Sehrish Kanwal1, Ali Saeed1*, Muhammad Munir2, Memoona Arshad1
Life Sciences International Journal Issue 7 Volume 1
...ing serotype-specific primers (SA(F)/SA(R)) which target the VP1 gene, serotype O was confirmed in all representative samples. As high as 98% nucleotide sequences similarity was determined between the representative strains. Furthermore, these strains have shown homology with previously characterized strains from Pakistan (O/PAK Lahore), Afghanistan, Iran, India, Nepal and Bhutan. Phylogenetically, these strains clustered into PanAsian II lineage of FMD O sero...
Sehrish Kanwal, Ali Saeed, Muhammad Munir, Memoona Arshad
British Journal of Virology
...ing serotype-specific primers (SA(F)/SA(R)) which target the VP1 gene, serotype O was confirmed in all representative samples. As high as 98% nucleotide sequences similarity was determined between the representative strains. Furthermore, these strains have shown homology with previously characterized strains from Pakistan (O/PAK Lahore), Afghanistan, Iran, India, Nepal and Bhutan. Phylogenetically, these strains clustered into PanAsian II lineage of FMD O sero...
Sehrish Kanwal1, Ali Saeed1*, Muhammad Munir2, Memoona Arshad1
British Journal of Virology
...ing serotype-specific primers (SA(F)/SA(R)) which target the VP1 gene, serotype O was confirmed in all representative samples. As high as 98% nucleotide sequences similarity was determined between the representative strains. Furthermore, these strains have shown homology with previously characterized strains from Pakistan (O/PAK Lahore), Afghanistan, Iran, India, Nepal and Bhutan. Phylogenetically, these strains clustered into PanAsian II lineage of FMD O sero...
Muhangi Denis
...io-economic status of farmers. The disease is endemic in a number of countries in sub-Saharan Africa, in Sardinia (Italy), the Russian Federations, the Caucasus and it has shown possibilities of spread within Eastern Europe. Involvement of all stakeholders in the pig value chain in designing and implementing of prevention and control strategies could be explored in future control programs. This may call for investing resources in changing disease management be...
Aradhana Chopra1, Ravi Shukla2 and Tarun Kumar Sharma2,3*
...b> in biology....
Maureen McKeague1, Maria C. DeRosa2*
...rs....
Shahid Ali, Munir Khan
...stically significant. Farmers’ education was found to be major determinant of technical efficiency/inefficiency. The esti- mated coefficient of farmers’ education was negative and statistically significant, implies that techni- cal inefficiency decreases with the increase in farmers’ education. The use of more labour and tractor plough hours would increase wheat productio...
Raja Waqar Ahmed Azad, Tahir Sarwar
...ield observations and farmers’ interviews. Water productivity of rice in the command area of selected watercourses ranged from 0.15-0.23 kgm-3 with average value of 0.19 kgm-3, water productivity of wheat ranged from 0.77-1.48 kgm-3 with average of 1.18 kgm-3, water productivity of maize ranged from 0.68-1.25 kgm-3 with average of 0.90 kgm-3 and average water productivity of onion crop ranged from 0.29-0.36 kgm-3, with average of 0.32 kgm-3. Water produc...
Nisar Ahmad1*, Inayatullah Jan2, Saif Ullah1 and Sidra Pervez1
..., credit needs of the farmers have increased rapidly. Credit is considered an important factor for raising the productivity and income of the farmers. The current study attempts to analyse the impact of credit on wheat productivity in district Jhang. Furthermore, study explores the purpose of farmers for acquiring loan and major sources of credit in district Jhang. This study is based on p...
Aqeel Ahmad, Zammurad Iqbal Ahmed, Irfan Aziz*
...eliable technique for farmers to optimize fertilizer recommendations and harvest maximum returns from their investment in agricultural business.
...
Kemi Funmilayo Omotesho1*, Isreal Ogunlade1, Opeyemi Eyitayo Ayinde2
.... This study analysed farmers’ perception of the accountability of agricultural extension services rendered in Oyo State, Nigeria. Structured interview schedule was used in eliciting information from 195 farmers in rural communities across the four agro-ecological zones in the study area using a two-stage random sampling technique. Data used for the study were analysed using descriptive statistics, Likert scale and the...
Hina Fatima1*, Muhammad Azeem Khan2
...d widely in Pakistan. Farmers make use of traditional wheat varieties, whose yields are quite below the modern wheat varieties. The result of the study reveals that the parameter estimate of wheat variety is negative and significant also. The parameter of seed rate variable is also negative and statistically significant. A technical inefficiency of 22% is present in the production of wheat crop in the selected district. Majority of the far
Rehmat Ullah1*, Muhammad Zafarullah Khan1 and Kalim Ullah2
...erence of progressive farmers, no timely availability of Inputs, unviability of crop specific machinery. It was recommended that MFSC may take initiative to compel private companies to sponsor schemes for low cost inputs. MFSC may take initiative for funds on account of pragmatic trainings arrangement, subsidized inputs and crop specific machinery....
Abiodun D. Olabode
...idual response of the farmers whose plots fall within the demarcated forty-sampled quadrats from both irrigated and non-irrigated farms. Information on socio-economic activities of the rice farmers, level of rice yield, agricultural practices for rice production and farm management techniques employed in the study area were observed. The study employed simple percentages to analyse the farmers...
John G. Bruno1*, Chien-Chung Chao2,3, Zhiwen Zhang3, Wei-Mei Ching2,3, Taylor Phillips1, Allison Edge1, Jeffery C. Sivils1
...b>Abstract | DNA aptamers were developed against Rickettsia typhi (R. typhi) whole cells and individual candidate aptamer sequences were ranked according to affinity by an ELISA-like microplate-screening assay (ELASA). Top three candidate aptamers were then paired in a matrix of all possible capture and reporter aptamer combinations and tested in a fluorescent peroxidase-linked Amplex® UltraRed (AUR; a ...
John G. Bruno
...botic development of aptamers or aptamer conjugates with associated mass production to provide rapid passive immunity for large human populations in the event of a major pandemic or infectious disease doomsday scenario. ...
Moustafa Kardjadj1, Pam Dachung Luka2
...financial capacity of farmers to expand or improve the systems, and inadequate supply of quality vaccines and the problem of delivery to maintain cold chain, there is need for a very strong regional coordination for effective and sustainable control of PPR in Africa. The African continent is currently divided into 57 countries (or independent territories), many of which rely heavily on livestock for fuel, motor power and sustenance with many also endemic to th...
Gurrappa Naidu Govindaraj, Vinayagamurthy Balamurugan*, Habibur Rahman
... causing huge loss to farmers. In this study, an attempt has been made to estimate the economic losses based on the annual incidence, morbidity, mortality levels etc. derived from literature, discussion with experts, and based upon scientific facts. Different mathematical models were used to assess the losses due to mortality in young and adult sheep/goats, body weight loss in young and adult sheep/goats, milk loss, loss due to increased inter-lambing/kidding ...
Shahab e Saqib, Mokbul Morshed Ahmad, Sanaullah Panezai, Hidayatullah, Khalid Khan Khattak
...tify;"> Ensuring farmers’ access to agricultural credit market has been prioritized in agriculture finance policies of Pakistan. The main objectives of this study are to explore farmers’ access to different formal and informal credit sources, and to investigate their credit adequacy and the role of important socio-economic factors in access to credit. The data were collected from 87 farming households in Mar...
Christopher U Orji1*, Ignatius O Onyeocha2, Steven S Shaida3, Peter M Dede4, Bitrus Yakubu5, Elijah E Ella6 and Pam D Luka5
...hondrial DNA fragment primers- Cytochrome oxidase subunit II (COII) and Cytochrome b (CytB). Twelve samples of laboratory-reared population of each species were used for the study. Sequencing data were used to calculate haplotype, haplotype diversity and nucleotide diversity for the two species. Based on combined loci of cytochrome oxidase II (COII) and cytochrome b (CytB), twelve haplotypes were generated for G. p. palpalis and five for G. m. submor...
Mukhtiar Ahmed, Jana Pickova, Taufiq Ahmad, Muhammad Liaquat, Abid Farid, Muhammad Jahangir
...al to the health of consumers. Antioxidants and chelating agents are the most helpful inhibitors of lipid oxidation....
Neha Singh and Anjana Pandey
...cleic acids known as aptamers. Aptamers are known for their high selectivity and specificity and their ability to form 3D conformations. CELL SELEX is a modification of SELEX where instead of using purified ligand molecules, whole live cells are used as targets, so the aptamers being generated could bind target molecules on live cells in their native conformation and it is possible to know...
John G. Bruno and Jeffery C. Sivils
...e analyses using DNA aptamers raised against the surfaces of general nonpathogenic Escherichia coli (ATCC No. 8739) as well as alpha and gamma intimins and Shiga-like toxin 2 (SLT-2) B subunit verified that the aptamers bound proteins of the correct molecular weights for intact outer membrane proteins (OMPs), intimins and SLT-2. Some bands on the aptamer Western blots were shared between the “Big 6” non-O157 Shig...
Amtul Jamil Sami1*, Madeeha Khalid1, Sara Iqbal1, Maira Afzal1 and A.R. Shakoori2
...epared using natural polymers chitosan and starch in molds. Structure of composites was analyzed using scanning electron microscopy. The physical parameters such as weight and swelling degree of composite were studied. Chitosan starch based composites were used in treatment of waste water to remove a toxic anionic dye Congo red. Congo red solution (0.015 mM) was treated with polymer composite at neutral pH overnight with 150 rpm orbital shaking at room tempera...
Hina Fatima, Muhammad Azeem Khan, Mahreen Zaid-Ullah, Abdul-Jabbar, Khurram Nawaz Saddozai
...Pakistan. Those farmers were selected as the respondents for the study that used to cultivate Non-BT cotton and BT cotton varieties. In Pakistan, the NonBT cotton varieties have been promptly substituted with the BT-cotton varieties. This substitution of imported BT-cotton seed is taking into account without considering the local environmental conditions of Pakistan. Thus the main objective of the research was on the c...
Tarun Kumar Sharma, John G. Bruno and William C. Cho
...city in recent years aptamers, have emerged as competitive tools with the potential to replace antibodies in many diagnostic formats. The aptamer industry is continuously growing to create space in research and diagnostics markets. However, translation of aptamer in several applied disciplines is still lagging behind as compared to antibodies. In this article, we discuss the translational aspects of aptamers, current potenti...
Atul Sharma, Aruna Chandra Singh, Gautam Bacher, Sunil Bhand
...s on prime interest. Aptamers are synthetic short sequences of single stranded (ss) oligonucleotides (ss-RNA or DNA), which are developed by an in-vitro selection process known as “Systematic Evolution of Ligands by Exponential Enrichment (SELEX)” technique. Among the receptors available for biosensing, aptamer exhibit the advantages of high specificity, selectivity, stability, facile labelling and modification, which makes them ideal candidates fo...
Misbah Riaz1, Qaiser Mansoor2, Maleeha Akram1, Muhammad Ismail2, Parveen Akhtar3, Shakeel Mirza4, Mazhar Qayyum1, Afzaal Ahmed Naseem1, Faheem Tahir5 and Syed Shakeel Raza Rizvi1*
...by PCR using specific primers for GPR54 and GNRHR splice site exons. Mutations were analyzed by single-stranded conformation polymorphism (SSCP) and/or sequencing. No mutation was identified in GPR54 gene, while two mutations in GNRHR gene were observed in one sporadic case of isolated HH. The first was a synonymous substitution mutation of T to G at nucleotide position 123, which did not replace valine with any other amino acid. The other mutation determined ...
John G. Bruno
...Lengthy 200 base DNA aptamers were developed against extracted lipopolysaccharides (LPS) of E. coli O157 and the so called “Big six” non-O157 Shiga-toxin producing E. coli (STEC) serovars (O26, O45, O103, O111, O121 and O145). These aptamers were assessed by enzyme-linked aptamer sorbent assay (ELASA) to rank their relative affinities and discriminatory ability for distinguishing between each of the STEC serovars...
