasnain Raza1*, Maryam Maqsood2, Muhammad Muzamil Nazir1, Iqra Tariq1, Kaynat Ahmed1, Qurat-ul-Ain1, Ali Raza2, Huda Bilal3, Muhammad Bilal Shoukat1, Attiq ur Rehman1, Awais Rasheed1 and Muhammad Zeshan Gulzar1

...s can be used for phytoremediation, which acts as a natural sink for toxins. The present paper aims to provide a brief discussion on wastewater health risks, CWs, and its phytoremediation attributes as a plant-based cleanup solution for wastewater remediation.

...

Hamida Bibi1*, Dave Rraffaelli2 and Muhammad Sharif1

...water quality while intermediate quality sites were highly variable in modality and there is no consistency between the number of modes, ASPT and Biological Monitoring Working Party (BMWP) score. If anything, the negative relationship has been revealed between water quality (BMWP score and ASPT) and the number of modes and this negative correlation was significant R2 = 0.5072, p <0.05.

...

Mahmoud M.A.Youssef and Wafaa M. A. El-Nagdi

...justify;">The artificial mediated abiotic components such as soil temperature, dry heat, irradiation and CO2 can work for controlling plant-parasitic nematodes. Higher soil temperatures with transparent or black plastic cover reduced citrus nematode, Tylenchulus semipenetrans on navel orange and reniform nematode, Rotylenchulus reniformis on sunflower. Also, dry heat was used to control rice root nematode, Hirschmanniella oryzae on rice soil and root and wheat...

Thomby Paul, Sreekanta Biswas, Sabiha Zarin Tasnim Bristi, Debashish Sarker, Saroj Kumar Yadav and Bhajan Chandra Das*

...tension band wire, and immediate radiographs were taken to confirm the position of implants. On 30th day of post-surgical observation, mediolateral radiograph revealed migration of implants but callus formation was observed between the fracture ends of olecranon in order that the implants were removed. On 45th day of clinical observation, the dog showed good weight-bearing in right forelimb and walked normally.

...
Abdul Sattar*, Hasan Orooj and Muhammad Iqbal Afridi
...es less as compared to immediate surroundings, as Rawalpindi and rural Islamabad do not prepare high risk mapping during the window period.
...
Abdul Sattar*, Hasan Orooj and Muhammad Iqbal Afridi
...es less as compared to immediate surroundings, as Rawalpindi and rural Islamabad do not prepare high risk mapping during the window period.
...

Mazhar Ullah and Mohammad Sayyar Khan*

...5) amongst the callusing media (CM). Maximum callus induction (48.55%) was achieved on CM-2 augmented with 2.5 mg L-1 2,4-D and 4% sucrose. All the carbon sources at 4% concentration in CM-2 showed maximum callus induction. However, the best results were shown by sucrose with 50.33% callus induction. Significant differences (P ≤ 0.05) were observed amongst the different shooting media (SM). Maximum regeneration (72.06%) w...

Syeda Shazia Bokhari, Aisha Waheed Qurashi*, Roheela Yasmeen*, Fouzia Yasmeen, Nabeela Nayab, Uzma Rafi

....0, temperature 37oC, LB media and shaking 160 rpm conditions. Cell surface characteristics of E. auranticum (EPF1) was determined in terms of bacterial cell surface hydrophobicity and auto-aggregation assay. Highest percentage hydrophobicity values of the strain EPF1 were recorded with toluene (84 %) as compared to other organic solvents such as chloroform (58 %) and xylene (63%). Auto-aggregation response of E. auranticum EPF1 was highest at fifth hour of cu...
Syed Sikandar Habib1*, Saira Naz2, Sadia Nawaz1, Iqra Ameer1, Ameer Khatoon1, Hameed Ur Rehman3, Sahibzada Muhammad Jawad4 and Haider Ali5
...and blood sampling was immediately drawn from caudal peduncle by syringe and added in EDTA containing vial and shake well for proper mixing. Vials stored in ice containing boxes and carried to laboratory for total complete blood count. The water parameter was analyzed in laboratory by taking the sample of water and some (Temperature, DO) was measured in situ. Results of hematological analysis revealed that there is no significant (P > 0.05) difference in pa...
Stefan Pratama Chandra1, Yoanes Maria Vianney1, Theresia Liliani Christie2, Merlyn Wongso2, Melisa Widjaja2, Deok-Chun Yang3, Se Chan Kang4, Manar Fayiz Mousa Atoum5,6 and Johan Sukweenadhi1*
...noculum grown in 13 L of media using formulation B and incubation at 21°C to 25 °C. In the long-term, KUH Lab aims to produce P. ginseng on an industrial scale to sufficiently supply the demands for P. ginseng in the country. Furthermore, this laboratory also intends to make standardized Indonesian herbal materials by using plant tissue culture.
...

Tamoor Ali1*, Muhammad Hamid Bashir1, Bilal Saeed Khan1, Abdul Ghaffar2, Danish Riaz3, Muhammad Zia ul Haq1, Shoaib Nawaz1, Aneeb Ali1, Iftikhar ul Hassan1, Ikram Ul Haq4, Muhammad Khuram Shahzad1, Usama Saleem5 and Tamsila Nazir2

...th the whitefly and intermediate with the thrips population while with the jassid it exhibited positive correlation. Sucking pests also had an influence on the yield factor.

...

Keiven Mark B. Ampode1*, Federico C. Mendoza2 

...wth performance and cell-mediated immunity of broiler chickens. A total of sixty-day-old Cobb-broiler chickens were used in the study and arranged in a Completely Randomized Design experimental set-up with four dietary treatments. Each treatment was replicated three times, having five birds in every replication. The experimental rations containing graded levels of OP (0%, 1%, 3%, and 5%) were formulated and fed ad libitum in 42 days feeding trial. The results ...

Ziyue Qin1, Ali Mujtaba Shah2, 3, Qing Zhu1, Yan Wang1, Diyan Li1, Gang Shu4, Yaofu Tian1 and Xiaoling Zhao1*

...th group was increased immediately after being treated with glucose and reached peaks at 20 min, then recovered to the normal at 60 min. Birds treated with glucose had greater blood glucose concentration and area under the curve (AUC) in SG than those of FG (P > 0.05). Administration of insulin at 40 and 60 µg/kg BW dramatically decreased blood glucose level in FG but didn’t affect SG. And at 40 µg/kg BW insulin administration, FG had lowe...

Mohamed S. Hussein1*, Hanan A. Fahmy2, Ashraf A. Abd El Tawab3 

...hen screened for plasmid-mediated quinolone resistance (PMQR) genes qnrA, qnrB, qnrS, qepA and aac(6′)-Ib-cr by PCR. The results revealed that 22 isolates (91.7%) harboured at least one PMQR gene, with qnrS being the most frequent (83.3%). The qepA, qnrB and aa (6′)-Ib-cr genes occurrence was 54.2%, 16.7% and 4.2% respectively, while qnrA was not detected in any isolate. The high prevalence of fluoroquinolones resistance, and transferable fluoroqui...

Syukriah Syukriah1, Ulinnuha Nur Faizah2, Hendry T.S. Saragih3*, Rizki Fitrawan Yuneldi4, Soenarwan Hery Poerwanto5, Raden Roro Upiek Ngesti Wibawaning Astuti5, Stephan Immenschuh6 

...nces in oxidative stress-mediated effects in pregnant and offspring mice in Plasmodium berghei infection. A Complete randomized design was used in this study, in which 25 mice were divided into five groups. Group 1 as a control group, consisted of non-pregnant and Plasmodium-uninfected mice, group 2 comprised pregnant and uninfected mice, group 3 to 5 were pregnant mice and were infected with 1 x 101iRBCs, 1 x 102 iRBCs, and 1 x 103 iRBCs respectively. On the ...

Sharjeel Saif1, Asghar Ali Kamboh1*, Ghulam Mustafa Solangi2, Rehana Burriro3, Hasina Baloch1, Atta Muhammad Memon2  

...pneumonia like organism) media and were found negative for Mycoplasma spp. The prevalence of mycoplasma mastitis in this population of dairy buffaloes was recorded <0.23%. The study results suggested that the mycoplasma mastitis did not exist in buffaloes of study area, however, further studies using molecular tools are warranted to validate these findings.

Keywords | Dairy buffalo, M. bovis, Mastitis, Mycoplasma, Survey 

...

Semra Okur Gumusova1, Gul Fatma Yarim2, Cuneyt Tamer1,*, Ayris Salt2 and Gokhan Inat3

...oculated in RTG-2. Then, media of IPNV infected cell and media of negative control were collected (n=3) for each incubation time (0, 8, 24, 48, 72 and 96 h) and superoxide dismutase (SOD), glutathione peroxidase (GPx) activities and malondialdehyde (MDA) concentrations were measured by the spectrophotometric methods. Data obtained revealed higher MDA levels in IPNV infected cells than negative control medium (p<0.001). Ho...
Zhan-Zhong Liu1, Chun-Ying Wang1, Jian-Ye Yang2, Qing-Hua Liu3,4, Xiao Zhang3* and Liang Wang3,4*
...ast region of China. The median age of the patients is 42-year-old and 45.57% are male; 25 cases (31.65%) are imported. 23 cases (29.11%) were confirmed between January 26 to 31, 2020 while 56 cases (70.89%) were from February 1 to 16, 2020. Among the ten administrative divisions of Xuzhou city, Suining county (n=31) and Pizhou City (n=15) have the most cases while Tongshan district has none. A representative familial cluster with 6 cases was analyzed in detai...

Guo-dong Zhao1,2*, He-ying Qian1,2, Yi-ling Zhang1,2, Gang Li1, 2, Jian Tang1, 2 and An-ying Xu1,2*

...ody is an important intermediate metabolic tissue, which is involved in detoxification in insects. In this study, high-throughput transcriptome sequencing was performed to investigate the gene expression differences between two silkworm strains with different susceptibility after exposure to fenvalerate. The results showed that a total of 2363 differentially expressed genes were detected in the Lan5 DGE library and 1611 were detected in the Mysore DGE library,...
Bambang Yudi Ariadi1*, Rahayu Relawati1, Barbara Szymoniuk2 and Waris Ali Khan3
...ne survey through social media. Questionnaires were filled by 95 respondents who met the requirements. Data were analyzed using the partial least square–structural equation modeling (PLS-SEM) model. The results revealed that product, psychography, and demography influence the purchase of organic vegetables. Furthermore, product and demography also influence the WTP of organic vegetables. All product attributes positively correlate with product variables,...
Syarif Husen1*, Devi Dwi Siskawardani2, Setiawan Deny Rexmardi1, Erny Ishartati1, Muhidin Muhidin1, Jumpen Onthong3 and Ivar Zekker4
...igatestheeffectof growingmediacompositiononthepropagationofstemcuttingpotato(G0)plantedinthe screenhouse.ConductedinSumberBrantasVillage(1700ma.s.l.),BumiajiRegency,City ofBatu,EastJava,Indonesia,thisresearchutilizedRandomizedCompleteBlockDesign withsevengrowingmediacompositionsandfourreplicatesinamicro-cuttingplanting.The growingmixmediacompositioncontainedhuskcharcoal+cocopeat+bokashi(go...

Amreen Zahra1, Mushtaq A. Saleem1*, Hasnain Javed2 and Muhammad Azmat Ullah Khan3

...ts strongly support an immediate investigation of multiple viral infections routine IDUs to guide the eradication of these fatal viral diseases.

...

Ikele*, Chika Bright, Ujunwa Aghaji, Mgbenka, Benard Obialo 

...a present in the biofloc media were higher in CA 20:1 with a significantly peak value of 390X104 cfu/ml compared to other groups. The C:N at 10 and 20 utilizing cassava and wheat supported growth of C. gariepinus with a mean weight gain of 214.91±26.84g, specific growth rate 3.78±0.26 but did not enhance the condition factor >1 of C. gariepinus juveniles within 28-days. In conclusion, inclusion of C:N ratio of cassava and wheat flour in biofl...

Abdelrahman A. Abdelrahman1, Salama A. S. Shany1, Kareem E. Hassan1, Mansy A. A. Dardeer2, Ali A.1*, Magdy F. El-Kady1* 

... were cultivated on PPLO media and detected under stereo-microscope for fried egg colonies. Forty-three samples were detected as Mycoplasma spp., using PCR for species identification, MG, MS, and Untyped strains, with a high prevalence of MG (27.9%) and lowest for MS (8.8%). An rRT-PCR used for detection of AIV-H9N2 and IBV showed high prevalence for IBV (88.2%) and AIV-H9N2 (52.9%), the highest rates of co-infection were MG-H9N2-IBV, Mycoplasma other than M...

Soliman Mohammed Soliman1*, Mohsen Mahmoud Shoukry2, Ahmed Mohammed El-Okazy1, Ahmed Mahmoud El-Morsy1, Mahmoud Mohammed Soliman1

...marked decrease in the immediately degradable fraction (a), the potential fraction degradation (b), and a lower rate of degradation. Diets containing SBM treated with 200 or 250 gm of PP reduced in vitro gas production, methane production, and TVFA and ammonia concentrations without effect on physiological rumen activity. Moreover, milk yield and milk composition were not affected. However, the concentration of milk urea nitrogen (MUN) was significantly decrea...

Asaad A. Fares1*, Mohamed M. Ghanem2, Yasein M. Abd El-Raof2, Hossam M. El-Attar2, Ameer A. Megahed2, Heba M. El-Khaiat2

...in serum Ca before and immediately after parturition, which is caused by rapid transport of large amounts of Ca into the mammary gland related to colostrgenesis. Blood and mid-stream urine samples were collected from 24 cows fed on DCAD ration and 24 cows fed on non DCAD ration daily starting 24h before calving (-1day), the day of parturition (0day), one day after parturition (+1), and second day after parturition (+ 2). Feeding DCAD ration lead to decreased u...

Noor Muhammad Khan1,2, Tariq Mahmood Khalil1,3*, Rashid Rehan2 and Iftikhar Zeb4

...al Estate and the phytoremediation capabilities of two locally available plant species Arundo donax (A.d) and Typha latifolia (T.l) for removing HM from the untreated wastewater of Hayatabad Peshawar used for irrigation downstream. The wastewater analysis showed that HM concentration exceeds the limits of thresholds values. For phytoremediation the T.l was tested in both on-site (in-situ) and laboratory conditions (ex-situ) ...

Zunaira Fatima Syeda1*, Ahafaque Ahmad Shah2, Farrah Deeba3 and Farheen Malik1

...ample of the study. Mean median, mode and range were calculated to describe the data. The difference between the levels of competence was measured with the help of independent sample t-test. The same was applied on gender and group to observe the difference. The relationship between generic competence and students’ grades was found with the help of Pearson correlation. The impact of generic competence and students’ grades was observed with the help...

Ahmad Ali1, Zaib Ullah2, Muhammad Javaid Asad1*, Muhammad Rafi3, Muhammad Maqsood4 and Sajid Mahmood5,6

Sri Melia1*, Indri Juliyarsi1, Yulianti Fitri Kurnia1, Evy Rossi2, Hurriya Alzahra3

...stance to 0.3% bile salt media, and antimicrobial activity against Escherichia coli: O157, Pseudomonas, Listeria inokua, and Klebsiella pneumonia; and (3) Molecular identification of LAB by analysis of the base sequence of the 16S RNA gene. The whey for this study was collected in Lasi Farm in Agam Regency, West Sumatra, Indonesia. The data was subsequently subJected to descriptive analysis. The bacteria obtained were rod-shaped that were catalase negative and...
M. Fatmawati1, L.T. Suwanti2*, Mufasirin3
... the cat, while the intermediate hosts are all mammals. Livestock become infected by ingesting sporulated oocysts in the environment, while humans can be infected by T. gondii due to environmental contamination by T. gondii oocysts, consumption of foods and milk containing cysts or tachyzoites of T. gondii. Raw milk is a risk factor for toxoplasmosis in humans. This paper discusses the presence of T. gondii in raw milk from various animals in both artificial a...

