Submit or Track your Manuscript LOG-IN

Sehrish Kanwal1, Ali Saeed1*, Muhammad Munir2, Memoona Arshad1

 

Life Sciences International Journal Issue 7 Volume 1
... field samples including tissues, vesicle and secretion. The direct sequencing and subsequent analysis of amplified PCR products for VP1 gene indicated the circulation of serotype O of FMD in studied areas. Moreover, using serotype-specific primers (SA(F)/SA(R)) which target the VP1 gene, serotype O was confirmed in all representative samples. As high as 98% nucleotide sequences similarity was determined between the representative strains. Furthermore, these s...

Sehrish Kanwal, Ali Saeed, Muhammad Munir, Memoona Arshad

 

British Journal of Virology
... field samples including tissues, vesicle and secretion. The direct sequencing and subsequent analysis of amplified PCR products for VP1 gene indicated the circulation of serotype O of FMD in studied areas. Moreover, using serotype-specific primers (SA(F)/SA(R)) which target the VP1 gene, serotype O was confirmed in all representative samples. As high as 98% nucleotide sequences similarity was determined between the representative strains. Furthermore, these s...

Sehrish Kanwal1, Ali Saeed1*, Muhammad Munir2, Memoona Arshad1

British Journal of Virology
... field samples including tissues, vesicle and secretion. The direct sequencing and subsequent analysis of amplified PCR products for VP1 gene indicated the circulation of serotype O of FMD in studied areas. Moreover, using serotype-specific primers (SA(F)/SA(R)) which target the VP1 gene, serotype O was confirmed in all representative samples. As high as 98% nucleotide sequences similarity was determined between the representative strains. Furthermore, these s...

Chun-Yi Lin1, Meng-Ling Wu2, Tang-Long Shen1, Hsin-Hung Yeh3, Ting-Hsuan Hung1*

 

...so occurred in different tissues of citrus. Two multiplex molecular detection methods provide the understanding of the genetic diversities among viroid isolates and quantify viroids in citrus host. Our field survey can help clarify citrus-viroid relationships and develop proper prevention strategies in the near future.

 

...

Suresh V Kuchipudi* and Kin-Chow Chang

 

...e astounding and unusual tissues in the body in its ability to undergo dramatic phenotypic changes in response to physical demands, age and disease. The contributions of skeletal muscle to immune response and virus pathogenesis are increasingly recognized. Recent evidence strongly indicated that skeletal muscle cells fully support productive replication of influenza A virus (IAV) and could play an important role in disease outcome. We are of the opinion that ...

Hu Zenglei1 and Xiufan Liu1, 2*

 

..., especially in lymphoid tissues. Genotype VIId of NDV, which is currently endemic in many countries of Asian and Middle East, replicates at a significantly higher level, induces more potent innate antiviral and inflammatory response, and causes more severe damages in lymphoid tissues when compared with virulent viruses of other genotypes. Therefore, severe pathology in immune organs, caused by genotype VIId of NDV, is assoc...

Brittany D. Rife 1,2, Marco Salemi 1,2*

E-mail | salemi@pathology.ufl.edu

...gration between infected tissues and cell types, provides valuable insight into immunopathological processes, and ultimately paves the way for a better understanding of the interplay between viral evolution and pathogenesis.

...

Jonas Johansson Wensman1*a, Karl-Johan Leuchowius2,3 a, Jiting Yan1, Anna-Lena Berg4, Liv Bode5, Hanns Ludwig5, Sandor Belak6, Ulf Landegren2, Ola Soderberg2, Mikael Berg6

...to detect BDV P in brain tissues of infected animals. Finally, protein-protein interactions were visualized in both C6BV and brain tissues of experimentally as well as naturally infected animals (rat and horse, respectively). BDV proteins and their interactions with host proteins could be shown in cell cultures (HMGB1, Cdc2) and in brain tissues of rat (HMGB1, Cdc2) and horse (Cdc2 only) i...

Sania Subhan Qureshi, Mian Saeed Sarwar and Zahir Shah

...ass from the surrounding tissues. Peritoneum, muscle and subcutaneous tissues were sutured with absorbable suture (vicryl; polyglactin 910) and skin with a non-absorbable suture (silk). Owner was advised for daily check-up for any damage to the stitches and for regular dressing of the wound with antiseptic. Antibiotics and analgesic was recommended for 3-5 days respectively. As per feedback of the owner, the wound was healed...

G.E. Odo1*, E.J. Agwu1, N.I. Ossai2, C.O. Ezea3, J. Madu1 and V. Eneje2

...esults on gill and liver tissues sampled showed concentration and time dependent significant increase (p < 0.005) in the values of malondialdehyde, catalase, superoxide dismutase, reduced glutathione, alkaline phosphatase (ALP), alanine aminotransferase (AST) and aspartate aminotransferase (AST). Similarly, aluminium phosphide enhanced levels of AST, ALT and ALP as both concentration and time dependent in elevation were recorded when compared to the control...
Önder Duysak*andKübra Azdural
...la caerulea L., 1758 tissues collected from eight different sampling stations of Iskenderun Bay. The concentration of heavy metal in P. caerulea tissues tended to vary significantly between season and stations.The distribution of heavy metals in P. caerulea followed in their muscular tissues in order; Çevlik > Kaleköy> Payas > Arsuz > Dörtyol ...
Sadaf Ijaz Malik1, Kiran Afshan2* and Mazhar Qayyum1
...phological studies. Bile tissues, aspirates and blood samples of the same animals were analysed. The infection was found prevalent throughout the year but during post monsoon season it was relatively high. Morphological identification of G. expalanatum was carried out on the basis of size and shape of worm. The hematological and bile biochemical changes were found in two groups. Pathologically significant changes were observed in the infected tissue. Th...
Hui Zhang2, Yajing Wang2, Kun Li2, Mujeeb Ur Rehman2, Fazul Nabi2, Rui Gui2, Yanfang Lan2 and Houqiang Luo1,2
... of tumors in connective tissues and other visceral organs. To evaluate the status of lymphoid leukosis virussubgroup A (ALV-A) infection in free-range chickens in five different cities of Anhui province, a total of 732 serum samples were analyzed through enzyme-linked immuno sorbent assay (ELISA) in 2015 and 2016. The diagnosis of avian leukosis virus subgroup A (ALV-A) infection was confirmed by necropsy, histopathological examinations and PCR analysis. The ...

Honnur Basha, Vinaya Hemannavar, B.Ramanujam, R. Rangeshwaran and S.Sriram 

Screening of chilli microflora and other biocontrol agents for their antagonistic effects on Colletotrichum spp. infecting chillies
...nside the leaf and fruit tissues, respectively. Among them, 70 fungal isolates belonged to plant pathogenic genera like,Alternaria, Cercospora, Colletotrichum, Curvularia, Glomerella, Mycosphaerella, Phoma and Stemphylium and the other 24 isolates of fungi belonged to Aspergillus, Acremonium, Chaetomella,Cunninghamella, Geotrichum, Gliocladium, Monodictys, Mucor, Myrothecium, Penicillium, Periconia and Pithomyces. One-hundred and thirteen isolates of chilli mi...
Beenish Zahid1,*, Asim Aslam2, Zafar Iqbal Chaudhry2 and Raheela Akhtar2
...ing the liver and kidney tissues with histopathological effect on lymphoid organs of chicken.
...
Yasemin Bircan Yildirim* and Hediye Tugce Vurmay
...from gills and intestine tissues of commercially important finfish species: saddled seabream (Oblada melanura), gilthead sea bream (Sparus aurata), Bogue (Boops boops), horse mackerel (Trachurus mediterraneus), red mullet (Mullus barbatus), brushtooth lizardfish (Saurida undosquamis), grey mullet (Mugil cephalus), threadfin bream, (Nemipterus randalli), which were caught from the Iskenderun Bay at 6 diffe...
Baohua Chen1,2, Wenzhu Peng3, Jian Xu2, Jingyan Feng1,2, Chuanju Dong1,2 and Peng Xu2,3,*
...e established in various tissues, including brain, heart, spleen, kidney, intestine, gill, liver, skin, blood and muscle of common carp. Expression profiles provided us more evidences to understand GST gene functions as well as their functional evolution post duplication. Overall, the whole set of GST genes provide essential genomic resources for future biochemical, toxicological and physiological studies in common carp.
...
Yijin He1, Song Ma2, Bo Liu1,*, Ting Xue1, Qunlan Zhou1, Wu Jin1 and  Kui Chen2,*
...l expression spectrum of tissues in combination with bioinformatics analysis so as to understand the possible functions in response to chemical sensation behavior of taste receptors. The receptors when compared with T. rubripes, there was 99.2% identity in two kinds ORF sequences, with only 7 bases different, and there were 5 amino acids different between speculated fusion proteins. Under bioinformatics analysis, the T2R1 gene without introns was...
Xue-yang Wang1, Shang-zhi Zhang1, Ming-hui Liu2, Dong Yu1, Yan Ma1, Dong-qiong Fei1, Hai-zhong Yu1 and Jia-ping Xu1,*
...rescence in all analyzed tissues, including head, midgut, hemolymph, fat body, testis and ovary. More importantly, the relatively high expression level of BmARM-like mRNA were observed in BC9 (near-isogenic line) following BmNPV infection as compared to P50 (susceptible strain), which was further validated in the midgut of A35 (resistant strain). The expression levels of BmARM-like protein showed similar trends with transcriptional levels in the midgut ...
Farid S. Ataya,1,2,* Dalia Fouad,3,4 Ajamaluddin Malik,1 Nikolaos E. Labrou,5 Mohamed S. Daoud1,6 and Hesham M. Saeed7
...n analysis in five camel tissues was examined employing real-time PCR. The highest level of transcripts was found in the camel testis, followed by liver, spleen, kidney and lung. CdGSTP1-1 was heterologously expressed in Eschericia coli BL21(DE3) as a ~24 kDa soluble protein and showed to be catalyticly active towards the model substrate 1-chloro-2,4-dinitrobenzene. The results of the present study provide new information into camelid evolution a...
Amtul Jamil Sami1,*, Madeeha Khalid1, Rehman Shehzad1, Sana Mughal1 and A.R. Shakoori2 
...weight gain for visceral tissues like kidney, liver, muscle and lungs was also observed, as compared to control subjects. It was also recorded that the exogenous supply of bubaline PL reduces fat cells in the hypodermal layer of skin.
...
Jing Xin Mao1,2, Guo Wei Wang2, Yuan She Huang3, Rui Wang2, Guo Ze Wang4, Bing Zeng1 and Fu Yuan Zuo1,*
...ne expression in various tissues between Rongchang pig and Landrace, we confirmed the expression of pig BPI gene in various tissues to determine the difference expression of antibacterial related gene among indigenous breed (Rongchang pig) and artificially cultivated breed (Landrace), The Rongchang pig (0 day old, 28 day old, 120 day old) and Landrace BPI (0 day old, 28 day old, 120 day old) gene were expressed in normal liv...

H.I. Hosein1, Sherin Reda Rouby1*, Ahmed Menshawy1 and Ahmed E. AbdAl-Ghany2 

... respectively. Different tissues specimens of 104 confirmed seropositive cows under investigation including, retropharyngeal, prescapular, prefemoral, internal iliac, supramammary lymph nodes, udder and spleen as well as milk of 46 lactating cows were subjected for bacteriological studies for isolation and identification of Brucella organisms. Brucella melitensis biovar 3 could be recovered from 64 (61.5%) tissue specimens and 28 (60.9%) milk samples. Brucella...
Serap Gelibolu1,*, Yasemen Yanar2, M. Ayce Genc3 and Ercument Genc4
... negative impact on body tissues and thus support the safe use of MOS in fish feed.
...
Lihong Qin1, Guoliang Zhang1, Chaojie Zhu1, Jian Wu1, Zhihui Zhao2,* and Yumin Zhao1,*
...in different bull testes tissues (1-day, 12-months-old and 24-months-old). In addition, genes mRNA and protein levels were detected after bull testicular Sertoli cells were transfected with miR-122 and miR-449a. Meanwhile, DUSP4, PDK4 and FKBP1B overexpression experiments were conducted. Eventually, MTT assay was performed to observe the cells proliferation. The results showed that miR-122 and miR-449a were highly-expressed in testis
Abd El-Nasser Ahmed Mohammed*
...und transplanted ovarian tissues. In addition, visible antral follicles and corpora lutea was demonstrated on the ovarian tissues upon transplantation. Histological examination indicated that transplanted young ovarian tissues restored function better than elder ones. It could be concluded that unilateral ovarian transplantation partially restored their developmental competence for produci...
Nazish Shaukat1, Muhammad Javed1,Faiza Ambreen2* and Fariha Latif1
...d adaptive mechanisms of tissues (gills and liver) against free radical induced toxicity.
...

 Arshad Ali, Imdad Ali Mahmood, Muhammad Salim, Muhammad Arshadullah* and Abdul Rasool Naseem**

GROWTH AND YIELD OF DIFFERENT BRASSICA GENOTYPES UNDER SALINE SODIC CONDITIONS
...c concentration in plant tissues and oil content in seeds were also determined. Comparatively more number of branches and pods per plant were produced by cultivar Dunkled closely followed by BARD-I while maximum seed yield (241.7 and -1 235.1 kg ha ) was obtained from Dunkled and Sultan Raya, respectively which was statistically at par. However, BRS-II and Rainbow showed significantly more percent oil contents in their seeds but genotype Dunkled showed minimum...

 Nazakat Nawaz*, Malik Shah Nawaz*, Mubashir Ahmad Khan*, Mirza M. Yasin*, Doulat Baig*, Nasir Mehmood Cheema**, Muhammad Amjad** and M. Altaf Sher**

EFFECT OF BORON ON PEANUT GENOTYPES UNDER RAINFED CONDITIONS
...tions in different plant tissues were higher in all genotypes as compared to control treatments during the two years. The boron using efficiency of peanut genotypes declined in the order of BARD-479 > ICG- 7326 > ICGV-92023. A boron fertilizer requirement observed for the -1 highest dry pods yields was 1.0 kg B ha for all genotypes and yield decreases gradually after certain level by increasing boron fertilizer rates.

...
Hao Zhang,1,2,3,* Hai Tao Nie,3 Tie Wei Ma,3 Zi Yu Wang3 and Feng Wang3
...butions in the main body tissues and the net requirements for maintenance and growth of F1Dorper × Hu ewe lambs. Thirty-five ewe lambs averaging 33.52±0.56 kg body weight (BW) were used. Seven ewe lambs were randomly chosen and slaughtered at 34.93 ± 0.37 kg BW as the baseline group for measuring initial body composition. Another seven lambs were also randomly chosen and offered a pelleted mixed diet (approximately concentrate : ...
Shagufta Andleeb*1, Shabana Shaukat1, Chaman Ara2
...rough bioaccumulation in tissues. Aim of present study was to analyze various developmental abnormalities by a sub-lethal dose of cadmium chloride and protective role of garlic (Allium sativum), to minimize the intensity of these toxicities. For this purpose, fertilized eggs of Gallus domesticus were randomly divided into four groups of forty eggs each. Control group was intact and untreated. Eggs of one group were injected with a sub-lethal dose...
Song Jiang1,2, Fa-lin Zhou3, Jian-hua Huang1, Qi-bin Yang1, Li-shi Yang1 and Shi-gui Jiang1,*
..., source of energy, with tissues and organs also important energy suppliers. The results of the present study will hopefully improve our understanding on the characteristics of feeding, gonad development, and energy conversion of P. monodon broodstock during their breeding season, and provide a theoretical foundation for the scientific cultivation of P. monodon broodstock.
...
Mohammed Al Bratty1, Hassan A. Alhazmi1, Somaya Jadoh Ogdi1, Jana Ahmad Otaif1, Abdul Jabbar Al-Rajab2, Mohammad Firoz Alam3 andSadique Akhtar Javed1,*
...g the least contaminated tissues. Importantly, the lead (Pb) content was found to be of serious concern in the tested chicken samples, as it was measured to be higher than its maximum permissible limit (0.1 mg/kg) in poultry meat set by WHO and European Union. The estimated daily intakes (EDIs) of the tested metals through the consumption of the Baladi chicken were found to be lower than their respective reference oral doses (RfD) set by USEPA. The non-carcino...
Tengfei Lu1, Wenhua Pei1, Shuang Zhang2, Yangnan Wu1, Fenghao Chen2, Xiao Han2 and Weijun Guan1,*
...a good many experimental tissues and organs were obtained from model animals but rarely from livestock. In this study, AMSCs were obtained from aborted sheep fetuses (1-3 month) under sterile conditions. Primary AMSCs were sub-cultured to passage 25 in vitro. The gene of Oct-4, Rex-1, CD29, CD44, CD71, and CD73 were identified by RT-PCR and immunofluorescence technique. The results showed that they were positive in AMSCs. The growth of different passage...
Tayfun Karataş
...rves in liver and muscle tissues of rainbow trout (Oncorhynchus mykiss). Eight-days of fasting caused a significant decrease in glucose, total protein, triglyceride, cholesterol, high-density lipoprotein and low-density lipoprotein levels as well as protein and lipid reserves in liver and muscle tissue of fish (p<0.05). The fasting period had no significant effect on the hepatic thiobarbituric acid reactive substances (TBARS), but, it caused a signif...
Hanif Ur Rahman1, Umer Saddique1, Zahoor-ul-Hassan1, Shakoor Ahmad1, Muhammad Kamal Shah1, Said Sajjad Ali Shah1, Farhan Anwar Khan1Fazli Rabbani2, Muhammad Asif Hussain2, Attaur-Rahman2, Irshad Ahmad3,4 and Sadeeq ur Rahman2,*
..., pleural fluid and lung tissues, and streaked into Pleuropneumonia like organism (PPLO) medium for isolation and identification of Mycoplasma species. Confirmed mycoplasma isolates were subjected to species specific PCR to identify members of MM cluster. Results revealed that 79/300 (26.3%) samples were found positive for the growth of Mycoplasma. MM cluster specific PCR showed 49 (16.3%) samples were found positive, of which 34 (11.3%) were fou...
Riaz Aziz Minhas1,*, Muhammad Nasim Khan1, Muhammad Siddique Awan1, Basharat Ahmad1, Syda Shaista Bibi1, Mohsin Hanif1 and Afsar Mian2
...es 64, hair 13, blood 5, tissues 4) from 5 geographic langur populations of Pakistan and Azad Jammu and Kashmir (AJK) and succeeded in extraction of DNA from 23 samples, which were used for further genetic analysis. RAPD makers (n=8) produced 245 bands (30.62±2.87 Mean±SE / primer) of different molecular weights (126-3342 bp), of which, 96 were population specific. Polymorphism was (37.71±5.29%; mean ± SE), with the highest in Muzaf...
Binbin Shan, Yan Liu, Changping Yang, Shengnan Liu and Dianrong Sun*
...s from four combined tissues (eyestalk, muscle, intestinal and viscus) using High-seq sequencing technology. A total of 65,703,216 high-quality clean reads were generated to produce 27,850 non-redundant transcripts with a mean length of 918 nt using Trinity and Tgicl software. For homological alignment, 13,083 unigenes had significant hits in Nr database. And then, 10,467 unigenes were annotated into three ontologies: biological processes, cellular compone...