Aiza Tahir, Muhammad Asif, Zaigham Abbas and Shafiq ur Rehman*
... causing organisms. Consumers of milk and milk products from mastitic animals are at high risk of foodborne infections. Escalating antibiotic resistance strived us to explore the alternate option to control mastitis. In ongoing era, bacteriophages are an alternate possible effective remedy. Therefore, in this study the infection ability of three lytic phages SA, SANF and SA2 was determined against ten isolates of Staphylococci and one Micrococcus, isolated fro...
Oluwasogo David Olorunfemi, Oluwasegun Adetokunbo Adekunle, Felix Olayinka Oladipo, Temitope Oluwaseun Oladele and Oladimeji Idowu Oladele
...raining needs of fish farmers’ on value addition initiatives in Kwara State, North Central Nigeria. Data were collected using a two-stage sampling technique to select one hundred and sixty respondents for the study. A purposive selection of two Local Government Areas each from the two Agricultural Development Programme administrative zones (Zones C and D) in Kwara State where fish farming is prominent and well-practiced was carried out. Forty fish far
Neelum Andaleeb and Munir Khan
... profitable; however, farmers need to utilize each input at its allocatively efficient level in order to get maximum profit....
Amjad Ali and Abbas Ullah Jan
...services. Many of the farmers achieving high and consistent yield and then obtaining high technical efficiency in study area can be used effectively to demonstrate the benefits of good farming practices for reduction of gap between the most technical efficient and the inefficient farmers. Empirical results illustrate that there exist opportunity to increase yield at present level of inputs use and technology....
Hina Fatima, Lal Almas and Bushra Yasmin
...re collected from 150 farmers; those were cultivating cotton-melon crops in combination under tunnels. The study area was Punjab, Pakistan. The stochastic cost frontier analysis was used to estimate the allocative efficiency of cotton-melon cropping systems efficiency. The result illustrates that none of the farmers to be optimally using their inputs. The average allocative efficiency was around 75%. Approximately 36 percent...
Naushad Khan1*, Shahnaz Akhtar1, Munir Khan1, Shaista Naz2, Javeria Tanveer1 and Muhammad Kaleem3
...this, a sample of 226 farmers was selected by employing multi stage sampling technique. At first stage, all the three tehsils (i.e.; Mardan, Takht Bhai and Katlang) of the district were selected. At second stage, two villages from each tehsil were randomly selected. In third stage, all the beneficiaries of ZTBL credit program for maize crop was selected and interviewed. Descriptive statistics, paired t-test and correlation analysis were used to analyze the dat...
Zeeshan Haider, Inayatullah Jan and Waqar Akram
...ed t-test reveal that farmers observed a significant difference in the overall income and income from tomato crop after the conflict as shown by larger t-values of 6.17 with (p<0.01) and 10.91 with (p<0.01) respectively. It was mainly due to restrained mobility during the conflict, farmers had limited or no access to cultivable land, irrigation facilities, and input and output markets which resulted in increased cost o...
Eman Mahmoud El-Diasty1,Madeha Abd El-Halim Ibrahim2 and Ghada Kamal El Khalafawy2,*
...rula. Using universal primers ITS1-5.8S-ITS4 amplified ITS region. And it yielded a unique PCR size of approximately 376-930 bp. PCR amplicons were digested with enzyme MspI and the generated bans corresponded to the predicted size.
...
Lingtong Ye1, Chao Cao1,2, Bin Tang1,2, Tuo Yao1, Ruixuan Wang1 and Jiangyong Wang1*
...wo polydorid-specific primers were successfully designed, for the first time, to amplify target fragments of the COI gene. This study is the first to molecularly validate unidentified larvae from the aquatic environment through the known COI sequences of adults.
...
Jiancheng Zhai, Li Gao, Yanling Xia and Heping Li*
...d with three anchored primers and ten random primers using differential display reverse transcription PCR (DDRT-PCR). Five differentially expressed fragments were obtained through recovery, cloning and sequencing. Three of them (Af1, Ce1, Ci2) presented a higher expression in antler mesenchyme of female reindeer, but the other two (Ae1, Af3) were the opposite. The results of Blast in GenBank showed that they shared high homo...
Rashid Mahmood1,*, Waqar Ahmad1, Muhamamd Khalid Rafique1, Ghulam Sarwar1 and Anjum Shahzad2
...inators to set fruit. Farmers in Pakistan are generally not aware of pollination needs of apple. Results depicted a high population decline of Syrphids and Non-Apis bees. Syrphids were recorded as 12.65 to 13.85 per 250 flowers in 2013 but decreased in year 2014 by 7.82 to 7.88 per 250 flowers and Non-Apis bees was recorded as 6.15 to 7.59 per 250 flowers in 2013 which also decreased and recorded as 5.35 to 5.70 per 250 flowers in year 2014. The results showed...
Zafar Iqbal1* and Muhammad Khurshid2
...ecific and degenerate primers. ToLCNDV is geographically wide spread Begomovirus (Family Geminiviridae), considered as a close relative of TYLCV, and cause severe losses for many economical important crops in tropical and subtropical regions of the world. This is the first report of the use of heterologous polyclonal antibodies (PAbs), raised against a geographically distinct begomovirus, ToLCNDV. The described results have shown to exhibit a many fold increas...
John G. Bruno
...y;">Twenty-seven DNA aptamers were developed against the Fab fragments of murine antibodies developed to bind Rickettsia rickettsii and Rickettsia typhi. A feasibility study was conducted to generate anti-idiotypic aptamers against Fab fragments of these antibodies and to determine if the aptamers were capable of emulating rickettsial antigens to enable sensitive detection of rickettsia ex...
Waqar Islam
...ighlighting that what farmers know about plant viruses, what is their perception about yield losses by virus diseases and what management strategies they choose to apply against viruses. We further added our suggestions that how plant viruses can be managed effectively through simple and credible efforts....
Usman Shakoor1*, Mudassar Rashid1, Abdul Saboor2, Nabila Khurshid1, Zuhair Husnain2 and Abdul Rehman2
...tation strategies for farmers to be made available, this should be the key policy intervention of the government to cater with the climate change on agriculture and particularly on maize. Fertilizer management and crop variety choices according to the changing climate will address this serious concern expected in the future....
M. D. Maji, N.K.Das, S. Chatterjee, A. Ghosh and A.K. Bajpai
Forecasting models of bacterial leaf spot disease of mulberry for Birbhum district of West Bengal
...seases in mulberry at farmers field in Birbhum district.BLS incidence appeared in May and continued up to November. The correlation coefficient between disease severity and meteorological parameters revealed that BLS disease severity showed significant positive correlation with max & min temperatures, min relative humidity, rainfall and number of rainy days. Step down multiple regression analysis revealed that the forecasting of BLS could best be done from...
B. Ramanujam, R. D. Prasad, S. Sriram and R. Rangeswaran
Mass production, formulation, quality control and delivery of Trichoderma for plant disease management
...ality products to the farmers, the Central Insecticide Board of Government of India has made registration of microbial pesticides mandatory before commercial production/import/sale. Guidelines and data requirements for registration of microbial pesticides have been provided in the annexure of Insecticide Act. Quality control parameters set by CIB are inadequate for knowing potentiality of a bioagent. Apart from the counts of live propagules in the formulation,...
1S. A. Khan and 2S. Jha
Effect of dates of sowing, moisture regimes, varieties and weather factors on incidences of aphid, Lipaphis erysimi (Kalt.) in rape and mustard
...2 days in advance for farmers. To escape critical aphid incidence, rape and mustard crops need to be sown by 15 October, because crops sown beyond this period are likely to be adversely affected by aphid. Keywords : Aphid, sowing date, moisture regime, weather parameters, correlation, regression
...
A. Regupathy and R. Ayyasamy
Initiatives of papain industry by private-public-farmer link-ages in classical biocontrol program for papaya mealybug in Tamil Nadu
...p by many progressive farmers in Tamil Nadu and facilitated by Senthil Papain and Food Products Ltd (SPFP), Coimbatore since 2004. The onslaught by the new invasive mealybug (PMB)-Paracoccus marginatus Williams and Granara de Willink) in 2006 caused major concern in papain production. The need for repeated application of insecticides and dearth of labour for application of insecticides made it difficult for the farmers to ma...
Shams Ur Rehman, Muhammad Arif and Abdul Mateen
Soil-borne viruses in major potato growing areas of Pakistan
...es collected from the farmers field at Baffa (21.73%) of Hazara while (23.80%) in Kalam of Malakand division. The highest incidence of TRV based on ELISA in Hazara was found in Mangal 14.28% and in Malakand division the highest incidence was in Shangla Top 17.39%. Isolates of PMTV and TRV were characterized using biological and serological techniques. Biological characterization of the field isolates revealed that variability in the symptoms produced by them o...
Dhananjoy Mandal
Eco-friendly management of mealybug and wilt in pineapple
... treatments were: T1 [Farmers’ practice: phorate 10 G @ 20 kgha-1 during planting + monocrotophos 36% EC @ 0.03% at 100 DAP + endosulfan 35% EC @ 0.02% during 150-180 DAP]; T2 [Treating planting materials (basal portion) with monocrotophos 36% EC @ 0.02% + phorate 10 G @ 15 kg ha-1at 100 DAP + Neem oil 1500 ppm spray @ 2.5 m/L-1 at 150 DAP]; T3 [Treating planting materials (basal portion) with monocrotophos 36% EC @ 0.02% + phorate 10 G @ 15 kgha-1 at 10...
Dhananjoy Mandal 2K. Baral 3M. K. Dasgupta
Developing site-specific appropriate precision agriculture
...y available to Indian farmers in general. Due to Precision Farming (PF), production increased by 40 to 60 percent farmers’ margins of the produce and reduction of the commission charged by the middlemen to 7-10 percent. Further, bargaining power, capacity building, optimal crop protection and produce quality were improved and the cost of cultivation has reduced at Agaram Village, Dharamapuri, Tamil Nadu of Adhiyaman Pr...
Sadia Munir1a, Asif Nadeem1a*, Maryam Javed1, Masroor Ellahi Babar2, Tanveer Hussain2, Wasim Shehzad1, Rajput Zahid Iqbal3 and Sidra Manzoor1
...nced using six set of primers. A total 15 polymorphisms; 12 in intronic and 3 in exonic region, were identified. The sequences of the amplified Pit1 gene fragments were aligned with the help of BLAST for SNPs identification. This is a first report toward genetic screening of this gene at molecular level in Sahiwal cattle of Pakistan. No work has been reported on this gene in Sahiwal cattle. In this study, a new set of single nucleotide polymorphisms (SN...
P.P. Ghosh*, C. Ghosh, B. Mahato, A. Chakraborty, S.K. Bhattacharya and M.K. Bhattacharjya
...n of diseased plants (farmers’ practice). Results indicated all the management approaches under study performed significantly superior to farmers’ practice in terms of reduction in disease severity (32.8-43.6%), yield increase (20.9% - 26.8%) and benefit-cost ratio. Integrated approach was the best approach followed by prophylactic and curative soil disinfestations. Thus, for the present micro-level situation vas...
P.P. Ghosh*, A. Chakraborty, S.K. Bhattacharya, C. Ghosh, B. Mahato and M.K. Bhattacharjya
...roduces are stored by farmers under homestead condition for the purpose of consumption and seed for the next year sowing. Callosobruchus sp.(Coleoptera: Chrysomelidae) is the major stored grain pest of blackgram under homestead condition resulting 15 – 30% grain damage during storage. An attempt was made to identify a practical and low cost solution of such damage with the active participation of village women responsible for the storage. Proven b...
Shahid Iqbal Khattak1*, Mohammad Safdar Baloch1, Khalid Naveed2 and Ejaz Ahmad Khan1
Umer Wahid1, Shahid Ali2* and Nihal Ahmad Hadi3
...cal efficiency of the farmers. On the basis of this study it is recommended that tomato growers in the study area need to increase the number of seedling for the purpose to increase the productivity. It is further recommended that government should provide training facilities to the farmers to improve their skills, as a results of which the productivity will be increased...
Shah Saud Ahmad and Muhammad Zafarullah Khan*
...h the linkages of the farmers with the entire line department associated with the farming. FSC should take steps to build the capacity of the farmers regarding the latest improved practices of vegetable cultivation to achieve more production....