Yuxia Zhang and Kong Yang*

...on and abundance of intermediate hosts. A structural equation model was produced to demonstrate the effects of habitat factors on the distribution and abundance of intermediate hosts of E. multilocularis. Plateau pika (Ochotona curzoniae) act as the main intermediate hosts of E. multilocularis, whose effective cave density was 0.03/m2 to 0.32/m2, and it was negatively correlated with altit...

Khalid Javed Iqbal1, Irfan Baboo2*, Arshad Javid3, Noor Khan4, Hamid Majeed5, Azra Anwer1, Zahid Farooq2, Muhammad Altaf6 and Moazam Jalees7

...s EDTA and transferred immediately to the laboratory for the assessment of their blood profile. There was recorded no mortality after 96h of exposure period. IONPs significantly affected the counts of WBCs, Hb, MCH and MCHC of experimental and control groups. The analysis of blood profile demonstrated that haematological parameters; the number of WBCs and Hb were increased in T1 and decreased in T2 in relation to T0. The counts of RBCs, HCT, MCV and PLT were f...

Khaliq Dad1, Fenliang Zhao2, Rumsha Hassan3, Kainat Javed3, Humaira Nawaz4, Muhammad Usman Saleem5, Tahreem Fatima6 and Muhamad Nawaz3*

Rida Haroon Durrani1, Ali Ahmad Sheikh1*, Masood Rabbani1, Muti-ur-Rehman Khan2, Aneela Zameer Durrani3, Salman Ashraf1, Muhammad Anas Naeem1, Muhammad Usman3 and Tauqeer Mahmood4
...treatment group. As an immediate intervention, the oral delivery reduced bacterial count to log100.86 and log101.02 on the 3rd dpc. Phage-cocktail is promising pre-harvest biocontrol approach to curtail host-adaptive antibiotic resistant Salmonella. 

...

Hairul Islam M. Ibrahim1,2, Abdalla A. Sayed1,3, Abdel Naser A. Ahmed4,5 and Emad A. Ahmed*1,6

...e levels of inflammatory mediators and TGF-β in splenic cells. The production of myelin basic protein (MBP) increased in PCB treated EAE mice. Taken together, the current finding revealed that, PCB suppressed EAE pathological checkpoints for demyelination and apoptosis in CNS and act as a therapeutic role for treatment of MS in upcoming prospects.
...

Auzair Javaid Butt, Irfan Ullah*, Shahid Ali, Khurram Nawaz Saddozai and Jahangir Khan

...imizing the role of intermediaries which will help farmers to generate more profit.

...

Tarek A. Wrshana1, Yousry A. Dowidar1, Bahgat A. El-Fiky2, Ali M. El-Rify1, Walaa A. El-Sayed3, Basem M. Ahmed4* 

...immunotherapy where MSCs media could be used for the treatment of vNDV in infected flocks.

Keywords | Newcastle Disease Virus (NDV), mesenchymal stem cells (MSCs), IFN-γ, IL-2, IL-6, IL-12. 

...

Nuraini Nuraini*, Yuliaty Shafan Nur, Ade Djulardi, Robi Amizar, Yesi Chwenta Sari

...te and tofu dregs growth media on nutrient content and determine the Tmc effect in the diet on the production of laying quail. The study was divided into two stages of research. Phase 1 of the laboratory experiment determined the composition of the concentrate and tofu dregs media on the nutrient content of Tenebrio molitor. This study method was a completely randomized design (CRD) with six treatments and three replications...

Razaq Adekunle Animashahun1*, Gbenga Emmanuel Onibi2, Samuel Olanrewaju Aro2, Oghenerobor Benjamin Akpor3, Funmilayo Abimbola Okeniyi1, Olayinka Olubunmi Alabi1, Michael Babatunde Falana1, Ayoola John Shoyombo1, Samuel Oyewale Olawoye1 

...ed that the fermentation media and the fermentation period significantly (P < 0.05) affected the nutritional and anti-nutritional components of the cassava stumps, as there was better enhancement of the by-product at higher fermentation period. The highest crude protein (CP), ether extract (EE), ash, and lowest crude fiber (CF) in fermented cassava stumps were obtained at 192 hours of fermentation with the following values CP 7.45%, EE 9.81% and ash 7.01%. ...

Waqas Raza1*, Muhammad Usman Ghazanfar1, Muhammad Asif2, Ikram-ul-Haq3, Muhammad Zakria4 and Laith Khalil Tawfeeq Al-Ani5,6

...cteristics, on different media. The phenotypic characteristic of the isolates were observed as fluffy cottony growth with striated pattern. The average length of sporangia among the isolates collected during 2017 from potato growing areas of Punjab ranged from 14.94 to 47.89 µm, and mean breadth of sporangia varied from 10.44 0 to 23.67 µm. During 2018, among all districts, isolate Jhg-22 showed the highest length (46.64 μm) and breadth (22.17 &...

Reem M. Ramadan1, Fady Sayed Youssef2, Gehad Genidy Mohamed3, Sameh Hamed Ismail4, M.M. El-Bahy1, Shimaa Abdel-Radi1* 

...stability in the aqueous media. The coccidiocidal efficacy of the C-Oo.Nc was evaluated versus five chicken Eimeria species oocysts. The immature oocysts were exposed to 5, 10, 20, and 40 ppm, each for 1, 3, 6, 9, 12, 24, and 36 h. Percentage of sporulation inhibition in oocysts and comet assay were used to investigate the C-Oo.Nc destructive effects. The infectivity of sporulated oocysts exposed to LC50 & LC90 were evaluated by In vivo inoculation of broi...

Sadaf Ansari1, Shahid Hussain Abro1, Abdul Jabbar Tanweer2, Abdullah Sethar3, Ghulam Abbas4, Sabahat Ansari1, Asghar Ali Kamboh1* 

...nd cultured on different media for isolation of bacterial species. The isolated species were identified by different biochemical tests. The results showed that the contamination of bacterial organisms in both raw and cooked meat was highest in beef followed by mutton and fish respectively (p < 0.05). In raw meat, bacterial species recorded were Escherichia coli (45%, 30% and 25%), Salmonella enteritidis (20%, 17.5% and 15%), Staphylococcus aureus (30%, 25% ...

Ahmad Nadeem1,2 and Rubina Arshad1,2,*

...medium and non-selective media were used for isolation of LAB from plant cuttings. A total of seven isolates were isolated on the basis of colony morphology on De Man Rogosa Sharpe (MRS) agar plates, Gram staining, biochemical tests and molecular characterization. The co-culturing of LAB isolates with fungal cultures (in vitro) showed that among seven LAB isolates, only three possessed antifungal activity. One promising wild type isolate (LPA6) was subjected t...

Hamenya Mpemba1, Fan Yang1, Kirsty J. MacLeod2,3, Dusu Wen1, Yan Liu1,4 and Guangshun Jiang1,*

...or behaviours are likely mediated by the presence of predator cues in the environment. Here, we test how different predator cues (visual and odor) from familiar and novel predators (brown bear and Amur tiger, respectively) influence ungulate, mesopredator, and top predator visitation rates to camera trap sites in a national nature reserve in China. The comparison of these predator types is of particular interest in this region as Amur tigers may shortly be rei...

Murad Ali Rahat1*, Muhammad Israr2, Hakim Khan1, Ishtiaq Hassan1, Mohammad Islam1 and Muzafar Shah3

...ict blue, brown and intermediate human eye color from DNA samples. To check the validity of IrisPlex system in the local Pakhtun population living in Shangla Valley of Pakistan, the current study was carried out. DNA samples as well as photographs were taken from total of 226 individuals. Exclusion and inclusion criteria were set for samples collection. The analysis showed that brown eye color individuals were greater in number than blue and inter

Ayma Aftab, Samia Afzal* and Muhammad Idrees

...hilar region adjacent to medial part of horizontal fissure on the 3rd day of manifestation of symptoms. Radiological studies showed early consolidation of COVID-19 whereas RT-PCR showed negative results. Chest CT imaging is a highly sensitive technique that has also been used in detection of corona virus. This case study emphasizes the importance of HRCT for early and confirm diagnosis of COVID-19 whereas RT-PCR results can vary. This process may show negative...

Anum Syyam1,2, Nazish Saqlain1, Sidra Hareem1, Naghmana Mazhar1, Liaqat Ali3 and Samia Afzal2*

... = 320 and females = 30, median age 27 years ± 6.4 SD). Estimation of IgM type anti-A and anti-B titers was done using the standard tube technique and the samples positive for hemolysis were further evaluated for titers of IgG type anti-A and anti-B. All the titers were confirmed microscopically. The total prevalence of IgG anti-A and anti-B hemolysins was 15.9%. The most frequently observed IgM anti-A and anti-B titers were 64 in 29.4% (n = 103) and 32...

Neni Widaningsih1,2*, Budi Hartono2, Hari Dwi Utami2, Eni Siti Rohaeni3 

....97). The marketing intermediary institutions that get the highest profit share are large traders.

Keywords | Livestock, Swamp Buffalo, Marketing, Margins 

...

Mochamad Rizal Umami1, Zainuri*2, Sebastiana Viphindrartin2 and Rafael Purtomo Somaji2

...OVID-19 pandemic (social media) has destroyed social capital between sugarcane farmers and partners (sugar factories) due to cheaper information costs borne by sugarcane farmers.

...

Abdurakhim E. Kuchboev1*, Mehmonjon Kh. Egamberdiyev2 

...strial mollusсs as intermediate hosts. In this study, eight species of land mollusсs from Uzbekistan were found to be positive larvae of protostrongylids. Based on the nucleotide sequence data, three species of nematode larvae Protostrongylus rufescens, Muellerius capillaris, and Cystocaulus ocreatus were identified. According to the morphological characteristics of the studied land mollusсs, the shell structure was identified as six different morphotypes. ...

Faisal Khurshid1*, Asad Ullah1 and Sana Manan2

...ions as the most popular media of agriculture innovations and way of acquiring information (P=0.009), mobile play vital role in the transfer of knowledge of agricultural innovations (P=0.001), information provided through mobile application are accurate about weather updates, market subsidies, fertilizers, etc. (P=0.014), and mobile application/information enabled direct interaction with agriculture experts in getting required knowledge about innovates (P=0.00...

Umar M. Bello1*, Samuel A. Ojo1, Abdurrahman Ghaji1, Ambrose A. Voh (Jr)2, Muazu N. Bappah3, Casmir O. Igbokwe4  

...al nucleated cells, intermediate cells, parabasal cells and leucocytes. Typically, the proestrus witnessed an increase in the proportion of anucleated superficial and superficial nucleated cells, with marked reduction in both intermediate and parabasal cells. Oestrous vaginal smear cells were highly cellular and consisted predominantly of superficial nucleated cells. Metestrus and Diestrus phases were markedly similar with...

M. Israr1, F. Shahina2† and K. Nasira2

...situated just behind the median bulb, anterior to nerve ring. Female have a short post vulval uterine sac extending 25-34% of vulva-anus distance. Also included is the first record of A. siddiqii Fortuner, 1970 from around the roots of carrot (Daucus carota L.), from Hasan Abdal, Punjab, Pakistan. Morphometric data of a known species A. bicaudatus (Imamura, 1931) Filipjev & Schuurmans Stekhoven, 1941 is also given.

...
A.M. El-Baha1, A. A. El-Sherbiny2†, M. Z. M. Salem1, N. Shaarawy3 and N. H. Mohamed3
... analysis results showed median
inhibitory concentration (IC50) values of 412.7 and 615.9 mg/l for C. citriodora and E. camaldulensis leaves EOs,
respectively. In addition, the lethal concentrations (LC) causing 50% J2 mortality (LC50) of C. citriodora and E.
camaldulensis oils were 235.9 and 327.7 mg/l, for C. citriodora and E. camaldulensis leaves EOs, respectively.
Essetial oils were analyzed by gas chromatogr...

M. Shahi-Bajestani† and E. Mahdikhani-Moghadam

...us, Ditylenchus apus, D. medians, Basiria gracilis, B. graminophila,
Aphelenchus isomerus, A. avenae, Boleodorus thylactus, Zygotylenchus guevarai, Pratylenchus thornei, P.
neglectus, Irantylenchus clavidorus, Neopsilenchus magnidens, Neopsilenchus paragracilis, Nothotylenchus
ferepolitor, Filenchus pratensis. Among these species Neopsilenchus paragracilis and Nothotylenchus ferepolitor
are new records in Iran.

Soshe Ahmed1*, Mst. Ishrat Zerin Moni1, Maksuda Begum2, Md. Jafar Eqbal3, Md. Shahidul Islam4, Mst. Samira Tanjim1, Mst. Rokeya Sultana1 

Kalsoom1, Nasir Shah2, Muhammad Ibrahim3*, Tahira Bibi1, Kazim Ali4 and Zahir Shah2

...Murashige and Skoog (MS) media subjected to (0, 25, 50, 75 and 100 mM) of Sodium Chloride (NaCl). Potato varieties showed an adverse in vitro growth response to all levels of salt in MS media, while plants of all the tested varieties were dead at concentrations more than 50 mM of NaCl in in vitro condition (75, 100 mM). Variation was observed in the level of tolerance to salinity in these potato varieties. Increasing NaCl (m...

Laveena Shekhawat, Sheethal S* 

...ich he failed to start immediately leading to recurrence of the parasitic hepatic cyst. Conclusion: Treatment is a combination of surgery and post-op anti-parasitic drugs. Delay in initiating albendazole therapy can lead to recurrence of the cysts in the same sites.

Keywords | Cystic ecchinococcosis, Ecchinococcus granulosus, Hepatic cyst, Parasitic cyst of liver, Liver parasite 

...
Chalothon Amporn1, Somchit Guntaprom1*, Sarawut Duongmawong1, Wilasinee Srisanyong1, Sirikanda Thanasuwan1, Phalita Koonnadilokpot1, Dechawut Bunyaluk2, Juggrid Jugsumrit3, Jakrit Yaeram4, Chompunut Lumsangkul5
...n vitro maturation (IVM) media. Experimentally, cumulus-oocyte complexes (COCs) which were obtained from bovine ovaries underwent culturing for a period of 22 h in TCM-199 containing an additional 10% fetal bovine serum, streptomycin (100 μg/ml), penicillin (100 U/ml), 25 μg/ml FSH, 2 IU/ml hCG, 0.2 mM sodium pyruvate, 1 μg/ml 17-β-Estradiol, and either 0, 100, or 200 μM/ml cysteine where 0 served as the control. IVF-TALP medium was used to fe...

Muhammad Adeel Qureshi1*, Raza Ahmad2, Bilal Ahmed1, Tanzim Ullah Khan1 and Muhammad Yasin3

...ypes of callus induction media (CIM) were used, i.e. CIM1 and CIM2 with concentrations of 2, 4-D 2mg/lit and 3 mg/lit respectively. Among the two different callus induction media (CIM), CIM1 with 2mg/lit auxin (2, 4-D) showed the best results. All the internodal explants placed on CIM1 produced 100% callus while CIM2 produced 70% callus. No callus was observed from leaves on CIM1 and CIM2. After callus induction, four differ...

Ayaz Ahmed1*, Muhammad Zulfiqar1 and Saadutullah Khan2

... through radio and other media. Forest department should design plan for management and sustainable extraction of NTFPs in study areas and also provide tools and trainings to local collectors.

...

J. Salma and F. Shahina

...lour, wheat flour, lipid media, corn flour and on assemblage culture on Galleria mellonella larva and lipid modified media for mas...

M. A. Radwan†, S. A. A. Farrag, M. M. Abu-Elamayem and N. S. Ahmed

...and ethoprop ranked intermediate in descending order by 95.06 % and 94.26 %; 81.99 % and 87.60 %; 78.73 % and 87.88 %, respectively. However, none of the nematicides tested significantly affected shoot length, fresh shoot weight and root length compared to the untreated inoculated control. Except oxamyl, all of these nematicides significantly decreased root fresh weight.