 Khurram Shahzad1*, Muhammad Naeem Khan1, Farhat Jabeen2, Nasreen Kosour3, Muhammad Sohail1, Muhammad Khalil Ahmad Khan1, Munir Ahmad1

Bioaccumulation of manufactured titanium dioxide
...ticles in
various tissues (gills, liver and muscles). Ti and Cu accumulation in gills was
recorded to be 5.7033 and 3.7133 μg/Kg respectively,whereas, maximum Zn
accumulation (2375.3 μg/Kg) was observed in liver. It was concluded from the
present study that the strategy applied to assess the bioaccumulation of
nanoparticles in the soft tissues of fish is very useful tracking method to...
Shagufta Nighat1, Muhammad Sajid Nadeem1,*, Syed Israr Shah1, Amber Khalid1, Tariq Mahmood2, Ayesha Aihetasham3 and Muhammad Asif4
...n) concentrations in bat tissues through atomic absorption spectrophotometer. Our findings showed that metals were more concentrated in the liver and kidneys, Zn and Pb showed high mean values as compared to other metals but these values were below the lethal levels. Within the regions and sexes no significant variations were found in metal concentrations; however within three bat species metal concentrations varied significantly. This study provides baseline ...
Ghulam Ali1,3, Wopke van der Werf2 and Just M. Vlak1,
...in dissolution of larval tissues and accumulation of viral occlusion bodies) exhibited reduced food intake and weight gain relative to uninfected larvae. The unexposed larvae and the larvae that were exposed but survived exhibited the same food consumption and weight gain. This study did thus not reveal any sub-lethal effects of exposure to the virus on food consumption and weight gain. There was no viral dose dependency observed in food intake or weight gain ...
Fariha Latif* and Muhammad Javed
...significantly in all the tissues as compared to control. Catalase activity varied significantly at p<0.05 among C. catla, L. rohita and C. mrigala. During present research the maximum catalase activity was observed in the liver followed by gills, kidney, brain and muscles. As a conclusion, the sensitivity, bioaccumulation and antioxidant capacities of different fish species based on their ecological and physiological differences may be useful ...
Hua-Lun Luo, Yi-Yu Zhang*, Yuan-Yu Qin and Lei Wu
...xpressed in all examined tissues. ChREBP mRNA level was the highest in abdominal fat and the lowest in gizzard. The g.247075G>A silent mutation in exon 10 was first identified by direct sequencing approach, and resulted in three genotypes of AA, GA and GG. Association analysis demonstrated that the liver ChREBP mRNA expression level was significantly positive or negative effect on serum total protein (TP), albumin (Alb), triglyceride (TG), total cholesterol...
Iqra Bano1,*, Moolchand Malhi2, Pershotam Khatri3, Saeed Ahmed Soomro2, Hira Sajjad4, Ambreen Leghari5, Muhammad Awais2, Safia Kandhro6 and Shakeel Ahmed Lakho5 and Munaza Soomro7
...D activity in testicular tissues was also significantly increased in SY as compared to C. The results revealed that the SY supplementation has positive effects on gross morphological parameters of testis by increasing its weight, thickness, and circumference. Besides this, the SY also improved the height of germinal epithelium of Seminiferous tubule and improved antioxidant status by enhancing the activities of GPx and T-SOD in both serum and testicular
Luo Lei1, Xingxing Deng1, Dengyue Yuan2, Zonglin Zheng1, Chengke Zhu1, Hui Luo1, Baohai Li3, Hua Ye1,* and Chaowei Zhou1,3,*
... mRNA distribution in 21 tissues and investigated the effect of its expression at different nutritional levels. Herein, we found that gibel carp npy has an Open Reading Frame (ORF) containing 291 bp. Moreover, the expression of npy was detected in all tested tissues, with the hypothalamus showing the highest expression in gibel carp. The npy mRNA expression in the hypothalamus significantly decreased 1 a...

Zafrullah Khan* and Shah Alam Khan 

...otato, feeding on phloem tissues of leaves of potato plant and significantly reduces the yield of potato. Antixenosis experiments were performed to assess the resistance potential of eight different potato cultivars against M. persicae under glasshouse conditions for three different durations of time (12, 24 and 48 hours) during spring and autumn potato growing seasons of 2016. Both the experiments were conducted using a completely randomized design. Each expe...

Khadim Hussain Wagan1*, Muhammad Ibrahim Khaskheli2, Jamal-U-Ddin Hajano1 and Abdul Ghani Lanjar2 

...rowing season. The plant tissues were carrying more M. phaseolina cfu as compared to soil samples. However, cfu count of M. phaseolina was significantly varying among districts, locations and year of samplings (Df= 54, F= 4, P= 0.0000). Similarly, as soil samples collected from Badin, plant tissue samples also gave maximum cfu per gram of M. phaseolina from Badin and then reduced gradually in Thatta, Tando M. Khan, Hyderabad, Shaheed Benazirabad, Mirpurkhas, S...
Saleha Gul1,2, Muhammad Khisroon2, Ajmal Khan2, Attaullah1, Saira Gul3 and Gul Nabi Khan1,4,*
...cigarette smoke on other tissues are largely unknown. We explored the genotoxic effects of tobacco smoke on peripheral lymphocytes of active and passive smokers. Blood samples were isolated from 100 males’ including 25 active-, 25 passive- and 50 non-smokers. Alkaline comet assay was done and classes were defined on the basis of comet tail length. Significant differences were found in total comet score (TCS) among different groups (p˂0.05). The T...

 Şaban Çelebi

... heart, breast and thigh tissues of laying hens were determined in present study. A total of 96 White Lohman laying hens, aged 24 weeks, were randomly divided into 4 groups (n=24), each of which was composed of 6 subgroups. The control group received the basal diet (T-1), treatment groups were fed on the the basal diet plus the three experimental diets included one of the followings: 125 mg/kg vitamin E + basal diet (T-2); 0.5 mg/kg Selenium + basal diet (T-3)...
Jie Yang
...s expressed in different tissues. It is significant to make a study of human PGLYRP1 because neutrophils are a more dominant mechanism in human host defense. Related research results show the functions of human PGLYRP1 in the innate immunity of neutrophils is to conducive to the killing of intracellular and extracellular bacteria. Bactericidal activity of human PGLYRP-1, PGLYRP-3, PGLYRP-4, and PGLYRP-3:4 for both Gram-positive and Gram-negative bacteria requi...
Zahra Nazir1, Saba Ijaz1, Roquyya Gul2 and Mahjabeen Saleem1,*
...haride polymers of plant tissues into simpler monomer like D-galacturonic acids. In this study, polygalacturonase from grape skin was purified by salting out with ammonium sulfate, gel filtration on Sephadex G-75 column and ion exchange on Q-Sepharose column chromatography. Polygalacturonase was recognised as a protein with 47kDa molecular weight by SDS-PAGE. The optimum pH of purified polygalacturonase activity was found to be 4.5 and stable within pH range 3...

Muhammad Usman Ghani1*, Muti Ur Rehaman Khan1, Asim Aslam1, Zubair Shabbir2, Li Bo3 and Naveed Anwar4 

Pin Lyu1, Xiangxian Chen2* andQinlong Liu3*
...ds. The injured muscular tissues and blood samples were collected pre-injury and post-injury on day 1, 2, 4, 6, 9, 12 and 15. The exercise and massage group showed the fastest recovery reflected by muscular histological structure and C-reactive protein levels, followed by the other three groups. C-reactive protein decrease in exercise and massage, massage only or exercise only groups was significantly different comparing to control group (p<0.05).Com...
Hong Zhang1, Shu-Fen Han2, Jing Wang1, Shao-Kang Wang1, Gui-Ju Sun1 and  Cheng-Kai Zhai1, *
...xpression in rats’ tissues. Compound whole-grain ameliorates diet-induced obesity and hyperlipidemia by enhancing PPARγ and reducing SREBP-1c in rats. 
...

Imdad Ali Mahmood1, Muhammad Imran2, Muhammad Sarwar1, Matiullah Khan1, Muhammad Aqeel Sarwar2, Shoaib Ahmed1 and Shahid Riaz Malik

...n concentration in plant tissues and grains. A significant increase in pods per peduncle, seeds per pod, grain yield and total biomass of lentil was observed with Zn application even at lower rate (5 kg ha-1) under PGPR inoculation. Maximum 100-seed weight (2.56 g) was recorded with PGPR inoculation which was 21 % higher than that of without PGPR inoculation. Overall, a significant increase (31 %) in grain yield and total biomass was observed due to Zn applica...

Muhammad Yasin1, Romana Shahzadi1, Muhammad Riaz2, Mahideen Afridi2, Wajya Ajmal3, Obaid Ur Rehman2, Nazia Rehman3, Ghulam Muhammad Ali1,3, Muhammad Ramzan Khan1,2,3* 

...o expression in the leaf tissues was observed. A strong expression for FUL gene was detectable in mature silique and silique from upper portion of plant as compared to other tissues of “Pakola” and “Punjab Sarsoon 3”. Our results flaunt basic gene expression information about shattering genes for developing genome edited plants to prevent yield losses in canola in future. 

...
Uzma Jabeen1, Irfan Khan2, Nadia Naeem2, Asmat Salim2,* and Waseem Ahmed1
...toxic effects on healthy tissues. Doxorubicin (DOX) is a commonly used chemotherapeutic drug. Oxidative stress plays an important role in DOX-induced toxicity. This study was aimed at analyzing the expression levels of genes that are induced in response to oxidative stress in heart and liver tissues following DOX administration to rats. In this study, DOX was administered to rats intraperitoneally (i. p.) at 3 mg/kg at alter...
Zeynep Soyer Sarıca1*, Meryem Eren2 and Meryem Senturk2
...e estimated in the brain tissues of the Sprague Dawley rats. Compared to the control groups, a significant increase in the brain tissue MDA level of the group which received only 10 mg/kg K2Cr2O7 was observed, whereas no statistically significant change was detected in SOD, CAT and GSH-Px enzyme activities. It was further observed that after administration of Boron at 5 and 10 mg/kg the lipid peroxidation in brain tissue of K
Nida Zia1, *, Ayesha Maqbool2, Muhammad Safdar3, Umm-I-Habiba1, Altaf Mehmood4, Muhammad Usman5, Zahid Iqbal6, Javed Iqbal6, Shahid Mehmood6, Amanullah Khan7 and Sajid Umar8
...haracterize FAdVs. Liver tissues were collected from poultry flocks showing clinical signs of HHS and investigated using PCR assay for FAdVs. The FAdVs were detected in 8 samples collected from different flocks. Positive PCR amplicons were sequenced to genetically identify the FAdVs. Phylogenetic analysis revealed two distinct clusters among FAdVs. One cluster containing 3 strains belonged to the FAdV- C species and serotyped as FAdV-4 and showed close proximi...
Nouf Alharbi*, Mai Elobeid and Promy Virk
...g Cd accumulation in the tissues, reversing the effects of Cd toxicity on blood profile, and on the CAT and SOD activity in the liver and decreased the MDA levels in both serum and liver. Thus, the key findings suggest a profound antioxidative potential of the low dose of querectin, which could be a prospective approach in the treatment of Cd intoxication.
...
Tahir Iqbal1, Umer Rashid1*, Naveed Shahzad2, Amber Afroz1Muhammad Faheem Malik3 and Muhammad Idrees4

 

...fluids, liver and spleen tissues were collected from overnight dead layer chickens (n = 8) from Pattoki region of Punjab province, Pakistan, during July to August 2016. The RT-PCR showed the amplifications of selected regions of helicase (186 bps, 2769-2954 nt) and capsid (280 bps, 5461-5741 nt) domain in the bile fluids of two birds. The histological data demonstrated pathological changes in liver and spleen tissues of laye...
Jinfeng Liu1,2, Yanhong Cao3, Tong Feng1, Laiba Shafique1, Chan Luo1, Peng Zhu1,4,* and Qingyou Liu1,*
...hysis, genital ridge and tissues of ovary and testis. Moreover, QRT-PCR results showed that BMP15 was expressed in the whole process of embryogenesis and folliculogenesis, early high level and then down regulated. It was significantly expressed higher level in COCs of middle diameter sized follicles than that of small and large sized follicles. BMP15 gene expression enhanced until morula stage but it fell sharply at blastula stage. Immunohistoche...
Zhijun Zhong1, Rui Tu1, Xichun Wang2, Yi Geng1, Qicheng Xiao1, Yinan Tian1, Bin Wei1, Jiaming Dan1, Ya Wang1 and Guangneng Peng1,*
... lesions of all examined tissues. Strong positive staining was primarily found in the spleen, liver, and testicle. In conclusion, this study was the first to report the isolation of two B. canis strains from pet dogs in Sichuan province, southwestern China, and to further evaluate B. canis antigen location in tissues. Our study will contribute to the understanding of B. canis pathogenicity in naturally-i...
Sajida Sabahat1, Asif Nadeem1,*, Maryam Javed1, Muhammad Yasir Zahoor1, Abu Saeed Hashmi1, Ghulam Yasein2 and Ghulam Abbas1 
... in various and specific tissues. The liver is the primary source of IGF-1 and considered as candidate genes for growth because they play a significant role in development and growth regulation. IGF-1 control protein metabolism and is extremely conserved region amongst species. IGF-1 have not been studied before in camel. The DNA samples of Marecha camel were collected from the Camel Breeding and Research Station at Rakhmani Bhakkar, Pakistan. Four polymorphic...

Nosheen1, Sajid Abdullah1, Huma Naz2* and Khalid Abbas1 

...xidase (POD) activity in tissues viz. liver, gills, kidney, muscle, heart and brain of fish Catla catla exposed for 4-day. After each sampling (24-hr interval) fish were dissected and required organs were obtained. Results showed that the POD activity was augmented in all selected organs of Pb+2 exposed fish in relation to control. The POD activity in organs of fish followed the order: brain>liver>gills>kidney>heart>muscle. Regression analysis s...
Hafiz Muhammad Arsalan1, Maria Altaf1, Zeemal Seemab Amin1, Muhammad Khalil Ahmad Khan2, Anum Shahzadi1, Hina Mudasser1, Iqra Maqsood1, Nazia Gulshan1, Saira Naseem3
...tial oxidative injury to tissues and lead to cartilage degradation in RA patients.
...
Hafiz Muhammad Tahir*, Palwasha Jabeen, Chand Raza, Shaukat Ali
...application in culturing tissues including skin, bone, cartilage and nerves. Sericin has been hailed to have antitumor activity and has also been widely used in different cosmetics. The major hindrance in using spider silk for different purposes is due to its small obtainable amount. Efforts are being made to overcome this problem by modern biotechnological techniques including of making transgenic organisms.
...
Fariha Latif1*, Muhammad Javed2, Hammad Ahmad Khan2 and Khalil-Ur-Rehman3
...accumulation in the fish tissues that increased significantly with increasing exposure of Pb. Pb accumulated variably in the fish tissues as liver > gills > brain > kidney > muscles. Oxidative stress in the Pb exposed fish was determined in terms of change in the activities of antioxidant enzymes viz. superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD). The Pb exposure caused a significant time and do...
Hazrat Ali1,2,*, Ezzat Khan1,* and Muhammad Jamal Nasir3
...as also studied in other tissues such as skin, gills, liver and kidneys of two fish species i.e., Clupisoma naziri and Mastacembelus armatus. Cr concentrations in fish muscles ranged from 30.5±41.9 to 70.8±12.1 mg kg−1 wet weight, Ni from 16.7±10.2 to 103.5±114.1 mg kg−1 wet weight, Cd from 1.1±0.18 to 2.5±0.21 mg kg−1 wet weight and Pb from 29.7&p...
Kadry A. El-Bakry1, Lamiaa E.M. Deef1*, Lotfy Z. Habbak1 and Samia S. El-Naeli2
...mical analysis and liver tissues were collected and fixed in 10% formalin for histopathological studies. The present study showed that, PAT causes elevated alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities and significantly increases serum level of malondialdehyde (MDA) but decrease the activity of superoxide dismutase (SOD) enzyme. On the other hand, in patuilin injected rats and treated with ginger, the activity of ALT, AST and S...
Sameh S. Tawfik, Ahmed A. Elkady* and Ehab T. Mohamed
...ogical-findings of renal tissues in the irradiated-group, showed nephrotoxicity; the renal cortex showed massive necrotic changes, the convoluted tubules showed distinctive pattern of ischemic renal injury and the cuboidal epithelium cells of proximal and distal renal tubules showed nuclear changes with leukocytes infiltrations. More over some cases showed atrophied glomeruli, widened Bowman’s space and thickened basement membrane, while in TSE-treated a...
Ramazan İlgün1*, Nilgün Kuru2, Ferhan Bölükbaş3 and Fatih Mehmet Gür4
...g a light microscope the tissues and papillae of the tongue were examined with a the scanning electron microscope, and photos of the general histologic structures were taken. The tongue was triangular shaped, and consisted of apex, corpus, and radix sections. The dorsal and ventral surfaces of the tongue were covered by a keratinised stratified squamous epithelium. Lamina propria and submucosal layers were distinguishable underneath the epitelium. SEM observat...
Mingsan Miao*, Hui Zhao, Jiaojiao Jia, Xiaoyan Fang and Yanyan Miao
...king the arteries. Brain tissues were examined 24 hours post-drug administration to determine the level of biochemical indicators such as serum NSE in the brain tissue. To investigate the impact of total phenolic acid on the biochemical parameters in the repeated cerebral ischemia-reperfusion mice, the mouse model of cerebral ischemia repeated reperfusion was successfully replicated. The doses of total phenolic acid of D. canes have significantly reduced the l...
Bo Gao1,2, Fengmei Yang3, Wei Chen2, Xiaojia Song4, Xiaobo Liu5 and Dongmin Li1*
...acent, and non-cancerous tissues. The tumor markers were detected with COBAS 6000. The prognostic value of relative MDR1 expression level in malignant tumors was investigated by univariate survival and Cox regression model analyses, and survival times were compared using the log-rank test. At the same time, through receiver operating characteristic (ROC) curve analysis, their diagnostic threshold values were calculated. MDR1 expression levels were the highest ...
Gong Ga1,2 and SuoLang Sizhu2,*
...ntigens were detected in tissues by immunohistochemistry analysis. Overall, we found that that eight serum samples (4.6%, 8/173) were positive to anti-HEV IgM antibody and Seventeen serum sample (9.8%, 17/173) were positive for anti-HEV IgG antibody. The HEV RNA positive rate was of 4.6% (8/173) in feces and serum. Moreover, the prevalence of HEV RNA was 9.5% (2/21) in swine liver, 4.8% (1/21) in swine spleen, 9.5% (2/21) in swine kidney, 4.8% (1/21)...
Qaisra Siddique1, Sajid Abdullah1, Huma Naz2*, Khalid Abbas1, Laiba Shafique3