Aneela Qureshi1, Ammara Ainee1*, Muhammad Nadeem1, Masooma Munir1,2*, Tahir Mahmood Qureshi1, Saqib Jabbar2
...ich is desirable by consumers was reduced but high fiber cake was dark colored, low in volume and with increased hardness. Treatment (T3) containing 5.6g grapefruit albedo powder shows significantly (p<0.05) higher sensory scores in term of color (8.02±0.50), flavor (8.04±0.29), taste (8.18±0.37), mouth feel (8.03±0.41) and overall acceptability (7.84±0.28) during 30 days of storage. It is concluded that grapefr...
Muhammad Zafarullah Khan
...in order to deal with farmers where a wide range of variations exists in their personalities and habits. A significant difference was reported in required and possessed competencies of preparing training schedules regarding crops followed by timely appointment and issuance of duties to junior staff for effective and efficient work. Results of the study reported that there is utmost need of training in competencies regarding identification of input supply deale...
Sania Shaheen1*, Hina Fatima2 and Muhammad Azeem Khan3
...entional and dry rice farmers and also determine the factors which significantly contribute to increase the rice output. Moreover, this study estimated the sources of inefficiency. Data collected from 300 sample rice farmers into the Kharif cycle (2013-14) at five main rice growing districts of Punjab namely: Hafizabad, Sheikhupura, Jhang, Vehari, and Gujranwala. Stochastic frontier analysis (SFA) was applied to find the res...
Raza Ullah1*, Qaisar Shah Safi2, Ghaffar Ali3 and Irfan Ullah3
... that majority of the farmers sold their orchards to the pre-harvest contractors. The most widely used marketing channel was producers selling their orchard to pre-harvest contractor who then harvest the orchard, pack the produce and transport it to the market where the produce is handed to wholesalers. Wholesalers then channel the produce to retailer from where the ultimately consumers buy the product. It was also observed ...
Fawad Ali1*, Hidayat Ullah2, Ikhtiar Khan1
...r irrigation by local farmers since long has contaminated the soil and now the pollution is being transferred to our food chain. An investigation has been done to ascertain toxic heavy metal concentration in the wastewater, irrigated soil, their accumulation in vegetables, and potential human health risks. The results reveal that Cr concentration in the wastewater, Cd and Zn in soil and in vegetables have been found well above the permissible limits of World H...
Muhammad Tariq Saeed1*, Muhammad Ashfaq Wahid1, Muhammad Farrukh Saleem1, Mumtaz Akhtar Cheema2, Muhammad Shahid1, Abdul-Shakoor1, Abdul-Sattar3
...ay be recommended for farmers having the problem of less germination and poor stand establishment.
...
Muhammad Zafarullah Khan*, Shah Saud Ahmad and Asif Nawaz
...or the empowerment of farmers that aimed to provide agricultural inputs like seeds, fertilizers, pesticides, machinery along with advisory services in order to increase per acre yield. This study was conducted in Khyber Pakhtunkhwa province in the year 2016. The study was conducted to assess the effectiveness of Farm Services Centers (FSCs) in district Charsadda regarding provision of agricultural services to its member farmers<...
Wanchao Zhu1, Qinguo Wei1, Shuyu Xue1, Huanxin Zhang2, Tianshu Lv1 and Honghai Zhang1,*
...em in this study. The primers designed by Primer Premier 5.0 based on conservative regions were tested on 22 individuals. Our results demonstrated that the number of alleles per locus ranged from two to five and the mean number of alleles was 3.67. The observed and expected heterozygosities ranged from 0.227 to 0.545 and 0.201 to 0.630, respectively. The polymorphic information content value ranged from 0.181 to 0.573. Null allele frequency varied from -0.0548...
Mushtaq Ahmad1,*, Mehboob Ahmed1,2 and Nasim Ahmad1
...solution); smears were immersed in tampon either at room temperature or at 60oC, Protocol III (concentration of dye in staining solution); slides were stained with 1, 5, 200, 500, or 1000µg/mL solution. The slides were observed, intensity of staining and debris presence in samples. The debris presence was reduced (P<0.05) due to washing of semen sample. Intensity of staining increased (P<0.05) due to washing and heating during incubation...
Umair Talib1*, Ijaz Ashraf1, Khalid Mahmood Chaudhary1, Riaz Ahmad2
...among the smallholder farmers in Pakistan. Since the late 1980s, the government of Pakistan include private sector in extension circle to enhance the effectiveness of public extension through competition. This study conducted in 2016, sought to analyze whether smallholder rice growers are more satisfied with public or private extension organizations and development of a strategy to enhance the effectiveness of extension work. The specific objectives ...
Habibun Nabi1, Saher Islam2, Amna Arshad Bajwa2, Imran Rashid1,*, Haroon Akbar1, Wasim Shehzad2, Kamran Ashraf1, Nisar Ahmad1 and Aneela Durrani3
...rformed. Five sets of primers were designed using PrimerSelect tool for PCR to amplify SAG2 gene 5’ and 3’ regions. Sequences of 5 fragments of SAG2 were annotated and analyzed using DNASTAR Lasergene. After phylogenetic analysis with 3 clonal types and atypical strains, and on the basis of restriction map of HhaI and Sau3AI, our 3 isolates of T. gondii were found more closely linked to a typical strain. This is the first genetic analysis of...
Rehmat Ullah1*, Kalim Ullah2, Inam Ullah3, Muhammad Zafarullah Khan1 and Asif Nawaz1
...ndomly. Among all the farmers, 120 farmers were evaluated through valid, reliable and pre-tested interview schedule. Data collected was analyzed through Statistical Package for Social Sciences ver. 20. Descriptive and inferential statistics were used. The study has revealed that field assistants (FA) provide new information (75 respondents). It was observed that FAs were available at their offices (70) and far
Faiz Muhammad1,*, Syed Khurram Fareed1, Urooj Zafar1, Taseer Ahmed Khan2 and Aqeel Ahmad1
...ent for positive PCR. Primers were selected for 16s rRNA and it could detect up to 100 cfu and 250 cfu from MS and MG respectively in a samples. We have tested pure DNA of other mycoplasmas (5 species from avian origin and 3 other mycoplasmas species) but it produced only the genus specific band. The optimized ratio of tPCR primers were 1: 1: 10: 1. For Outer F, Inner R, and Inner F and Outer R, respectively. MgCl2
Shahab e Saqib1*, Himayatullah Khan2, Sanaullah Panezai3, Ubaid Ali4 and Mazhar Ali5
...tment among different farmers’ group in Khyber Pakhtunkhwa. The data were collected from 87 subsistence farmers in Mardan sub-district. Multistage sampling technique was used to select the study area. A standardized questionnaire was used to collect data from farming households’ heads. Credit fungibility ratio and ANOVA were used to explore the credit fungibility and credit margin of investment among the groups o...
Inayatullah Jan*, Sajid Khan, Noor Paio Khan and Muhammad Ashfaq
...dit services to small farmers with the aim to increase agricultural productivity and income of farmers. This study was conducted with the aim to assess the effects of micro-credit programme of KBL on agricultural productivity in district Mardan in Khyber Pakhtunkhwa Province of Pakistan. The study was conducted in three purposively selected villages namely; Nasir Kaly, Shankar and Kodeenaka. From the field surveys, it was fo...
Muhammad Anas1, Abdul Jabbar1, Muhammad Aqeel Sarwar2*, Raza Ullah1, Muhammad Khubaib Abuzar3, Ijaz Ahmad4 and Sohail Latif5
...esults suggested that farmers may adopt 6 sunflower plants m-2 + 30 mungbean plants m-2 in intercropping system for increased productivity and economic return. ...
Haidar Ali* and Malik Muhammad Shafi
...m employment of small farmers in Peshawar Valley. A sample of 201 small farmers were selected using random sampling technique and data were collected through a pre-tested interview schedule. This study focuses on two selected districts i.e. Peshawar, and Charsadda. Four villages were selected two each from the sampled districts. Analysis showed that the coefficients of household size, educational level of the sampled respond...
Wali Khan1,*, Noor-Un-Nisa2 and Aly Khan3
...arasitic infection in farmers, education concerned and shepherds of Swat, Khyber Pakhtunkhwa, Pakistan. A total of 1041 stool samples were examined from January 2006 to December 2008 using direct smear and concentration methods. One hundred and fifteen (11.04%) participants were found infected with one or more than one intestinal protozoans. Forty one (35.6%) of the participants were infected with single parasite and seventy four (64.3%) with multiple infectio...
Gut Microbe Analysis between Asthma Patients and Healthy Volunteers in Shaanxi Province, Xian, China
Hafiz Muhammad Ishaq1, Muhammad Shahzad2, Xiaokang Wu3, Chaofeng Ma4 and Jiru Xu1,*
...E, by using universal primers focusing V3 region of 16S rRNA gene, was performed for characterization of gut microbial composition. Sequencing of most dominant excised gel bands was done. Real-time PCR was performed to evaluate the copy numbers of dominant bacteria of gut microbiota. The results indicated that a significant diversity difference between asthma and healthy groups (*P< 0.05), was shown in DGGE profile. Similarity index was found to be l...
Saara Ahmad1,*, Iftikhar Ahmed2, Saida Haider3, Zehra Batool3, Fatima Ahmed4, Saiqa Tabassum3,6, Syeda Madiha3, Tahira Perveen3 and Saad Bilal Ahmed5
...lth outcomes on the consumers. The ill effects account for hyper-lipidemias and imbalance in the steroidal sex hormones may result in the development of cysts in the ovaries with resultant difficulties in reproduction. The present study was done on 75 rats divided randomly in 5 equal groups fed with rat chow, caged chicken meat, uncaged chicken meat, raw spinach and soybean for a period of six weeks. The levels of plasma cholesterol, progestril, estradiol, and...
Muhammad Zahid1*, Muhammad Ather Javed Khan2, Muhammad Idrees3 and Ahmad Kamran Khan4
...st management all the farmers used pesticides haphazardly while 1.3% used after it. 90.7%, 86.7% and 97.3% farmers were aware of economic threshold level of harmful insects, use of pesticides at economic threshold level and clean cotton picking respectively. 94.7% growers adopted thinning of plants, 91.3% knew pest scouting, 87.3% used pesticides after pest scouting while 74% farmers used ...
Muhammad Jamal Nasir*, Anwar Saeed Khan and Said Alam
...ermine the ability of farmers to detect climate change and how they have adapted to whatever climate change they believe has occurred. Farmers have indigenous knowledge of the climate of the area to predict and forecast the changing weather and climate. Knowing such traditional knowledge provides an opportunity to understand how the farmers are adapting to new type of weather. The study wa...
Muhammad Tariq1*, Muhammad Khawar Hussain1, Zilakat Khan Malik2 and Noor Jehan1
...cal efficiency of 178 farmers was more than 90%. Furthermore, farmers with more years of schooling, greater age, smaller farm size, greater experience and obtained credit were having 82%, 83%, 83%, 87% and 84% technical efficiency respectively. The study results suggested that’ education, training and credit availability can play a significant role in increasing the output efficiency of strawberry far
Ayesha Bibi*, Musharaf Ahmad and Shaukat Hussain
...colonies Cmm-specific primers CMM-5 and CMM-6 were used for amplification of 614bp product from pat-1 gene of bacterial plasmid. The whole bacterial DNA was used as template, extracted with standard procedures using commercially available kit i.e. protinase-K (sigma). 27 out of 34 isolates were confirmed as Cmm having 614bp band. Black nightshade (Solanum nigrum L) was the only weed from which pathogen was consistently isolated. From Northern KP, a total of ni...
Imran Khan*, Zahir Shah, Wiqar Ahmad, Farmanullah Khan and Muhammad Sharif
... Fe (55-72%) over the farmers practice and only second after sole FYM 20 t ha-1 whilst the maximum Mn (115-145%) were observed in these treatments. The FYM5,10,15,20 reduced the BD significantly (p<0.01) by 7-12% and increased the porosity by 9-14%, saturation water by 9-20% and available water by 19-29%. However the INM5:75,10:50, 15:25, closely followed the FYM5,10,15,20 with reduction in BD by 9-11% and increased in porosity by 11-13%, saturation water b...