...

Salahud Din

...omprised the lateral and medial proximal, middle and distal phalanx. The first two phalanges were long bones. The shaft of the phalanx proximalis (P1) was thick proximally than distally and slightly arched. The phalanx media (P2) was shorter in length than the proximal. Its proximal articular surface was divided into two glenoid cavities “axial and abaxial’ by a dorsopalmar ridge. The phalanx distalis (P3) was tr...

Lihang Wang, Qiling Chen, Tingsheng Lu, Shudan Yao, Xingwei Pu and Chunshan Luo*

...was with MH or/and MPS immediately. Conduction of Basso-Beattie-Bresnahan (BBB) scores was on all rats at different time points after surgery. Subsequently harvest of the serum and the spinal cord tissues was behind euthanasia of rats. Detection of biochemical indicators, observation of cell apoptosis, and determination of Bax, Bcl-2, p38 MAPK and Smad2 were clarified. We found that MH and MH+MPS could effectively reduce apoptotic cells, dramatically minify TN...

Alsaied Alnaimy Habeeb*, Amaal M. Kamal, Mostafa Abbas A. Atta, Ahmed K. Sharaf  

...rabbits were employed, immediately following first parity. The young rabbits were left with their mothers for the first two days after kindling so they could nurse on colostrum. By adding or removing the kits on the third day, the quantity of each litter for each mother was consistent with six, ensuring an equal number of litters at the beginning of the experiment. One of the two groups of animals received a random distribution of female rabbits. Ten does in g...

Athhar Manabi Diansyah1, Muhammad Yusuf2*, Abdul Latief Toleng2, Muhammad Ihsan Andi Dagong2, Tulus Maulana3, Hasrin4, Abdullah Baharun5 

...The semen samples were immediately sent to the laboratory for processing. Parameters measured were sperm motility, abnormality, viability, acrosome integrity, and membrane integrity. Liquid chromatography-mass spectrometry (LCMS/MS) analysis was used to assess the confirmation profile protein of seminal plasma. The conception rate from artificial insemination was used to determine the fertility rate (AI). This investigation revealed that the quality of the spe...

Shabana Memon1*, Aamir Ali Abro1, Muhammad Iqbal Jakhro2, Aqsa Farid3, Maliha Habib4, Maqbool Ahmed5, Liaquat Ali Bhutto6, Saba Ambreen Memon7 and Muhammad Farooq8*

Noor Rahmawati, Alfi Rumidatul* and Sopandi Sunarya

...aluate different culture media that can support endophytic fungi to produce bioactive compounds that have antibacterial and antioxidant activity. The method used in this study was to ferment endophytic fungi from gall rust sengon in different media, namely PDB, PDB plus sengon wood powder, and PDB plus yeast, for 9 days, followed by extraction using ethyl acetate solvent and testing of antioxidant and antibacterial activity....

Shabana Noureen1, Shirmeen Ijaz2, Saad Ullah3, Iqra Shafique Abbasi4 and Shakeel Ahmad5*

...ut the content of social media tweets reflecting the need to increase more awareness in the general public about the ways to manage social anxiety.

...
SAEED AHMED*1, ZIA-UR-RAHMAN1, SALMA KHALID2, TARIQ KHAN1, ARSHAD IQBAL3
& ZAMARUD SHAH4
...lective and differential media (MacConkey agar, Eosine & Methylene Blue agar) for isolation and identification of microorganisms.Water samples showed the presence of faecal contamination; especially coliform bacteria which is a risk for the health of local community. Salmonella spp. was detected in 7.42 % of water samples having range 1-20 CFU 100ml-1, while E.coli was detected in 91.4% of water samples having colonial population between 1-40 CFU/100ml. Ac...
 
 ANSA KHALID, UZMA HAMEED* AND IKRAM-UL-HAQ 
...0 different fermentation media screened for enzyme production, maximum dextransucrase activity (9.96 U/ml) was obtained by bacterial strain IIB-C9 in fermentation medium M6 comprising (yeast extract 15 g/L, sucrose 40 g/L, and Na2HPO
 
 ANSA KHALID, UZMA HAMEED* AND IKRAM-UL-HAQ 
...0 different fermentation media screened for enzyme production, maximum dextransucrase activity (9.96 U/ml) was obtained by bacterial strain IIB-C9 in fermentation medium M6 comprising (yeast extract 15 g/L, sucrose 40 g/L, and Na2HPO
Heavy metals (HMs) are harmful and lethal at negligible levels and non-biodegradable in the typical ecosystem and constitutes animal, human and environmental hazards. They are divided into toxic metals like Lead, Cadmium, Arsenic, etc. and essential elements like copper, zinc, manganese, iron, nickel and chromium. Additionally, could be categorized into two groups based on the natural and anthropogenic sources releasing origins. Population and industrial expansion led to food contamination with HMs. Poisonous metals can be transferred from irrigation water to agricultural soils, agricultural operations, air pollution, animal feed, and packaging materials. Toxic metals are non-biodegradable, non-thermos degradable, and exceedingly stable in the ecosystem; as a result, they quickly build in various foods. Metal pollution of many foods, including agricultural commodities, and animal protein sources such as fish, milk, meat, and eggs, poses a hazard to food safety and security. Toxic metal pollution of irrigation water, agricultural soils, plants, and animals result in their integration into the food chain, posing a health hazard to humans. Most metals are harmful to animals and humans and accumulate in several organs like the skeleton, hepatic tissue, spleen, and renal tissues. Metals have a deleterious impact on the production of plants and animals. As a result, several remediation strategies have become necessary to limit the hazardous HMs pathway into the food chain and the human body. Metal nanoparticles are employed in beneficial applications, although they are associated with specific hazards.
 
Keywords | Food contamination, Heavy metals, Nanoparticles, Pollution sources, Remedy, Soil contamination
.... As a result, several remediation strategies have become necessary to limit the hazardous HMs pathway into the food chain and the human body. Metal nanoparticles are employed in beneficial applications, although they are associated with specific hazards.
 
Keywords | Food contamination, Heavy metals, Nanoparticles, Pollution sources, Remedy, Soil contamination
...
Riaz Muhammad1*, Aamer Sharif2 and Muftooh ur Rehman Siddiqi³
...e results showed that at median head 0.70 m and flow rate 0.004 m³/s, the maximum rotational speed 172 rpm and vortex height 0.59 m, respectively, with strong and fully developed air core is achieved which results in high output power and efficiency. However, the water disturbance, weak shape vortex formation and decrease in the vortex height and rotational speed occurred at a minimum and maximum inlet head of 0.6 m and 0.8 m and flow rates of 0.002 m&sup...

Oussama Zghari*, Mouloud Lamtai, Sofia Azirar, Mohamed Yassine El-Brouzi, Hajar Benmhammed, Aboubaker El-Hessni, Ali Ouichou, Abdelhalem Mesfioui

... dismutase (SOD) as well mediates brain damage in CA3 hippocampal area. These alterations were reversed by MEL. It can be concluded that, by exerting its properties against the oxidative action of this metal in the hippocampus, MEL may play a potential role in protecting against the behavioral and histopathological alterations induced by Al.
 
Keywords | Aluminum, Melatonin, Neurobehavioral alterations, Oxidative stress, Biochemica...

Fang Chen

...xpression of miR-4728-3p mediated the apatinib resistance of SCLC by targeting PTEN and regulating PI3 K/AKT pathway.

...

Xiaowei Huang1, Chao Ma1, He Lin1, Yuchen Wang1, Yan Xu1, Guangfu Lv2* and Zhe Lin1*

Nawfal Hammadi Jasim1, Yasmeen Jassim Mohammed2 , Jala Amir Salman Alahmed1, Majdy Faisal Majeed3* 

...ose induced free radical-mediated oxidative stress, through an increase of antioxidant enzymes and histological alterations in the liver.  

...

Indira Jurinskaya1*, Tynyshtyk Kenzhebaeva2, Kairat Iskakov3, Bekzat Niyazbekov1 

... breeds occupied an intermediate position between the original breeds in terms of most down indicators. For 5 days, the goats of the experimental groups underwent intramuscular injection of the cyclophosphamide drug at a dose of 7 ml/kg of body weight. The results showed one-year-old goats of the Kazakh coarse-haired and Gorno-Altai downy breeds subjected to an intramuscular injection did not show a molt of down, but the output during their brushing was, respe...

Md. Rashedul Islam1, Abul Farah Md. Hasanuzzaman1*, Md. Latiful Islam2, Ghausiatur Reza Banu1 

...hatchery. Selective agar media, a series of biochemical tests, and bacteria isolation kits were used for the isolation and identification of bacteria. The genus Vibrio, Aeromonas and Pseudomonas were identified in different components of the larval production line in the hatchery. V. mimicus, V. parahaemolyticus, V. harveyi and V. alginolyticus were the major species identified from the Vibrio genus. The average concentrations of Vibrio spp. in brood, brood&rs...

Salvator Minani1,2*, Eric Nsengiyumva1, Anatole Bigirimana1,2, Arnaud Cubahiro1,2, Dieudonné Ntakirutimana1,2 and Vénuste Bizoza1,2

...of liver flukes for intermediate and definitive hosts should be implemented to control fascioliasis in Burundi.

...

Desi Kurniati Agustina1,3, Suyadi Suyadi2*, Veronica Margaretha Ani Nugiartiningsih2, Kuswati Kuswati2 

...llected into tubes and immediately stored in a cold box at approximately 4°C. Data analysis was conducted at the Veterinary Clinical Pathology Laboratory, Faculty of Veterinary Medicine, Airlangga University, Surabaya, Indonesia. A statistical analysis was conducted using analysis of variance using Proc Mixed with general linear model (GLM) using SAS studio for academics Online Edition. This study showed the Haematological profile and leucocyte differentia...

M.A.M.M. Shehab-El-Deen1,2*, S.A. Al-Dobaib1 and K.A. Al-Sobayil1

...in serum-free maturation media. Obtained zygotes were cultured in synthetic oviduct fluid with 5% FCS for eight days. Blastocyst stages from each treatment group were assessed and evaluated for their quality by determining the ACR by means of TUNEL staining. The presence of palmitic or stearic acid at high concentrations during oocyte maturation increased ACR, whereas oleic acid had no significant effects. The results of the present study concluded that compro...

Beenish Shahid1* and Muhammad Ijaz Khan2

...n of E2+rhFSH in culture media was found to be the best combination of hormones for in vitro maturation of denuded buffalo oocytes.

...

Akbar Hayat1*, Muhammad Asim1*, Tehseen Ashraf2, Ehsan-Ul-Haque1, Rabia Zulifqar2, Maryam Nasir3, Ahmed Raza1, Fahim Khadija1, Sohaib Afzal1 and Shafqat Ali1

...e the effects of potting media with different compositions on growth of rough lemon (Citrus jambhiri L) rootstock. Potting media has vital role in the production of healthy and vigorous plants in the nursery. The trial was designed with seven treatment combinations of growing substrates that was five times repeated for each treatment in Completely Randomized Design (CRD). The rough lemon rootstock was tested for growth with ...

Yakun Ge

...using flow cytometry and median fluorescence intensity detection. Cell proliferation was detected by MTT method. Combined treatment promoted the production of ROS. The cell viability of the combined treatment group was lower than that of the control group at 24h, 48hs and 72h (P<0.05). Compared with the control group, the expression level of E-cadherin mRNA in the combined treatment group increased (P<0.05), and the expression levels of N-cadherin and vi...
Tariq Ahmad1*, Anum Razzaq2*, Li Bo1, Faiz ur Rehman3, Gul Saba2, Omama Saqib1, Saif Ullah2 and Muhammad Suliman1
...illing must be stopped immediately, otherwise this species will become extinct.

...
Tehreem Fatima1, Jabbar Khan1,*, Hamid Shafiq2, Dost Muhammad3, Muhammad Rafi1 and Shoaib ur Rehman1
...ar response to stress is mediated by intracellular proteins, called heat shock proteins (HSPs). Among various known stressors, heat is a major factor that induces the production of HSP70. Keeping in view the very hot conditions of Dera Ismail Khan (D.I. Khan) division where the temperature remains at 45-50°C during the months of June to September, it was hypothesized that heat stress conditions do induce the overexpression of HSPs, especially Hsp70. It was...

Elihasridas, Mardiati Zain*, Roni Pazla, Simel Sowmen, Qurrata Aini 

...ubating them on in-vitro media at 39ºC/48 h. The analysis of variance following a 5 x 4 randomized block design was used. The results revealed a significant (P<0.05) increase in the digestibility of ammoniated aromatic lemongrass waste in the rumen. The degradation of ammoniated aromatic lemongrass waste was found to be significantly (P<0.05) higher when supplemented with cassava leaves and mineral zinc (T3) compared to others. However, it was obse...

Jaisy Aghniarahim Putritamara1*, MB Hariyono1, Budi Hartono1, Hery Toiba2, Hamidah Nayati Utami3, Moh. Shadiqur Rahman2, Tina Sri Purwanti1

...he findings show that IC mediates CKM in achieving CA. There are also positive impacts of CKM on IC, IC on CA, and CKM on CA. The results indicate that young firms have higher IC, empowering them to obtain CA. This study confirms that CKM, IC, and CA are intangible assets sensitive to firm age. However, this study is limited to honey product MSMEs in East Java and respondents with a business aged ten years and above. Nonetheless, the findings can inform future...

Abeedha Tu-Allah Khan and Abdul Rauf Shakoori*

...-1β a key player in mediating inflammatory process using online databases. Next, we identified the interacting partners of the significantly differentially expressed TFs out of the selected ones, and the mRNA expression changes were studied for both the differentially expressed TF along with its interacting partners. Finally, we explored the expression of these genes from some online available RNA-seq datasets for brain tissue, neurons, microglia and astr...

Bing Yan1, Meng Meng Zhang2, Xi Chen2, Yongming Li2*, Muhammad Khan3* and Tonghui Ma1*

...nvincing evidence of ALT-mediated inhibition of glioma SCLP and tumor growth via repression of EGFR/MOB1/LATS1/YAP pathway and suggests ALT as a promising therapeutic drug candidate, and YAP as a potential therapeutic target for glioblastoma treatment. 

...

Erni Damayanti1,2, Herry Sonjaya2*, Sudirman Baco2, Hasbi Hasbi2, Ekayanti Mulyawati Kaiin3

...li cattle embryo culture media in vitro has never been carried out and this study aims to measure the concentration of FGF2 and EGF in follicular fluid, maturation media and Bali cattle embryo culture media. The study used ovaries that came from slaughterhouse and were oocytes mature before fertilization using semen from one bull, oocytes are fertilized then cultured for 48 hours. Embryo g...

Xu Yun-Ming1*, Sun Zhi-Yuan1, Yang Jian-Bo1, Bian Rong-Rong2, Ren Hong-Lin3, Zhong Si-Yuan1, Cai Yu-Hong1, Peng Jing1 and Bao Hua-Xia1

...rapid and sensitive loop-mediated isothermal amplification assay has been developed to detect it in uniformly items. According to the entFM gene of B. cereus, four primers were designed, and reaction components and conditions optimized. Sensitivity was compared between optimized LAMP assay and the conventional PCR. The optimal reaction conditions of LAMP assay (25uL each reaction) comprised 1.0 mol/L betaine, 6 m mol/L Mg2+, 1.4 mmol/L dNTPs, 1.6 μmol/L inn...

Muhammad Ilyas Riaz1, Masood Rabbani1*, Sohail Raza1, Ali Raza Awan2, Aleena Kokab1 and Iqra Nazir3

...egain growth in enriched media. The results confirmed that the highly attenuated Brucella abortus ΔpurD mutant can be used successfully as a potential vaccine candidate for the control of bovine brucellosis.

...