 

...otein contents (TPCs) in tissues viz. brain, gills, kidney, heart, muscle and liver of Labeo rohita kept under sub-lethal dose (4.13 µgL-1) of chlorpyrifos. Fish was kept under chlorpyrifos stress for two months and samples were collected on weekly basis. It was noted that GST level varied significantly with duration. The GST level was raised in first 28 days after that it was dropped off up to 56-day. The trend of GST in fish
Weihao Chen1,2, Zhilong Tian2, Lin Ma2, Shangquan Gan3, Wei Sun1,4,* and Mingxing Chu2,*
...xpressed in all selected tissues, but BMP15 was specifically expressed in the epididymis. Further study indicated that the expression of BMPRIB in the brain, hypothalamus, pituitary, epididymis, and adrenal gland was significantly higher in Sunite sheep than in Small Tail Han sheep (p <0.05, p <0.01); the expression of BMP15 in the epididymis was significantly higher in Sunite sheep than in Small Tail Han sheep (p
Saeed Fatima1, Khalid Javed Iqbal1, Usman Atique2,3*, Arshad Javid4, Noor Khan2, Sonia Iqbal2, Hamid Majeed5, Hamda Azmat2, Bakhat Yawar Ali Khan6, Irfan7, Muhammad Tausif Shahid1, Gulnaz Afzal1
...s rather than the muscle tissues that evidently indicated gradual water quality degradation conceiving higher metal concentrations in the environment. Similarly, a higher concentration of Cd was observed in water (0.78 ppm) and sediment (0.64 ppm) samples. In acquiescence to the above-given outcomes, the metal concentration hierarchical arrangement in sediment and water was identical to the witnessed in fish species (Cd > As > Hg). In conclusion, this st...
Min Lv1, Hui Gan2, Zhide Ruan1, Huizan Yang1, Rui Wang1, Laiba Shafique3, Huma Naz4 and Huawei Ma1,
...intestines than in other tissues. The Cd, Cr, and Hg concentrations in suspended particles and sediment increased significantly as time elapsed and feed increased. The Cd, Cr, and Hg concentrations in the intestinal systems increased as fish grew. Strong correlations were found between heavy metal concentrations in the intestine contents and suspended particles; intestine contents and sediment; and suspended particles and sediment, but correlations with concen...
Arifa Savanur1,*, Tallat Naz1,2, Tayyaba Hamid1,3, Syed Abid Ali4, Mian Jahangir1,3 and Muhammad Abdul Azeem4
...of their visceral muscle tissues. Therefore, a comparative study was conducted to determine the mechanical properties of esophageal and intestine tissue strips of Uromastix hardwickii. Tissues were subjected to electrical stimulation in order to observe the graded mechanical response, and the quick isotonic release method was used for the measurement of stiffness in the series elastic component. The higher stif...
Tehreem Usman1, Sajid Abdullah1, Huma Naz2*, Khalid Abbas1, Laiba Shafique3 and Qaisra Siddique1
...mming very fast. Various tissues such as hepatic, neural, renal, cardiac, gills and muscle tissues were studied for the determination of CAT activity and TPC after exposure of 24 and 96 h. Results showed that both treatments caused a significant (P<0.01) decline in CAT activity and TPC of C. idella as compared to control group. CAT activity and TPC decreased with the passage of time. Among both treatments, ES+CPF c...

Bibi Safia Haq1,2, Shahnaz Attaullah3, Abdul Shakoor4, Hidayat Ullah Khan5, Khan Alam5, Kausar Shaheen1 

CHARACTERISTICS AND EFFICACY OF ULTRAFAST LASER PULSES FOR BIOMEDICAL APPLICATIONS
... different
living tissues. Polymerisation based on a direct write system to build up solid polymeric material for the fabrication
of three dimensional cell scaffolds can be achieved. By tailoring the optical system and making use of a relatively
weak absorption cross-section we have been able to manufacture deep structures in a single pass of the laser light. 

...
Zarish Yaqoob1, Saleema Bashir Shams2, Gaitee Joshua2 and Bibi Nazia Murtaza2,3*
... the water and different tissues of native fish collected from three different areas. The highest concentration of Cr (1.451 µg L-1) and Co (0.325 µg L-1) was measured in the river water at Balloki. However, Cd (0.981µg L-1)and Zn (1.239 µg L-1)were contributing maximum contamination at confluence of Deg Nallah and river Ravi. We found maximum accumulation of Cr (21.1 ppm) in Rita rita, Co (13.1 p...

Muhammad Riaz1*, Naureen Akhtar1, Salik Nawaz Khan1, Muhammad Shakeel1,2 and Ateeq Tahir1

Neocosmospora rubicola: An Unrecorded Pathogen from Pakistan Causing Potato Stem Rot
...olated from the infected tissues, purified and identified on the basis of morphological characters, nucleotide sequences of internal transcribed spacer region (ITS) and partial beta tubulin gene. Phylogenetic analysis was also conducted to determine the phylogenetic relationship of this species with other reported species of this genus. Pathogenic potential of the isolate was verified by artificially inoculating the spores of pathogen in healthy plants. Appear...

Markus I. Francis1*, Paul I. Ankeli2, Clara N. Kwanashie1, Jibril Adamu1, Lushaikyaa Allam1, Mashood A. Raji3, Godwin O. Egwu4, Flavio Sacchini5 and Massimo Scacchia5

Detection of Mycoplasma bovis from Cattle Presented for Slaughter in Adamawa and Taraba States, Northeastern Nigeria
...ty (480) samples of lung tissues (180), nasal swab (180), ear swab (60) and pleural fluid (60) were collected from 190 heads of cattle at slaughter in Yola and Jalingo abattoirs in Adamawa and Taraba States, respectively Samples were processed based on standard laboratory protocols. An overall Mycoplasma bovis isolation rate of 0.83% (4/480) was obtained. Based on the states studied, 1 (0.35%) and 3 (1.53%) M. bovis were isolated from Adamawa and Taraba States...

Joseph Anejo-Okopi1*, Obinna Oragwa Arthur2, Ocheme Julius Okojokwu1, Sarah Joseph1, Geoffrey Chibueze1, Joshua Adetunji1, Joseph Ameh Okwori3, David Ochola Amanyi4, Otobo I. Ujah5 and Onyemocho Audu6

Seroprevalence of Rift Valley Fever Virus Infection among Slaughtered Ruminants in Jos, North-Central, Nigeria
...al body fluids and other tissues. We aimed to determine the prevalence of antibodies against RVFV in slaughtered ruminants in Jos, North-Central, Nigeria. Blood samples were collected from 100 livestock (cattle and goats) at selected slaughter locations in Jos Metropolis. Questionnaires were administered to obtain information on animal species, sex, and localities of origin. The blood samples were screened for RVFV antibodies using competitive Enzyme Linked-im...

Ghulam Akbar1*, Ali Ahmad2, Neha Arooj1, Muhammad Anjum Zia1, Aamna Rafique1, Sania Riasat1, Mohsin Raza1, Mahpara Qamar1, Shahneela Nusrat1 and Shakila Hanif1

Critical Update for the Treatment of Anemia by using Advanced Genome Editing Crispr Cas Technology
...of oxygen supply towards tissues of body. It is common and worldwide problem that associates with all ages like pregnant women, children and aged people. Anemia associated with numerous infectious and continual problems such as persistent kidney disease, cancer, ischemic heart ailment and inflammatory bowel disorder. However, with the development in generation at genome editing level have made feasible to accurate mutations in human genome. A site oriented spe...

Kecheng Zhu1,2,3, Peiying He1, Baosuo Liu1,2,3, Huayang Guo1,2,3, Nan Zhang1,2,3, Liang Guo1,2,3, Shigui Jiang1,2,3 and Dianchang Zhang1,2,3,* 

...ite muscle than in other tissues. Furthermore, to explore whether two MyoDs are modulators of Almyomaker, a promoter analysis was performed using progressive deletion mutations of Almyomaker. The results of promoter activity assays show that Almyomaker expression is notably activated by two MyoDs. Transcriptional activity of the Almyomaker promoter was observed to dramatically decrease after targeted mutation of the MyoD1 M1 and Myo...
Mehwish Saleem Khan
Evaluation of Changes in Zinc Levels in Patients Suffering from Cancer
...tually spread into other tissues. There are more than 200 different types of cancer. Tobacco use is the cause of about 22% of cancer deaths. Another 10% are due to obesity, poor diet, lack of physical activity or excessive drinking of alcohol. Other factors include certain infections, exposure to ionizing radiation and environmental pollutants. In this study zinc level in serum of cancer patients was observed. For this purpose, the blood of 50 cancer patients ...

Mahmoud Mohamed Ahmed Youssef* and Suzan Abd-Elazeim Hassabo

The Role of Genetic Engineering in Management of Plant Parasitic Nematodes with Emphasis on Root-Knot Nematodes: A Review
...es can be expressed into tissues and cells feed upon by nematodes. Transgenic products with a potential to interefere with nematode physiology such as digestive enzymes or structural proteins of the intestine are considered.

...
Q. Sun1, Q. Liu1, R. Di1, Y. Wang1, S. Gan2, S. Liu2, X. Wang1, W. Hu1, X. Cao1, Zh. Pan1, X. Guo1, Y. Yang3, H.E. Rushdi4* and M. Chu1*
...d synthesis in lipogenic tissues. Identification of single nucleotide polymorphisms (SNPs) of sheep THRSP gene and their association with fat deposition were investigated using Altay and White Suffolk sheep. In addition, the messenger RNA expression profiling of THRSP in fat-tailed and thin-tailed breeds was compared among 8 different tissues. Four SNPs have been detected in position g. 205A>C, c. 52C>T, ...

Muhammad Usman Ghazanfar1, Waqas Wakil2, Shahbaz Talib Sahi3 and Waqas Raza1*

Influence of Resistance Inducers on Nitrogen, Phosphorus and Potassium Contents of Susceptible Chickpea Cultivars after Inoculation with Ascochyta rabiei
....00 ppm) contents in the tissues decreased disease severity (79.3%) in cv. C-44. These increases were significant (P ≤ 0.05) after 14 days of inoculation with plant pathogen in plants pretreated with chemicals. There was no significant change in plants treated with the plant extracts except with extracts of A. indica. Chemically increased N, P, and K were highest in cultivar C-44 followed by Pb-91 and Bittle-98. A similar trend was observed with plant extra...
Wentao Wang1,2, Xu Lin3, Jianshu Zhuo3, Dongjie Zhang2, Xiuqin Yang3* and Di Liu1, 2*
...rms are expressed in all tissues studied with high level in spleen and muscle. Both of isoforms V1 and 2, containing functional domains of E2Fs, were localized throughout cells. No functional nuclear localization sequence and export signal were characterized through site-directed mutagenesis analysis, although their existence was predicted by bioinformatic methods. The results increase our knowledge of E2F3b mRNA diversity and provide basis for in-depth functi...
Zhen-Yang Wu1, Li Li1, Yu-Hua Fu2, Sheng Wang3, Qing-Ming An1, Xiao-Hui Tang4, Xiao-Yong Du3,5,* and Fei Zhou6,*

Muhammad Umair Hassan1, Muhammad Aamer1, Muhammad Nawaz2, Abdul Rehman3, Talha Aslam3, Ubaid Afzal4, Bilal Ahmad Shahzad3, Muhammad Ahsin Ayub5, Faryal Ahmed1, Ma Qiaoying1, Su Qitao1 and Huang Guoqin1*

Agronomic Bio-Fortification of Wheat to Combat Zinc Deficiency in Developing Countries
...ns the Zn pools in plant tissues during later stages thus resulting in an increase in Zn accumulation in wheat grains. Therefore, in this review, we discussed roles of Zn in plants and humans and possible strategies to combat Zn deficiency in humans. Additionally, challenges for agronomic and breeding strategies and possible benefits of both these strategies also discussed in this review.

...
Faiza Altaf1, Shamim Gul1,2*, Tasawar Ali Chandio3, Gul Bano Rehman1, Attiq-ur-Rehman Kakar4, Sami Ullah4, Naqeebullah Khan4, Umbreen Shaheen5, Muhammad Naeem Shahwani6, Muhammad Ajmal7 and Misbah Manzoor8
 
 
...f heavy metals in edible tissues of tomato and lettuce. These biochars were separately mixed with poultry manure as 1:1 ratio on air-dry weight bases. Soil was contaminated with chromite mine tailing debris at 2% amendment rate (980 g soil + 20 g debris). Biochar-poultry manure mixtures were applied in soil at 10% and 20% amendment rates (respectively, 900 g soil + 100 g mixture and 800 g soil and 200 g mixture of poultry manure and biochar in 1:1 mixture rati...

 Shuanping Zhao, Lei Xu, Hai Jin and Yutang Jia*

...expressed in all studied tissues. The results of our study provide evidence that polymorphisms in CFL2 gene are associated with growth traits, and CFL2 gene could be utilized as molecular markers for future assisted selection in cattle breeding program.
...
Muhammad Akram Muneer1, Khalid Munir1, Ghulam Abbas1’*, Isra Munir1Mumtaz Ahmad Khan1, Asif Iqbal1, Munsoor ud Din Ahmad1, Muhammad Arshad Javid2, Zareen Fatima1 and Maria Arshad1
...)emerged as very importantissuesduringlastthree decadesas these infectionscaused quitelargenumberofhumandeathsworldwide.Coronavirusesaresingle-strandedpositive sense RNA viruses which mainly in past were considered responsible for high percentage of (around 30%) of common cold/flu cases. Viruses causing SARS, MERS and COVID-19 are members of family Coronavirdae. World Health Organization (WHO) reported that the novel Cov-19 virus infection was first dia...
Hazrat Ali1, 2* and Ezzat Khan1*
...ccumulation in different tissues of M. armatus was: kidneys > liver skin > muscles > gills. Bioaccumulation factor (BAF) values of the metals in muscles of M. armatus were in the order: Cr > Pb > Ni > Cd. BAF values show that these metals are accumulated in the fish tissues and may pose a potential health risk to regular consumers. 
...
Xuhai Wang1,2, Xin Li1, Fangyuan Yuan1, Chaocheng Li1, Bin Jia1* and Song Jiang1*
...chinococcosis intestinal tissues, and they were differentially expressed in the intestine tissue between the resistant sheep and non-resistant sheep, more widely distributed in the resistant group. These results illustrated that miR-216b and IL2RB activated stronger immune response in the resistant sheep, compared with the non-resistant sheep, and participating in the T cell immune response.
...

Mokbel, Samah A.1,Ahmed K. El Attar1; Azza G.Farag2.

... of
infected tissues showed scattered area stained bright blue. Molecular detection utilizing
nested and direct PCR as well as DNA sequencing was used for the diagnosis of the
witches‟ Broom infection. Total DNA was isolated from leaf tissues of infected hibiscus
plants. Nestedpolymerase chain reaction(PCR) was performed using the universal -
phytoplasma specific ...

Maha I. El Zaafarany1, WafaaM. Badawy2, Eman M. El Salakh3

... of the malignant breast tissues. This finding suggests that HPV may have a biological significance in breast carcinogenesis.

...

Yanni, M. I1; Hanaa A. Ahmed2; Lamyaa, A. Ahmed1; Hanan, A. Fahmy3 and Ibrahim, E.M.4 Aggour, M. G.3

... expecting Rabies. Brain tissues were sent for direct fluorescent antibody technique and isolation on tissue culture using BHK cells. Direct confirmation was performed by Real time RT- PCR and gene sequencing was performed directly from brain samples. Phylogenetic analysis including sequences from all previous Egyptian isolates and neighboring countries isolates was conducted. The % of nucleotide identities of the Egyptian recent isolate (Egy/cairo /2014) with...

Nashwa M. Helmy1 and Ahmed S. A.2

...the vesicular epithelial tissues collected from infected cattle from Sharkia
(7) and Fayoum (5) governorates were subjected to antigen ELISA and RT-PCR. 8
epithelial tissues were identified by Indirect sandwich ELISA. The results were 5 and 3
positive from Sharkia and Fayoum respectively, while 12 samples were positive by RTPCR.
In conclusion, this study demonstrates that real-...

Om-Hashem M. El-Banna1, Maisa A.E. Awad2, M.S. Abbas3, Hoda M. A. Waziri2 and Huda S. A. Darwish2

...tructure changes in leaf tissues of both Tomato and Grapevine artificially infected with Tomato ringspot virus were studied by light and electron microscopy. By light microscopy viral infection resulted in the presence of amorphous inclusion bodies in the cytoplasm of infected leaves.Phloem tissues were also affected by infection. Investigations of leaf tissues of both tomato and grapevine...

A. B. Badr1 ; M. A. S. El-kady2; and Kh. E. A. Saker2

...des, palisade and spongy tissues were increased than the healthy plants. In
contrast the thickness of upper and lower epidermis layers were reduced. Also the
thickness of midrib zone was slightly reduced. Moreover, vascular tissues lost their
normal shape and arrangement as xylem arms. The most interesting finding, lengths
of both , protoxylem and metaxylem were reduced while t...