Ronaq Zaman*, Shahid Ali and Inam Ullah
...ler farming. Broilers farmers also need to be provided with loan facility on easy installments, for a smooth running of broiler farms in future. ...
Saima Akhtar Qureshi1 and Asim Anwar2*, Ather Maqsood Ahmed3
...ion and increases the farmers’ profit. However, concerns about production may hinder widespread adoption of this technology by farmers. The aim of the study is to evaluate economic feasibility of IPM method in Punjab. The study consisted of 326 farmers (161 IPM producer and 165 NON-IPM producers) and compared input and output outcomes of IPM and NON-IPM farms and provided a detailed ...
Wali Khan1,*, Noor-Un-Nisa2 and Muhammad Asif Nawaz3
...rms) infections among farmers, education concerned and shepherds of Swat, Pakistan. A total of 1041 stool samples were examined from January 2006 to December 2008 using direct smear and concentration methods. Two hundred and twenty one (21.2%) participants were found infected with one or more than one intestinal tapeworms. Seventy seven (7.39%) of the participants were infected with single parasite and one hundred forty four (13.8%) with multiple infections. <...
Mohammad Aslam*
...consumption plan of consumers. The study reveals that rice is a substitute food commodity for wheat and may be promoted as such. Since level of significance is small, it may need sustained promotional efforts and appropriate policy measures on the part of the state. Moreover, wheat being a staple diet of people for centuries, switching over to rice may happen only over a long period of time....
Khalid Mahmood Aujla, Sajida Taj*, Khalid Mahmood** and Nadeem Akmal*
...ance the wheat yield, farmers were of the view that the timely availability of quality inputs (seed, fertilizers) at reasonable prices, canal water supply at critical stages of plant growth, and affordable diesel and electricity prices should be ensured. Timely availability of credit to the resource poor farmers would also enhance the wheat yield in Punjab....
Hassnain Shah, Hina Riaz, Nadeem Akmal , Muhammad Sharif* and Abdul Majid**
...rvention based on the farmers’ perception regarding the acceptability and compatibility of the balance feed was done through survey of the participating and fellow farmers at the project sites. Paired sample ‘T’ test was used to compare the difference in milk yield. Farmers reported 0.5 to 2 liters per day increase in milk yield with the use of balance feed. The paired sa...
Aslam Memon, A. M. Khushk* and Umer Farooq**
...arcane crop by sample farmers with more than 70% and 76% of total sugarcane areas were devoted to recommended varieties during 2006-07 and 2007-08, respectively. More than 25 sugarcane varieties were cultivated by sample farmers in Pakistan. Majority of the farmers planted only one variety. Among recommended varieties, Thatta-10 and CP-77-400 were relatively the most commonly planted. That...
Mazher Abbas*, Muhammad Waqas Akram**, Ikram Saeed*** and Arshed Bashir*
...all, medium and large farmers was Rs. 35913.10, Rs. 39635.54 and Rs. 39868.80 acre-1 respectively. Average of net income by small, medium and large farmers was Rs. 21194.59, Rs. 20608.26 and Rs. 19956.50 respectively. Benefit cost ratio for small, medium and large farmers was 2.44:1.00, 2.08:1.00 and 2.00:1.00 respectively. The study revealed that canola production in Central Punjab is pro...
Nadeem Akmal, Hassnain Shah*, Muhammad Azam Niazi** and Waqar Akhtar*
...rs and 31 beneficiary farmers using a structured pretested questionnaire. The main influencing factor in keeping bucks was goat breed improvement. All the sample respondents were convinced of the benefits of crosses with Beetal buck and reported that the offsprings Beetal were of higher body weight (40% higher), good looking and well built. Regarding the suitability of Beetal with fodder and forage in the area, majority of the farmers<...
Muhammad Azam Niazi*, Hassnain Shah, Waqar Akhtar and Nadeem Akmal**
...vealed that Pakistani farmers’ profitability improved slightly during the study period but at the same time overall purchasing power of the farmers dropped. Pakistani farmers are expected to loose and consumers to gain if free agricultural trade (in selected commodities) opened with the neighboring India. It is suggested that farmer friendly polici...
Zaheeruddin Mirani*and Aslam Memon**
...udy was the fact that farmers were not receiving new agricultural information from agricultural extension as most of the farmers were not visited. This entails the fact that farmers are not alone responsible for non-adoption of improved practices. Pesticide/fertilizer agents were viewed as effective in transferring messages, however, they were limited to their product sales since they have...
Muhammad Azeem Khan*, Abid Hussain, Irfan Mehmood and Sonila Hassan **
...ic and livelihoods of farmers in semi arid zones of Punjab and Khyber Pukhtunkhwa provinces of Pakistan. Data for the study has been taken from various issues of Crop Area Production (by districts) MINFA (Economic Wing), district agricultural departments and meteorological department, Islamabad. Primary data for the study was collected in 2010 by conducting farm level surveys in Kohat and Attock districts. Clusters of six villages were selected from each distr...
Rubina Bano, Hassnain Shah, Muhammad Sharif and Waqar Akhtar*
...of the sample poultry farmers along with cost and profitability analysis. Broiler farming was done by adult males on full time basis. It was the main source of income of a family. The average flock size in the study area was 4033 birds. The study also bifurcates the cost structure and fixed cost accounts for 7 % while variable cost accounts for 93% of total cost of production. Feed makes the major share and accounts for 49.34%. Broiler production in the study ...
Muhammad Zafarullah Khan1*, Rehmat Ullah1, Asif Nawaz1 and Ejaz Ashraf2
...in the empowerment of farmers towards the sustainable development. Five districts of Khyber Pakhtunkhwa such as Mansehra, Dir Lower, Swat, Dera Ismail Khan and Swabi were the sampled districts and 80 farmers registered with Farm Services were randomly selected from each district. Thus, sample size was making a total of 400 respondents. Primary data were collected with the help of pre-tested interview schedule through persona...
Anish Shrestha
...sample for the study. Farmers were rearing on an average 34.54 hives and average honey productivity was 34.6 Kg/hive. Average production cost was NRs. 7392.52 with the average net profit of NRs. 2987.05 (1 USD = 106 NRs), and B:C ratio was 1.67. Labor cost, migration cost and expenditure on sugar drug and comb foundation seems to have positive and significant relation with gross return. All of them appeared to be underutilized and needed to be increased by 39%...
Imtiaz Hussain*, Hassnain Shah, M. Azeem Khan, Waqar Akhtar**, Abdul Majid*** and M. Yaqub Mujahid*
Corresponding author:[email protected]
PRODUCTIVITY IN RICE-WHEAT CROP ROTATION OF PUNJAB: AN APPLICATION OF TYPICAL FARM METHODOLOGY
...breaks this rotation. Farmers are aware of the beneficial effects of this crop rotation and believed that this riceberseem rotation control weeds in the next wheat crop along with yield -1 -1 improvement of both rice (upto 5.4 md acre ) and wheat (4.4 md acre ). However there is need to assess the economic impact and evaluation of berseem in rice-wheat cropping system and evaluation of different wheat planting techniques in relation with residue management. Th...
Arshed Bashir *, Shamsheer-Ul-Haq**, Mazher Abbas*, M. Aamir Munir** and Aneela Afzal***
Corresponding author:[email protected]
IMPACT OF SUGARCANE MILLS DEVELOPMENT ACTIVITIES ON CANE PRODUCTION IN PUNJAB
...2010. The beneficiary farmers were operating significantly larger land holdings. Area under new high yielding, with more sugar recovery varieties was relatively higher at beneficiary farms as compared to non-beneficiary farms. The beneficiary farmers were getting higher returns from sugarcane production (fresh and ratoon crops) as compared to non-beneficiary farms. Inclusion of small and medium farme...
Hassnain Shah, Muhammad Azeem Khan, Umar Farooq, Nadeem Akmal*, Shahid Munir and Bashir Hussain**
POTENTIAL FOR INVESTMENT IN INDIGENOUS TECHNOLOGIES: A CASE OF LOW COST SOIL AND WATER CONSERVATION STRUCTURES IN RAINFED POTHWAR, PAKISTAN
...efits realized by the farmers recorded through assessment survey revealed that the technology had a short payback period along with internal rate of return varying in the range of 25-37% under rainfed conditions and positive net present value. The farmers' perceptions revealed that the technology can solve the erosion problem along with 10-35% increase in crop yield and save repair and maintenance cost incurred on eroded lan...
Mazher Abbas*, Tahir Mehmood**, Arshed Bashir*, Muneeb Zafar*** and Aneela Afzal****
ECONOMICS OF LALLEMANTIA ROYLEANA (TUKHAM-EBALANGOO) PRODUCTION IN THE LOW INTENSITY CROPPING ZONE OF THE PUNJAB, PAKISTAN
..., medium and large -1 farmers was Rs. 44175, Rs. 52483.02 and Rs. 55247.73 acre respectively. Average net income by small, medium and large farmers was Rs. 25281.02, Rs. 28734.98 and Rs. 28763.83, respectively. Benefit cost ratio for small, medium and large farmers was 2.34:1.00, 2.21:1.00 and 2.09:1.00 respectively. Cultivation of L. royleana in Punjab is profitable enterprise. Because of...
Parvez Khaliq*, Azim Malik**, Nasir Mahmood Cheema* and Muhammad Umair***
ECONOMICS OF WHEAT BASED CROPPING SYSTEMS IN RAINFED AREAS OF PAKISTAN
...r-wheat will help the farmers to sustain productivity of these crops, stable economic benefits and improvement in soil nutrients and organic matter over time....
Muhammad Tariq*, Raja Muhammad Omer**, Muhammad Ashraf Mian*, Obaid Ur Rehman***, Amjad Tahir Virk and Kazim Abbass**
PROMOTING CERTIFIED SEED AVAILABILITY OF WHEAT (TRITICUM AESTIVUM L) THROUGH PUBLIC-PRIVATE PARTNERSHIP AND ITS IMPACT ON YIELD IN RAINFED AREAS
...oved varieties to the farmers. An approved wheat variety 'Chakwal-50' of rainfed areas was selected for certified seed production and distribution in rainfed District Chakwal under joint venture of a study on comparison of seed source(Certified vs. Farmer's seed) contribution towards wheat yield at six sites in the District. All the agronomic practices were the same in both -2 treatments. The number of fertile tillers m were significantly higher in certified s...
Akhtar A. Siddiqui and Allah W. Rind*
EXTENSION FIELD WORKERS� PERCEPTION OF COTTON INTEGRATED PEST MANAGEMENT PROGRAMME IN SINDH PROVINCE
...ogramme was to enable farmers to be self sufficient, using practices that are agro-ecological friendly. This study was carried out in four districts of Sindh province (Hyderabad, Tando Allahyar, Matiari, and Mirpurkhas). The sample size comprised 48 EFWs who participated in Training of Facilitators (ToF) and erecuted FFSs during 2001 and 2004. The results revealed that the EFWs performed effectively to attain the objectives of IPM programme. It appears that EF...
Muhammad Zubair Anwar, M. Azeem Khan, Ikram Saeed, Akhtar Ali*, Shafique Zahid and Abdul Majid**
SMALL FARMERS PERCEPTIONS REGARDING IMPROVED FODDER AND FORAGE VARIETIES: RESULTS OF PARTICIPATORY ON FARM RESEARCH
...larly majority of the farmers (68%) pointed out 50% increase in dry stalk yield. Majority of the respondents (83%) appreciated the newly introduced plant species while about 17% have shown their interest in fruit trees....
A.A. Mengal* , M. U. Mallah, Z. A. Mirani* and B. N. Siddiqui**
AN ANALYSIS OF PUBLIC AND PRIVATE AGRICULTURAL EXTENSION SERVICES IN BALOCHISTAN, PAKISTAN
...aled that a number of farmers received visits from private extension field staff on a fortnightly, monthly and quarterly basis, but not from public extension staff during these periods. When public field staff did visit, the favored method of extension was by exhibition and seminar, which ranked 1st and nd 2 , respectively, based on the mean score for each extension teaching method used. A majority of the farmers received fa...