Sumaira Kousar* and Safdar Ali Shirazi

...plications beckons for immediate intervention, especially for the 2% of land grappling with extreme soil erosion. Urgent measures are imperative to preserve land integrity and safeguard the communities reliant on these resources. The amalgamation of GIS with the RUSLE model is indispensable in grappling with soil erosion’s complex tapestry. This synergy empowers soil conservation agencies to channel resources toward high-vulnerability regions, sculpting ...

Nida Sadaqat1, Sheheyar Ahmed Khan1, Amna Bibi1, Sadaf Zahra1, Muhammad faisal Salamt1, Noreen Latief2 and Fatima Ali1*

... release of inflammatory mediators including reactive oxygen and nitrogen species (ROS, RNS), which are implicated in pathophysiological events in burn patients. Excessive productions of free radicals are harmful and implicated in tissue damage and multiple organ failure. Supplementation of antioxidants has proven beneficial in decreasing free radicals in burns. The aim of the present study was to investigate the effect of N-acetyl cysteine (NAC) on biochemica...

Frah Razzaq Kbyeh1, Ahmed N. Abedsalih2* 

...tests identified special media and the isolates. The isolates were confirmed and diagnosed by Vitek assay. In this study, forty-eighth adult female rabbit aged (6-8 weeks) and weighing between (1500 and 2000) gm., was randomly divided into six equal groups(8/each) as follow positive control(PC) , negative control(NC) diclofenac in 1mg/kg(DC), ciprofloxacin in 7 mg/kg(CIP), combination (ciprofloxacin 3.5 mg/kg+diclofenac1mg/kg) COM1 and combination(ciproflo...

Haiyan Nan, Ran Feng, Guiling Zhang and Jingqin Liu*

...ng measurement of intima-media thickness, atherosclerotic plaque and stenosis; western blot and RT-qpcr were used to detect the FGF23 protein and mRNA expression results of this study showed that in the left pop artery, the inner diameter of the T2DM group was smaller than that of the control group (P<0.05), while the peak flow velocity, blood flow and spectral width of the T2DM group were higher than those of the control group (P<0.05). In the left and ...
Rabail Hassan Toor1,3, Raazia Tasadduq2, Jane B. Lian3, Janet L. Stein3, Gary S. Stein3 and Abdul Rauf Shakoori1*
... signaling pathways that mediate osteoclastogenesis will contribute further insights on the anti-osteoporotic therapeutic activity of CQ.

...

Bilal Ahmed Shah1, Muhammad Avais1*, Jawaria Ali Khan1, Masood Rabbani2, Aftab Ahmad Anjum2, Muhammad Asad Ali2, Muhammad Awais1, Sohail Ahmad3 and Shahan Azeem2*

...en streaked onto culture media showed any growth indicating sterility of the vaccines. Repeated measures ANOVA was applied to compare mean O.D values of treatment groups for evaluation of humoral immunity. Serum ELISA O.D values against S. aureus (tst), Str. uberis (cpn-60 STUB) and E. coli (aggR) in vaccinated groups randomly inoculated i/m at thigh region @ 0.2 ml per rabbit were significantly higher (p<0.05) compared to control. Likewise, the humoral imm...

SYED SHAHID IMRAN BUKHARI*, ZULFIQAR ALI & RIDA AHMAD

...n the living rooms and immediate
outdoor of residential household of each selected site using DustTrak
aerosol monitor (model 8533, TSI Inc.). Results of this study indicated
poor air quality in the residential indoor environments of asthmatics. The
24-h average values of PM10 exceeded 13 times the WHO limits (50
μg/m3 24-hours mean value for PM10). It was noticed that many
anthropogeni...

ZULNAIRAH REHMAN1*, AZMATULLAH KHAN2, ABDUL WAJID3 & AYESHA MAQBOOL4

... Mianwali. The selective media used for the Salmonella was
hektoen enteric agar. The incidence of Salmonella in egg shells of
commercial eggs and non-commercial eggs was 32.5% and 27.5%. The
Salmonella prevalence in egg content was 15% and 12.5% in samples of
commercial eggs and non-commercial eggs. The Salmonella incidence
was 40% and 32.5% in egg storing tray samples that were collected from
...

MUHAMMAD JAVAID AFZAL1*, FARAH JAVAID2, SHAHZADI TAYYABA3, MUHAMMAD WASEEM ASHRAF4 & MUHAMMAD ILYAS YASIN5

...rtion and hence better remedial measures may be adopted.

...
Ummul Firmani1,3, Rahmi Nurdiani2, Arning Wilujeng Ekawati2 and Happy Nursyam2*
...c activity on blood agar media. The results of the antagonistic test based on the well-diffused method against Aeromonas hydrophila showed that B. paramycoides did not produce an inhibition zone around the bacterial wells. The molecular identification found that the bacterial species was B. paramycoides B2.1. These results suggested that Bacillus paramycoides B2.1, which is found in the digestive tract of milkfish, can be used as a probiotic candidate for fish...

Rini Widyastuti1*, Rangga Setiawan1, Nurcholidah Solihati1, Siti Darodjah1, Kundrat Hidajat1, Mochamad Ali Mauludin2, Alkaustariyah Lubis3, Mas Rizky Anggun Adipurna Syamsunarno4, Sigit Prastowo5, Takdir Saili6, Arief Boediono7

...ty of the participants immediately carried out mating of the estrus dairy goat and more than 75% treated the pregnant animal and prepared a proper place for delivery. A small proportion of <25% managed and weaned the kids. Farmers mated their goats in the first estrous cycle, leading to an early first delivery age of approximately 12 months. Farmers in Simpay Tampomas Farmers Group generally had adequate knowledge of reproductive physiology but little exper...

Hayder M. Watban1,2, Nabeel M.H. Al-Maaly2

...lla pneumoniae selective media. Subsequently isolated bacteria were subjected to molecular detection using conventional PCR and sequencing. The finding showed that Klebsiella pneumoniae were 31 out of 74(41.89%) from total 100 camels that slaughter in the abattoir. This study indicates that Klebsiella pneumoniae reported higher infection rate as it is the predominant bacteria isolated from pneumonic camels which slaughter in Al-Muthanna abattoir.
&...

Nurul Fajrih1,2, Komang Gede Wiryawan1*, Sumiati1 and Suraya Kaffi Syahpura3

.../font> using control media without sugar sources, MRS + glucose media, and MRS + banana corm extract (BCE) media. Based on the results of the study, BCE contains glucomannan by 33.59% with a yield of 14.15%, and in vitro test results show that BCE is only able to be fermented by the lactic acid bacteria but not by pathogens. In addition, BCE can be utilized as a source of carbon for th...

Nurul Isnaini*, Dedes Amertaningtyas, Hanief Eko Sulistyo, Aulia Puspita Anugra Yekti, Faizal Andri

...s) in different enriched media and its potential as a poultry feed. A total of 1000 one-day-old eggiest were weighed (pool of 200 eggiest per single weight), randomly divided into groups of five and allocated in 5 bio ponds (12 cm x 15 cm x 10 cm) (5 replicated per dietary treatments). The treatments enriched media was formulated as follows: T0: 100% dried poultry waste; T1: mixed up-fermented dried poultry waste 75% and com...

Hermawan Setyo Widodo1,2*, Tridjoko Wisnu Murti1, Ali Agus1, Ambar Pertiwiningrum1

...those breeds and an intermediate-expressing genotype was predominant, which affected the amount of some milk protein.
 
Keywords | Casein, CSN1S1, Goat, Milk, Gene variation
...

Ahmad Khan1, Muhammad Amjad Ali1, Muhammad Tahir1, Samreen Nazeer2*, Muhammad Zubair Akram3*, Muhammad Arslan Azmat1 and Sabina Asghar4

...varieties exhibited intermediate (IM) responses. Inqlab-91 and Iqbal-2000 were found susceptible (S) with maximum RI of 72.4 and 77.6, respectively. Significant negative correlations were found between nematode infestation and plant growth parameters. Plant height exhibited maximum impact of 59.09 and 45.24 % on galling index and egg mass index, respectively. The findings provide valuable insights for selecting resistant varieties and implementing nematode man...

Sidra Hafeez1, Tayyaba Sanaullah2, Hafsa Naeem3, Mah Noor Hassan4, Muttalib5, Farhana Kausar6, Muhammad Salman Hameed7*, Muhammad Anayat Ullah8, Abdul Samad9, Memoona Bashir10 and Sadaf Shabbir11

...yoniae on the respective media. Then morphologically identification was observed through fungal growth pattern, growth color, spores shape, spores color, hyphal septation. For the confirmation of Koch’s postulates, the pathogenicity test was performed. CTAB method and Internal Transcribed Spacer region were applied to isolate and amplify the fungal genomic DNA respectively, by using universal primers ITS1/ITS4. The analysis of polygenetic of an amplified...

Wei Wan1, Xiao-Li Wang1, Shu-Juan Wang2, Qin Si2 and Li-Qing Duan1*

... P. sinica adult, with a median lethal concentration (LC50) value of 0.52 g/L. Among the 66 binary mixtures, 19 showed strong synergistic effects, while 21 showed antagonistic effects. The most profound synergistic effect was the mixture of l-carvone and dihydrocarvone, with an expected mortality of 35.2% and actual mortality of 98.4%. Estragole had the highest frequency of antagonistic effect (7 combinations), and the most significant antagonism was observed ...
Moustafa A. Zaghloul1*, Mohamed F. Azooz1, Saleh E. Ali1*, Heba M. Soliman1, Maha M. Sayed1, Mohamed H. Kafafy2 and Alaa R. Morsy1
...it both humoral and cell-mediated immune responses making it a reliable model for future in vivo and in vitro studies for control LSD infection in Egyptian cattle dairy farms.
...

Rana Mahmood Ahmad*, Orooba Mohammed Maeed  Ibrahim

...l compounds. Oil’s median lethal dose (LD50) was 2225 mg/kg, which suggests that clove oil has a relatively low level of toxicity. Eighteen adults male Wistar albino rats, six months, weighing 200–250g, were used and randomly grouped as follows: Group 1 was kept as a positive control group without treatment. At the same time, Group 2 received clove oil extract orally (10 mg/kg B.W.). Group 3 received Piroxicam (5mg/kg B.W) orally. The anti-inflamma...

Abd El-Razakl, A.G. and AboElkhair2, M.

...m B, the attenuated intermediate plus live IBD vaccine was given via drinking water at the age of day. The vaccine uptake was monitored via serology, bursal indices and effect of the two vaccines on immune response to Newcastle disease and avian influenza vaccines. It was also verified by an experimental very virulent IBD challenge performed at the age of 2e day in birds transferred from the farms with appropriate control groups in a laboratory. The immune res...

El-Dougdoug2, Kh.A; Ghalyl, M.F. and Tahal , M.A.

...9compared with the broth media treated control 15 days post inoculation and remained symptom less throughout the study period. Such five Streptomyces species identified were able to produce an antiviral component in the culture filtrate, non phytotoxic and effective in local as well as systematically control of CMV infection.

...

Attyat, M. Kotb; Abeer, E. Mansour; Naglaa, I. Aly; Zeinab, T.Salama and Azab, A. Mohamed

.... Evaluation of the cell mediated immunity for both FMD and BEF in vaccinated calves revealed that such immune response was started to increase from the 3rd day post vaccination (DPV) and reached its peak at 21 - 28 (DPV). So, simultaneous vaccination of calves with the bivalent FMD and BEF could be considered of applicable benefit.

...
Hala M. El-Makaky*•, Sherif, N.A.;Fekria El-Bordiny* and Taha, M.M.*
...e by measuring both cell-mediated and humoral immunity. The results of both T-lymphocyte transformation and ELISA tests revealed that the prepared vaccine induced good protection and has good potentiality for use in chicken in the Egyptian poultry industry.

...

Sabry Y. M. Mahmoud; Maher H. Hosseny and Mamdouh H. Abdel-Ghaffar

...ed to the tissue culture media. Several stems including axillary buds were excised from the potato plants grown for 45 days and electric-shocked treated. Stems were directly connected to the electrodes of power supply or indirectly by immersion of plant tissue in electrified  water in a wide range of intensity-time. Axillary buds excised from electric-shocked stems or tissues immersed in electrified water, were transferred into the medium  supplement...

Amina A. II. and M.K. Amin

... the bacteriophages as a mediated generalized transducing vectors of genetic material play role in natural ecology.

...

E.F. Mohamedl and A.A. Owayss2

...90% of infected plants immediately: to 75, 65, 45, 55 and 80% after one hour storage period and to 65, 50, 35, 45 and 70% after two hours. when used at a concentration of l, 3, 5, 10 and 20% respectively. In vivo experiment, using of propolis immediately pre-inoculation was more effective in reducing the occurrence of symptoms in infected plants than post-inoculation. The same result was obtained after 1 and 2 hours. So. pre...

Zhengfei Wang1*, Chenchen Shen1,2, Yiping Zhang1, Dan Tang1,3, Yaqi Luo1, Yaotong Zhai1, Yayun Guan1, Yue Wang1 and Xinyu Wang1

...e identified in the cAMP-mediated olfactory transduction pathway, including Cyclic nucleotide-gated cation channel beta-1, Adenylyl cyclase III, Calcium/calmodulin-dependent protein kinase II and Na+/Ca2+ exchanger. As a whole, our study laid a solid foundation for further functional elucidations of olfactory molecular mechanism in Procambarus clarkii, and provided further insight for a better understanding of olfaction molecular mechanism in crustaceans.

...
Saliha Bashir*, Muhammad Shafique, Muhammad Shahzad, Muhammad Sohail Anjum and Ahmad Ali Shahid
...rough SPSS program. Intermediate eye color was frequent in KPK (44%) while brown was higher in Punjab (47%). Contrarily, light to medium brown skin color was recurring (55%) in Punjab whereas lighter skin color prevailed in KPK (69%). Furthermore, Fuchs’ crypts were significantly correlated with contraction furrows in both populations. Likewise, crypts were significantly associated with Wolfflin nodules and furrows were significantly related to conjuncti...

Rahmat Rahmat1, Muhammad Yusuf2*, Abdul Latief Toleng2, Herdis Herdis3, Athhar Manabi Diansyah2, Hasrin Hasrin4 

...concentrations of sexing media showed no significant difference (P>0.05) on motility, viability, abnormality, membrane integrity, acrosome integrity, and movement patterns of spermatozoa in treatment between T1, T2 and T3 treatments both in the upper and lower fraction. In the movement pattern of sexed sperms, There was no significant difference in the kinematics parameters (P>0.05) in the T1, T2 and T3 treatments. The proportion of X:Y with freeze-dried...

Qamer J. Jadoaa, Raffal A. Omar*

...he proximal third of the medial aspect of the tibia by an electric drill with dropping isotonic normal saline to prevent thermal necrosis. The experimental animals were divided randomly into three equal groups, each group include fifteen rabbits (n=15). control without any additive. group 1(lidocaine hcl). Which applied daily single dose of 2% lidocaine Hcl 2 mg/Kg. B. W. for five days post-operation (P. O.), while the group 2(diclofenac) applied 3.75% of 20mg...

Cut Intan Novita1,2, Kartini Eriani3, Amalia Sutriana4, Tongku Nizwan Siregar5,6*, Ni Wayan Karja7

...to ovarian vitrification media to prevent apoptosis of granulosa cell follicles. Bovine pituitary has been proven as an effective substitute for the functions of FSH and LH in some studies related to superovulation due to its high content of both hormones. Therefore, this study aimed to determine the effect of bovine pituitary extract (BPE) supplementaion to vitrification media. A total of 18 ovaries were usedwhich was divid...
Aatif Masood Ahmad Khan1, Masood Rabbani1*, Arfan Ahmad1, Muhammad Wasim2 and Sohail Raza1
...ge serovars B. Among the media evaluated for growth of the isolated strain BHI/SN appeared to be the optimum media supporting the maximum growth rate and providing the maximum cfu count and the highest value of specific growth rate during the exponential phase of bacterial growth curve were obtained at 8 h. Thus the current study demonstrates that diagnostic approach using direct swab samples for the detection of Av. paragal...