Amira A. Mazyad1; A. A. Kheder1; Ahmed K. El-Attar1; W. Amer.2; Mahasen, H. Ismail.2; Amal, A.F.1

...of SLRSV in the infected tissues of strawberry plants was performed using both serological (DAS-ELISA) and molecular assays. Reverse transcription polymerase chain reaction (RT-PCR) was used to amplify 497 bp fragment using PCR primers specific for the viral coat protein gene as a tool for molecular diagnosis. The PCR detection was confirmed with direct DNA sequencing and phylogenetic analysis for the coat protein gene. Further insurance of SLRSV infection was...

Elharony, S.B.1,3, SaharA.Youssef2 and Richard F. Lee3

...
small quantities of tissues. The method does not require expensive
and environmentally hazardous reagents and equipment. It can be
performed even in low technology laboratories. The amount of tissue
required by this method is ∼50–100 mg. The quantity and the quality
of the nucleic acid extracted by this method is high enough to
perform hundreds of PCR-based reactions and also to be used...
Eman A. Ahmed1, Osama Y. Shalaby2, Emad F. Dwidar2, Samah A. Mokbel1, Ahmed K. El-Attar1 
.... The phloem of infected tissues
showed scattered area stained bright blue. Different techniques for transmission of
phytoplasma to healthy tomatoes and periwinkles in an insect-proof greenhouse were
tested, including mechanical inoculation, wedge grafting, parasitic plant dodder (Cuscuta
campestris), insects in the family Cicadellidae (leafhopper, Empoasca decipiens) and in
germinated seeds within th...

Maryam Yousaf1, Salman Ahmad1*, Romana Anjum2 and Muhammad Zeeshan Majeed3

...on and disruption of the tissues along with the blockage in xylem and phloem vessels due to the tylone production. Hyphal growth and proliferated hyphae inside the root cortex were also observed. We concluded that FOL fungus penetrated into the cell wall of the tomato seedlings through hyphae and proliferated into the cortex. Later on, it progressed into the roots and stem, started blocking of the xylem and phloem by producing tylones and deposition of phenoli...
Abd El-Hamid, M.I1, Seham, A.El-Zeedy1, El-Sanousi, A.A2, Reda, I.M2, Nehal, S. Saleh1, Abbas, A.M1
...ere either aborted fetal tissues either Lung and livers as well as Aborted placenta and nasal swaps from mares suffering from repeated Abortions, The current study used the gene synthesis technology introduced by Invitrogen to synthesis the glycoprotein D of the Kentucky Strain as reference strain to use it as appositive control for the envelope glycoprotein D of EHV-1 (EHV-1gD) cloned in pMA-T plasmid for optimizing the detection of the virus from field sampl...

Abd El-Hamid, M.I1; Seham, A. ElZeedy1; El-Sanousi A.A2, Reda, I.M2, Nehal, S. Saleh1., Abbas, A.M1

...ere either aborted fetal tissues or nasal swaps from apparently healthy animals and previously aborted mares the current study focuses on isolation and molecular characterization of EHV-1 of the local isolate Egypt/VSVRI/Zahraa/2014 using the glycoprotein D of EVH-1 due to its role in virus infectivity and its function in entry of virus into cells and is considered as one of the most potent inducers of virus-neutralizing antibody among the spectrum of EHV-1 pr...

Badr, A. B. 1, Abou-zeid, A. A2. and Al-Naggar, A. M1.

...yer, palisade and spongy tissues, length and width of protoxylem and metaxylem vessels were reduced. However, lower epidermal layer was increased. Stomatal characters i.e. number of stomata and length of stoma pore were increased, while, width of stoma pore, length and width of guard cells were reduced. Anatomical characters of tubers i.e. thickness cork layers was slightly increased, however, its number was sharp reduced compared with healthy tubers. Biochemi...
Eman A. Ahmed1, Osama Y. shalaby2, Emad F. Dwidar2, Samah A. Mokbel1 and Ahmed K. El-Attar1
...ither palisade or spongy tissues by 212.5% or 275%, and significant malformation in leaflet midvein was observed which consequently led to increase in both length and width of midvein by 15.19% and 5%. Electron microscopy was used to recognize the internal changes in cell organelles due to phytoplasma infection. The results obtained showed that, general disorganization of phloem tissue and thickness of cell wall resulted from high concentration of phytoplasma ...
Rasha M. Mahrous1,4, Ahmed K. El-Attar2, Ahlam A. AlWatban1, Sohair I. EL-Afifi3,
Nagwa M. Aref1,3
...differentiate the phloem tissues of leaf
petiole sections from infected trees. The phytoplasma was detected in the sieve tubes and parenchyma
cells of leaf midribs by Transmission Electron Microscopy (TEM). Phytoplasma was molecularly
detected in symptomatic samples using the specific primers of their 16S-23S rRNA gene by PCR.
Results: The Phytoplasma was isolated on indicator (Vollka marina) plants. It was trans...

Hanaa A. Elsamadony1, Laila A. Tantawy1, Sabry E. Omar2 and Heba A. Abd Alah1

...n thymus and bone marrow tissues of SPF chicks infected with
CAV.
Methods: In this study, 30 layer farms of age 40 to 100-days-old from different governorates
(Alexandria, Gharbia, Giza and Qalubia) were examined for CAV with real-time PCR and
histopathological examination. The positive samples were prepared and inoculated in SPF chicks' oneday-
old then at aged 10-days post-inoculation collected orga...
Allam A. Megahed, Badawi A. Othman, Samar S. El Masry, Abeer A. Faiesal and Mohamed A. Nasr Eldin
...VM on
potato tissues, and detection of PVM in commercial potato seed tubers using RT-PCR.
Methods: The PVM was detected in symptomatic infected potato plants during growing seasons for
the cultivated commercial local tuber seeds using Double Antibody Sandwich-Enzyme Linked
Immuno-Sorbent Assay (DAS-ELISA). The PVM was mechanically isolated on potato cv. Diamant.
Host range was carried out by mechanica...

Shimaa M. Gad1, Ahmed A. Kheder1, Mohamed A. Awad 2

...differentiate the phloem tissues of leaf sections from infected gazania and periwinkle plants.
Transmission Electron Microscopy (TEM) revealed the presence of phytoplasma in the sieve tubes and
parenchyma cells of leaf midribs in infected plants. DNA extracted from symptomatic samples was
used as a template in nested polymerase chain reaction (nested-PCR) using universal primer pairs
P1/P7 and R16F2n/R16R2. Seque...

Md. Abdullah Al Mamun1,2*, Shamima Nasren1,3, Sanjay Singh Rathore1 and Kavalagiriyanahalli Srinivasiah Ramesh1

...d different parts of gut tissues. According to the results obtained in the present study, it can be suggested that acute infestation of A. japonicus elicited direct effects such as eye opacity, fin rots, scale loss and severe histopathological alterations in catla. 

...
Kai Jin1,2,3, Chen Chen 1,2,3, Xinyu Sun1,2,3, Caiye Zhu1,2,3, Mahmoud F. Ahmed1,2,3,4, Qisheng Zuo1,2,3, Jiuzhou Song4 and Bichun Li1,2,3*
...es in goat mammary gland tissues and muscular tissues was aligned with GEO database, and tested by qRT-PCR. F1 transgenic mice were mated and then the target genes and protein expression level in F2 transgenic mice, as well as fat content in F1 and F2 transgenic mice muscle were examined. Successful transgenic goats generation was identified by testicular injection. The results sho...
Sen Liu1,2, Yue Zhu2, Haixia Leng2, Ying Wang1, Xiangju Yin1 and Yajun Zhao1*
...ic DNA methylation among tissues in chiropteran animals have yet to be investigated. In this study, the epigenetic variation of six tissues in normal state Rhinolophus ferrumequinum (i.e., no pregnancy, nursing, or hibernation) was explored using the F-MSAP technique, including brown adipose tissue (BAT), brain (B), heart (H), kidney (K), liver (L), and muscle (M) tissues. An averag...
HuaBin Zhang1,2, YaSen Li1, Tao Pan1, Peng Yan1, En Li1, Hui Xue1 and XiaoBing Wu1,*
...ts receptor in different tissues of Chinese alligator by immunohistochemistry analysis. This study aims to access the possible effect of leptin in Chinese alligator. The results showed that immunoreactivity of leptin was observed in the adipocyte of white adipose tissue, the gastric gland of the stomach, the lamina propria of the intestine and the interstitial cell and seminiferous tubule of testis, leptin receptor staining was detected in the adipocyte of whi...
Iram Liaqat1,*, Safdar Ali Mirza2, Sumera Sajjad3, Shaukat Ali1,*, Muhammad Faiz Qamar4 and Ikram Ul Haq5
...e foreign surfaces, host tissues and substrates. Flagellar biosynthesis and function in Salmonella typhimurium isregulated by >50 genes. Bioinformatics analysis of flagellar assembly in S. typhimurium identified several conserved structural elements. In this study, FliI a flagellar protein required for flagellar assembly and involved in a specialized protein export pathway was cloned and overexpressed. ΔfliI mutant Salmonella
Ou-Mei Hao1*, Xue-Feng Wang1, Zhi-Jun Yue1, Chun-Hong Nan1,Yan Yu1,Tong Zhang2,Yu-Feng Liu3 and Xue Zhao1
...els of cytokines in lung tissues were assessed by Immunohistochemistry staining and Quantitative real-time (qRT)-PCR assays were performed to explore the effects of QZZKF on the expression of surfactant protein A (SP-A), B7 homolog 3 protein (B7-H3), interleukin (IL)-12 and IL-13. The expression levels of B7-H3 and IL-13 were upregulated after MPP infection in the mouse model (P<0.05), while the expressions of SP-A and IL-12 were significantly decreased (P&...

Usman Asghar1*, Muhammad Faheem Malik1, Umer Rashid2, Naeem Mahmood Ashraf2, Sumera Afsheen1 and Muhammad Hashim1

...as extracted from muscle tissues of cow, buffalo, goat, donkey and a dog. A set of degenerative primers was designed for Polymerase Chain Reaction (PCR) of the cytochrome b gene fragment. All PCR was accomplished at the same reaction conditions. Amplified products had a length of 400 bp, which was our estimated length. After the sequencing of these amplicons, In silico restriction analysis was performed for each specie. Restriction endonuclease TfiI was select...
Song Jiang, Dong-liang Liu, Fa-lin Zhou, Xian-bin Mo, Qi-bin Yang, Jian-hua Huang, Li-shi Yang and Shi-gui Jiang*
... expression in different tissues of Penaeus monodon. The results showed that the mRNA level of PmATP synthase gene was not significantly up-regulated under low salt stimulation (P> 0.05),while under high salinity stimulation, the transcription level of PmATP synthase mRNA reached the maximum at 16th h (P<0.05).The expression level of PmNa+-K+-ATPase mRNA increased at 4th h and 16th h, which ...

Mst. Deloara Begum1, Md. Muniruzzaman1, Md. Salauddin2* and Md. Mostafizer Rahman1

...nimal proteins. The soft tissues of fish and aquatic environment are extremely susceptible to microbial contamination. In this research a total of 79 samples were collected from different local market. In which 54 samples were from dried fish and 25 from cooked fish samples. In this research there were 18 different types of dried fish and 6 types of cooked fish were used as a sample. Laboratory work was done by different bacteriological laboratory methods and ...
Luis Daniel Jiménez Martínez1, Vicente Morales Garcia2Carlos Alfonso Frias Quintana3, Alejandra del Carmen Castillo Collado1, Gloria Gertrudys Asencio Alcudia4, Carina Shianya Alvarez Villagomez4, Emyr Saul Peña Marín4,5, Bartolo Concha Frias1 and 
Carlos Alfonso Alvarez-Gonzalez4
...o compare between cells, tissues and organs; as well as different populations, stages of development, metabolism, among other conditions. This study analyzed the stability and normalization of six commonly used reference genes such as alpha elongation factor (ef1-α), beta-actin (actb), 18S ribosomal RNA (18s rrna), beta-2-microglobulin (b2m), tubulin alpha (α-tub) and glyceraldehyde 3-phosphate dehydrogenase (g...
Nida Sadaqat1, Abdul Wajid2, Quratul Ain2, Muhammad Zia Akbar2Farkhanda Manzoor4, Muhammad Sarwar Khan1, Nasir Ali3,  Masroor Ellahi Babar3 and Tanveer Hussain3*
...) and in some peripheral tissues in sheep and goats. Scrapie resistant/susceptibility have been associated with the presence of PRNP gene polymorphisms. We analyzed the polymorphisms in PRNP gene sequences in 49 wild Punjab urial (Ovis vignei punjabiensis). Four novel amino acids polymorphisms (p.Q149E, p.Q155E, p.Y228L and p.L253F) were detected in PRNP gene. The urial was monomorphic at codon 149 and 155 and polymorphic at codon 2...

Muhammad Shahbaz1,2, Sajid Abdullah1*, Huma Naz3*, Khalid Abbas1, Tanveer Ahmed4, Sana Mehmood1, Muhammad Adeel Hussan5

...l fish was dissected and tissues viz. liver, muscle and gills were obtained to analyze the CAT activity. The CAT level was reduced in all treatments when compared control. CAT activity was observed higher in the gills, muscle and liver tissues of T1 diet fed C. idella as 14.68±0.90, 12.76±0.87 and 20.34±0.99 UmL-1, respectively. Comparison among diets for CAT activity showed the trend as T4<T3<T2&l...

Ayesha Muzamil, Hafiz Muhammad Tahir, Shaukat Ali, Iram Liaqat, Aamir Ali, Muhammad Summer

...t helps in fight against tissues injury or foreign invaders. Uncontrolled or excessive inflammation is destructive for normal homeostatic processes of body. Most of the modern human diseases such as asthma, allergy, autoimmune diseases, hepatitis, coeliac disease, inflammatory bowel disease and glomerulonephritis are linked directly or indirectly to different inflammatory processes. Conventionally, different steroidal and non steroidal drugs i.e., antibiotics ...
Amr N. El-Shahat1, Refaat G. Hamza1,*, Ashraf M. Mounir1 and Madeha N. Al-Seeni2
Weihao Chen1, 2, Zhilong Tian1, Lin Ma1, Shangquan Gan3, Wei Sun2, 4* and Mingxing Chu1*
...ferens and adrenal gland tissues in both breeds. The expression level of Clock and BMAL1 showed similar trends in the brain, cerebellum, hypothalamus, pituitary, testis and epididymis in both breeds. The expression levels of Clock, BMAL1, and Cry1 were significantly higher in the pituitary tissue of STH rams than in that of SNT rams, whereas the expression level of Cry2 showed the opposite pattern. We speculate that

Noha M. El-Shabrawy1, Atef M. Kamel2, Aza S. Goda1, Gehad R. Donia1, Ahmed M. Salah-Eldein2* 

...etals among the examined tissues. Egyptian barn swallow and house sparrow have a great tendency to accumulate heavy metals in their tissues among other examined birds. Levels of Pb in Egyptian barn swallow and house sparrow have exceeded the normal background level. Levels of Cu exceed the normal background level in all examined birds except great white egret. Levels of Pb and Cd concentrations in water exceed the permissibl...

Nour El-Hoda Khayrat Hammad1*, Yousef Y. El-Seady3, Azza E. Hassan1, Sara T. Elazab2, Magdy S. Amer2 

...ly reduced in testicular tissues of FCZ group while aromatase gene was elevated. The administration of LIN oil after FCZ treatment markedly improved the aforementioned alterations caused by FCZ. So linseed oil is capable to ameliorate the fluconazole induced fertility disorders.

Keywords | Male fertility, Antifungal, Medicinal plant, Testosterone hormone, Aromatase 

...

Hong Yin*, Dan Yang, Ji-Jie Liu, Jing-Wei Ding and Dan-Dan Cui

...antly increased in liver tissues with β-CM-7 treated. β-CM-7 decreased the fatty acid synthase (FAS) level significantly. The results suggest that β-CM-7 can change the dyslipidemia which is induced by aging. The mechanisms of the regulating effects likely tend to pass through controlling the oxidative stress and balancing the level between FAS and acetyl-CoA carboxylase (ACC).

...

Kanakuntla Sandhyarani*, Dhoppalapudi Madhuri, Yadala Ravikumar 

...ere mechanical damage to tissues like kidneys, heart, lungs, intestine (visceral gout) and also in the joints (articular gout). Gout is a multifactorial metaboic disease which involves infectious agents, nutritional factors and managemental prcatices. Infectious agents include Nephropathic Infectious Bronchitis Virus (IBV), Avian Nephritis Virus (ANV), Chicken Astrovirus (CAstV) and nutritional factors like high dietary calcium (>2%), high crude protein (&g...

Muhammad Amin1*, Masarrat Yousuf1 and Naveed Ahmad2

... brain, gills and muscle tissues. Significant (p< 0.005- 0.00) decreased in total protein was noted in response to all the pesticides as compared to control group and a slight increase was also noted during 48 h as compared to 24 h. The level of total protein was decreased for pesticides in order of chlorpyrifos>malathion> lambda-cyhalothrin during the exposure period.

...

Qaisra Siddique1*, Sajid Abdullah1, Huma Naz2, Khalid Abbas1, Laiba Shafique1 and Qingyou Liu3

...tein contents in various tissues (gills, hepatic, renal, brain, muscle and cardiac) of Labeo rohita was determined. Fish was exposed for 60-day and sampling was done after 7-day. Results showed that the GST activity was considerably increased in L. rohita as compared to control. The GST activity was enhanced in various tissues (hepatic, brain, cardiac, gills, renal and muscle) of CPF treated fish as compared to control group...

Fan Da1,3, Zheng-Yong Wen1,2*, Xiao-Dong Wang4 and Yu Luo5

...xpressed in all detected tissues, with the highest expression in liver. Two-week fasting significantly decreased while refeeding dramatically increased the hepatic pvucp2 transcriptions. These findings suggested that fish UCP2 proteins are highly conserved and they might play important roles in maintaining energy homeostasis and reducing reactive oxygen species.

...

Magdy M. Fahmy1, Nisreen E. Mahmoud 1*, Mohamed R. Mousa2, Manal M. Zaki3, Elshaimaa Ismael3, Mai Abuowarda1 

...ing of the affected fish tissues revealed deleterious responses especially in gill tissues. Result analysis concluded that the associated impacts of ectoparasitic infestation together with the water quality deterioration played a significant role in mass mortalities event . The study recommended periodic monitoring of the lake water .Also, the proper sanitary and regular disposal of the waste remnants of clearing and dredgin...