Sajida Taj*, Muhammad Tariq Iqbal Khan**, Mazher Abbas and Arshed Bashir***
PRICE SPREAD AND MARKETING MARGINS OF CUT ROSE IN PUNJAB, PAKISTAN
...ata collected from 34 farmers, 13 wholesalers-cum-commission agents and 20 retailers from main flower producing areas of Kasur and Faisalabad districts from Punjab province, the structure and marketing margins of producers and other marketing intermediaries are quantified along the existing two marketing channels for cut flowers. In the first channel the main players were producers, wholesalers-cum-commission agents, retailers and consu
Ayesha Tahir* and Zafar Altaf**
DETERMINANTS OF INCOME FROM VEGETABLES PRODUCTION: A COMPARATIVE STUDY OF NORMAL AND OFF-SEASON VEGETABLES IN ABBOTTABAD
...jority of the sampled farmers were growing tomato and cucumber. There was not much fluctuation in the income among the farmers in normal season but the income from off-season vegetable production was almost double. Most of the farmers were not highly educated but many of them had their own land or land rented or shared in with other farmers so they were ...
Shafique Qadir Memon*, Muhamamd Safar Mirjat, Abdul Quadir Mughal** Nadeem Amjad***, Muhammad Azhar Saeed, Shabbir Kalwar, Asif Ali Mirani and Habib Iqbal Javed****
TILLAGE AND NPK EFFECT ON GROWTH AND YIELD OF SPRING MAIZE IN ISLAMABAD, PAKISTAN
...owever, poor-resource farmers can use the medium level of NPK @ -1 150-75-75 kg ha for getting an economical and successful maize crop....
Amir Khatam*, Sher Muhammad and Ijaz Ashraf**
ROLE OF FARMER FIELD SCHOOLS IN ENHANCING SKILLS OF FARMING COMMUNITY IN KHYBER PAKHTUNKHWA, PAKISTAN
...ides opportunities to farmers of improving various skills through practicing various techniques by themselves. Considering therefore, the importance of this approach, the study was conducted in 2011 to examine the role of FFS in enhancing skills of farming community in the central region of Khyber Pakhtunkhwa, Pakistan. The data were collected through survey method on various aspects from 280 randomly selected farmer respondents. The data collected were analyz...
Muhammad Sohail*, Imtiaz Hussain*, Riaz-ud-din*, Syed Haider Abbas*, Maqsood Qamar* and Muhammad Noman*
EFFECT OF SPLIT N FERTILIZER APPLICATION ON PHYSIOAGRONOMIC TRAITS OF WHEAT (TRITICUM AESTIVUM L.) UNDER RAINFED CONDITIONS
...r rainfed conditions. Farmers usually apply full N dose at seeding. However, winter showers during vegetative growth period provide an opportunity to apply N in split doses. Study was conducted to find out appropriate N rate and application method to enhance wheat productivity. -1 Three N rates i.e., 60, 90, and 120 kg ha and three application methods i.e. full basal N dose at planting and N application in two and three equal split doses at tiller formation an...
Sajida Taj*, Akhter Ali*, Nadeem Akmal*, Shujaat Yaqoob** and Mubarik Ali***
RAISED BED TECHNOLOGY FOR WHEAT CROP IN IRRIGATED AREAS OF PUNJAB, PAKISTAN
... crop. A sample of 63 farmers was interviewed in detail to understand the whole system and the factors contributing to the adoption of the technology. The study revealed that adopters typically have a more favorable resource base and tend to variously outperform non-adopters. More access to education and other social indicators increases the chances to adopt new technologies by the farming community. However, the small farmers
Abid Hussain*, Khalid Mahmood Aujla* and Sonila Hassan**
PRODUCTION AND MARKETING OF CAMEL PRODUCTS IN SEMIDESERT AND DESERT AREAS OF PAKISTAN
..., 2011 from 220 camel farmers and 17 market intermediaries. It is found that both camel farmers and market intermediaries were less educated. It is observed that markets for camel milk, meat, hides and hair are less established in semi desert and desert areas of the country. Mean production of milk per farm household was 5.4 and 6.5 liters per day in summer and winter seasons, respectively; however, none of the surveyed far<...
Naheed Zahra*, Muhammad Zubair Anwar*, Sonila Hassan** and Irfan Mehmood**
INSTITUTIONAL CREDIT ARRANGEMENT AND THEIR IMPLICATION ON AGRICULTURAL INCOME IN THE SELECTED VILLAGES OF RAWALPINDI DISTRICT
...pacity of subsistence farmers. The aim of the present research was to ascertain the impact of institutional credit on the agricultural income of the sample farmers. The study was based on the primary data collected from 150 farmers through purposive random sampling. Regression analysis was done to obtain the results. Ordinary Least Square (OLS) method was applied to generate the results. R...
Hafiz Sultan Mahmood*, Munir Ahmad**, Tanveer Ahmad*, Muhammad Azhar Saeed* and Muhammad Iqbal***
POTENTIALS AND PROSPECTS OF PRECISION AGRICULTURE IN PAKISTAN - A REVIEW
...o provide benefits to farmers as well as reduced environmental stresses in the developed world. Present paper provides an overview of precision agriculture and examines the potentials, prospects, implications, issues and relevance of precision agricultural applications in Pakistani agricultural system. There is a scope of many precision technologies to be implemented in the country. In this perspective, farmers and governmen...
Amir Khatam*, Sher Muhammad**, Badar Naseem Siddiqui***, Muhammad Zakaria Yousuf Hassan****, Ijaz Ashraf**, Muhammad Zafarullah Khan***** and Aijaz Kuharoo******
COMMUNICATION OF AGRICULTURAL INFORMATION THROUGH GROUP CONTACT METHODS IN PAKISTAN
...280 randomly selected farmers of four districts and analyzed using descriptive statistics. Survey method was used for data collection by researchers using a pre-tested research instrument. The results of the study show that sources of agricultural information used by the farmer respondents were seed/ fertilizer dealers, workshops, panel discussions, role playing and brainstorming. However, seed/ fertilizer dealers proved to be the most effective source of agri...
Abid Hussain*, Khalid Mahmood Aujla* and Sonila Hassan**
ECONOMICS OF COW MILK PRODUCTION IN SINDH AND AZAD JAMMU & KASHMIR
...data of 130 livestock farmers, selected through simple random sampling technique. Shares of different feed resources in total feeding cost have been determined and cost-benefit analysis of milk production by ecological zones was also conducted. Wide variations in share of feed sources in total feeding cost per annum, milk productivity and profitability of main cow breeds across selected areas have been observed. Concentrate feeding is the main cost item for co...
Tanzila Kazmi*, Abid Ghafoor Chaudhry*, Aftab Ahmed** and Shaheer Ellahi Khan**
FARMERS BELIEFS ABOUT INDIGENOUS FARMING PRACTICES AND SUSTAINABLE AGRICULTURAL DEVELOPMENT
...ich the sample of 187 farmers were drawn out of the population of 3680, to cultivate insight and beliefs regarding the indigenous farming practices and how it is related with sustainable agricultural development. During the study a mixture of qualitative techniques including interview guide(s), focus group discussions (FGDs) and case study were used. The study revealed that indigenous knowledge is a long term process and demands a complete approach to achieve ...
Naveed Jehan*, Khalid Mahmood Aujla**, Muhammad Shahzad*, Abid Hussain**, Muhammad Zahoor*, Majid Khan* and Ahmed Bilal*
USE OF MOBILE PHONES BY FARMING COMMUNITY AND ITS IMPACT ON VEGETABLE PRODUCTIVITY
...hancement, growth and farmers’ prosperity. Mobile phone helps farmers in getting information about commodity prices in different markets. The farmers can get up-to-date information about various markets in different regions and can accordingly arrange transportation and labor services in time. The study was conducted to see the effect of timely information availability with mobile on...
Saima Rani*, Hassnain Shah*, Umar Farooq** and Bushra Rehman**
SUPPLY, DEMAND, AND POLICY ENVIRONMENT FOR PULSES IN PAKISTAN
...ation decision of the farmers. But yield for mung and fertilizers price for both pulses were insignificant factors in influencing the farmers' decision to allocate land. Production of pluses mainly depends on area under the crop. Pulses area under irrigated conditions and sowing season rainfall positively influence the production of gram and mung. Technological factors by the time trend had given positive impact on the yield...
Rehmat Ullah*, Kalim Ullah** and Mohammad Zafarullah Khan*
EXTENSION SERVICES AND TECHNOLOGY ADOPTION OF DATE PALM (PHOENIX DACTYLIFERA L.) IN DISTRICT DERA ISMAIL KHAN
...ating the problems of farmers and suggesting a suitable solution for these problems. Due to the utmost importance of agricultural extension services, its role was investigated in the major date producing areas (Dakki, Mian Wada, Mathra Abad, Jhok Ghamywali, Habib Abad, Bilot Sharif, Himat, Jhok Moazam, Matwala Shah, Chura and Jhok Malkanri) of the district Dera Ismail Khan by personal interview method from a sample of 51 respondents selected from these village...
Abid Hussain*, Khalid Mahmood Aujla* and Nouman Badar*
YIELD GAP DETERMINANTS FOR WHEAT PRODUCTION IN MAJOR IRRIGATED CROPPING ZONES OF PUNJAB, PAKISTAN
...ctional data from 210 farmers for the crop year 2009-10. Results suggest that farm level wheat yields are less than the potential yield level by 33.0%, 43.0% and 50.6% in the mixed-cropping, cotton-wheat and rice-wheat zones of the province, respectively. Ordinary least square regression analysis of wheat production by assuming Cobb-Douglas specification reveals that the number of irrigations, usage of farm yard manure and fertilizers contribute positively and...
Rashid Minhas*, Iftikhar Ahmad Khan**, Faisal Saeed Awan**, Lal Hussain Akhtar*, Syed Awais Sajid Shah* and M. Shahjhan Bukhari*
ESTIMATION OF GENETIC DIVERSITY AND HYBRID IDENTIFICATION IN AMERICAN COTTON (GOSSYPIUM HIRSUTUM L.) BY PCR BASED RAPD ANALYSIS
...n. Out of the 26 RAPD primers used for DNA amplification, 14 primers produced polymorphic bands, while 12 produced monomorphic bands. These 14 primers yielded total 96 RAPD markers, out of which only 40 were found polymorphic which resulted in 41.66% polymorphism among the genotypes studied. The number of RAPD markers produced ranged from 4 to 12. Average number of 6.40 bands per primer wa...
Hassnain Shah*, Nadeem Akmal*, Waqas Farooq*, Muhammad Azeem Khan* and Shahid Munir**
SHIFT FROM SITE DEVELOPMENT TO SKILL DEVELOPMENT: A CASE STUDY OF WATER HARVESTING THROUGH MICRO CATCHMENTS
... to get insight about farmers' intention towards adoption of micro catchments as a useful tool for rainwater harvesting. The assessment of acceptability and compatibility of the intervention through farmers' perceptions, feed-back, practices and intentions regarding up-scaling the technology would develop the up-scaling and sustainability options for wider area. Under Watershed Rehabilitation and Irrigation Improvement Proje...
Syeda Aimen Hadi*, Abid Ghafoor Chaudhry*, Aftab Ahmed** and Shaheer Ellahi Khan***
PERCEPTION, APPROACHES AND PRACTICES OF LOCAL FARMING AND DEVELOPMENT: AN ANTHROPOLOGICAL APPROACH
...eing abandoned by the farmers. Modern farming which is representative of development has increased the competition, transitioning, breaking the community into people experimenting on modern technology and those who are still finding means to adapt their traditional agriculture to the fast changing needs of the societies. The research was carried out in the villages of Ghora Gali and Aruka through qualitative and quantitative methods. Sustainable development in...
Muhammad Arshad Ullah*, Nazir Hussain**, Helge Schmeisky*** and Muhammad Rasheed****
INOCULATION AND INTER-CROPPING OF LEGUMES IN ESTABLISHED GRASS FOR INCREASING BIOMASS OF FODDER
...nd high income to the farmers. In Pakistan, this vast resource faces many crucial challenges like low quality and high priced feed and fodder and limited chances of increasing area under fodders due to competition for food crops. Intercropping (33%, 50% and 67%) of Panicum maximum grass and legumes (Vicia sativa and cowpeas) coupled with inoculation was studied under rainfed conditions at National Agricultural Research Centre (NARC) Islamabad, Pakistan. Interc...