Ghaith Z. Hasan Al-Askari *, Eman H. Yousif Al-Taee

...eview were to assess the median lethal dose (LD50) of VD in female albino rats and to assess the effects of vitamin D (VD) on the severity of acute upper or chronic vitamin D intoxication (VDI) through the study of cytogenetic effects in addition to histopathological changes in the tissues of female rats. The methods included in the first experiment, the female rats were orally administered the following lethal doses: 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 7, 8, 9, ...

MADIHA AFTAB1, ARIFA TAHIR*1, TAYYABA ASIM1 & IRFANA MARYAM2

... Five different cultural media were tested and best one was selected for laccase production. Different cultural conditions such as inoculum size, pH, temperature, incubation period, moisture content and inducer were studied. Medium components were further optimized by Plackett-Burman and central composite designs. Results showed that maximum enzyme activity (297±0.1 U/ml/min) was obtained by using AFM02 medium containing g/L: sawdust, 5.0; glucose, 5.0;...

MARIAM ZAHEER*1, SYED SHAHID IMRAN BUKHARI2, MUDDA

...n food industry and bioremediation. This review article describes sources, synthesis, fermentation, extraction and applications of exopolysaccharides.

...

UMER YOUNAS, SHAHID IQBAL* & JAMSHED AKBAR

...f methanol as extraction media over the other solvents used. In addition, microwave-assisted extraction technique for the recovery of antioxidants from M. nigra leaves was optimized using response surface methodology. For the purpose, oven dried samples were further extracted using methanol under different sets of extraction conditions (microwave intensity and extraction time). A central composite design was employed to determine the optimum conditions for the...

Aziz Ahmed1*, Anila Naz Soomro2, Muhammad Ramzan Ali1, Muhammad Aleem Khan1 and Hasina Basharat1

...;">Fish sperm-activating media are chemical solutions having certain properties now thought to be a prime indicator for the peculiarity of spermatozoa. Present research evaluated the effect of two laboratory-prepared media and one commercially available media i.e., ACTi fish while control is freshwater on sperm quality parameters i.e., percent motility, motility interval, sustainability, a...

Muhammad Usman1*, Aneela Zameer Durrani1, Nasir Mehmood2, Muhammad Hassan Saleem1 and Mamoona Chaudhry3

...cycline cured the dogs immediately when checked on the 7th day followed by amoxicillin on the 21st day; whereas dogs treated with azithromycin and clindamycin did not show promising results. Besides, results of CRP showed that doxycycline had significantly (p < 0.05) greater efficacy than Azithromycin till the end of the trial and clindamycin till the 21st day. However, the comparative efficacy of doxycycline and amoxicillin showed a significantly (p < 0...

Tanveer Jilani1*, Irfan Khan2, Asmat Salim2, Fareena Bilwani1, Bushra Moiz3 and Mohammad Perwaiz Iqbal1,4

...ACS) or by flowcytometry-mediated cell sorting. There are no reported studies from South Asia in which CD34+-derived EPCs have been isolated and purified from the peripheral blood samples obtained from healthy adult humans. The aim of the present study was to isolate CD34+ cells, differentiate CD34+ cells in to EPCs, purify and characterize CD34+-derived EPCs from peripheral blood samples from healthy adult human subjects. Blood samples were obtained from appa...
Mouhamed Zakiou Kolawole Adissa Raimi1, Ghulam Hussain2, Nousheen Zafeer3, Faheem Ahmad1, Muhammad Irfan4, Anwar Ullah1, Imdad Kaleem1 and Asghar Shabbir1*
...idate for an alternate remedial treatment of MS in animal model as well as in humans. In this study we established a new animal model (quail), to assess the synergistic efficacy of honey and black seed against demyelination within brain. A total of 35 male quails were used, among 10 were non treated and 25 were treated with 200 mg/kg/day cuprizone (CPZ) demyelination for six months to induce demyelination. After that they were divided into seven groups of five...

Qurrat ul Ain Shafique1, Sana Batool2, Hanfa Ashfaq2, Asima Tayyab2, Roquyya Gul3 and Mahjabeen Saleem1*

...pression in LB,TB and M9 media with varying concentrations of inducers (IPTG and lactose) and post induction time. Maximum expression of IL-2 was achieved in LB with 0.5 mM IPTG for 6 hours post induction time. A denaturing purification scheme (Immobilized metal affinity chromatography) was employed for the purification of IL-2. The refolding of the purified IL-2 was achieved by stepwise dialysis method using urea gradient (8M-0M). Human IL-2 was recovered fro...

Dio Fico Felsidan Diatmono1, Seraphina Kumala1, Pradita Iustitia Sitaresmi2, Stefani Winda Paramita1, Megawati Andi1, Yustina Yuni Suranindyah3, Diah Tri Widayati1*

...m from whole blood was immediately for total protein, cholesterol, glucose, and blood urea nitrogen (BUN) levels assay. The spectrophotometry method used for biochemical data using specifics enzymatic were used. Feed samples were analysed using proximate method to determine dry matter (DM), crude protein (CP), and total digestible nutrient (TDN) intake. The data results were analysed using Independent Sample T-Test and the correlation between blood metabolite ...

Hayder S. Rwayyih*, Tahani S.S. Al-Azawi

...th muscle cells from the media to intima). In conclusions, the result of the current study could prove that Alpha lipoic acid has a protection on cardiovascular system in menopause estrogen deficiency and ovariectomized female rabbits. Alpha lipoic acid could fight the deleterious effect of menopause estrogen deficiency. 
 
Keywords | Ovariectomy, Menopause, Estrogen deficiency Alpha lipoic acid, Cardiovascular system, Rabbits...
Julio Adolfo Corzo-Bacallao1*, Carlos Alfredo Salas-Macías1, Osvaldo Fonseca-Rodríguez2,3, Felipe R. Garcés-Fiallos1, Erika Isabel Alcívar-Muñoz1 and Henry Fabricio Baque-Loor1 
 
...hose obtained at an intermediate shade level considered as standard (S2: 31-50%). The phenological variables related to vegetative development (Total Branches) of coffee plants showed higher values in S2 compared to S1 and S3. These results are related to the higher photosynthetic activity associated with the higher intensity of incident solar radiation, although the relationship is not linear. In our results, flowering and fruiting were not affected by the le...
Sanaullah Sattar1, Ali Hussain1,2*, Javed Iqbal Qazi2, Arshad Javid1 and Shahid Mehmood1
...pons in solid and liquid media under two variable nutritional conditions. The bacterial species for the experimental trials was isolated from buried corroded metallic installment and found motile, Gram-negative, non-spore former and identified by 16S rRNA gene sequencing as Desulfovibrio desulfuricans. The corrosive impact of SRB on steel coupons was performed in water as liquid medium and the processed clay as the solid medium without and with the provision o...

Md. Khayrul Basher1, Sumon Sarkar2,3, Md. Samiul Haque1, Sourav Sarker4, Md. Rashedul Islam1*

...selenite against arsenic-mediated hematological, biochemical, and organ development toxicities. In this study, adult female mice (Swiss Albino) were categorized into four groups namely control, NaAsO2, NaAsO2+Na2SeO3, and Na2SeO3 (10 µm NaAsO2 and 10 µm Na2SeO3, respectively) were orally administrated via drinking water up to 60 days of the treatment period. Then the hematological, biochemical parameters, organ-to-body weight ratio, and morphology ...
Mona Adel El-Wakeel1*, Salah El-Din Abd El-Ghany Ahmed, Sanaa Abd El Rahman Mohamed
and Nadia Khalil Messiha
...ed with acetic acid 5% immediately. Moreover, sole spraying of acetic acid
5% treatment was sprayed on the soil surface. All treatments were applied before
transplanting directly. Results revealed that the maximum inhibition of both weeds in both
seasons (2018 and 2019) was recorded by PLP at 60g + Acetic acid 5% as compared to
unweeded control. Concerning C. annuum growth parameters and yield traits, sole
...
Muhammad Ehsan Safdar1, Muhammad Ather Nadeem1, Abdul Rehman1, Amjed Ali1,
Nasir Iqbal2, Qaisar Mumtaz1, Amir Javed1
...-1) which were applied immediately
after sowing and six post-emergence herbicides (oxyfluorfen at 237.1 g a.i. ha-1,
metribuzin at 518.7 g a.i. ha-1, quizalofop-p-ethyl at 148.2 g a.i. ha-1, acetochlor at 741
g a.i. ha-1, halosulfuron at 37 g a.i. ha-1and topramezone at 21.5 g a.i. ha-1) which were
used 25 days after sowing. In contrast to control, all herbicides have shown significant
decline in weed...

Shabana Mangi1, Waheed Ali Panhwar1, Abdul Manan Shaikh1, G. Sarwar Solangi2, Khalid Hussain Rind3, Nazir Ahmed Abro4, Zaibun-nisa Memon1, Gul Hafeeza Lund1 and Paras Somroo1

...rgins with golden hairs, median lobe of parameres broad at base, rapidly narrowing apically, hairs like structure view from the ventral aspects. The instant discovery will help the growers and technical personals to identify the instant species easily and its identification will help in these control of the referred species. Further studies are suggested to explore its nature of damage.

...
Muhammad Sikander Hayyat1*, Muhammad Ehsan Safdar1, Muhammad Mansoor
Javaid1
...were used as germination media for rice. Among plant parts, red sprangletop leaves showed
maximum allelopathic effect by fully inhibiting the germination of rice while its stem could
be positioned at second situation as it caused 60, 73, 84, 13 and 86 % reductions in
germination percentage, germination index, seedling length and seedling dry biomass of
rice as compared with control, respectively. This treatment a...
Muhammad Shakil Ahmad1, Muhammad Afzal1, Liu Yu Feng2
Muhammad Zeeshan Majeed1*, Hina Safdar3, Arif Mehmood1, Shahid Iqbal4 and Muhammad Adnan1
...n and exhibiting minimum medial lethal concentration (LC50) and time (LT50) values (i.e. 12.32 and 38.01 ppm and 16.67 and 11.68 days, respectively). Among microbial formulations tested, S. litura-nuclear polyhedrosis virus (NPV) and Bacillus thuringiensis kurstaki appeared as the most effective microbial treatments exhibiting minimum LC50 (3.78 × 103 OB mL-1 and 1.22 × 107 spores mL-1, respectively) and LT50 (3.83 and 3.71 days, respectively) valu...
Zafar Hussain , Muhammad Zubair , Wasif Nouman , Irfan Ashraf , Maryam , Rahmatullah Qureshi, Muhammad Farrakh Nawaz and Khalil Ahmed Ansari

Muhammad Bilal Zia1*, Ashar Farooq1, Hammad Ud Din1, Barkat Ullah Khan1 and Samee Ud Din2

...station agent for phytoremediation of heavy metal-polluted soils. Pakistan Forest Institute, Peshawar introduced Paulownia species in 1989 and six species were evaluated in multi-location trials. The studies for optimal planting stock and propagation methods for Paulownia indicated that the root stumps grew substantially taller, having straight stems and symmetrical crowns. Highest survival was observed for Paulownia fortunei, Paulownia tomentosa and Paulownia...

Kang Cheng1*, Zhihua Song2, Jingyi Niu1, Jin Huang1, Laiting Liu1, Jinrong Wang1 and Yong Zhang1*

...ptor 4 signaling pathway mediated expression of pro-inflammatory cytokine tumor necrosis factor alpha at translational and transcriptional level, and the increased gene expression of interleukin 10 in the jejunum. In conclusion, fisetin alleviated the intestinal injury in rats caused by heat stress through inhibiting of oxidative stress and inflammation. This may offer a useful nutritional strategy for improving the health status of individuals exposed to heat...
Ashar Farooq1*, Mohammad Salim2, Muhammad Tahir Khan3, Zahid Rauf1, Ahmed Hussain2 and Muhammad Bilal Zia1
...e yield was determined immediately after clipping. The samples were oven dried to determine dry matter yield and In-Vitro Dry Matter Digestibility. The data were subjected to Analysis of Variance (ANOVA) for Factorial arrangement. Significant difference between individual means was separated using Tukey's HSD test. The results of the study for comparison of species indicated that fresh forage yield (t/ha) and In-Vitro Dry Matter Digestibility (%) of Panicum...
Muhammad Yousaf Khan and Pervez Manan
...he required publicity in media. It is pertinent to mention that in district Malakand Eucalyptus plantations were carried out through Malakand-Dir Social Forestry Project in 80s. All the Eucalyptus plantations carried out after proper Village Land Use Planning (VLUP) in the supervision of foreign technical advisors of that particular project. The data for this study has been collected from 56 plantations carried out on communal lands by the project on demand of...
Mamoona Wali Muhammad1, Syed Ajmal Rahim2, Junaid Mumtaz3 and Syed Akmal Rahim4
...newspapers, TV and Radio media. Negative perceptions regarding effects of trees planting on agriculture crops is the major hindrance and be removed by conducting on farm relevant scientific research and disseminating the finding to the farmers.