Uzma Jabeen1, Asmat Salim2*, Irfan Khan2, Nadia Naeem3 and Rubina Mushtaq4

...ys for two weeks. Kidney tissues were harvested and the mRNA levels of glutathione peroxidase-1(Gpx1), NAD(P)H quinone dehydrogenase 1 (Nqo1), 24-dehydrocholesterol reductase (Dhcr24), dual oxidase 2 (Duox2), and isocitrate dehydrogenase-1 (Idh1) were analyzed in the kidney tissues by RT-PCR. Extent of injury was analyzed by the change in expression of kidney injury biomarkers, kidney injury molecule-1 (KIM-1) and osteoponti...
Yuechen Li1, Yumo Li1, Xuefeng Zhuang1, Guangfu Lv2, Xiaowei Huang1, Zhe Lin1, Yuchen Wang1* and He Lin1*
...-1 and NOQ1 in the brain tissues of aging mice, which was detected by western blotting. In conclusion, OR treatment improved behavioral disorders and brain damage in the aging mice, suggesting that OR has the potential to be a new anti-aging drug candidate.

...

Barirah Rehman Talpur1, Zaheer Ahmed Nizamani1*, Imdad Hussain Leghari2, Mansoor Tariq1, Aisha Rehman3, Shahnawaz Kumbhar1 

...n of hepatocytes. Kidney tissues of both rabbits and broilers revealed marked shrinkage of glomeruli with widened bowman’s spaces along with inflammatory cellular infiltration. It is concluded that high dose (200mg/l) of Sodium Fluoride causes liver and kidney dysfunction in both species along with lesions in digestive system of broilers.

Keywords | Fluorosis, Rabbits, Broilers, Liver, Kidney 

...

Hye-myoung, Jang 1,3, Ju-Hyeun, Kim3, Garam Park1, Yoon Dong Choi4, Sun-Eui Kim1,5, Gwang Joo Jeon1,2* 

...ein) formed in the brain tissues. Under the hypothesis of obesity inducing potential dementia, mice were fed with high-fat energy diet to gain excessive weight. The experimental groups in this study are 1) high-fat diet fed only (control) and 2) high-fat diet fed with AE added (AE group). After the experiment was terminated, they were slaughtered and brains were obtained. Throughout the experiment, measured were changes of body weight, blood chemical compositi...

Samia Azad1, Iram Liaqat1*, Riffat Iqbal1 and Uzma Rafi2

...r, kidney and intestinal tissues of Rohu (Labeo rohita) exposed to sub lethal concentrations of heavy metal cadmium (Cd). CdCl2 was used as cadmium (heavy metal) source. Five concentrations of CdCl2 (0.2, 0.4, 0.6, 0.8 and 1.0 ppm of Cd) were tested in glass aquaria having 35 Rohu fingerlings in each. After exposure for six week, sections of intestine, kidney and liver were excised and studied histologically. Results revealed variation in histological changes ...

Rizwana Abdul Ghaffar* and Kamil Nadeem

... Pathological studies of tissues from infected intestine reveal several changes from the normal architectural organization of tissues. The most common findings were massive congestion, cellular infiltration, atrophy, hypertrophy and dystrophy of cells and disintegration of cellular layers, fibrosis, necrosis and dilation and proliferation of blood vessels.

...
Dalia M. Aboelhassan1*, Inas S. Ghaly1, Noha E. Ibrahim2, Nermeen M. Shaffie3, Mariam G. Eshak1, Aboelfetoh M. Abdallah4, Ibrahim M. Farag1
...and COX-1 genes in liver tissues, as well as the expressions of mdr1a and COX-1 genes in kidney tissues are evaluated. In addition, the histological architectures of these organs are examined. Bisphenol A (BPA) treatment causes over-expressions of the above mentioned genes, and induces massive damage to the histological architectures of liver and kidney tissues. In contrast, FCE treatment ...

Xiaojing Liu and Zhongxin Li*

...ein expression in kidney tissues, in order to reveal the mechanism of TSG. After 12 weeks of administration, compared with those in the DN modeling group, 24 h urine protein, serum creatinine (Scr), blood urea nitrogen (BUN), blood uric acid (UA), alanine aminotransferase (ALT) and aspartate aminotransferase (AST) significantly reduced in rats treated with TSG (20 mg/kg) (P<0.05), blood total protein (TP) and albumin (ALB) significantly increased (P<0.05...

Iqra Ejaz1, Saima Chaudhry2 and Sarah Ghafoor1*

...k 12 and week 16. Buccal tissues were evaluated for histological assessment. There was minimal increase in body weight of animals belonging to groups IB, 2A and 2B along with a decrease in mouth opening as compared to the control group (1A). However, in the OSMF groups, a gain in body weight, improvement in mouth opening and resolution of fibrosis was observed in experimental group (2B) treated with muco-adhesive gel with active ingredients (2B) than the one w...

Mohammed A. Almujtaba1, Turky Omar Asar2, Salma Naqvi3, Vikas Kumar4, Fahad A. Al-Abbasi1, Abdulbasit I. Al-Sieni1 and Firoz Anwar1*

...eased in DC group. Heart tissues from each group were examined for histological changes. Altered serum levels of the biomarkers were restored on treatment with Zamzam water. Histopathological studies are in agreement with cardioprotective influence of Zamzam in cardiac dysfunction. Research findings endorse the cardioprotective potential of Zamzam in doxorubicin induced cardiac remodeling. We attributed this effect to the presence of zinc in alkaline medium of...

Hakan Kececi1*, Yasin Ozturk2, M. Bahaeddin Dortbudak3, Seda Yakut4, Gurdal Dagoglu5 and Merve Ozturk1

... in the liver and kidney tissues of the rats in the experimental groups. Both hematological and serum biochemical values (Ca, P, TBIL, ALT, AST, ALP, Urea, and Creatinine) were within the physiological limits in all groups. Consequently, in light of the obtained data, it was observed that the rats were not exposed to any toxic effect even when they consumed a stomach full of cocklebur fruit at once.

...

Xiangli Dong1,2, Shilin Mikhail Borisovich2, Jiji Li1,*, Jianyu He1, Zeqin Fu1, Yingying Ye1, Julia N. Lukina3, Olga V. Apalikova4 and Jianshe Zhang1

...ent large yellow croaker tissues, and that their expression was up-regulated by Vibrio anguillarum challenge. Here, we performed membrane protein analysis and epitope analysis to select MRC1 and MRC2 protein fragments suitable for antibody production. We then PCR amplified L.c-MRC1 and L.c-MRC2 and cloned them into prokaryotic protein expression vectors (MRC1 (1044bp)-pET32A and MRC2 (993bp)-pET32A). We performed SDS-PAGE analysis of the expressed L.c-MRC1 and...

Mutassim Abdelrahman1, Ibrahim Alhidary1, Majdi Bahaddi1,2, Mohsen Alobre1,3, Riyadh Aljumaah1 and Rifat Ullah Khan4, *

...and different biological tissues of growing Naemi lambs. Twenty-four lambs were randomly selected and divided into three dietary groups and placed in separate pen/lamb (8 lambs/treatment). The three treatments were as follow: control (fed with complete feed as total mixed ratio [TMR]); T1 (TMR with drenching 1% of Zeolite daily); and T2 (TMR with drenching 2% of Zeolite daily). The feeding trial lasted for 56 days. Digestibility trial was conducted at mid of t...
Muhammad Sajid Hamid Akash1*, Hina Sharif1, Kanwal Rehman2, Sumbal Rasheed1 and Shagufta Kamal3
...nificantly high in liver tissues of ATO exposed rats. Contrarily, RSV was found to be effective in regulating normal glycemic level, insulin tolerance, and metabolic biomarkers. Hence, it was found that ATO exposure is correlated with onset of impaired metabolism and RSV can be used as therapeutic intervention for arsenic-induced impaired metabolism.

...
Mutassim M. Abdelrahman1, Ibrahim Alhidary1, Mohsen Alobre1, Riyadh S. Aljumaah1 and Rifat Ullah Khan2*
...the rumen pH, epithelial tissues pigmentation, fecal odor and status of some trace minerals. Forty-five growing lambs were used in an 84-day trial. Lambs were randomly assigned to five dietary treatments as follows: TMR, AS1 (TMR +15 kg AS/Ton; 22.5 g/lamb/day), AS2 (TMR + 30 kg AS/Ton; 45 g/lamb/day), AS3 (TMR + 45 kg AS/ Ton; 67.5 g/lamb/day) and AS4 (TMR +90 kg AS/Ton; 135 g/lamb/day). The growth performance was not affected by the supplementation of AS. Th...

Qi Zhuo, Yuanchun Yao, Meisongzhu Yang*, Jinhua Chen and Miao Tian

...and malignant and normal tissues were confirmed pathologically. The breast cancer cell line MDAMB-231 and the immortalized normal breast epithelial cell line MCF-10A were used in this study. Western blot analysis of miR-216b-5p and HDAC8 protein expression in tissue samples; reverse transcription quantitative PCR (RT-qPCR) real-time analysis of miR-216b-5p, HDAC8 mRNA expression in cell lines; MTT detection of cell proliferation; wound healing test and transwe...

Alexander Tsybulsky1*, Eduard Kostetsky1, Anton Degtyarenko2, Michail Shchelkanov1,2,3 

... in the BC and FCM tumor tissues, as well in the uterus tissue and WBCs using qPCR. Results. In cats with MG tumours, signs of lymphopenia and thrombocytopenia were found, these being especially pronounced in animals with BC. In cats with BC and FCM, there were significant differences in the expression patterns of the spectrum of target IFN system genes and a number of key cell cycle control factors. These differences were expressed in the tumour tissue itself...

Mai A Fadel1*, Ahmed M Elmahdy1, Jihan Mostafa Badr2, Mohammed AM Saleh3, Mona A.A. AbdelRahman3 

...n in serum and different tissues of chickens. The pharmacokinetics and pharmacodynamics indices of both antibiotics were calculated and statistically analyzed. Aspartate aminotransferase, alanine aminotransferase, urea, and creatinine serum level were also estimated. From our findings, we concluded that the usage of a half-dose combination of enrofloxacin and amoxicillin is safer and more efficient in the treatment of Escherichia coli and Salmonella enteritidi...
Ahmed H. Massoud1, Mohamed S. Ahmed2, Moustafa Saad-Allah1, Aly S. Derbalah1, Ashraf Albrakati3* and Ehab Kotb Elmahallawy4*

Xiajun Zhang1, Jie Yang2, Wenjun Zhou1, Zhenshi Chen2, Weidong Wu3, Shaoru Zhang2 and Lihui Wang2*

...nd SMAD4 genes in normal tissues was higher than that in tumor tissues. ASPN was positively correlated with TGF-β1, TGF-β2, TGF-β3, SMAD3 and SMAD4. Pathway activity shows ASPN and TGF-β1 and TGF-β3 activate EMT. Finally, we speculate that lncRNA CASC7 inhibited miR-26, inhibited ASPN, inhibited TGF-β, and promoted XIAP, to activate SMAD/XIAP pathway, improving the survival rate and invasiveness...

Zahin Anjum1*, Mubashra Tarana1, Shaista Ali1, Faryal Yousaf1, Amina Rahat1 and Sumbla Yousaf2

... analyze three different tissues (liver, gizzard and muscle tissue) of the broiler chicken for absorption of four heavy metal contents (Cu, Zn, Pb and Ni). In addition, analysis of five electrolytes (Ca, Na, K, P and Mg), moisture content, protein, lipids and ash were carried out. The samples were obtained from five different sites of the University Campus, Peshawar- Pakistan. The Atomic Absorption Spectrometry was employed for determination of Cu, Zn, Pb, Ni,...

Ashira Manzoor1, Imran Ahmad Khan1,2*, Muqadas Sadiq3, Muhammad Omer Iqbal4 and Shaukat Hussain Munawar5

...dent manner. The cardiac tissues showed marked improvement in extract treated groups as compared to doxorubicin treated group. This research indicates that the hydro alcoholic leaf extract of C. colocynthis have exceptional cardio protective potential as compared to toxicity induced by DOX. As a result, it could be used as an alternative medicine for the treatment of cardiovascular disorders.

...

Man Wang1 and Fengmei Yang2*

...ene and protein in tumor tissues were higher than those in normal tissues, and the differences were statistically significant (P<0.05); TOP2A gene expression was positively correlated with immune cells infiltration (P<0.05); the overall survival, disease-free survival and survival probability of patients with high expression of TOP2A gene were lower than those with low expression of TOP2A gene (P<0.05). In clinical ...

Aslı Çilingir Yeltekin

...). The kidney and muscle tissues indicated a significant decrease in antioxidant enzyme activities (superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GSH-Px)) compared to the control (p< 0.05). Therefore, these data may reflect one of the molecular pathways that play a role in tebuconazole toxicity.

...

Sara Magdy Hashim1, Elshaimaa Ismael2, Mohamed Tarek3, Faten Fathy Mohammed1*, Fatma Amer Abdel Reheem3, Rawhia Esawy Doghaim1 

...s that involve different tissues. The immunohistochemical characterization of viral antigen revealed direct relation between viral residence in tissue and developed pathology. The present study confirmed that H5N8 HPAI clade 2.3.4.4b, became a predominant strain during the period 2018-2020, causing severe outbreaks in duck farms in Egypt.

Keywords | Avian influenza, HPAI, H5N8, Ducks, Pathology, Egypt. 

...

Sumreen Begum, Atta-ur-Rahman and Asmat Salim*

...tal and adult rat kidney tissues. These genes were divided into three categories. Group 1: renal multipotent progenitor genes; Group 2: self-renewal and pluripotency genes; Group 3 pluripotent state regulator genes. In neonates, renal progenitor genes Wt1, Pax2, Cad6, Six2 and HNF1β were significantly expressed with concomitant expression of pluripotency genes. Nanog was highly expressed as compared to Oct4 and Sox2 at neonatal stage. Aicda, Glis1, Tbx3 a...

Öznur Özil*, Öznur Diler, Mevlüt Nazıroğlu, Aşkın Atabay 

...otic and fibrotic muscle tissues lesions in Garra rufa.

Keywords | Clinostomum complanatum, Garra rufa, Histopathology, Prevalance, Intensity  

...

R. Singh1† and R. Z. Sayyed2

...ode body and surrounding tissues
when stained with toluidine blue.
...
Saleh Aljubran, Shaker Al-Suwaiegh, Yousef Alyousef, Sulaiman Alhajri, Mohammed Alghareeb, Abd El-Nasser Ahmed Mohammed*
...opreservation of ovarian tissues and germ cells and embryos, and genome resource banking for mammalian species. Such biotechnologies allow more offspring to be obtained from selected parents to increase milk and meat productivity, reduce the interval between generations, therapy of diseases and conservation of endangered mammalian species. Practically, current reproductive biotechnologies are species-specific because of differences in estrous cycle, seasonalit...

Sadaf Aman1, Fouzia Tabssum2, Ali Hussain3, Shamsa Jabeen1 and Javed Iqbal Qazi1*

...the liver and intestinal tissues for the fishes fed with plant based feeds added with probiotics. Conclusively, fish production can be enhanced with the addition of probiotics in the feed derived from plants.

...

Lihang Wang, Qiling Chen, Tingsheng Lu, Shudan Yao, Xingwei Pu and Chunshan Luo*

...erum and the spinal cord tissues was behind euthanasia of rats. Detection of biochemical indicators, observation of cell apoptosis, and determination of Bax, Bcl-2, p38 MAPK and Smad2 were clarified. We found that MH and MH+MPS could effectively reduce apoptotic cells, dramatically minify TNF-α, IL-6, IL-8, MDA and Bax contents (P < 0.01) and elevate GSH-Px and Bcl-2 level (P < 0.01). Additionally, the P38AMPK/Smad2 pathway proteins (phosphorylated...

MARIUM ASLAM, MUHAMMAD JAVED, FAIZA AMBREEN* & FARIHA LATIF

...zyme was observed in the tissues of fish as compared to the control group. Peroxidase activity in the liver of fish from all the treatments was significantly (p<0.05) higher than that of kidney. The results of these studies in fish tissues may prove that peroxidase activity can be used as a sensitive bio-indicator of the antioxidant defense system.
 
Key Words: Catla catla, Sub-lethal, Zinc, A...
Heavy metals (HMs) are harmful and lethal at negligible levels and non-biodegradable in the typical ecosystem and constitutes animal, human and environmental hazards. They are divided into toxic metals like Lead, Cadmium, Arsenic, etc. and essential elements like copper, zinc, manganese, iron, nickel and chromium. Additionally, could be categorized into two groups based on the natural and anthropogenic sources releasing origins. Population and industrial expansion led to food contamination with HMs. Poisonous metals can be transferred from irrigation water to agricultural soils, agricultural operations, air pollution, animal feed, and packaging materials. Toxic metals are non-biodegradable, non-thermos degradable, and exceedingly stable in the ecosystem; as a result, they quickly build in various foods. Metal pollution of many foods, including agricultural commodities, and animal protein sources such as fish, milk, meat, and eggs, poses a hazard to food safety and security. Toxic metal pollution of irrigation water, agricultural soils, plants, and animals result in their integration into the food chain, posing a health hazard to humans. Most metals are harmful to animals and humans and accumulate in several organs like the skeleton, hepatic tissue, spleen, and renal tissues. Metals have a deleterious impact on the production of plants and animals. As a result, several remediation strategies have become necessary to limit the hazardous HMs pathway into the food chain and the human body. Metal nanoparticles are employed in beneficial applications, although they are associated with specific hazards.
 
Keywords | Food contamination, Heavy metals, Nanoparticles, Pollution sources, Remedy, Soil contamination
...issue, spleen, and renal tissues. Metals have a deleterious impact on the production of plants and animals. As a result, several remediation strategies have become necessary to limit the hazardous HMs pathway into the food chain and the human body. Metal nanoparticles are employed in beneficial applications, although they are associated with specific hazards.
 
Keywords | Food contamination, Heavy metals, Nanoparticles, Pollution s...

A.S. Gamal El din1; Sohair I. El-Afifi2; A. S. Sadik 2; Nashwa M. A. Abd El-Mohsen1; and H. M. Abdelmaksoud1

...cted from virus-infected tissues of D. metel leaves by the use of degenerate primers through polymerase chain reaction (PCR). Large-scale amount of PVY (N-Egypt) coat protein produced by gene expression technique in E. coli through: (I) Insertion of CP gene isolated by RT-PCR into Pinpoint Xa-l Vector by ligation and propagation after transformation process in E. coli. (2) Isolation of plasmid DNA. then used restriction enzymes Bam HI and Bgl II to identify cl...