Rashed Saeed*, Shoaib-ur-Rehman**, Muhammad Qasim*, Hafiz Zahid Mahmood*** and Irfan Mehmood*
ECONOMICS OF PERI-URBAN RADISH PRODUCTION AND MARKETING IN FAISALABAD
...rom 70 radish growing farmers selected randomly from peri-urban area of district Faisalabad, Pakistan. It was found that majority of farmers were not following recommendations of the agriculture department regarding seed rate, fertilizers, and irrigations. Majority of respondents (94.2%) reported the local Meno as the best yielding variety. Imported and 40 day varieties were not popular as only 5.8% far...
Khalid Mahmood Aujla* and Abid Hussain*
ECONOMICS OF MILK PRODUCTION OF MAJOR DAIRY BUFFALO BREEDS BY AGRO-ECOLOGICAL ZONES IN PAKISTAN
... purpose, 219 buffalo farmers were randomly selected from mixed and rice-wheat cropping zones of Punjab and Sindh provinces, mixed cropping zone of Khyber Pakhtunkhwa (KPK) province, coastal zone of Sindh and mountainousAJK. Of these, 155 and 64 were Nili-Ravi and Kundhi buffalo breed farmers, respectively. The study revealed that among the structure of cost components, feed cost occupied the major share in total cost of mil...
Muhammad Asif Jamil*, Nowshad Khan*, FarhatUllah Khan* and Muhammad Zakria*
EFFECTIVENESS OF AGRICULTURAL EXTENSION SERVICES IN DISSEMINATION OF INFORMATION TO THE FARMING COMMUNITY OF DISTRICT BHIMBER, AZAD JAMMU AND KASHMIR
... data consists of 150 farmers. The study revealed that respondent's acquaintance with extension staff was very low as only 18.00% of the respondents had personal acquaintance with the extension staff and 12.67% of them knew extension staff through their neighbour, while 38% of respondents from their friends. The farmers who knew extension staff through relatives were only 16%. It was also found that demonstration, personal c...
Quratulain*, Muhammad Aslam**, Muhammad Khalid Rafique*, Mian Atiq Ahmad* and Rashid Mahmood***
POPULATION DYNAMICS OF ROSE APHID MACROSIPHUM ROSAE L. ON DIFFERENT CULTIVARS OF ROSA INDICA L. IN PAKISTAN
...studies revealed that farmers growing roses on a commercial scale should grow Christan Diar to avoid aphid attack. Maximum average number of aphid nymph, winged and wingeless adults on leaves, buds and flowers were 11.11, 4.97 and 10.13, respectively observed on Perfecta variety...
Junaid Alvi*, Ijaz Ashraf*, Khalid Mehmood Ch*, Muhammad Iftikhar* and Saleem Ashraf**
IMPACT OF LIVESTOCK IN UPLIFTING RURAL LIVELIHOOD
...ic needs fulfillment. Farmers were spending income on family chores, education, health and other aspects of life. Informal discussions and observation dictated the lower productivity than the potential and inadequate awareness and adoption of precise dairy farming practices. Livestock keepers demanded provision of location specific best management practices, training on livestock management and market aspects. Essential veterinary services enabling the livesto...
Khurram Nawaz Saddozai*, Umme Rubab* and Abass Ullah Jan*
STOCHASTIC FRONTIER ANALYSIS OF MAIZE FARMERS IN AZAD JAMMU AND KASHMIR, PAKISTAN
...3%, implying that the farmers can still enhance their technical efficiency by 11% within the given inputs and technology. The results have demonstrated that maize crop is lucrative crop in the study area as maize growers have received increasing return to scale i.e., 1.90 (Ep>1), hence economies of scale exists. The variance parameter lambda (λ) and gamma (Γ) both were significant indicating the good fitness of model and inefficiency impact, re...
Anwar Hussain* and Muhammad Rahman**
ROLE OF TRAININGS ON FARMERS' PROFITABILITY OF MEDICINAL AND AROMATIC PLANTS IN MOUNTAINOUS AREAS OF DISTRICT SWAT, KHYBER PUKHTUNKHWA
...impact of training on farmers' profitability in medicinal and aromatic plants (MAPs) in mountainous areas of district Swat. A convenient sample of 100 respondents, engaged in MAPs in Chail Valley Madyan was taken. Information about revenue from MAPs, marketing, prices and quantities was collected through a structured questionnaire. The respondents were given training under Swiss Development Cooperation Project at the time of collection, harvesting, cleaning, d...
Muhammad Qasim*, Khuda Bakhsh**, Sultan Ali Tariq*, Mahmood Nasir***, Rashed Saeed**** and Muhammad Ather Mahmood****
FACTORS AFFECTING GROUNDNUT YIELD IN POTHWAR REGION OF PUNJAB, PAKISTAN
...lts showed that large farmers allocated significantly higher area (34%) to groundnut cultivation compared to other categories of farmers. The gross margins were also significantly higher at large farms. Ploughing frequency, seed rate and labor mandays have positive relationship with groundnut productivity. Therefore, the provision of improved groundnut production technologies package and improved seed to groundnut growers ma...
Khalid Mahmood Aujla* and Abid Hussain*
MARKETING SYSTEM OF LIVE CAMELS IN THE DESERT ECOLOGIES OF PAKISTAN
...tan. Out of 220 camel farmers that were randomly interviewed for the study, during past one year sale of live camels was reported by more than half of the camel farmers. On an average two camels per farm mainly to meet urgent family cash needs. Mean ages of adult males, milking and non-milking females, male and female young stocks at the time of sale were 8.3, 10.8, 12.3, 1.8 and 2.3 years, respectively, with average sale pr...
Waqar Akhtar*, Muhammad Sharif**, Abdul Hayee Qureshi*, Khalid Mahmood Aujla*** and Muhammad Azeem Khan*
COMPETITIVENESS OF TOMATO PRODUCTION IN PUNJAB, PAKISTAN
... protection to tomato farmers in the study area. Net effect of policy or market failure is reducing the profitability of tomato producers at farm level which indicates lack of motivation from policies for farmers to expand tomato production as import substitute crop. Present study recommended competitiveness and economic efficiency analysis in other tomato producing regions of the country for year round tomato supply on the ...
Muhammad Nisar Khan*, Hassnain Shah*, Saqib Shakeel Abbasi and Abid Hussain*
FARMERS PERCEPTION TOWARDS THE APPLICATION OF BIOZOTE IN SELECTED DEMONSTRATED RICE FIELDS AT HAFIZABAD AND SHEIKHUPURA DISTRICTS
...p was demonstrated at farmers' fields in Hafizabad and Sheikhupura districts under the project “Improving Soil Fertility and Soil Health in Pakistan”. The present paper aimed to assess the performance of biozote on rice and is based on perceptions of farmers involved in on-farm demonstration trials. Four different treatments on each selected plot were carried out for demonstration purpose by a team of technical p...
Basharat Hussain Shah*, F. S. Hamid*, Shams ul Islam*, Fayaz Ahmad*, Sohail Aslam*, and Noorullah Khan*
EVALUATION OF DIFFERENT PEA (PISUM SATIVUM L.) GENOTYPES FOR YIELD AND OTHER ATTRIBUTES AT SHINKIARI, MANSEHRA
...ncial benefits to the farmers of the area. Advance lines PF-400 & 9375 which performed well in the experiment and bear bright future prospects should be considered in designing future hybridization programs....
Arshia Naeem*, Maria Anjum*, Mariam Rehman*, Zahid Mahmood** and Muhammad Asif Kamran**
AN INTEGRATED INFORMATION SYSTEM TO FACILITATE FARMERS IN WHEAT, SUGARCANE AND OTHER CROP DISEASES IDENTIFICATION
...ication to facilitate farmers to communicate their crop related issues directly to agriculture scientists is proposed. This 'AXPERT Platform' consists of web application that provides user centered interface to farmers and a desktop application that facilitates agricultural scientists to identify crop diseases. A case study was developed from Faisalabad region where information about crops, their soil conditions and associat...
Raza Ullah*, Mariam Rehman*, Maria Anjum*, Muhammad Asif
Kamran**, Khuda Bakhsh***, Abdul Saboor****
NAVIGATING FARMING RISKS BY SIMULTANEOUS DIVERSIFICATION AND CREDIT THROUGH FORMAL AND INFORMAL COMMUNICATION CHANNEL
...ess to information on farmers' risk management adoption decisions keeping in view the potential correlation between these risk management adoption decisions. Bivariate and multinomial probit models are used to assess the impact of access to information on farmers' risk management adoption decisions using data collected from 330 randomly selected respondents from four districts of Khyber Pakhtunkhwa Province of Pakistan. Biva...
Ghazala Nawaz*, Muhammad Nawaz Malik**, Muhammad Hassan
Mushtaq***, Fraz Munir Ahmad****, Ali Abdullah Shah*****, Farooq
Iqbal******, Shinawar Waseem Ali*******, Zahida Fatima******** and
Amjad Khan*********
SURVEILLANCE OF BRUCELLOSIS IN LIVESTOCK IN RURAL COMMUNITIES OF PUNJAB, PAKISTAN
... and close contact of farmers with their livestock in Pakistan. Where the socio-economic conditions of rural population does not allow test and slaughter policy, therefore, mass vaccination is recommended to control brucellosis through local government support....
Nusrat Habib*
RELATIVE PROFITABILITY ANALYSIS OF SUNFLOWER IN DISTRICT SWABI AND MARDAN
... by a large number of farmers only by 1990's. Sunflower cultivation trend kept on increasing from the year 1990 to 1999. Since then a continuous decreasing trend in adoption of sunflower has been observed. The present research work was planned to estimate the relative cost effectiveness of sunflower with competing crops like sugarcane and tobacco to find out the major factors which caused the decreasing trend of sunflower in the area. Primary data of 100 respo...
Muhammad Nawaz*, Anwar Javaid Wahla*, Muhammad Saleem Kashif*, Masood Qadir Waqar**, Muhammad Anjum Ali*** and Asim Raza Chadhar****
EFFECTS OF EXOGENOUS NITROGEN LEVELS ON THE YIELD OF RICE GRAIN IN SHEIKHUPURA, PAKISTAN
...e widely grown by the farmers in rice-wheat around the experimental site. Every year, the nursery of both the rice cultivars was transplanted during the second week of July. The results indicated that different nitrogen levels had a significant effect on all studied parameters of both rice cultivars during all the years of experimentation. Both cultivars also differed significantly from each other in number of grains per spike, 1000-grain weight and paddy yiel...
Sher Muhammad , Ijaz Ashraf*, Amir Khatam**, and Naima
Nawaz***
SOCIO-ECONOMIC CHARACTERISTICS OF FARMERS AND THEIR PARTICIPATION IN ACTIVITIES OF MODEL FARM SERVICES CENTERS IN KHYBER PAKHTUNKHWA, PAKISTAN
...tive participation by farmers in farm related activities. The present paper focuses on farmers' participation in various activities of MFSCs as influenced by their socio-economic characteristics. The target population of current study consisted of the member farmers of the MFSCs in four districts of KPK having different ecological mix cropping zones. Data were collected with the help of a ...
Wazha Mugabe1,3,Gaolebale Segolame Mpapho1, John Kamau1, Wameotsile Mahabile2, Shalaulani James Nsoso1, Kealeboga Dipheko1 and Assar Ali Shah3,*
...nd attributes of goat farmers in the Oodi agricultural region, Botswana. Ninety-one farmers were purposively selected based on milk production potential from a list of 170 farmers officially registered with the Oodi agriculture station. Farmers were visited to conduct face to face interviews and administer a questionnaire. The results showed that fa...
Selçuk Kaplan1,* and Sertaç Atalay2
...region using specific primers and cleavage with the BfoI enzyme. Allele frequencies of A and B were found with 0.915 and 0.085 respectively. The genotype frequencies of IGF1 gene were 0.85 (AA), 0.13 (AB) and 0.02 (BB). The SNP in the exon 3 of the LEP gene was detected by amplification of the 494 bp region using specific primers and cleavage with the BcnI enzyme. The estimated frequencies of three genot...