...
Ghulam Mustafa Nasir and Hakim Shah
...h rate, both had an intermediate value of basic density of wood. Likewise, the wood samples possessing the highest and lowest value of basic density, both were found to have a medium value of average annual ring width....
Tanvir Hussain
...nts in different culture media i.e. Murashige & Skooge (MS) medium, Gamborgs B5-salt (B5)and Basal nutrient medium (BNM) alone and in combination with Auxins and Cytokinins. It was found that only the axillary buds gave good response to all media. For callus initiation, same ex-plants and media (alone and in combination with callus initiators) were tried but callus formation was not observ...
Muhammad Afzal and Aqeela Mobeen Akhter
...ation was achieved on MS media with 5µM BAP concentration. High multiplication rate i.e.12 micro shoots per culture was obtained with 15µM BAP. After 4-5 weeks the shoots developed roots in the same media without adding any rooting hormones. These plantlets showed a good growth response in earthen pots and 85% survival of plants in soil was recorded....
Mahmood, H.1, O. Saberi2, B. Japar Sidik1 and K. Misri1
...during dry, wet and intermediate seasons in mangrove forest at Kuala Selangor Nature Park, Malaysia. The different parameters (pH, redox-potential, conductivity and salinity) of water samples showed seasonal fluctuation. Infiltration water showed comparatively higher conductivity (55.83-71 00 dS/m) followed by river water (18.17-22.17 dS/m) and relatively higher conductivity of rainwater, canopy drip, river and infiltration water was observed during the dry se...
Muhammad Aftab Majeed
...on In situ enhanced bioremediation techniques are effective in remediation of MGPs particularly for contaminants such as the dense non-aqueous phase liquids (DNAPL), like coal tar The aim of this study was to assess the potential of in situ technologies in a laboratory column experiment. In situ amendments of nitrogen, phosphorus and oxygen releasing compound were performed on site Soil samples were collected from a site and...
Mirza Hakim Khan
...e for certain species. Remedial measures through chemical control applying different doses of 2-4-D Sodium, Amine and Ester are suggested in this article....
Altaf Hussain and Shams-ur-Rehman
...y and October using sand media by following randomized complete block design. The results indicated maximum rooting (85.4%) with 4000 ppm IBA treatment. Maximum average rooting was observed in October (78.0%). The untreated cuttings showed lowest rooting percentage of 15.4 and 28.6 in March and July seasons respectively Interestingly more than 70% rooting was obtained in October without any hormone treatment. The analysis of variance indicated significant diff...
Muhammad Afzal, Muhammad Mushtaque, Aqeela Mubeen Akhtar, Nighat Chughtai and Shaheena Ramzan
...he species. In the basal media (MS + 5 micro molar BAP), ex-plants started differentiating shoot buds at high frequency. These aseptically developed plantlets were shifted to earthen pots for rooting without applying any root-promoting hormone. These plantlets showed a good growth response in earthen pots and attained one-meter height within a period of two months...
G. A. Bajwa and M. N. Ashiq
...-MKD and C-102 were intermediate between 207-PO and J-101, however they were relatively more resistant to grasserie than flacherie....
Muhammad Afzal and Muhammad Hafeez
...alternative except the immediate adoption of agroforestry (Rashid & Hafeez, 1991)....
Mohammad Arif Chaudhry and Ashraf Hassan Chaudhry
...owth on P+N and tween-80 media, in 28 days. In the absence of combined nitrogen, the strain CN5 fixed nitrogen showing acetylene reduction assay (ARA) and was found highly sensitive to higher concentration of NaCI (500mM in yeast extract-dextrose medium). This strain gave the infective and effective results for nodulation on the root system of C. nepalensis. The light microscopy revealed the occurrence of seperate and branched hyphae bearing spo...
Mian Muhammad Muslim
...ila locality of Punjab immediately after independence in 1947. Subsequently, it was introduced in and around the irrigated forest plantation where mulberry was available in abundance to support the silkworm rearing programme. Since then it made a slow but steady progress in Punjab. Presently, sericulture is one of the major cottage industries in rural areas of the province. The activity is mainly concentrated around irrigated forest plantations of Chang...
Wulf Killmann
...ms from the plantation immediately after felling and convert them quickly - use tungsten carbide or stellited saw blades - apply large bites as recommended for hardwood - maintain saw properly - dip the timber in fungicide after sawing - segregate and stack the sawn timber in accordance with at least two, preferably three density classes - Seasoning: air season the timber properly stacked (in airy place under cover, off the ground, with fillets between) - air ...
M.I. Sheikh and Sultan Maqsood Khan
...he forests along with remedial measures are described. The demands of local people on the forests, status of demarcation and settlement of rights, damage being cone to the forests, are given. The objectives of management of these forests and the proposed means to achieve these objectives are suggested. The present situation and future recommendation for watershed management, soil conservation, medicinal plants, sericulture, wildlife and outdoor are al...
Sultan Maqsood Khan
...orage production of intermediate species, Themeda anathera and Heteropogon contortus....
Mirza Hakim Khan Dr.
...iffthii, Othonopsis intermedia community Community 1 was found the best both from food and shelter point of view, while the others stand in descending order of importance....
S. Maqsood Khan
...forbs of desirable, intermediate or undesirable species due to closure....
Ghaus Mohammad Khattak
... generally 10%. The intermediate yields are usually prescribed by area and their volume estimated from past experience. Adequately stocked Reserved Forests growing on steep slopes vulnerable to soil erosion, and the guzara forests, are worked under the modified selection system. Felling of trees of exploitable size is further restricted in the guzara forests by special marking rules. The final yield is usually calculated by dividing the volume of...
Raja Walayat Hussain and Syed Hasan Abbas
...ees and upto 10% of intermediate trees....
M. Hafeez and M. I. Sheikh
...ing, different rooting media, frequency of irrigation and position of cutting on the plant etc. and using clones like P. deltoids 63/51, 90/60, 69/55 and 18/62, P. euramericana CV-I-214 being the control. Indications in both the cases were that supported by adequate winter rains or artificial irrigation and an efficient planting schedule, February was the best month for planting of most of the clones of poplar in the country....

Syed Saqlain Hussain1*, Muhammad Rasheed2, Zammurad Iqbal Ahmed2, Ghulam Jilani3, Muhammad Irfan4, Muhammad Kashif Aziz5, Fiaz Hussain1, Muhammad Akhlaq Mudassar1 and Zuhair Hasnain2

Javairia Mehboob1, Syeda Hafsa Ali1*, Fahima Ashraf Kasi1, Syeda Ayesha Ali2, Safa
Farooqi3, Muneeza Arbab4,
...ial activity of lavender mediated AgNP was highly
significant, followed by artichoke mediated AgNP and Alkanet AgNP. However, in contrast,
Artichoke mediated AgNP showed significant activity against plant fungal strains, followed
by Alkanet AgNP, and finally by Lavender mediated AgNPs. We concluded that the three
...

Ghodrat Akhavan Akbari1, Saman Hayadokht1, Saeed Sadeghiyeh Ahari2 and Ahmad Gasi1*

...d that oxycodone pills immediately after surgery may reduce the incidence of shivering significantly and also effective in shivering control as much as Meperidine at the other times of recovery.

...

Mariana Isti Dwiningsih1, I Ketut Suatha2 and I Ketut Puja3*

...ent 1, sample examined immediately after added extender, experiment 2, 3 and 4 were. The results of the study found that the average motility percentages for semen transported at 0 hours, 1 hour, 2 hours, and 3 hours were 91.00% ± 0.89, 90.83% ± 0.75, 90.17% ± 0.75, and 89.83% ± 0.75, respectively. Similarly, the average viability percentages for the same transport times were 82.00% ± 0.89, 81.66% ± 1.03, 81.66% &plusm...

Md. Maniruzzaman1, Md. Kamrul Haque1,3, Md Rokonuzzaman2, Md. Mahmudul Hasan3, Rumana Biswas4, Md. Mustafizur Rahman5, Tahmina Akter Rimi6, Md. Rahat Uz Zaman7*, Md. Alauddin8, Md. Abdul Baki9 and Md. Yeamin Hossain10

...ernational markets. Intermediary-based poor marketing channels, inadequate finance facilities, a lack of infrastructure, and trained personnel are the significant constraints found in the current study. These constraints can be resolved by creating a new marketing channel, enhancing export, minimizing on-season product wastage, processing food and encouraging private investment in the industry. This article recommends a new marketing chain that combines severa...

Imania Ghaffar1, Ali Hussain2*, Arshad Javid1 and Shahid Mehmood1

...heavy metals’ bioremediation. This study attempts to check the influence of microplastic pollutants on Hg2+ uptake potential of metal-resistant Aspergillus flavus at laboratory scale under pre-optimized conditions. A. flavus showed a remarkable potential of remediating simulated wastewater, i.e., 100% Hg2+ reduction was achieved at 25 mg/L of the added metal in 15 days of incubation. On higher concentrations like 75 an...
Wasseem Emam1, Mohamed E. Bakr2*, Marwa F. Abdel-Kader3, Mohamed M. Abdel-Rahim4, Ashraf I.G. Elhetawy4 and Radi A. Mohamed1
...e surface of the water immediately below it. Oxygen levels were also higher under the greenhouse than outside of it and higher than in the control pond. Fish reared in the greenhouse ponds tended to be larger than the control ponds and had improved physiological and immune status (i.e., better liver and kidney function, higher antioxidant activity and lysozyme count; p < 0.05). The results of this study suggest that low-cost interventions that introduce the...

Gökhan Ulukan1*, Zeynep Pekcan2, Zülfükar Kadir Sarıtas3, Ilker Etikan4, Serkan Sayıner5, Feride Zabitler6 and Fatma Eser Özgencil1

...GCPS-SF) scores and pain mediators in the early post-operative ovariohysterectomy (OHE) period in 30 female dogs of different breeds and ages divided into three equal groups. OHE is reportedly associated with moderate pain. BLK was administered inside the ovarian bursa 10 min before ovary removal in Groups (G) 1 and G2 and linear to the incision line 10 min before entering the abdomen in G1. G3 was the control group. The intergroup comparison of pain

Lin Li1*, Lu Lu2, Gang An2 and Xiaoguang Zhang3

...g Bax and Bcl-2 pathways mediated by TF.

...

Diyar Mohammad Hussein*, Iman Mousa Khaleel

...s and smooth lateral and medial surfaces. All measurements of left lobe in suckling and adult cats were higher than those of the right one. Statistically, the weight, length, width and thickness of right and left thyroid lobes in adult cats were higher significantly than those in suckling at p <0.05. The adrenal glands in suckling and adult cats contains two creamy small glands, located on each side of vertebral column, the right gland situated on the crani...
Iswahyudi Iswahyudi1,2, Wahyu Widodo1*, Warkoyo Warkoyo1, Roy Hendroko Setyobudi3, Damat Damat1
Dyah Roeswitawati1, Shazma Anwar4, Thontowi Djauhari Nur Subchi1, Irma Rahmaita Utarid5,  Marchel Putra Garfansa2, Mohammad Shoimus Sholeh2, Ida Ekawati6, Rusli Tonda7,  Wahyu Alvina Mujianti2, Dody Sukma RA8, Sri Utami Lestari8 and Choirul Anam9
...r and earthworms to bioremediate MPs.
...
Shorouq Mohamed Omara1, Ibrahim Saad El-Shamaa1, Emad Abd-Elaziz Abd-Allah2, Assmaa Abd-Allah Fathy3, Essam-Eldin Tharwat4, Mohammed Hamdy Farouk5* and Ibrahim Mahmoud Abd El-Razek1*
...ysts. The tissue culture media included a control culture medium and other three LC supplemented media (2, 3 or, 4 mM LC). All LC treatments had higher COCs percentages at the metaphase II (MII) compared to the control group. The 2 Mmol LC treatment had the highest percentage of oocytes maturation rate at metaphase ΙΙ (47%) compared to the control group (33.3%). The same treatment had a higher percentage of cleaved...

Marwa M. El-Deriny1,2*, Rania H. Wahdan1, Marwa S. Fouad3 and Dina S.S. Ibrahim1,2*

... agents for ecological remediation.

...
Shruti Yadav1,2*, Kamana Singh2, Pratap Adinath Divekar3 and Suhas Gorakh Karkute1,3*
...al through Agrobacterium mediated transformation. Presence of Cry2Aa gene was confirmed by PCR and Southern blot analysis showed single copy insertions in plants of six independent transgenic events. Cry2Aa gene was highly expressed in transgenic plants and its protein level was as high as 30.94 µg/g in fresh leaves and 20.57µg/g in fruits. Insect bioassay showed the BSFB larval mortality between 90% to 100%. Altogether it was observed that express...

Iffat Ara Mahzabin, Mohammad Maruf Hasan*, Saifur Rahman, Md. Asaduzzaman Sarker and Md. Yeakub Ali

...onomic return, extension media contact, organizational participation, and attitude towards extension service providers were identified as the influential factors affecting their level of satisfaction. As most of the fishermen had a medium level of satisfaction, concerned authorities should be more careful and take the initiative to make the services easier and more effective for the fishermen to maintain this current level of satisfaction.

...

Rejvi Ahmed Bhuiya1, Md. Ruhul Amin2 and A.K.M. Kanak Pervez2*

... extension services, the media, and organisations were, and the more likely they were to avail of resilient climate adaptation technologies in dealing with recurrent and more severe drought in the Barind region (p≤ 0.05). Therefore, it is recommended that the Government of Bangladesh take the necessary steps, including non-formal education campaigns and training, media exposure, and organisational participation.

...

Mohammed Nasir Uddin1, Maimona Monir Jhilam1, Most Zannatun Nahar Mukta1, Zujaja Wahaj2, Mohammad Maruf Hasan1* and Samiha Khan3

...ional participation, and media contact were identified as the influential factors affecting the livelihood change of the wetland farmers and these factors accounted for 65.8% of the observed variation in the study’s focal issue. In terms of problems problems faced during the implementation of the crop interventions, 53% of the respondents reported facing medium-level problems. The most prominent problem reported by the respondents was ‘lack of tech...

Yusra Karim1, Munawar Saleem Ahmad1, Javed Khan2, Imtiaz Khan3*, Said Hussain Shah2, Syeda Anika Shamsher4, Imran Qazi5, Habib-Ur-Rehman Kakar6 and Wajih Ullah7 

...ed in Luria-Bertani (LB) media under controlled laboratory conditions. The goal was to maximize colony growth for the preparation of spore/crystal mixtures at various concentrations. The larvae of S. litura and H. armigera   were reared in a laboratory under control. Following tests, the LC50 (96-hours) of the CRY1F protein-crystal mixture against lepidoptera pests was determined to be 158.37 µg/ml for S. litura and 170.73 µg/ml for H. ar...

Quratulain Amjad1,2 and Abdul Rauf Shakoori1,2*

...eparan sulphate in Slit2 mediated inhibition of cancer metastasis. Cancer proliferation was induced by TGF-β in lung cancer cells (H1650) and glioblastoma cells (SF767) and then the anti-proliferative role of Slit2 was analyzed in presence and absence of heparan sulfate. The data revealed that, heparan sulfate plays important role in enhancing tumor inhibition by Slit2 in cancer cells as there was further reduction in cell proliferation when Slit2 was adm...

Zuyang Zhou1, Xi He2, Yufang Liu1, Qiuling Li3, Pingqing Wang2, Yongfu An4, Ran Di1, Yuze Yang5 and Mingxing Chu1*

...ion belonged to the intermediate polymorphism level. The results preliminarily indicated that g.17924 G>A of FASN gene is a potential genetic marker for application of marker-assisted selection programmers to improve milk fat percentage in Chinese dairy cattle.

...
Abdul Majeed Saim1, Arshad Javid1, Misbah Sarwar2­, Muhammad Hafeez-ur-Rehman3 and Ali Hussain4*
... dark purple on EMB agar media plates while S. enterica colonies were small, circular, and red on SS agar media plates. E. coli and S. enterica isolates were found resistant to amoxicillin, ciprofloxacin, and sulfamethoxazole, while sensitive against doxycycline, gentamycin, and tetracycline. E. coli isolates showed positive results in catalase, indole, and methyl red tests while S. enterica isolates showed negative in citra...

Ibrahim Ali1,2, Hanan Mohamed Fathy Abdien1*, Wael Kamel Elfeil1, Mohsen Mohamed Zaky ElDemerdash1, Mohamed Ali Zain El-Abideen2,3, Walid Hamdy Kilany2,3

...ocus to humoral and cell mediated immune response. Seven groups of specific pathogen-free (SPF) chickens were treated as G1 and G2 vaccinated with (H5N8+Gel 01), G3 and G4 with (H5N8+IMS1313) by intranasal (IN) and intramuscular (IM) for each treatment respectively. Each group (G1-G4) was vaccinated twice at day 7 and 21 of age. Meanwhile, G5 treated with (H5N8+ISA70) received the primary vaccination dose intramuscularly only on day 7 of age. Group G6 served a...

Natalia Shchur1,2*, Tetiana Mazur1, Orest Katsaraba3, Ihor Halka2, Ludmila Shalimova2, Larisa Moskalenko4, Tetiana Ponomariova-Herasymiuk4, Maksym Lusta4, Vitalii Nedosekov1

...using selective nutrient media of various compositions, and employing both commercial materials and those prepared from components. Additionally, a comparative assessment of two isolation methods was conducted using a model of 138 samples of cecal contents from poultry (n=106) and animals (n=32) from farms in Vinnytsia, Volyn, Kyiv, and Cherkasy regions. 97% of the isolates were obtained by direct plating, with 15.6% being pure cultures. The enrichment method ...

Roy Sukbir Singh1, Jekson Martiar Siahaan2,3*, Endy Juli Anto4, Syafruddin Ilyas5, Putri Eyanoer6, Hendrika Andriani7,8

...pounds with inflammatory mediators such as TNF-α and COX-2. Furthermore, this study also employed a laboratory design with a post-test randomized controlled group. The study included 30 male white rats divided into six groups. Prior to the study, the rats were induced with a high-fat diet (HFD) for 14 days. The groups consisted of a normal group receiving distilled water, a negative control group following a high-fat diet, a positive control group treate...

Wali Muhammad Mangrio1*, Hakim Ali Sahito1, Abdul Hafeez Mastoi2, Sanaullah Sattar3, Fahmeeda Imdad Sahito4 and Shahid Ali Jakhrani1

...kistan. Cotton growers immediately take some control measures before to avoid pest infestation. This study also have significant implications for pest management against destructive insect pest species of the cotton crop in future endeavors. 

...