E. K. Allam.1; B. A. Othman.1; Hayam S. Abdelkader2; and Noher A. Mahmoud2

... in both fresh and dried tissues. A fragment (321 bp) of the coat protein gene of GFLV was amplified by reverse transcription-polymerase chain reaction (RT-PCR) using two primers specific for the coat protein gene or GFLV. Nucleotide sequences of the RT-PCR products confirmed that these sequences were amplified from the GFLV coat protein gene. A specific GFLV Dig labeled DNA probe was prepared by PCR and detected the GFLV virus in fresh leaves up to 10-5 dilut...

M.A.S. El-Kady1, Om-Hashem M. El-Banna 2, E.A Salama2, Salwa N. Zein1

...ay (ELISA), Dot-blot and tissues-blot immunobinding assays (DBIA and TBIA). The presence of the virus was confirmed in mature seed parts and non-seed parts of the different five barley cultivars tested.

...
A.l. Abd El-Fattah; A.s. Saclik M.M. El-Kholi; I.A. Åbdcl-Hmnid and M.A. Madkour
...virus-infected sugarcane tissues and then used as a template for reverse used transcription-polymerase to amplify the coat protein chain reaction (CP) gene (RT-PCR) Of SCMV-E to amplify strain. the ThecDNA that directly amplified cp gene was used as a template using the internal primer combination in PCR for confirmation its specificity to the SCMV-cp gene as a PCR product with a size Of about 400 bp was amplified. Th...

Shaimaa A.Tawfik2,3, EL S.T. Awad1*, Hoda O.Abu Bakr1, Amira M.Gamal-Eldeen4, Esmat Ashour2, Ismail M.Ahmed1  

... liver, kidney and heart tissues were confirmed these findings. In liver tissues, DOX resulted in an observable induction in CYP3A4 and MRP-1, while CSO/DOX showed an inhibition in both proteins. c-MYC was dramatically decreased in DOX group, while CSO/DOX group restored cellular c-MYC. CSO/DOX group resulted in a remarkable inhibition in the tumor suppressor miRNA (let-7a) compared to DOX-induced expression. Moreover, miR-...

Nawfal Hammadi Jasim1, Yasmeen Jassim Mohammed2 , Jala Amir Salman Alahmed1, Majdy Faisal Majeed3* 

...ced, and blood and liver tissues were collected for biochemical and histological analysis . Results: Comparison to the Control Group, the ratio of ALT in the blood serum significantly increased in groups 1 and 2 of MPH-treated rats, meanwhile, the ratio of AST remained unchanged significantly in Group 1. In the liver, MDA and GSH-PX rates were significantly increased (P≤0.05) in 1 and 2 groups compared to the 3 groups (the control), while SOD level signif...

Munir Ahmad1, Abdul Ghaffar1, Riaz Hussain2* and Rifat Ullah Khan3*

...blood and other visceral tissues were obtained on days 10, 20, and 30 of treatments. Different physical and behavioral disorders were noted in terms of time and concentration manners. In comparison to control fish, the hematological profile including lymphocyte, hemoglobin erythrocyte and monocyte counts, was considerably (p < 0.05) lower. The final results on the serum biochemical parameters showed significantly (p < .05) higher concentrations of liver ...

Amr N. El-Shahat1*, A.M. Abdul Azeem1 and Mohamed H.M. Abd el Megid2

...tatus in liver and heart tissues with indicated inhibition of lipid peroxidation by reducing the level of malondialdehyde compared to HCD-fed rats. The results concluded that BLE may have an effective role in reducing high cholesterol levels.

...

Yufang Liu1,2, Guiling Cao3, Yujing Xie3 and Mingxing Chu1*

...LC 90d, EO group). Ovary tissues were taken from goats on 30 days, 90 days and 180 days, total RNA was extracted, differentially expressed (DE) gene libraries were constructed by suppression subtractive hybridization (SSH) technology, and puberty-related differential genes were screened. A total of 184 differentially expressed genes were screened, including 57, 68 and 59 in the AO, BO and EO groups, respectively. There are 22 differentially expressed genes wer...

Atef M. El-Sagheer1*, Aline F. Barros2, El-Sayed M. Abd El-Aal3, Mohamed M. Gad4, Doaa S. Mahmoud4 and Amr M. El-Marzoky3

...cal modification in root tissues under natural conditions of banana cultivation. R. similis was observed in the cortical parenchyma as a feeding site, and for the first time, the feeding site extended to the vascular cylinder. In roots infested with M. incognita only, the laceration of the feeding site in the inner cortical tissue and spread to the vascular cylinder were selected as the initial feeding site, as shown. Multinucleate cells, giant cells, and thic...

Jing Hu1,2,3 and Zhenhua Ma1,2,3*

...he gills and head kidney tissues of juvenile hybrid grouper, and obviously affect the serum indicators, but some indicators can be restored to normal by adaptation. From the perspective of this study, indoor flowing seawater system can be properly opened during typhoons, but attention should be paid to water quality monitoring and to observe whether juvenile hybrid grouper has abnormal behavior.

...

Chen Zhao, Lulu Ding, Ying Ye, Congying Kou, Haoran Xiao, Jing Zhu and Jicang Wang*

...onoid that protects many tissues of the body from the toxic effects of heavy metals. Studies have explored the adverse effects of Cd on rats and other animals, but the mechanism of Cd-induced autophagy in the kidney and the antagonistic effect of Nar on Cd are still unclear. In this study, SD rats were treated with Cd and/or Nar to investigate the protective effect of Nar on Cd-induced toxicity. The rats were treated for 4 weeks. The histopathological observat...

Reza Esmaealzade Dizaji1, Arasb Dabbagh Moghaddam1*, Arash Ghalyanchi Langeroudi2, Mohamad Foad Heydari3, Seyyed Javad Hosseini Shokouh4 and Ana Shirzad Shahrivar5

...cal alterations in wound tissues and to determine mRNA expression of inflammatory and pro-inflammatory cytokines. We found that the PRP/BNF group and the PRP group had faster wound healing rates than the model group at each time point in the current investigation. The same results were corroborated by the pathological score of skin wounds stained with H&E. Researchers found that in comparison to the control group, those in both the PRP/BNF and PRP groups h...

Wei Wang1, Meifeng Zhou2, Yuebo Liang1, Fan Zhang1, Zhong Wu3, Shaowei Mo4* and Yi Qing Wang1*

...not been explored. Tumor tissues were collected from 40 breast cancer patients for clinical studies. For in vitro studies, human breast cancer cell lines SK-BR-3-TS was obtained, and trastuzumab resistant model SK-BR-3-TR was constructed. Cell viability was determined using MTT assay. Cell apoptosis was analyzed by flow cytometry. Protein and mRNA expression was measured using western blotting and RT-qPCR, respectively. The mRNA and protein level of YAP was si...

Qingjin Li1,2, Zhiyuan Sui1,2, Jihu Zhang1,2, Zhishuai Zhang1,2 and Feng Xing1,2*

...was expressed in all the tissues of Duolang sheep at the prepuberty, puberty, and postpuberty. The expression level of CTSD in the hypothalamus and uterus was relatively low. But its expression level in the ovary at puberty was significantly higher than that in other tissues. These results suggest that CTSD may play an important role in the onset of puberty in sheep by regulating the development and ovulation of follicles in...

Nida Sadaqat1, Sheheyar Ahmed Khan1, Amna Bibi1, Sadaf Zahra1, Muhammad faisal Salamt1, Noreen Latief2 and Fatima Ali1*

...und tissue. Wounded skin tissues were cut off and stored at − 20°C for PCR and ELISA analysis. The therapeutic effects of a NAC supplementation for a short period of time on rat skin wound healing were investigated. The NAC treatment promoted an improvement of wound healing by reducing the oxidative stress, improving wound closure, reducing tissue inflammation with no significant change in blood parameters. There were no significant difference...

Omar Berkani1*, Souheila Slimani2, Nora Sakhraoui3 and Cherif Abdennour1

...ration in the testicular tissues. It was concluded that PO aqueous extract co-administration may be promising as a natural protective herb against CYP-induced reproductive toxicity in the male pigeons.

...

Abnet Mekonnen1*, Kadir Abderehman1 and Feti Seyaka2

...ics affect all excitable tissues in the body, so toxicity can occur when sufficient amounts of the drug are absorbed into the circulation. General anesthesia (GA) is not commonly used in small ruminants as its administration results in several side effects such as; ruminal tympany, regurgitation of reticuloruminal contents, aspiration of refluxed material or saliva, hypoventilation, hypotension and fluid and electrolyte imbalances. Ketamine (injectable) is a c...

Saime Betül Baygeldi1, Barıs Can Güzel1*, Ramazan Ilgün2 and Zait Ender Özkan1

...of the German mast goose tissues took a total of 31 days. On the SEM plastination images, scattered dispersion was observed on the epithelium of the tongue surface, corresponding to the findings on the fresh material. The papillae on the SEM images were observed to be preserved as in the fresh material images.

...

Di Zhou1, Qingmeng Long1*, Rong Yang1, Xiaoshan Tan1, Jun Li1, Mingyan Tang1, Zhonghai Zhao3, Ye Ao2, Zhinan Zhou1 and Changxue Chen1

...arian and fallopian tube tissues of goats with the same pedigree and analyzed the results using bioinformatics and qRT-PCR. We found 8120 differentially expressed genes (DEGs) in ovarian tissues (3205 up- and 4915 down-regulated), 5255 DEGs in the fallopian tubes (1317 up- and 3888 down-regulated) and 5180 DEGs in uterine tissue (2597 up- and 2583 down-regulated). The biological processes associated with these DEGs were prim...

Zhipeng Song1,2, Jialiang Xin1,3, Xiaoli Wei1,2, Abula Zulipiya1,3, Kadier Kedireya1,2 and Xinmin Mao1,3*

... inflammatory factors in tissues by affecting their pathways. It can integrate with these and many other proteins, and the formed conjugates have a better therapeutic effect.

...
Qiangsheng Wu1, Yumei Yin2, Hui Gao1, Baoding Chen3, Jianjun Yu2, Jian Zhang4, Donglai Zhu5, Fang Liu6, Guohong Ge7 and Ya-Mei Dang8*
...ma patients’ tumor tissues were compared to 8 normal liver tissues to screen out the significant abnormal expressed genes. The potential interactions and mechanisms of these genes in promoting hepatocellular carcinoma were analyzed through bioinformatics analysis. The results showed that the functions of these 1495 differently expressed genes enriched in cell cycle, oxidation-reduction and drug metabolic process. Addit...

Ali Mosa Rashid Al-Yasari1, Zahid I. Mohammed2, Haider S. Almnehlawi3,4, Ali F Bargooth5, Nawar Jasim Alsalih1, Huda F. Hasan6*, Mohenned A Alsaadawi1 

...acrificed on day 28, and tissues were collected for immunohistochemical identification of pancreatic cells that produce insulin and glucagon. Based on our results, none of the research parameters significantly differed across the groups on day 0. Days 1 through 28 showed that STZ-Diabetes group had the uppermost blood glucose level with lowermost blood insulin among the study groups as a result of the induction of diabetes. Comparing the STZ group to the contr...

Shafi Muhammad1, Bibi Nazia Murtaza2, Aftab Ahmad1, Muhammad Shafiq3, Nurul Kabir4 and Hamid Ali1*

...IHC) techniques in liver tissues in HCV patients from the southern districts of Khyber Pakhtunkhwa, Pakistan. In addition, the network of IL-17A and its KEGG pathway related gene IDs were constructed using GeneMANIA and STRING online web tools. IL-17A serum levels were significantly higher in fibrotic patients compared to chronic HCV patients and showed a positive correlation with age. The constructed gene network revealed interactions between IL-17A and vario...

Iftikhar Ahmad1, Tahir Saeed1, Umair Faheem2*, Qaisar Abbas2, Muhammad Saleem Akhtar Khan3, Mussurrat Hussain2, Tanveer Ahmad4, Gulzar Akhtar4, Asifa Hameed5, Muhammad Hasnain6 and Muhammad Jamil7

...eding of thrips on plant tissues. Thrips commonly feed upon the gladiolus and different vegetative and floral parts of gladioli are attacked by them. Application of chemical insecticides provides effective control of insect pest in short period of time. The present investigation was carried out on Jasminum sambac against flower thrips for efficacy of insecticides. To conduct this experiment, six insecticides viz., imidacloprid 20Sl, Spinosad 240SC, Spintoram 1...

Haneen Imad Al-Sultani1*, Ahmed Obaid Hussain1, Hazar Shakir Saleh2 

...re dissected, and kidney tissues were taken for histological study. Male rats treated with rosuvastatin showed an elevated cystatin C level and increased vitamin D3. At the same time, the results of the microscopic examination showed significant histopathological changes in the kidneys of the groups treated with rosuvastatin compared to the control group, which included mild, moderate, and severe injuries: necrosis, congestion, hemorrhage, glomerular degenerat...

Rana Mahmood Ahmad*, Orooba M.S. Ibrahim 

...ial role in safeguarding tissues against damage caused by inflammation. These results led us to hypothesize that SaZnONPs therapy speeds up the switch from an inflammatory to an anti-inflammatory response during the healing process. The histopathological observation showed that a section of a joint in groups treated with SaZnONPs had a normal joint cavity with normal articular cartilage compared with other treated groups. Accordingly, the findings of the prese...

Danish Kamal2, Muhammad Abbass Khan1, Ghulam Mujtaba-Shah1, Naveed Ahmed1, Maryam Iqbal¹, Basharat Hussain Shah1 and Imtiaz Ahmed1*

... in epidermis, mesophyll tissues and vascular bundles. Stomatal index of different tea varieties and clones was array from 33.9 to 45.4 respectively. Highest was mentioned in clone P-7 because high number of stomata found in lower epidermis.

...
Zhi Qiang Gao*, Dan Dan Zhang, Qin Gmei Qin, Xiu Xiu Li, Li Li, Yan Zhong Xue and Shifeng Guo
...). Then, the DNA of GNTs tissues was extracted, and the PSEN1 E280A mutation was detected by sequencing. Finally, the correlation of PSEN1 E280A mutation with clinical characteristics was analyzed. PSEN1 E280A mutation was detected in 16 GNTs patients (44% in GGs (11/25) and 33.3% in DNTs (5/15)). PSEN1 E280A mutation was obviously elevated in females (10/16, 62.5%) versus in males (6/24, 25%) (P = 0.025). Meanwhile, more extensive seizure types were present i...
Morcos Ibrahim Yanni1* and Eid Elsaid Abdelaziz2
... isolates from the brain tissues of three dogs from 2017 to 2019 at the genetic level of the N and P genes from three governorates of Delta region in Egypt with earlier isolates, locally used vaccinal strains and other used strains internationally. Ten brain tissues from confirmed rabid cases in three governorates; Dakahleya (3), Alexandria (4); and Beheira (3) were diagnosed using viral cell culture and Direct Fluorescent T...
Hanaa H.A. Gomaa1*, Dalia Y.A. Amin1, Mona A. Ismail1, Basma Hamdy2, Khaled A. El-Dougdoug3
...hytosanitary of cell and tissues of FLV infected fig plants treated with ChNPs and BM, as well as improved shoot length, leaf area and dry weight. Biochemical markers as indicators for systemic acquired resistance were significantly increased including total proteins, salicylic acid, phenol, proline, Peroxidase, polyphenol oxidase and superoxide dismutase activities Nanochitosan and biomagic were treated and improved tissues...

Abdul Aziz1,2, Hamad Bin Rashid1*, Muhammad Arif Khan1, Asim Khalid Mahmood1, Ayesha Hassan1, Hamid Akbar1, Sadaf Imran1, Naveed Hussain1, Muhammad Umar1, Muhammad Asif1, Sajjad Javaid1 and Mamoona Chaudhry3

... SVF per gram of adipose tissues was 2.992±1.527 x 106 cells/g, percentage of viability was 97.98± 0.31%, while non-viable cell count was 2.02± 0.31%. It is concluded that enzymatic digestion is an easy technique requiring less time for SVF isolation and gives better cell yield per gram. SVF preparation process has advantages of minimum cell contamination and processing time. Hence, it is a cost effective and alternate procedure for develo...
Yi Zhao1,2,3, Lei Luo1,2, Liqi Tan4, Jianhua Huang1,2, Dongliang Liu1,2,5, Shigui Jiang1,2 and Lishi Yang1,2*
... hepatopancreas and gill tissues of crayfish was gradually increased, and the fatty acid synthase activity at 10°C and 30°C were significantly lower than the control group of 25°C. Furthermore, lysozyme, catalase and superoxide dismutase in 10 °C and 30 °C were significantly lower than that of 25 °C. ELISA revealed that HSP90 activities was enhanced with the increasing temperature in hepatopancreas after 36h of treatment. HE sections sh...

Ibrahim l , Madiha Salah and Ikuta 2, Kazuyoshi

...ng lung, liver and brain tissues with high sensitivity and specificity. The sensitivity and specificity were 71% and 100% for Sysmex avian influenza kit and 86% and 33% for Sysmex influenza MB kit. Thus, Sysmex avian influenza kit was shown to be a potentially useful tool for the direct and rapid detection of H5N1 in clinical specimens due to its high specificity. Additionally, an advantage over the other kit is specifically reacting with viruses of avian orig...

Bakr3 *, Youssef M.; Nour El-Din3, Hanan A.; Abd EL-Wahed2, Waiel F. and Hemeidal , Aläa A.

...nst PLRV infected potato tissues.

...

Khamiss l , Omaima; El Helaly , Alexandra and Abol Ela 3, Said

... from the insect ovaries tissues was established, cloned and maintained as contentious cell line. Nine serial dilutions of Polyethylene glycol (PEG) were prepared from mother suspension (18.2g PEGS" in 100 ml double distilled de-ionized water) started fromlO 1-109. Each concentration was prepared to treat five replicates of C35 cell dish. Treated cells were observed daily and counted 5 times within 15 days, and cell viability was detected by using the via...

Khatab, Eman A.H.; Zein, Salwa N. and Ahmed, Amal A.