Khalid Khan*1, Muhammad Abdul Kamal2, Saubia Ramazan3, Gulawar Khan4, Gulzar Ali5 and Sheharyar Ahmed6
...vestock income of the farmers by 65%. Furthermore, the elasticity of agricultural credit is higher than the elasticity of family size and education level. The elasticity of the credit, family size and education level are 11%, 0.09 % and 0.05% respectively. Thus, this paper argue that if the policy makers give priority to livestock in agricultural credit and devise easy credit procedures for the small farmers, will ultimatel...
Ejaz Ashraf1*, Hafiz Khurram Shurjeel2 and Zafarullah Baloch3
...nowledge level of the farmers for producing, processing and marketing of dates in Panjgur-Balochistan, Pakistan. Snowball sampling technique was used to select 90 respondents. The data revealed that average age of the farmers was 53.9 years with education from secondary to graduate level. The results of the study showed that many of the farmers on average have 10 acres of land under date p...
Irfan Ullah, Shahid Ali*, Muhammad Fayaz and Abbas Ullah Jan
...d experienced broiler farmers efficiently allocated resources on their farms. Therefore, the policy makers needs to provide education and training facilities to the farmers which are appropriate to rearing of broiler in open shed farms for the efficient utilization of resources and enhancing productivity of broilers. ...
Nazia Qamar1, Sher Khan Panhwar1,* and Ralf Riedel2,*
...ng of Scomberoides commersonnianus and S. tol were obtained between July 2013 and June 2015 for stomach content analysis. Analysis of prey composition was done using permutational analysis of variance (permanova), with species, life stage (juvenile and adults), gender, and weather (rainy and dry season) as factors. Patterns of empty stomachs were investigated to estimate feeding intensity. Feeding intensity was estimated with logistic regression,...
Amjad Ali1, Rajan Shrestha2, Ghaffar Ali1, Irfan Ullah1 and Salman Khan1
...ion services to guide farmers on proper inputs utilization, low interest rate crop based loans and comprehensive policy of setting right price for output to increase net return and per unit yield. ...
Amjad Ali1, Rajan Shrestha2, Ghaffar Ali1, Irfan Ullah1 and Salman Khan1
...ion services to guide farmers on proper inputs utilization, low interest rate crop based loans and comprehensive policy of setting right price for output to increase net return and per unit yield. ...
Muhammad Jamal Khan1, Abdul Malik2*, Muhammad Shahzad Khattak2, Naveedullah1, Naeem Ijaz3 and Ishaq Ahmad4
...e number of hours the farmers operates their well ranged from 2 to 10 hours per day. The water quality reveals that pH of the water varies from 8.2-8.9 while ECw ranges from 0.4-4.7 dS/m. Out of 36, only inseven villages groundwater has ECw higher than the useable limit recommended by WAPDA (1974) and Sodium Adsorption Ratio was within safe range, following various classification schemes. In Richard’s salinity diagram, it is observed that 21 (60%) villa...
Muhammad Suleman Bacha1*, Mohammad Nafees1 and Syed Adnan2
...s vulnerabilities and farmers adaptive measures toward climate change in district Swat of Khyber Pakhtunkhwa, Pakistan. Additionally, vulnerability matrix was used to identify livelihood resources that are vulnerable to climate change induced hazards. Results showed that primarily deforestation and pollution contributed more to the perceived causes of climate change which resulted frequent and sever floods or droughts and reduction in agricultural productivit...
Nihal Ahmad Hadi, Shahid Ali* and Umer Wahid
...data from 150 broiler farmers. A well-structured interview schedule was used with both close and open-ended questions. Data from broiler farmers were collected during April and May 2016. Maximum Likelihood Estimation (MLE) technique was used for estimation of stochastic frontier Cobb-Douglas type production function. Results indicated the mean technical efficiency of 0.89 with the range of 0.63 to 0.97. This implies that far...
Shahid Ali1* and Salamat Ali2
...pled respondents. 120 farmers, 60 farmers of open shed and 60 farmers of EC shed were interviewed during 2014. Dummy variable regression was applied for estimation and comparison of costs and revenues of open shed and EC shed broiler farms. Results revealed that there was statistically significant difference between the cost of production and net revenue of open shed and EC shed farms. Cos...
Amna Kausar1,2, Sana Anwar1, Naila Siddique2, Safia Ahmed1 and Javid Iqbal Dasti1,*
... by using N2 specific primers that confirmed 100% of the matrix (M) gene positive isolates as subtype H9N2. This is the first report from Pakistan that confirms prevalence of AIV H9N2 among different bird species across various regions of the country. AIV remains a pandemic threat therefore vigilance for routine AIV surveillance programs and improved vaccination strategies are highly desirable.
...
Muhammad Waqar Yasin*, Mobushir Riaz Khan and Muhammad Amin
...of this paper so that formers be trained to take necessary precautions while looking after their crops at different stages of crop cycle regarding these climatic variables i.e. temperature and rainfall. ...
Urooba Pervaiz1, Abdus Salam1, Dawood Jan2, Ayesha Khan1 and Mahmood Iqbal1
... was given to all the farmers, results of t-test showed that after getting training; tomato yield, income, total cost of seed, weeding, and pesticides were increased, while seed rate gm per acre was decreased. It is concluded that all the respondents adopted HYVs. Major constrains in the adoption of extension recommendations were high price of agricultural inputs, non-availability of; cold storage, agricultural credit and certified vegetable seeds, lack of fer...
Abdur Rehman1*, Wang Jian2, Noor Khan3 and Raheel Saqib3
...gn: justify;">Chinese farmers faced price volatility risk of major agricultural crops. The main purpose of this article is to compute and determine exactly the sizes and degrees of major crops market risk. The market risk analysis of major crops such as coarse grain rice, wheat, corn, cotton and soybean are determined using the VaR (Value at Risk) model. The practical consequences indicated that the normal distribution model is not appropriate used in evaluati...
Baharullah Khattak1*, Saifullah2, Shaukat Hussain2, Musharraf Ahmad2, Asad Ali2, Mohammad Junaid2, Ijaz Ahmad Khan3, Taj Ali Khan1 and Mubbashir Hussain1
...d set of three random primers was used for this purpose, which resulted in 113 bands on gel for the 15 isolates of T. harzianum. The analysis of the bi-variate data, using Unweighted Paired Groups Method Averages, divided the indigenous isolates of Trichoderma, into four well-defined clusters. These results clearly revealed that there were considerable genetic differences among the Trichoderma isolates. While, there was no correlation, found between RAPD clust...
Arshad Mahmood Malik1, Khalid Mahmood Mughal2, Sarfraz Ahmed Mian2 and Atta Ullah Khan2
...cher. Sample firm was Farmers Market Pvt. Ltd which is unique entity involved in commercial production of hydroponic products in Pakistan. Data on various production and economic variables was collected from FMP during 2009 to 2013. Variable of the study were area, area allocation decisions of farmer, customer structure, markets, costs involved in production process and revenue earned from selling of the produce in both local and in export market. Yield of hyd...
Saima Rani*, Hassnian Shah, Nusrat Habib and Muhammad Azeem Khan
...llingness to pay of consumers estimated by using the probit model. The model contains the information of socioeconomic characteristics, awareness and preferences of organic vegetables and product attributes. The empirical findings indicate that age, employment status, income, education, number of children, taste, no chemical residual, high nutritional value, freshness and colour of the vegetables have positive effects on consumer to pay a high price. While i...
Rehman-Ud-din* and Naeem-Ur-Rehman Khattak
... a sample size of 175 farmers was randomly selected from nine villages on a proportional basis. The study reveals that a large number of both types of farmers are neither completely mechanised nor completely non-mechanised. Majority of the farmers in each type of farmers do not have their own farming machines/animals. Per acre productivity of mechanised ...
Usman Shakoor1, Ali Nasir2, Mudassar Rashid1, Muhammad Iftikhar-ul-Husnain1, Nabila Khurshid1 and Zuhair Husnain2
...in return, would help farmers increase income leading to higher income tax revenue. ...
Zeqin Fu, Yunfang Tian, Yingying Ye*, Pengzhi Qi and Changwen Wu
...ne hundred and twenty primers pairs to screen all microsatellite loci and twenty-three polymorphic loci were identified. The number of alleles per loci ranged from six to twenty-one with an average of 12.913 and the allele size varied between 161 and 470 bp. The observed and expected heterozygosity varied from 0.143 to 1.000 and from 0.351 to 0.926, with average values of 0.614 and 0.771, respectively. Eighteen loci accorded with the Hardy-Weinberg Equilibrium...
Wiqar Ahmad1* and Farmanullah Khan2
... The control (C), ii. Farmers practice (FP; 60:45:0 N: P2O5: K2O), iii. Recommended NPK dose (RD; 120:90:60 N: P2O5: K2O ) and iv. 60:90:60 N: P2O5: K2O integrated with FYM 20 t ha-1 (N1/2PKF) in sub plots. Maize (Zea mays L.) CV Azam (yield data contained in this paper belongs to maize only), wheat (Triticum aestivum L.) CV Uqab and lentils (Lense Culinarus M.) CV NM-89 were cultivated in rotation. Results revealed that during 2006, maize yield did not improv...
Xi-wen Chen1,2, Qian Wang1,3, Miao Yin1, Zhong-hui Pu1,2, Ai-wei Guo3, Lian Li 1,3, Wen-tao Luo1,3 and Xiong-qing Wang1,*
...to detect PRRSV. Four primers were designed targeting the ORF5 gene of PRRSV were designed. Reverse transcription and amplification of the viral RNA using AMV reverse transcriptase was optimal at a constant temperature of 65 °C. The output of the RT-LAMP assay was visualized using 1% agarose gel electrophoresis or color change after the addition of the SYBR Green I dye. The RT-LAMP method was approximately 100-fold more sensitive than RT-PCR for PRRSV dete...
Naeem Ahmad1,* and Zulqurnain2*
...critical decision for farmers. The purpose of the present study was to compare the growth performance of two GIFT strains (GIFT-Th, imported from Thailand; GIFT-Tw, obtained from a local hatchery) in two earthen ponds, fed with commercially available feed. Similar feeding regime and physical conditions were maintained for both treatments. It was found that there was no significant difference in final total length (TL) and standard length (SL) of the fish in bo...
Ejaz Ashraf1*, Hafiz Khurram Shurjeel2 and Mujahid Iqbal3
.... A sample size of 60 farmers was selected by systematic sampling technique using the available list of the farmers provided by Agricultural Extension Department. The respondents were than randomly assigned into two groups, one group was comprised of experimental group (to whom a set of advisory instructions were sent by mobile phone) and other was control (face-to-face). Two- population independent t-test was applied for co...
Mian Noor Hussain Asghar Ali, Liaquat Ali Jamali, Shakeel Ahmed Soomro*, Shakeel Hussain Chattha, Khalil Ahmed Ibupoto, Naseer Ahmed Abbasi and Noor Mehdi Qumi
... suggested that local farmers should adopt sugarcane trash cover method which do provides a convenient and safe storage system. ...
Impacts of Climate Change on Livestock and Livestock Produces: A Case Study of Banke District, Nepal
Anish Shrestha* and Samata Baral
...s. Result showed that farmers perceived the climate change as change in rainfall pattern, rainfall duration, onset of the monsoon, and changes from summer and winter etc. Some farmers realized the change in climate and its impact on their usual farming practices. But, majority of farmers (57.88%) are still unaware about climate change and how to deal with it. Among total respondent, only 1...
Amar Razzaq1, Abdur Rehman4*, Abdul Hassan Qureshi2, Iqbal Javed3, Raheel Saqib5 and Muhammad Nadeem Iqbal6
...ta collected from 120 farmers located in Nurpur Thal, Bhalwal, Sargodha and Lodhran districts of Punjab province. These areas were purposively selected based on relatively higher concentration of HEI infrastructures installed on the farms. Sprinkler irrigation system was mainly installed on wheat crop while the drip irrigation systems were installed on mango orchards. Therefore, one half of the sample consisted of modern and conventional far
Sajad Ali1*, Syed Asghar Ali Shah2, Jaffar Ali3, Muhammad Nadeem Iqbal4, Arshadullah Jadoon5 and Farmanullah6
...straints faced by the farmers in augmenting and stimulating export of the country. The pea’s cultivators and also market agents were quizzed by using structured questionnaires in two related districts that is Haripur and Mansehra in the year 2013-14. The data were analyzed by using SPSS Package version 22 for calculating marketing marginal analysis and cross-tabulation were also been employed. The studied statistics of the land size of chosen pea’s...