Ferry Lismanto Syaiful*, Jaswandi Jaswandi, Mangku Mundana, Zaituni Udin 

... techniques. The culture media used include TCM-199 medium supplemented with both B-O (Brackett Oliphant) medium (HEPES, without the use of 5% CO2) and modified B-O (mB-O) medium (without HEPES, with 5% CO2). For the oocyte maturation stage, the culture period was 24 hours, while for in vitro fertilization, various culture periods (6, 12, 18h) were utilized. The analysis of research data acquisition was conducted using a Completely Randomized Design, utilizing...

Ashraf Samir Hakim1*, Doaa Diab Khalaf1, Engy Farahat1, Mohammed Darwish Mohammed1, Wahid Hussein El-Dabae1, Khaled Abd El-Hamid Abd El‑Razik2, Amany Nabil Dapgh3, Ehab Ali Fouad4, Hussein Ahmed Abuelhag1

...ltured onto the suitable media; the presumptive E. coli colonies were identified phenotypically, biochemically via Vitek2® and serotyping. The virulence of E. coli isolates were characterized phenotypically via hemolysis, Congo red binding, Vero cell cytotoxicity. The antibiotics resistance pattern was assessed by disk diffusion test. Also, the E. coli isolates were molecularly confirmed and screened for presence of 3 virulence genes (fimH, iss and iutA) a...

Zhongjiang Niu1, Periyannan Velu2, Annamalai Vijayalakshmi2*

...memory, pro-inflammatory mediators (IL-1β and TNF-α) in hippocampal tissue, neuronal damage (increased sNSE), mitochondrial dysfunction, and oxidative stress. PTZ-kindling augmented TBARS and reduced GSH and CAT. PTZ-kindling significantly decreased locomotion, memory and learning. Neuronal damage and hippocampus swelling were reversed with NF45 in a dose dependent manner. P2y agonist, methylene - ATP, significantly reduced the positive effect of NF...

Muhammad Luqman1,*, Aqsa Ashraf 1, Muhammad Yaseen1, Muhammad Umer Mehmood1, Anwar Saeed2 and Rizwan Ahmad3

...rce Focuses with general media resources and emphasizes the significance of training agricultural information providers in taking care of and transferring knowledge successfully. Reinforcing institutional linkages is suggested for consistent knowledge delivery. All in all, the review reveals insight into the multifaceted difficulties faced by small-scale farmers in getting to vital agricultural information and underscores the need of fitted

Pangesti Nugrahani1*, Hery Purnobasuki2, Arif Nur Muhammad Ansori3, Jatuporn Anuchai4 and Anugerah Dany Priyanto5,6

...urashiage and Skoog (MS) media supplemented with various types of growth regulators (PGRs). Cytokinin and Auxin are incorporated into MS media to promote shoot and root growth in banana explants. 6-benzyl amino purine (BAP), a form of cytokinin, plays a significant role in stimulating cell division and differentiation. This study aimed to assess the impact of BAP on various growth parameters, including shoot initiation, root...

1Md. Faruq Hasan, 2Nazmunnahar Kolpona, 3*Atia Shahin, 3Md. Rayhan Sojib and 3Susmita Sarmin

... annual income, and mass media contact, respectively. Thus, to enhance farmer engagement and trust in government extension services, policy formulation should be aimed at proactive and collaborative communication, emphasising tailored solutions, building a strong extension network, maintaining transparency, arranging digital platforms, targeted awareness campaigns, and practical training.

...

Dalia Hamid Mansour1, Mohamed Elshabrawy Ghanem2, Marwa Hassan3, Yousry Ibrahim4, Ibrahim M. Hegab5*

...logical investigations immediately. Final body and carcass weights were significantly (P=0.007 and P= 0.009, respectively) improved in groups (AandC) received Biocid® (13.5% and 8.7 %, respectively) as well as an elevated levels of albumin (P=0.03) in group A (8.8%) compared to groups B and C. while the other biochemical parameters including total protein, liver enzymes, creatinine Alkaline Phosphatase and urea in serum did not show any significant alterat...

Mona F. Shousha1*, Aml M. Ragab2 and Salwa M. Helmy1

...a-lactamases and plasmid-mediated quinolone resistance genes in Salmonella isolates. First, 800 internal organs (heart, liver, intestine, and yolk sac) were collected from 200 infected broilers to genetically analyze their recovered Salmonella antimicrobial resistant genes. Ten isolates of Salmonella were recovered: two (20%) for each S. enterica serovar Grampian, S. enterica serovar Kentucky, and S. enterica serovar Blegdam and then one (10%) for each S. ente...

Naglaa A. El-Taib1*, Asmaa T. Talayea2, Hanan R. Ghanayem3

... cannot grow on standard media but retain certain features of viable cells, such as cellular integrity, metabolic activity, and virulence. Therefore, this study examined the effect of chlorine and hydrogen peroxide as common chemical sanitizers on inducing E. coli O157 into a VBNC state. The results showed that after 30 minutes of treatment with 200, 100, or 50 ppm chlorine, the numbers of culturable E. coli significance P<0.05 dropped (100%) from 6.93&plus...

Wan Nurfarzana Wan Mohamad Zani1, Norrizah Jaafar Sidik1*, Asmah Awal2, Nurul Izzati Osman3, Lyena Watty Zuraine Ahmad1 and Mohd Khairi Nordin4

...liquid and semi-solid MS media. In vitro nodal segments were initiated on MS media supplemented with 4 mg L-1 BAP and 0.5 mg L-1 IBA. Subsequently, after four weeks, a cluster of shoots, varying in numbers (3, 4, and 5 shoots per propagule), were cultured in the same media for shoot multiplication. Propagules with three shoots exhibited the highest multiplication rate, showing a 4.9-fold i...

Noorulhuda A. Mahdi, Nadia H.R. AL-Falahi*

...uated radiographically immediately after operation then every two weeks till 12 weeks post operation to observe the bone formation and bridging of segmental bone defects. The results indicated a new bone formation and mineralization on radiographs in both treated groups at 4th week post operation, a partially bridging of the segmental defect in a straight direction in the FSB group was seen at 12th week post operation , while a complete bridging in a straight ...
Sanaullah Sattar1, Ali Hussain2*, Javed Iqbal Qazi2, Arshad Javid1 and Shahid Mehmood1
...steel coupons in aqueous media with and without the addition of nutrients of Postgate B medium. For the purpose, SRB strain was isolated from a highly polluted wastewater stream flowing in Lahore, Punjab, Pakistan. The bacterial isolate was motile, Gram-negative, non-spore former and identified as Desulfovibrio vulgaris after 18 S rRNA gene sequencing. The corrosive action of the bacteria was assessed in a 60-day trial of anaerobic incubation. After an incubat...

Shaza N. Alkhatib1, Rasha M. Ghoneim2, Hend M. Tag2,3, Hekmat M. Tantawy2, Heba M.A. Abdelrazek4*

...oestrogens mitigate cell mediated immunity perturbations caused by ovariectomy besides, the influence of 1 month of their dietary withdrawal on the same parameters. Therefore, forty-two female Albino rats were subjected to ovariectomy then divided into six groups. Experiment I: 3 groups (7 each); group A, served as control, received based casein diet, group B, fed low dietary soy (6.6%) for one month, and group C, fed high dietary soy (26.41%) for one month. E...

Song Jiang1,2,3, Zhenhua Ma1,2, Falin Zhou1,2, Xu Chen1, Jing Hu1, Rui Yang1, Shengjie Zhou1, Yundong Li2 and Qibin Yang1*

... and glutaraldehyde. The median lethal concentrations (LC50) of bleaching powder, dibromohydantoin, methionine iodine and glutaraldehyde were 14.24 mg/L, 28.21 mg/L, 55.01 mg/L and 68.51 mg/L, respectively after 24 h of treatment. However, 48 h post-treatment, the LC50 were 11.26 mg/L, 10.15 mg/L, 30.24 mg/L and 36.71 mg/L, respectively. The safe concentration (SC) of tested disinfectants were recorded to be 1.93 mg/L, 0.41 mg/L, 2.73 mg/L and 7.81 mg/L for bl...

Yonghong Ma1, Jinlan Ma2, Qifu Zhang3, Huajie Zou1 and Shenghua Ma1*

...nship between TGF-β-mediated P53 and microRNA-related signaling pathways and the occurrence and development of diabetic nephropathy. The sample of rats was randomly assigned to a control group and an experimental group, and a rat model of diabetic nephropathy was established. After the establishment, HE staining, immunohistochemical staining and real-time quantitative PCR were performed to compare the groups. The situation after the successful model creat...

Mohamed E. Enany1, Ahmed M. Hamouda2, Reem M. Khashaba3*

...ere examined toward intermediate resistant strains of Escherichia coli, Salmonella typhimurium and Klebsiella pneumoniae. Among the plant extracts used, cloves showed a broad antimicrobial spectrum three examined strains with inhibition zones between 17-19 mm followed by garlic with inhibition zones between 16-18 mm and rosemary with 8-13mm. Meanwhile Ficus sycomorus and Ziziphus spina-christi have no effect against the three tested strains. Combinations of th...

Hina Jabeen*, Usman Irshad, Kainat Azhar, Alisha Fatima, Asma Zaheer Abbasi, Tayyaba Sadia and Jaweria Aqeel

...while Cd showed the intermediate concentration throughout in all fish species. Results showed that the concentration of Pb and Fe exceeded the limit of WHO and FAO which is the potential threat specifically the marine species due to their high consumption rate.

...

Salma Ali Munshed*, Fadwa Abdul Razaq Jameel

...s was done using special media for hydrolysis albumin, hemolysis action and microplate technique for biofilm formation. This study showed a high percentage of Aspergillus spp.; at 42%, which included (Aspergillus flavus, Aspergillus niger at 18% respectively and Aspergillus terreus at 6%), The second fungus which isolated was penicillium spp. at 24% which also appeared an opportunistic filamentous fungal infections in dogs, with other fungi isolated at 34%. Al...

Hayder A.H. Al-Mutar*, Baqer J. Hasan, Khawla Abbas Hussein, Souhayla Oneeis Hussain

...cted to Stuart transport media, before planted in blood agar media to identify the number of colonies counted. The bacteria was confirmed by Gram’s staining and biochemical tests. The PCR products from the bacterial samples were genetically analyzed (Al-Mutar et al., 2018). The result show that the most bacterial present in bovine vagina were Streptococcus thermophilus and Streptococcus uberis (92.65%) while the lowest...

Mohammed A. Hamad1*, Murtadha Abdule Mahdi Al-Mudhafar2, Alaa Fayeq Habeeb3, Firas R. Jameel1, Ismael Raheem Al-Muhana2, Najemaddin A. Hamad5

...by using viral transport media from the period between October 2022 and April 2023 and were utilized by time PCR (RT-PCR). Thus, the virus was identified by employing this technique, which is a more precise and sensitive method of detection. The system utilized for nucleic acid extraction was RT-PCR compatible, and successfully extracted the virus’ genome and detected the suspected animals with RSV. Were calves’ male RSV infection with a prevalence...

Layla S. Laylani1, Wijdan I.A. Abd-Alwahab2, Hanan Shihab Ahmad3, Mohammed Ahmed Mustafa2*

...iation exposure period immediately before therapy. The research project comprised 28 male albino rats were distributed into 4 groups, every group containing seven animals. The findings revealed a considerable increase (P< 0.05) of urea, creatinine and uric acid concentrations in the UV radiation-exposed group relative to the control group. We have observed a significantly reduced in urea, creatinine and uric acid in all groups receiving a probiotics of L. a...

Soumble Zulfiqar* and Abdul Rauf Shakoori

...esistance in bacteria is mediated by regulatory systems that sense and respond to metal stress. In this study, the CusS and CusR from a copper-resistant Klebsiella pneumoniae strain were explored, which form a two-component regulatory system crucial for copper detoxification. The genes were successfully amplified and cloned into a vector. Their sequences were obtained through commercial services. The corresponding protein sequences were deduced and a comprehen...

Constant Boris Bankole1, Ignace Ogoudanan Dotche1*, Serge Gbênagnon Ahounou1, Mahamadou Dahouda2, Issaka Youssao Abdou Karim1, Marcel Senou2

... improved pigs, and intermediate in Pietrain and their crosses with improved pigs. There was a significant difference in coat color between the genetic types (p < 0.001). The prevalence of black coat was significantly higher (p < 0.05) in local pig (100 %) and their crossbred(95 %), whereas white coat was more prevalent in improved pig (91.7 %) and their crossbred (90 %). Local and improved pigs exhibited a greater prevalence of long, thin snout (60 to 6...

Roheena Abdullah*, Kinza Nisar, Afshan Kaleem and Mehwish Iqtedar

...3. The Five fermentation media were also screened. The Medium2 gave higher titer of alpha amylase activity 1qand found to be the best medium. Different parameters including time and temperature of incubation, pH, Inoculum size, volume, carbon and nitrogen sources were also tested. Optimal enzyme production was obtained at 72 h, 30C, pH5.5, Iml inoculum, 50ml volume and 1.5% lactose and 1% yeast extract.

...

Asmaul Khusna1, Mujtahidah Anggriani Ummul Muzayyanah2, Tri Anggraeni Kusumastuti2, Ahmad Romadhoni Surya Putra2

...airy goat farms, 27 intermediaries, and 7 dairy company representatives. Potential failures were found using the SCOR matrix. FMEA was then used to assess and analyze risks, considering the frequency of occurrence (O), severity (S), and detectability (D) of each failure. The higher the calculated RPN value, the more likely the failure is to occur. The identification results show that the 3 risks with the highest values are fluctuating milk prices, milk quality...

Sigit Bintara1*, Diah Tri Widayati1 and Pradita Iustitia Sitaresmi2

...by reducing free radical-mediated oxidative stress during pre-freezing or after thawing.

...

Iqra Javed, Beenish Maqsood* and Muhammad Khurshid*

...temperature. Best liquid media was Czapek 2 for R. marisflavi that produced 583 U/mg enzyme and TSB for B. cereus that gave 250 U/mg L-asparaginase; while Corn cob as solid substrate facilitated L-asparaginase production maximally by both strains. The supplementation of metal ions altered L-asparaginase production differently. However, addition of Mg+2 under optimized fermentation conditions magnified L-asparaginase production to 882.35 U/mg by R. marisflavi a...

Wakeela Gul Mughal1, Muhammad Younis Laghari2*, Zameer Ali Palh2, Summaiya Rajput2, Ikram Hussain3, Punhal Khan Lashari2 and Maryam Sheikh2

...e regression value shows median correlation (r2=<0.8) except L. barbus (r2=0.852) for all other four species. The present investigation is likely to be useful for application in fish biology and fisheries management.

...

Zarifshan Malik1, Muhammad Ramzan Ali2*, Hasina Basharat2, Aziz Ahmed2 and Sabina Noor1

...f activation or dilution media. Therefore, the lab prepared activation media A and B, commercial activation media C and fresh water were used in this experiment to compare their effects. Experimental layout was CRD (Complete Randomized Design) with four treatments: control, media A, media B and

Ariani Trisna Murti1, Budi Hartono1*, Hari Dwi Utami1, Tri Wahyu Nugroho2, Tina Sri Purwanti1, Jaisy Aghniarahim Putritamara1

...to pay (WTP), which is a mediating variable. Additionally, WTP, and these factors, significantly influence key outcomes like product stability, habitual buying, recommendations, and repurchase intention. Notably, the study underscores the mediating role of WTP, highlighting its importance in bridging the effects of consumer characteristics on purchase intentions. Based on these findings, the study suggests several practical ...

Sofia Azirar*, Abdelghafour El Hamzaoui*, Mouloud Lamtai, Mohamed Yassine El Brouzi, Aboubaker El Hessni, Abdelhalem Mesfioui

...els of Hg that may not immediately show overt toxicity. 24 rats received either NaCl 0.9% (control group) or mercurial chloride (HgCl2) via intraperitoneal injections at 0.25, 0.5, or 1 mg/kg for eight weeks. Behavioral evaluations included the open field (OFT), elevated plus maze (EPM), and forced swimming tests (FST) for anxiety and depression assessments, alongside the Y maze and Morris water maze (MWM) tests for memory and learning. In addition, markers of...