...t ELISA with dilution of tissues 1/5 was 1/1024. Purification of the immunogamaglobulin G and conjugate of IgG with alkaline phosphatase were carried out to be used for ELISA detection. The concentrations of IgG and IgG conjugated with alkaline phosphatase were 1.0 mg/ml and 1:1000 respectively. Antiserum produced specific to BBTMV was used for virus detection by using different serological diagnostic methods. The percentages of virus detection in leaves, stem...

El.-Kadyl, M.A.S; Badr2, A.B.; zein3, Saiwa N. and Khalifa4, M.A.A.

...s was 3.35 mg/100 g leaf tissues. Electron micrographs of the purified virus preparation revealed the presence of filamentous flexuous virus particles about 730-745nm long. Antiserum obtained after the second bleeding was 1/1024. The optimum concentrations of IgG and IgG conjugate were 1.0g/ml and 1/1000, respectively.The antigen dilution end point was 1/800. Ribavirin had a higher inhibitory effect (80%) when sprayed at lower concentration (the minimum inhibi...

Eman, M. Abd El-Mottaleb.*; Ahmed, S.A."; Maysa, H.M.*; Salem, S.A.* and M. M. El-Shenawy

...agulant, nasal swabs and tissues (bovine liver, kidney, lymph nodes and lung) for BEFV isolation and propagation on Vero, BHK21 cell lines and baby mice. Identification was done by both Indirect Fluorescence Antibody Technique (IFAT) on tissue culture and inoculated mouse brain, while immunoperoxidase technique was done on bovine lung. Haematological examination revealed leucocytosis accompanied with neutrophilia (immature form) and lymphopenia. Histopathologi...

Sabry Y. M. Mahmoud; Maher H. Hosseny and Mamdouh H. Abdel-Ghaffar

...lectric-shocked stems or tissues immersed in electrified water, were transferred into the medium  supplemented with or without ribavirin (RBV) •to examine its combination effect. With  an electric shock treatments alone (5, 10 and 15 mA electric current), the replicates become PVY-free in rates53.8,72.7 and 87.5%, respectively. Simultaneous, RBV and electric shock had higher efficiency for PVY elimination, reaching rates of healthy plantlets of ...

*Amal Abou El-Ela A., M. A. Amer and Eman A. H. Khatab,

...ith uninfected carnation tissues.
 
...

* Amal Abou El-Ela, A.

...rbaceous and woody plant tissues. In successful attempt to eliminate the virus from infected dormant rose cuttings by heat therapy resulted in 29.6% virus elemination of (PNRSV).
 
...

A. A. Kheder1; I. A. M. Ibrahim2; H. M. Mazyadl

...PRMV was detected in the tissues of infected trees by DAS- ELISA, TBIA and DBIA. RT-PCR was used to amplify fragment of PRMV cDNA using specific primers designed to amplify 200bp of the coat protein gene as a molecular procedure for diagnosis. Electron microscopy of purified preparation of PRMV showed presence of isometric particles 28 nm in diameter. Ultrathin section for electron microscopy examination of infected peach leaves shows virus particles in vacuol...

M.R. Abd-El Wahab l, H.A. Hussein2, T.M. Asfourl and M.A. Shalaby2

...y;">BVDV was detected in tissues collected from dead camel cases using antigen capture ELISA and fluorescent antibody assay. Histopathology examination of different organs revealed changes similar to those reported with BVDV infection. The existence of BVDV in sera collected from camel population. in the area (Al-Ain city. Western area or Abu Dhabi- Emirate, UAE) where camels were found was confirmed. The antigen was confirmed using antigen capture ELISA and F...

Noor A. Namaa*, Hayder A.N. Al-Zamely

...al protein in testicular tissues utilizing the two assays of Western blotting and Bicinchonic Acid. A total of 60 Wister rats were chosen, prepared, and divided equally into three groups: T1, T2, and negative control, which received only distilled water daily and no other treatment. T1 was given a daily dose of (500 mg/kg) of Ginseng extract, while T2 received a daily dose of 250 mg/kg of Ginseng NPs. After a 60-day experimental period, all study animals were ...

Tayfun Karatas1*, Betul Apaydın Yıldırım2 and Serkan Yıldırım3

...re in the liver and gill tissues. However, both 50 and 100 mg doses of TLE had protective effects against CMN-induced toxicity in all the above parameters. As a result, we have shown that 100 mg of tea leaf extract is more effective in preventing harmful effects on blood biochemistry (AST and ALT), oxidative stress, immunity, apoptosis, histopathology and DNA damage caused by CMN.

...

Ghaith Z. Hasan Al-Askari *, Eman H. Yousif Al-Taee

...hological changes in the tissues of female rats. The methods included in the first experiment, the female rats were orally administered the following lethal doses: 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, and 16 mg/kg b.w. of vitamin D. Survival and mortality numbers were observed following 24 hours of intoxication. In the second experiment, the selected groups were divided according to the doses they received. In a cross-sectional stu...

ZARYAB KHALID SIAL & FARAH KHAN

...tly RNAs are degraded as tissues are taken from fields, therefore the protocol for PSTVd RNA isolation was optimized and improved for obtaining Pure and high quality RNA having an increased and nondegradable life from infected plants of Potatoes. The present study was aimed to confirm the presence and identification of potato spindle tuber viroid (PSTVd) on potato plants in Pakistan. RNA was extracted and purified using optimized Trizol reagent and RNeasy Mini...

NAILA MALKANI*, IRFAN ISHAQUE, KHALID SHAHBAZ, RIZWAN ULLAH KHAN, ARIFA SHABBIR & ATIF YAQUB

...logy of liver and kidney tissues revealed signs of chronic damage in the wild captured fish as characterized by lymphocyte infiltration and altered morphology of functional units. It is concluded from findings of the present study that farm-raised Labeo rohita were healthier and safer to consume compared to the wild-caught fish.

...

SHAGUFTA ANDLEEB1*, ASMATULLAH2, SHABANA SHAUKAT1 & SIDRA NAWAZ2

...sthetized torecoverliver tissues following fixation in Bouin’s fluid and processing for histological preparation using different grades of alcohol and xylene for dehydration. These tissues were later on infiltrated with paraffin wax, sectioned to size of 4μm and stained with Hematoxylin and Eosin. The histological analysis revealed that metformin could cause adverse malformations like pyknosis, necrosis, and steatos...

Adriana Beatriz Sánchez-Urdaneta1,2*, Gisela del Carmen Rivero-Maldonado2, Cecilia Beatriz Peña-Valdivia3 and Dianelis del Carmen Sánchez-Urdaneta4

 

 

... protection of the inner tissues. All of the above has applicability for the selection and cultivation of promising genotypes.
...

SYEDA NADIA AHMAD1, MEHWISH NASIR1, AQSA NAUREEN1, SHAGUFTA ANDLEEB4, KAUSAR RAEES3, TAHIR ABBAS2, ASMA YOUNIS1 & KHAWAJA RAEES AHMAD*1

...ometric changes in these tissues.

...
NOREEN RAZA1*, TASNEEM A. SAQIB2, SYED NAEEMUL HASSAN NAQVI3, MUHAMMAD ZAHEER
KHAN2 & MAZHAR HIJAZI3
...ed in the mentioned body tissues of Larus argentatus of control group.

...

ADEEBA SYED1, DILAWAR HUSSAIN2, UZMA RAFI1 & SUMAIRA MAZHAR1*

...t the end of the trials, tissues from various organs like intestine, liver and kidney were collected and sections were examined under digital microscope. Pronounced histological changes like necrosis, infiltration, atrophy, shrinkage and degeneration of intestine was observed for different CPF concentrations. Kidney sections of Labeo rohita under different CPF concentrations exhibited nuclear hypertrophy, vacuolar degeneration of glomeruli, and occlusion of tu...

Muhammad Wasif Gulzar*, Riffat Maqsood, Muhammad Zain, Muhammad Suleman, Tayyab Ur Rehman, Sana Asif, Abdul Wadood and Jawad Hussain

...es in fresh canine brain tissues. The preferred methods for routine diagnosis include PCR (Polymerase Chain Reaction), and Mouse Inoculation Test (MIT). In endemic locations, vaccinations with DNA, recombinant vaccines, and live, attenuated, or inactivated viruses can be administered. This study provides comprehensive information on immunization, treatment techniques, pathophysiology, epidemiology, transmission, and relevant preventive and control measures.

Sedef Selviler Sizer1, Semih Kurt1*, Burcu Onuk1, Gokmen Zafer Pekmezci2 and Murat Kabak1

...n the beetle colony. All tissues, including eye and brain tissues, of the heads placed in the Dermestes colony were cleaned in one day in cats, two days in roe deer, and three days in cows. In addition, it was observed that the Dermestes colony was not a preference priority when consuming soft tissues such as eyes, brain and muscle. This current manuscript has revealed the advantages of th...

Afrah Adil Hassan1*, Hawraa F. H. Alowaid1, Majdy Faisal Majeed2 

...tion of lead in multiple tissues and its interactions with bio-elements, essential for various biological functions. This study aimed to investigate the combined protective effects of Chrysin (Chy) and Ginkgo biloba (Gnk) against the bioaccumulative toxicity of Pb+2 on histological liver profiles and antioxidant enzyme activities in male adult rats. Adult male Wistar rats (250±10 g) were divided into four groups: group I (n = 6) served as the control an...

Liyun Chang1*, Yumei Cai1, Chenghui Li1 and Jianhua Qin2*

...the total DNA from fresh tissues of immunized chickens, the 3-1E gene was amplified by PCR, the serum IgG antibody was detected by routine ELISA, peripheral blood lymphocyte proliferation response was evaluated by cell proliferation assay. The results showed that a target band of 583 bp was obtained by PCR in DNA vaccine PLGA microspheres group at 7th, 14th, 21st, 28th, 35th day post-injection. No 3-1E gene target band was found in the control group and the na...
Muhamamd Arif Chaudhary and Ejaz Ahmed
...n blockage of conducting tissues, causing heart wood rot followed by termite attack and elimination of Rahizobial nodulation. Therefore, it is suggested to carry out an intensive field survey; study the biology, physiology and ecology of the suspected fungi and Rhizobial nodulation pattern.

...
Sarfaraz Hussain Bangash
...akdown of the conducting tissues and results in the brittleness of stem and petiole which finally causes brown coloration and cessation of roots and height-growth (Bangash & Gardiner, 1985). Boron deficiency causes increase in total sugar and starch in leaves and stems of boron deficient plant (Oram, 1961); while a greater amount of benzene insoluble matter is also found in the leaves of normal plants and in the stem of boron deficient plants. Certain parts of...
S. H. Iqbal, Shahbaz and Ghazala Nasim
...porophylls and epidermal tissues of Abies pindrow, Auracaria cunnighamii, Cycas circinalis, C. revoluta, Cupresses torulosa, Ephedra gerardiana, E. regeliana, Juniperus communis, Pinus helepensis, P. roxburghii, Podocarpus chinensis, Taxodium mucronatum, Thuja orientalis and Zamia floridana. Endomycorrhizae were prevalent in species of most families including Pinaceae which normally forms the ectomycorrhiza. Fungal hyphae colonized the yo...
R. H. Jafri Dr., K.M. Saleem, R. Iqbal and Qaisra Fazal
...at the nuclei of adipose tissues, tracheal membrane, dermal cells and blood cells developed polyhedral bodies within a week after infection. Nuclear polyhedrosis virus multiplied rapidly and finally occupied the whole cell. Due to rapid increase in number of nuclear polyhedrosis virus, the cells and finally all the tissues disintegrated, resulting in death of the individual. Nuclear polyhecrosis virus infection in silkworm c...
M. Ismail Chaudhry and Iqbal Ahmad
...s and feed on parenchyma tissues, leaving network of viens and skeleton of leaves intact. It causes more than 90% leaf stitching when severe.
The moths from hibernating pupae emerge during March and copulate 10-20 hours after emergence. The duration of mating varies from 25 minutes to 8 hours. The moths start laying eggs 12 hours after mating. A single female on an average lays 163.5 eggs with a range of 71 to 264 eggs per female. The oviposition per...

Fatima Aziz Mahdi Al-Badry

...re manifested lesions in tissues by receiving of puma, it involved many histopathological changes (mild, middle and very severe injuries) in renal structure as hemorrhage, congestion, inflammation and structural disorders such as breakdown, death and absence of glomeruli with increasing of Bowman’s space. while these histological changes in liver were included congestion, hemorrhage, hypertrophy as well as necrosis of the hepatocytes. Conclusion: It was ...

Nada Hamzah Shareef Al Shabbani1, Marwa Jamal Hussain Al Kinani2*, Tmara Qais Al-Mohammadi1 

...observe the fragments of tissues under light microscope with different magnification power. We have observed excessive males and the prevalence of SCABies were more in a young adult group in comparison with other age groups. It was found that lesions with wiry projections tended to persist for two weeks to 52 weeks and the number of nodules had varied from one to fourteen lesions. Examination of Histopathological slide showing acanthosis in 80, histolymphocyti...

Hong Chen1,2, Jiawei Liu1,2, Chuan Lin1,2, Hao Lv1,2, Jiyun Zhang1,2, Xiaodong Jia1,2, Qinghua Gao1,2 and Chunmei Han1,2*

... BVES in the mesenchymal tissues of regenerated antlers than in the antler skin, cartilage, and bone tissues after top pruning treatment (P < 0.05); the brown immunohistochemical reaction products were concentrated in the mesenchymal cell membranes and intercellular matrix of healthy and regenerated antlers. Our results suggested that the repair process of antler damage after top pruning treatment mainly promotes the prol...

Ali D. Nashmi1*, Jawad K. Hasan1, Manal A. Ibrahim2 

...flammatory cells in lung tissues in dipyridamole treated rats (group C) and prednisolone treated (group D) was observed in contrast to ovalbumin (ova) sensitized rats (group B). Collectively, dipyridamole has the ability to decrease inflammation to a lower limit in the airways in rats through its ability to decrease total and differential WBCs in BALF.

...

Lei Chu1, Jie Yang2, Zhenshi Chen2, Xiajun Zhang1, Weidong Wu3*, Shaoru Zhang2 and Lihui Wang2*

...ghly expressed in cancer tissues, but low in normal tissues, which was consistent with the results of GEO analysis. Correlation analysis showed that there was a significant positive correlation between MCM2 and GINS2. This study suggests that MCM2 and GINS2 may be new biomarkers to predict the prognosis of CC.

...

Masoumeh Hosseynikhah 

... sodium content in plant tissues and decreased the absorption and accumulation of potassium by plants. In addition, plant weight, 100 seed weight, relative water content, chlorophyll content and photosynthesis were also affected by different levels of NaCl. However, the external application of silicon and potassium nitrate decreased sodium absorption, increased potassium, and as a result improved plant weight, 100-seed weight, seed yield, cob length, and photo...

Saima Naz1*, Moazama Batool2*, Qurat Ul Ain2, Ahmad Manan Mustafa Chatha3, Sheeza Bano2, Sadia Nazir4, Ghulam Abbas5 and Unab Zahra1

... and DNA damage in brain tissues of exposed fish. Thus, malathion in water have toxic effects on fish therefore its seepage into aquatic bodies should be carefully monitored.

...
Alaa H. Sadoon1, Zainab Abdulimam Majeed2, Majdy Faisal Majeed1*
...ity and structure of the tissues. Competitive results exhibited that amongst all the fixatives, Formalin and Zenker,s had higher effectiveness for short-term fixation (6,12 and 24 hrs). For Bouin’s fluid, the tissues were far more preferable at 12- and 24-hours fixation, while Carnoy’s and Clarke’s solutions were preferred at 6- and 12-hours fixation. The efficiency of these fixatives was also poor after fo...

Mohammed H. Asker*, Nagham S. Mohammed, Zinah S. Zamil  

...anesthetized, and kidney tissues were collected for RNA isolation. The expression of genes encoding translocator protein (TSPO) and nuclear factor erythroid 2 related factor 2 (Nrf2) was analyzed in the kidney tissues. Vitamin C significantly reduced blood levels of urea, creatinine, salt, potassium, and calcium in both intact and ovariectomized groups (p≤0.05). Additionally, gene expression decreased significantly in the...

Abdulla A. Albishtue1,3, Nurhusien Yimer1,5*, Md Zuki A. Zakaria2, Abd Wahid Haron1, Abdul Salam Babji4

... precipitates in various tissues of the body, especially the central nervous system, which causes histological structural changes that may persist even after its concentration in the blood reduces. It produces neurotoxicity related to the deterioration of brain functions. Edible bird’s nest (EBN) is important natural product that has biological characteristics, such as regenerative effect. The objective of this research was to evaluate EBN’s neurop...

Bingzhao Yan1, Guiping Chen2, Lulu Ding1, Ruxue Huang1, Wenjing Yu1 and Jicang Wang1*

...enefits and protect many tissues from heavy metals. This experiment aimed to explore the effect of Que on Cd-induced PERK-CHOP apoptosis pathway in rat testis. A total of 24 8-week-old Sprague–Dawley rats were divided into four groups: control group, CdCl2 group, CdCl2+Que group, and Que group. The control group was gavaged daily with distilled water and 0.9% sodium chloride solution, and the Cd and/or Que-treated groups were treated by daily intraperito...

Saher Mahmood Jwad1, Tamadhur Hani Hussein2, Tahreer Mohammed Al-Thuwaini2* 

...n of thyroid and hepatic tissues, as well as on oxidative stress markers induced by paracetamol (acetaminophen), a study was conducted on sixty male laboratory rats. The animals were equally divided into four experimental groups. The control group was orally treated with 0.9% normal saline solution. The second group was orally administered 1g/kg of paracetamol. The third study group was orally given 200 mg/kg of broccoli aqueous extract along with 1 g/kg of pa...

Adham Omar Mohamad Sallam1*, Ashraf Abd El-Hakem Ahmed El-Komy1, Enas Abdulrahman Hasan Farag2, Samar Saber Ibrahim3

...nges in liver and kidney tissues. This study addresses a significant gap in understanding how GSE can counteract NSAID toxicity, with potential clinical implications for safer long-term NSAID use. GSE administration significantly reversed the elevated levels of serum alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, urea, and creatinine caused by Meloxicam toxicity. Additionally, oxidative stress markers such as malondialdehyde (MDA) ...

Zainab Sadik Chetheer*, Aseel Abdullah Ibraheem

...ile the thyroids section tissues of the group treated with both PTU and Withania somnifera supplement showed a significant reversal of histological changes with most follicles restored. The current study concluded the using of Withania somnifera supplement is improved the production of thyroid hormones by stimulating the thyroid gland lead to increase the biosynthesis of T4 and T3 hormones.
 
Keywords | Hypothyroidism, Ashwagandha,...

Sherine Abbas1, Hadeer M. Shosha2, Hala M. Ebaid2, Heba Nageh Gad El-Hak2, Heba M. A. Abdelrazek3*

...ile the kidney and liver tissues were investigated for histopathological and immunohistochemical expression. The results indicated there was significant tolerance of female offspring than male as indicated by ALT, urea and creatinine. A notable alteration in the biochemical parameters of blood serum (ALT, AST, albumin, total protein urea, uric acid and creatinine), as well as in the histopathological changes and immunohistochemical expression of tumor necrosis...

Sherine Abbas1, Heba M.A. Abdelrazek2*, Eman M. Abouelhassan3, Nayrouz A. Attia4, Haneen M. Abdelnabi4, Seif El-Eslam E. Salah4, Abdelrahman M. Zaki4, Mohamed A. Abo- Zaid4, Nadia A. El-Fahla5

...ffected DNA and lymphoid tissues evidenced by increased (P<0.05) immunohistochemical expression of IL-6, NFKB and TNF-α in addition to induced spleen and thymus histopathological alterations. The study concluded that methanolic neem leaves extract has a cytotoxic effect that affects the histo-architecture of lymphoid organs, promoted inflammatory markers and the mononuclear cells’ DNA damage that seemed to be as a result of neem extract oxidativ...

Ashraf B. Said*, Ibrahim A. Ibrahim, Hoda I. Bahr, Marwa A. El-Beltagy

...asured. Liver and kidney tissues examinated for histopathological and Immunohistochemistry. Untreated diabetic group showed significant (P≤0.05) hyperglycemia, hyperinsulinemia, and elevation in inflammatory cytokines with hepatic and kidney tissues disruption. At the same time, treatment alleviated hyperglycemia and IR with a significant (P≤0.05) decrease in inflammatory biomarkers levels and tissue expressions, espec...

Zainab A. Shehab1*, Assad H. Eissa2, Hind A.A. Alahmed1 

...logical kidney and liver tissues taken from the rats and fixed in 10% formaldehyde solution for histological and immunohistochemical analyses. The results showed that 60 mg/kg of 5-FU drug significantly decreased RBCs and WBCs count in all rats in comparison , furthermore results referred that HB concentration was significantly decreased in 5-FU group compared to the control group The histopathological examinations revealed that while the liver and kidney tiss...

Rico Anggriawan1,2*, Widya Paramita Lokapirnasari1, Sri Hidanah1, Muhammad Anam Al Arif1, Diyah Ayu Candra2  

...nd can leave residues in tissues, probiotics enhance digestive health. They adhere to and form colonies on the intestinal epithelium, thereby minimizing the attachment and replication of pathogenic bacteria. In conclusion, probiotic microorganisms produce enzymes such as lipase, amylase, and protease, which facilitate digestion and improve metabolic processes and nutrient absorption. Additionally, probiotics secrete bacteriocins that can eliminate pathogenic b...

Oula E. Hadi*, E.H. Altaee

...d be inflammation in the tissues, and animal might die, leading to degeneration, necrosis, and inflammation. However, in high doses, it leads to the occurrence of various tumors in the kidneys or the occurrence of clear cell carcinoma, Sarcomatoid type of renal cell carcinoma. The results indicate that the levels of uranium found in grass lead to the depletion of the antioxidant defense system in cows and stimulate oxidative stress in the kidneys. Although at ...

Qutaiba J. Gheni1, Alfred S. Karomy1, Alice Louis Yousaf2, Wessam Monther Mohammed Saleh3*

...ion, respectively. Liver tissues samples from were subjected to histological examination. The results revealed a substantial decrease in body weight (160 gm) in stunted birds compared to the normal control group (479 and 1488 gm) at both 14 and 28 days of ag, respectively. Furthermore, we observed a significant decrease in cellular and biochemical blood parameters in stunted birds where RBC (1.65 and 1.83) showed a lower (p<0.05) count compared to health co...

Khalid Hadi Kadhim1*, Iman Mousa Khaleel2, Firas Abbas Hussen3

...ed high loose connective tissues and adipose tissues. Whereas, the tail region was contained a large amount of skeletal muscle fibers. Furthermore, sweat and sebaceous glands had a positive reaction to Periodic Acid-Schiff staining, while with alcian blue stain appeared sebaceous glands only. From this study concluded the layers thickness of Gazella subgutturosa skin were differed according to the body regions and gender. As...
Imad Ahmad Noor1, Abdullah1, Ihteram Ullah2*, Kashif ur Rahman4, Imtiaz Ahmed1 and Habib Ur Rahman3
...race amounts in definite tissues and control a variety of processes correlated to development, metabolism, and reproduction in the target tissue. The chemical generated by plants are known as phytohormones. During current study we isolated five fungi of which three strains were isolated from the rhizosphere soil of A. esculentus L. while the remaining strains were isolated from the bulk soil in the plant vicinity. The result revealed that the rhizosphere and b...

Zhishuai Zhang, Zhiyuan Sui, Jihu Zhang, Qingjin Li, Yongjie Zhang, Chenguang Wang, Xiaojun Li and Feng Xing*

...he TTR gene in different tissues of Dolang sheep at the periods of prepuberty, puberty and postpuberty, we collected hypothalamic, pituitary, ovarian, oviduct, and uterine tissues. The TTR gene was amplified, cloned, and sequenced using RT-PCR in Dolang sheep. Its expression in the five tissue types was analyzed. The amino acid sequences of the TTR gene were compared to those of other species and a phylogenetic tree was prod...
Tanveer Ahmed1,2*, Khalid Abbas1*, Huma Naz3, Sajid Abdullah1
Syed Qaswar Ali Shah3, Adnan Khalil4, Muhammad Sarfraz Ahmed1
Hina Amjad1 and Shahbaz Ahmad1
...isolation, dorsal muscle tissues of the sampled fish were used. In terms of the average number of alleles and observed heterozygosity, low to moderate levels of genetic variation were found in all the hatchery stocks. The total number of alleles was found to range from 2.800 to 4.000. In all the populations analyzed, FIS values were found to be positive on an average basis, although some loci had negative values. No HWE deviation was found. The pairwise estima...
A.M. Abdul Azeem1, A.N. El shahat1, Mohamed H.M. Abd El Megid2 and Amal A. Mansour1*
...ase) in kidney and heart tissues compared to DOX-group. So, the results concluded that gamma irradiation (5 kGy) can be effective in increasing the in vivo and in vitro antioxidant potential as well as enhancing the medicinal value of turmeric against tissues damage.

...

Sadique A. Javed1*, Mohammed Al Bratty1, Abdul Jabbar Al-Rajab2,3, Hassan A. Alhazmi1,4, Asim Najmi1, Mohammad Firoz Alam5, Hafiz A. Makeen6 and Waquar Ahsan1

Yifan Wang1,2, Liangyu Hu2, Numan Ullah2 and Mengzhi Wang2,3*

...al amino acid in various tissues, arginine (Arg) has received increased interest due to its key roles in metabolism and physiology. Arg not only regulates lactation performance (milk yield and milk composition) by serving as a building block to synthesize milk protein, but also acts as a signaling molecule coordinating casein protein gene transcription and translation. A number of studies have characterized various possible pathways by which mammary total milk...

 

Mahesh Raj Pant 1 Dipti Shrestha 1 Shovana Thapa 2

Volume 2, Issue 3 May and June 2018 Pages 53-60
...hen the integrity of any tissues is compromised. Infection causes significant increase in costs, morbidity, and potential mortality. This study was conducted during the period from July, 2015 to January, 2016 with the aims of identifying the etiological agents causing skin wound infections, and their antibiotic susceptibility profile among patients visiting International Friendship Children’s Hospital (IFCH), Maharajgunj, Kathmandu, Nepal. Specimens were...

 Seham Abdel-Shafi1*; Ghaly Mohamed Farouk1; Mohamed Taha1; Khalid El-Dougdoug2

Novel Research in Microbiology Journal (2019), 3(2): 297-313
...inst PVY infected potato tissues.

...

 

Muhammad Junaid1*; Ayesha Bibi2; Musharaf Ahmad3; Muhammad Ali4; Yousaf Noor5

Novel Research in Microbiology Journal (2019), 3(2): 314-325
...ated from diseased plant tissues by growing it on the selective 2,3,5-triphenyl- tetrazolium chloride (TTC) medium. Based on colony morphology of R. solanacearum on the agar plates; and pathogenicity assays, about 29 isolates were guessed to be R. solanacearum. To further confirm the identity of these isolates, a species-specific primers-mediated Polymerase chain reaction (PCR) was carried out. Two specific primers i.e. forward primer: 5'GTCGCCGTCAACTCACTTTCC3...

 

Mahmoud Hamdy Abd El-Aziz1*; Hosny Aly Younes2

Novel Research in Microbiology Journal (2019), 3(2): 326-340
...ready printed with plant tissues was tested. Results revealed that both faces of nitrocellulose membrane and Canson paper could be used as solid carriers in TBIA, for detection of CMV in infected leaves. According to Reverse transcription polymerase chain reaction (RT-PCR); the size of amplification of the obtained product was approximately 870 bp for CMV isolate; and was assigned accession number of LN606587. The Phylogenetic tree was generated using partial ...

 

Gamal Abdelaziz 1,2*; Motaleb, M.A.1; Farouk, N.1; Adli A. Selim1*

Novel Research in Microbiology Journal (2019), 3(3): 341-350
...gh accumulation in tumor tissues. The T/NT (target to non-target ratio) was of 5.4, after 60 min. of post injection (p.i). The direct intra-tumoral (I.T) injection of [99mTc] Tc-insulin showed good retention in tumor tissues with a ratio more than 50 % after 15 min. As a result of the promising bio-distribution studies; the newly recombinant insulin showed good uptake in tumor site, which assured high concentration of insuli...

 Eman Abuheiba1*; Sawsan M. El-Sonbaty2; Nahed Abdel-Samed3; Eman Kandil1

Novel Research in Microbiology Journal (2019), 3(3): 387-395
...ine (DEN) in rates liver tissues. This treatment significantly improved the alanine aminotransferase (ALT) activity and total protein compared to DEN group. Results showed that manganese nanoparticles were effective in treatment of HCC induced by diethylnitrosamine (DEN) in rats. So manganese nanoparticles can serve as a good therapeutic agent for the treatment of hepatocellular carcinoma, and deserve further studies in the future.

...

 

Dalia G. Aseel1*; Mahmoud H. Abd El-Aziz2; Sanaa A. Riad3; Azaa Makhlouf3; Gaber I. Fegla4; Elsayed E. Hafez1

Novel Research in Microbiology Journal (2019), 3(4): 453-463
... from the infected plant tissues, and a band with molecular size 336 bp was obtained using Reverse transcription-Polymerase chain reaction (RT-PCR). The DNA sequence of the Egyptian PLRV-Banha -MP gene was deposited in GenBank under an accession number of KR002119. Moreover, sequence analysis revealed that the Egyptian PLRV isolate was closely related to a New Zealand isolate of PLRV (GU002341), with identity of 100%. Transmission electron microscope (TEM) exa...

Sherihan Samir1*; Ahmed B. Barakat1; Waled M. El-Senousy2; Ahmed A. Abou-Zeid3; Omar A. Rabiee1

Novel Research in Microbiology Journal (2020), 4(1): 598-605
...yomavirus (BKV) in tumor tissues of colorectal cancer (CRC) patients as well as in control samples; however, many recent studies did not show the prevalence of these viruses in the CRC patients. A total of 50 clinical biopsies samples were collected from patients with and without CRC in the General surgery department, Faculty of Medicine, Ain Shams University, Egypt, with the approval of the research ethics committee. Current results showed the absence of the ...

Noor Ul Ain1, Naila Siddique1*, Akbar Ali Malik2, Muhammad Athar Abbas1, Saba Rafique1, Sidra Zamir1, Hu Huilong3, Wang Yihui3, Quan Hongkun3 and He Cheng3

...sitivity was detected in tissues/swab and 10.53% (26/247) sero-positivity was found in serum samples. Compared to C. psittaci infection, higher H9N2 circulation was dominant in poultry and our study revealed that co-occurrence of H9N2 and C. psittaci was under estimated and demands further investigation. 

...

Andrei V. Kozlov1,2; Artem V. Lyamin1; Aleksei A. Neilenko1; Anna V. Yanchenko1; Alena A. Ereshchenko1,2*

... were found in the brain tissues and the
cerebrospinal fluid. It can be assumed that part of the effect of Porphyromonas gingivalis on
the brain cells is mediated by the transport of active metabolites of this bacterium into the
outer membrane vesicles. These outer membrane vesicles contain the main Porphyromonas
gingivalis virulence factors; gingipains, and iron-binding proteins. Indirect penetration of the

 

Belal Natey1; Ahmed M.M.A. Kasem1; Younes M. Rashad2*; Nageh Fathy Abo-Dahab1

Novel Research in Microbiology Journal (2024), 8(6): 2712-2733
...from the rhizosphere and tissues of 25 plant species collected from different sites across four Egyptian governorates. The antagonistic activity of all isolated Trichoderma strains was screened against S. cepivora BYAN1 in vitro. Microscopic examination showed that isolate B3R12 (identified as T. afroharzianum B3R12) has the greatest mycoparasitic level. Moreover, this isolate showed high in vitro inhibitory effect on S. cepivora BYAN1 growth by the production...

Aml Ghanem1,2; Ahmed A. Al-Karmalawy3,4; Noha E. Morsy5; Mahmoud Elsabahy6; Ahmed M. Rayan2,7*

Novel Research in Microbiology Journal (2024), 8(6): 2750-2771
... harmlessly within plant tissues, have attracted much attention as potential sources of novel bioactive compounds. This study aimed to evaluate the chemical and biological characteristics of Alternaria alternata as an endophytic fungus isolated from Thymus vulgaris. Alternaria alternata was isolated from Thymus vulgaris leaves and characterized using morphological and molecular identification techniques. Chemical characterization of dichloromethane fraction (D...

Huma Naz1*, Sajid Abdullah2, Fariha Latif3, Farzana Abbaasi4, Naila Hadayat5, Tanveer Ahmed6*, Khalid Abbas2 and Muhammad Adeel Hassan7

...POx, SOD, and GST in all tissues of both fishes exposed to the insecticides mixture was noted as compared to the control. The trend of SOD level in organs of both fish species was noted as hepatic>neural>nephron>bronchial>cardiac>muscle tissue. The POx and GST levels in L. rohita and C. catla were observed as: hepatic>neural>bronchial>nephrotic>cardiac>muscle tissues. CAT activity was increased ...

Umar Salisu Ahmad1,2*, Adamu Zoaka Hassan2, Echiobi Gaba Emmanuel2, Munir Ari Sani2, Fatai O. Anafi3, Adamu Abdul Abubakar4,1

...mmatory reactions in rat tissues. These results should be combined with other parameters for a comprehensive biocompatibility evaluation. 

...

Yulin Zeng

...lassified into PZ and TZ tissues. A TRAF6 interference lentivirus was utilized to measure the expression levels of IGF1 and TRAF6 in the prostatic tissue matrix. The impact of TRAF6 on cell growth in the matrix of TZ and PZ tissues was analyzed, the TRAF6 level in the matrix of TZ and PZ tissues was explored, and its role in the phosphorylation process under growth factor stimulation was d...

Chaoqi Yin1*, Ruyi Tao1, Kaixi Tan2 and Jianfei Zhang3

...els of ADAR1 in human IH tissues. ADAR1-targeted siRNAs were transfected into HemECs cells to knockdown the expression of ADAR1. CCK-8 assay and cell tubule formation assay were performed to detect the phenotypic change after knockdown of ADAR1 expression. Western blotting was used to detect the related factors of Akt/mTOR signalling pathway. The expression level of ADAR1 is significantly up-regulated in the IH tissues as co...

Suanyuan Zhang, Qing Ji, Xinglong Wu, Jinjing Wang, Jin Yao, Chengfang Li, Xiaorong Yang, Na Tan, Jing Yang and Hong Zheng*

...tected miR-30a-5p in the tissues and serum of patients with active UC and in NCM460 cells after dextran sulfate sodium (DSS) treatment. Inflammation factors, nuclear factor-κB (NF-κB) and p65, were detected in NCM460 cells introduced with disparate concentrations of GRh2 after DSS treatment or transfection. We found that GRh2 increased expressionlevels of miR-30a-5p to inhibit inflammation and promote to advancement of NCM460 cell. In conclusion, e...

Zhihong Huang1, Xuemei Zhang1, Ling Li1, Min Hu1, Mo Chen1 and Qunchao Mei2*

...issue compared to normal tissues adjacent to the tumor and normal controls. Furthermore, changes in the expression of CDX1 and CDX2 genes show a significant relationship with increasing disease stages and lymph vascular and perineural invasions. It was concluded that increased frequency in the promoter methylation of CDX1 genes in patients with gastric cancer compared to control tissues and its relationship with factors that...

Chunqin Tian1, Lichun Cui1 and Xiaoyan Wang2*

...ral blood (PB) and tumor tissues were collected before treatment (TB), during treatment (TM), and after treatment (TA). Multiple-parameter flow cytometry and immunohistochemical analysis were employed to analyze changes in immune cells and biomarkers. Correlations between these changes with treatment response, overall survival (OS), and progression-free survival (PFS) were analyzed. T cells at TB, TM, and TA increased sequentially, with remarkably increased co...

Mao MeiYa, Sheng Yuehua, Ding Huiqing*, Zheng Xiaojiao and Du Yongming

... MMP1/7/9/10/11/14 in OC tissues were significantly elevated while the transcriptional levels of MMP2/16/23A/23B/28 were significantly reduced. A significant correlation was found between the expression of MMP7/9/12/15/25/27 and the pathological stage of OC patients. OC patients with low transcriptional levels of MMP1/4/12/17 were associated with a significantly better prognosis. The functions of differentially expressed MMPs are primarily related to the matri...

Pakistan Journal of Zoology

November

Pakistan J. Zool., Vol. 56

Featuring

Click here for more

Subscribe Today

Receive free updates on new articles, opportunities and benefits


Subscribe Unsubscribe