Adel K. Madbouly

Volume 2, Issue 3 May and June 2018 Pages 48-52
...CA) or bioagent. Microbe-mediated biological control is considered safe as being close to the natural eco-systems (Coleman-Derr and Tringe, 2014). There are two general ways of applying biocontrol agents against phytopathogens; through addition of large amounts of bioagents to the soil or stimulating the activities of the existing bioagents using various amendments (Conrath, 2011).

...

Rawia F. Gamal

Volume 2, Issue 6 November and December 2018 Pages 101-104
...reat potential for the remediation of polluted environments. The colonization patterns and activities of inoculated endophytes in the rhizosphere and endosphere of host plant are among the primary factors that may influence the phytoremediation process. However, these patterns and activities are in turn controlled by none other than the host plant itself. The plant endosphere contains diverse groups of microbial communities....
Samia Sharafat1, Dildar Hussain Kalhoro1*, Muhammad Saleem Kalhoro1, Shahid Hussain Abro1, Mazhar Hussain Mangi1, Azhar Ali Laghari2, Ali Raza Nizamani3, Abdul Ahad Soomro3, Rani Wagan1, Asmatullah Kaka1, Abdullah Channo1, Hubdar Ali Kolachi4, Muhammad Ibrahim Panhwar4 and Mehkar Hussain5
...nd cultured on selective media for the isolation and identification; mannitol salt agar for Staphylococus aureus (Staph. aureus), Salmonella Shigella agar and brilliant green agar for Salmonella and MacConkey agar for Escherichia coli (E. coli.). Furthermore, biochemical tests were performed for the confirmation of bacterial species. Overall, 19%, 35% and 56% prevalence were found for Staph. aureus, Salmonella and E. coli, respectively. Antimicrobial resistanc...
Habtamu Tedila1*; Addisu Assefa1; Feto Haji
Novel Research in Microbiology Journal (2019), 3(1): 190-203
...stems, and Th1-type cell-mediated immunity (CMI) is required for clearance of this fungal infection. Candida albicans is an opportunistic pathogen of humans and has a parasexual cycle that appears to be stimulated by environmental stresses. Aspergilli represent the most common pathogenic species especially for ...

 

Muhammad Junaid1*; Ayesha Bibi2; Musharaf Ahmad3; Muhammad Ali4; Yousaf Noor5

Novel Research in Microbiology Journal (2019), 3(2): 314-325
...species-specific primers-mediated Polymerase chain reaction (PCR) was carried out. Two specific primers i.e. forward primer: 5'GTCGCCGTCAACTCACTTTCC3', and reverse primer: 5'GTCGCCGTAGCAATGCGGAATCG3', were used for amplification of the 281bp band. Twenty five isolates out of the 29 were genetically confirmed to be R. solanacearum based on their amplified 281bp band.

...

 

Adeniyi O. Adeleye1*; Mohammed B. Yerima2; Michael E. Nkereuwem3; Victor O. Onokebhagbe3; Peter G. Shiaka2; Florence K. Amoo2; Ibrahim K. Adam4

Novel Research in Microbiology Journal (2019), 3(5): 471-484
... for application in bioremediation of heavy metals.

...

Hafsa Zaib1; Rabia Kanwar1; Nishat Zafar1*; Sultan Ali1

Novel Research in Microbiology Journal (2019), 3(6): 526-534
...ated on suitable culture media including; nutrient agar, MacConkey’s agar and blood agar to isolate the bacterial pathogens. Identification of the bacterial cultures was carried out by observing the cultural and macroscopic characteristics including Gram staining. Further verification of these bacterial cultures was carried out using appropriate biochemical assays. The biochemical assays were performed for characterization of Staphylococcus aureus, Staph...

Muhammad Evan Magistrama1, Dio Fico Felsidan Diatmono1, Mira Tsurayya Masruroh1, Fransisca Gani Padmawati1, Pradita Iustitia Sitaresmi2, Yustina Yuni Suranindyah3 and Diah Tri Widayati1*

...l cells (parabasal, intermediate, and superficial), the score of salivary fern patterns, and vaginal pH value. All the data were analyzed using One-Way ANOVA. The results showed significant differences in vaginal epithelial cells, salivary fern patterns scoring, and vaginal pH values across the different estrus phase (p<0.05). In conclusion, vaginal cytology, salivary ferning, and vaginal mucus pH value were effective in identifying the estrus cycle in trop...

Malathi H1*; Pooja Sharma2

...c of in-situ microbial remediation of heavy metals (HM) in the industrial
wastewater. Due to the ever-expanding industrial sector; groundwater contamination by HM is
a global environmental crisis. Heavy metals; environmental pollution, and the adaptive
mechanisms that allow the bacteria to thrive in the metal-contaminated environments, have all
been linked to the dramatic shifts in the microbial diversity, which ...

Anjana Suresh*; Grasian Immanuel

...here is a feasible and immediate
need to produce ecologically compatible low-toxic and harmless antifouling compounds for
the maritime companies and underwater equipment; since the usage of Tributyltin (TBT)
based marine coatings was banned globally in 2008. In recent years; the marine natural
products have emerged as one of the most potential forms of antifouling agents. Although the
natural antifoul...

Andrei V. Kozlov1,2; Artem V. Lyamin1; Aleksei A. Neilenko1; Anna V. Yanchenko1; Alena A. Ereshchenko1,2*

...;-amyloid peptide in the medial regions of
the temporal lobe and the neocortical regions of the brain. It is impossible to name the sole
cause of Alzheimer's disease; however, the features of pathogenesis of this disease are known,
including cholinergic deficiency; beta-amyloid toxicity, hyperphosphorylation of a
microtubule-associated protein Tau, synaptic dysfunction, oxidative stress, and neuroinflammation.

 

David C. Nwobodo1,5*; Chibueze P. Ihekwereme2; Chinedu J. Ikem3,5; Festus B.C. Okoye4

Novel Research in Microbiology Journal (2020), 4(3): 845-855
...ate fermentation on rice media at 28oC for 21 d. The fungal secondary metabolites were extracted using ethyl acetate, and then concentrated under vacuum. The fungal crude extracts were screened for their antibacterial activities against clinical and laboratory strains of P. aeruginosa, using the agar diffusion method. The bioactive components of the fungal extracts were identified using High-Performance Liquid Chromatography-Diode Array Detector (HPLC-DAD) ana...

 

Hosam, El-Sayyad1, 2; Khaled, F. Elyasergy3; Tahany, M. Abdel Rahaman3; Moustafa, A.S. Aly1, 4; Menna Allah, Ashraf 1*

Novel Research in Microbiology Journal (2020), 4(5): 979-991
...nsidered as an effective mediator for bioremediation of heavy metals, due to its higher surface area and extensive hyphal density in the soil. About seven fungal spp. were isolated from the soil garden of the Middle Eastern Regional Radioisotope Center for Arab Countries (MERRCAC); however, a single isolate of Aspergillus japonicus with high potential of metals biosorption was selected for further research during this work. ...

 

P. I. Orjiakor*

Novel Research in Microbiology Journal (2021), 5(3): 1269-1282
... hence the need for bioremediation. This study aimed to investigate the in vitro biodegradation of acrylic based paint; using an indigenous bacterial isolate namely; Alcaligenes faecalis and optimization of its activity in shake cultures. The bacterial isolate; A. faecalis (2 % v/v) was able to grow and effectively degrade 68 % of acrylic paints (1 %) amended mineral salt medium after 14 d of incubation. The rate of biodegradation was significantly (p< 0.05...

Rutuja S. Patankar1; Vasudeo P. Zambare2,3*; Mohanadoss Ponraj4

Novel Research in Microbiology Journal (2021), 5(5): 1371-1391
...oduction, genetics, bioremediation and other aspects. The aim of the current study was to explore the halophilic and halotolerant fungi, which are least explored for their habitats, growth requirements, and mechanism for salt resistance and tolerance. This will be followed by their biotechnological applications focusing on the biomedical industry, due to the emergence of the new multi-drug resistant pathogenic microbes.

...

Olubusola A. Odeniyi*; Ladi Turaki

Novel Research in Microbiology Journal (2022), 6(3): 1557-1582
...Phosphate (NBRIP) growth media. The isolates of Penicillium sp. (PSF-8) and Bacillus sp. (PSB-29) produced the highest alkaline phosphatase at pH 8, 42οC on the 2nd and 3rd d of incubation; and they solubilized concentrations of 937.78 and 848.89 μg/ ml of phosphates, respectively. The optimum temperature and pH activity of the alkaline phosphatase produced by Penicillium sp. (PSF-8) were recorded at 50°C (1.145 U/ ml) and pH 9 (1.147 U/ ml), re...

I Wayan Wisaksana Yasa1, I Wayan Teguh Wibawan2, Okti Nadia Poetri2*

...andidate for an IBD intermediate-plus vaccine master seed.
 
Keywords | Infectious bursal disease (IBD), Pathogenicity, Immunogenicity, Live vaccine, Poultry vaccination, Intermediate-plus
...

Zheng Han1, Junbo Liu2, Jingyao Luan2, Changlong Gao2, Yufeng Tai2, He Liu2, Saipeng Zhang2, Guanqiang Zhai2, Xi Yang1,3, Haitao Wang1,4*

...rroundings, and the intermediate value of NDVI, edge density, and patch richness can contribute to a relatively low pylon use rate. Our results provide evidence to identify and predict high-risk regions where high-voltage pylons and power lines might be located. It also has conservation implications when building artificial nesting platforms on suitable pylons to create new habitats for target species.

...

Hanadi J. Al-Zubaidi1*, Shatha Mousa Mlaghee Al-Safi2, Asseel Abdulateef Abdulzahra1, Saadia Saleh Mehdyal-Zeiny2, Nadia K. J. Al-Dawah2, Zainab Abbas Al-Asadi3

...ium dichromate (K2Cr2O7) mediated liver toxicity. Also, that treatment with crude WEE reduced bad lipid serum levels significantly. The histopathological results showed the negative group showed atypical texture without any significant obvious lesions. While positive group in the potassium dichromate (K2Cr2O7), the liver showed severe hydropic degeneration and necrosis of hepatic cells. In case of crude methanolic extract of Eggplant (MEE), the histopathologic...

Alfinira Sekar Rosiyanti1, Muhammad Abrar Zulkarnain2, Lovita Adriani3*, Andi Mushawwir3

... Rogosa and Sharpe (MRS) media and incubated at 37°C for 24 hours. The statistical data were analyzed using Analysis of Variance (ANOVA) and Duncan’s multiple range test. In this study, feed conversion ratio (FCR) was measured by comparing the amount of ration consumed with the weight of eggs produced, and hen-day production (HDP) was determined by collecting the number of eggs each day by comparing the number of hens on that day. In contrast, egg we...

Salwan A.Z.J. Allobawi1*, Ali Ajil Al-Haidery2, Malik H. Karem2 and Adeeb Kitab Abdul Zaid Al-Shafiee3

... 51.94% on solid culture media (PDA). In liquid media (PDB), which was used to measure the wet biomass weight, stimulation effects were observed with Spartan and Bestor on A. terreus, A. flavus, A. clavatus, and B. cinerea. For Appland, significant interactions were observed with A. terreus, achieving biomass increases of 39.91%, 14.54%, 70.62%, 13.16%, 34.95%, 48.35%, 25.83%, 4.02%, and 59.27%, respectively. Furthermore, dr...

Jassim M. Khalaf Albozachri1*, Hameed A. AL-Timmemi2

...the hemisection cavity immediately post-surgery. Motor and sensory functions, including gait, proprioceptive posture, and nociceptive responses, were assessed weekly using the open field locomotor scale from the first week until the 16th week post-operation. Throughout the study, the analysis revealed no significant differences (p < 0.05) in motor and sensory outcomes between the placenta powder and stem cell groups. However, at the 16th week post-surgery, ...

Anwar A. Maki* and Asaad M.R. Al-Taee

...justify;">Petroleum bioremediation is internationally recognized as a cost-effective and ecologically sustainable solution. The aim of this study is isolating and identifying the PPFM bacterium from oil contaminated soil. So, this bacterium was isolated from soil samples collected from Rumaila oil field in Basra, southern Iraq, using a mineral salt medium (MSM) complemented with 1% methanol as the only carbon and energy source. Genetic identification of the pr...

Mashael Alhumaidi Alotaibi*

...ast cancer cells, likely mediated through the induction of apoptosis and modulation of apoptotic gene expression. These results contribute to a better understanding of the potential therapeutic benefits of lemongrass extract in cancer treatment.

...

Minghui Xiao, Minjie Huang, Jie Dong and Deqian Wang*

...elayed allergic reaction mediated by cellular immunity. P815 degranulation model was established by stimulating P815 cells with C48/80 inducer to explore the effect and mechanism of quercetin on mast cell degranulation. The ACD model of mice was established by 1-Chloro-2,4-dinitrobenzene (DNCB) external application to explore the therapeutic effect and mechanism of quercetin and Ginkgo biloba leaves extract on ACD. Quercetin could inhibit degranulation of P815...

Wen-Da Wang1, Wei-Yue Gong1, Bin Li2, Shan-Shan Lei3* and Qing-Hua Wang1*

...">Psoriasis is an immune-mediated skin disease with a high incidence, it has been demonstrated that particular long non-coding RNAs (lncRNAs) are vital in psoriasis. However, their exact functions and regulatory mechanisms in psoriasis remain unclear. In this study, GSE142582 and GSE54456 datasets from GEO database were used to screen differentially expressed microRNAs (DEmiRNAs) and mRNAs (DEmRNAs) between psoriatic lesions and normal skin. Gene ontology (GO)...

Li Yang1, Xuliang Ma2 and Chao Wang1*

...d: experimental group (immediate implant placement + implant covering PRF, n=40) and controls (immediate implant placement, n=27). The patients were followed up for 6 months to evaluate the treatment effect. The osteogenesis ability of the two groups at different time points and the state indicators around the implant before and after treatment were observed. At different time points after operation, the bone width and bone ...

Basir Ahmad1, Lubna Ansari1*, Shazia2, Saqib Mehmood3 and Nasim Iqbal Butt3

...e appropriate functional media, the bacteria were isolated. They were then identified using molecular and specific biochemical properties. Their functional quantitative activities and PGP properties were evaluated using the phosphate solubilization test and the production of indole-3-acetic acid (IAA). Based on their individual high functional activities, root and shoot lengths, and improvements in seedling vigor, the study results revealed the numerous PGP fe...

Majharul Islam1, Swagata Das Gupta1, Mohammad Anisur Rahman2, S.K.M. Azizul Islam3, Nazmul Hasan1, A.K.M. Saifuddin3, Md. Shohel Al Faruk3*

... completely because of immediate diagnosis, prompt intervention, adjuvant therapy, analgesics, antibiotics, and antiseptic.
 
Keywords | Bone fracture, X-ray, Metalic plate, Gaseous anesthetics, Surgery, CBC
...

Fangyi Hao1, Tian Tian1, Zhen Yang1 and Jiaxin Zheng2*

...regression, and weighted median estimator (WME). Intercept term of the MR-Egger method was adopted to assess the SNP sensitivity. Genes regulated by SNPs were identified in the eQTL database, and the intersecting target genes were subjected to GO analysis. Furthermore, interactions among proteins were predicted using the Search Tool for the Retrieval of Interacting Genes (STRING) database.47 SNPs related to Scr and CKD were identified in the retrieved GWAS dat...

Pakistan Journal of Zoology

November

Pakistan J. Zool., Vol. 56

Featuring

Click here for more

Subscribe Today

Receive free updates on new articles, opportunities and benefits


Subscribe Unsubscribe