Fan Shuli1*, Ameer Hussain Jarwar1,3, Xiaoyan Wang2, Long Wang1 and Qifeng Ma1
...wing cotton crop. The farmers of Pakistan surveying and evolution for high quality of fiber and high quality of lint yield sweetening, the Pakistan also fulfills its 18.8% of comestible oil demand from cotton seed oil. Information acquiring on seed cotton oil and its consumptions is while ever short and not available. There is impregnable need from industry to furthermore sanctify cottonseed oil to provide it suit for direct used as vegetable cooking oil alter...
Muhammad Israr1*, Saeed Ullah1, Shakeel Ahmad2, Asif Yaseen3, Urooba Pervaiz4 and Nafees Ahmad5
...he perceptions of the farmers about the different dimensions of agriculture LD with the construction of LD index. For achieving this primary data was collected by proportionate random sampling techniques form 90 sampled farmers through face to face interview survey method by filling a questionnaire. Farmer’s perceptions on agriculture LD were measured through the extent of severity scale in terms of LD dimensions and i...
Abid Hussain1*, Muhammad Azeem Khan2, Muhammad Anjum Ali Buttar3, Umar Farooq4, Muhmmad Islam5 and Zahid Ullah Khan1
... pass benefits to the farmers by reducing input prices through reduction in GST, providing cash subsidy and supplying inexpensive feed gas for fertilizer industry. Currently, cash subsidy on urea is costing Rs. 12 billion to national exchequer and total tax relief (all products inclusive) costing around Rs. 40 billion to the national exchequer, respectively. Thus, total financial implication of subsidy and tax relief is Rs. 52 billion. In the existing tax regi...
Monsif Ur Rehman1*, Hidayat-ur-Rahman1, Muhammad Iqbal2, Iftikhar Hussain Khalil1 and Zahir Shah3
...; T3 were the best performers in terms of maximum grain yield (above checks) and desirable SCA effects. Another 33 crosses exhibited positive SCA effects for 100-grains weight and grain yield and could possibly be utilized in maize breeding programs for developing high yielding maize hybrids accompanied with other desirable attributes ...
Aneel Salman1, Muhammad Iftikhar ul Husnain1, Inayatullah Jan2*, Muhammad Ashfaq2, Mudassar Rashid1 and Usman Shakoor1
...for their sustenance. Farmers’ perception about climate change, current adaptation measures, and decision-making process is important for farmers’ successful adaptation strategies. Using data of 205 conventional farmers from three district of Punjab province, this study provides insights into farmers’ perceptions about climate change, o...
Amjad Ali1, Abbas Ullah Jan1, Lal Almas2, Noor Piao Khan1 and Khurran Nawaz Saddozai1
...n services would help farmers to redirect their scarce resource allocation and reduce allocative inefficiency. ...
Ghazunfar Rashid1, Muhammad Avais1, Syed Saleem Ahmad1, Muhammad Hassan Mushtaq2, Rais Ahmed3,*, Mahboob Ali1, Muhammad Naveed-ul-Haque4, Mehtab Ahmad5, Mumtaz Ali Khan1 and Naimat Ullah Khan6
...ncome for small dairy farmers in developing countries. Dairy animals fed with a fodder containing a balanced nitrogen contents produce high quality milk. Excess use of nitrogen fertilizers in the soil cause excess accumulation of nitrates in fodder, which is the main source of nitrate poisoning in dairy animals. In the present study nitrate contents in fodder crops, viz., Sorghum bicolor (Jowar), Pennisetum glaucum (Bajra), Zea mays...
Nadia Sharif1, *Neelma Munir1 and Shagufta Naz1
MICROBIAL PRODUCTION OF ALGINATE
...ds, water soluble biopolymers. Alginate is a natural polysaccride that occur as 30 to 60% structural component of brown algae. Alginate favorable properties like ease of gelation and biocompatibility promote its applications in engineering and bio medical science....
Farah Deeba, Hafiz Abdullah Shakir, Muhammad Irfan, Javed Iqbal Qazi*
Chitinase production in organisms: a review
... durable, richest biopolymers distributed widely in nature both in the terrestrial and marine environments. Chitinase are chitin degradable enzyme have control of phytopathogens, physiological functions and degradation of chitinous waste. Interest in chitin wastes utilization is increasing day by day because of its natural resistance against degradation. The review focused on different sources of naturally chitinase production in organisms was discussed....
Umair Talib1, Ijaz Ashraf2, Robert Agunga1 and Saleem Ashraf3*
...lder or resource-poor farmers in a tropical country, such as Pakistan, are often the cause of environmental degradation and at the same are impacted by it. More than 80% of the farmers in Pakistan are resource-poor or practice subsistence farming which degrades the environment. Therefore, there is an urgent need for climate smart extension education for these farmers. The main purpose for ...
Imran Khan1*, Muhammad Iqbal1 and Malik Muhammad Hashim2
...n important role. The farmers do not have sufficient knowledge about the suitable irrigation time (interval). The aim of study was to explore the best irrigation time for sugar beet crop. Hence, this study examines the physiological response of sugar beet cv. California-kws with different irrigation intervals at the research farm, Faculty of Agriculture, Gomal university Dera Ismail Khan Pakistan during 2013-14 and 2014-15. The study was conducted using Random...
Mudassar Javed, Muhammad Zeeshan Majeed*, Muhammad Luqman and Muhammad Afzal
...mporary issues of the farmers in Afro-Asian regions. This two-year field study was carried out to evaluate an IPM (bio-intensive) module developed by selecting through in-situ evaluation and incorporating the most effective pest control options along with the biological (parasitoid Trichogramma chilonis egg cards) and cultural techniques against okra lepidopterous borers. According to results, maximum shoot and fruit infestations (i.e. 19.86 and 15.63%, respec...
Raza Ullah1* and Jamal Shah2
... and heavy rains etc. Farmers adopt available risk coping tools to minimize the impacts of such risks at farm level however, these adoptions require farmers to incur cost or forgo part of the potential benefits from agricultural production. These costs (explicit or implicit) are referred to as the cost of risk management. Previous studies on risk management in agriculture however have ignored such costs. The present study is...
Khwaja Tariq Ziad1, Umar Hayat1, Muhammad2 and Muhammad Suleman Bacha3*
...for small-scale dairy farmers in Pakistan. The study aimed at explaining the costs of the chosen supply channels and their transaction costs, the role of the mid-agent opportunistic behaviour in the relative milk supply chain. Using case study and qualitative method approach, eight key informants including five farmers, one local middleman, and representatives of two dairy companies were interviewed during the study, focusin...
Ejaz Ashraf1*, Hafiz Khurram Shurjeel2, Nosheen Fatima1, Raheel Babar3 and Ikramul Haq4
...problems encounter by farmers of Pakistan. It is vitally important to take proactive measures to enact timely solutions to this issue, and avoid further losses in biodiversity. The present study was aimed to determine the awareness level of the respondents regarding biodiversity conservation. The results showed that farmers were relatively aware of regarding species diversity; however, they do not know the modern techniques ...
Aisha Siddiqua1*, Munir Ahmad1 and Nusrat Habib2
...n Pakistan in future. Farmers are expected to receive significant positive benefits from the adaptation of the combination of strategies. Farmer’s adaptive capacity, farm size, access to credit and sources of information on climate change are significant drivers of adaptation to climate change. ...
Syed Amjad Kamal Jan* and Naushad Khan
...ing to requirement to farmers by bank; Agriculture extension programs should be launched for transfer of knowledge and for awareness of rice growers; Inputs should be provided at door step on subsidized rate to farmer; Legal programs should be arranged for farmer awareness in the study area; Road facilities should be provided to farmer for pick and drop of input and output; Several farm plots should be combined and modern farming be practiced on the farm for e...
Naseer Ahmed Abbasi1, Mian Noor Hussain Asghar Ali1*, Bilawal Abbasi2, Shakeel Ahmed Soomro1, Najeeb Ahmed Khan Nangraj1, Jam Ghulam Mustafa Sahto1 and Sajjad Ahmed Morio1
... but land manager and farmers face the main problem when and where to cultivate. The present study was aims to analyze the efficiency of the parametric and fuzzy set methods in the land assessment for wheat production of Tando Allahyar district of Sindh Province. The present study able to provide grade performance suitability of lands for agricultural purposes; it could be more helpful for farmers of the research area. Fuzzy...
Jam Nazeer Ahmad1,2,*, Muhammad Jafir1, Muhammad Wajid Javed1, Sumaira Maqsood3 and Samina J.N. Ahmad1,2,*
...se I (COI) gene based primers were used for identification of this pest collected from various cotton fields in Punjab. Phylogenetic analysis was also complemented to differentiate DCB identified from other countries of the world. The PCR bands obtained in gel electrophoresis amplified PCR fragments from all DCB species at 710 bp. The sequencing results and phylogenetic analysis with sequences submitted at NCBI database revealed that DCB have 99-100% similarit...
Muhammad Ali1,2*, Norsida Man2 and Farrah Melissa Muharam2
...lso the motivation of farmers. Perceptions of farmers could be influenced by a risky environment to become either risk averse or risk neutral. Indeed, less attention has been paid by researchers to empirically examine the motivation of farmers to manage their agricultural risks exclusively from the lens of Malaysia. Thus, the research was formulated to assess the motivation of farming comm...
Khalid Khan1, Saima Liaqat2*, Somaiya Rasheed1 and Ihsanullah Kakar3
...one hundred livestock farmers of diverse Tehsil/Union Council of District Lasbela. The findings of the study exhibited that trivial farm holders widely used livestock for income generation. Furthermore, livestock have a predominant role to accomplish the rudimentary needs of the households. Moreover, livestock offer opportunities of income generation and to spend it on education, health and housing, which eventually enhanced the living standard of the househol...
Ayesha Chaudhary1, Fouzia Mumtaz1, Muhammad Yaseen2* and Muhammad Younis Afzal3
...ere is a need to make farmers aware of the reasons and causes of climate change so that they may contribute to their side in actively advocating the cause. The present study was survey-based research and carried out in the Faisalabad district of Punjab, Pakistan. The data was collected using a multistage sampling method with the help of well-structured interview schedule. At first, on the basis of simple random sampling Faisalabad saddar tehsil was selected. S...
Muhammad Zulfiqar1*, Irshad Abbasi2, Himayatullah Khan1, Arjumand Nizami3, Abdul Hakeem4, Jawad Ali3 and Muhammad Jamal Khan1
...t on glacier/snow and farmers face sever water shortage at the time of crops sowing in March/April when glacier/snow water is not available. It is therefore recommended to construct water storages at community as well as at farm level as well considering lifting of ground water or river water to meet irrigation water requirements at the crops sowing period. ...
Ayesha Khan*, Zubair Ahmad Khan, Urooba Pervaiz And Mehmood Iqbal
... constraints faced by farmers. Majority (86%) extension agents reported that the extension services are farmer friendly. The most appropriate teaching methods were group meetings (38%) and method demonstration (24%), while the most frequently used method for farmers contact was individual contact method (63%) as identified by extension agents. Non- significant association exist between diffusion of improved practices with ad...
Dilshad Ahmad1* and Muhammad Afzal2
... Bt and Non-Bt cotton farmers in two core cotton districts Muzaffargarh and Rahim Yar Khan of Punjab, Pakistan. In this study, the stochastic frontier approach was employed for empirical analysis and multiple stages random sampling technique used for data collection of 400 Bt and Non-Bt cotton farmers for the year of 2012-13. The results of the study have indicated Bt cotton farmers of bot...
Dilshad Ahmad1* and Muhammad Afzal2
... livelihood of cotton farmers in Pakistan. Potential productivity in agriculture is possible with introduction of advanced mechanization, which is only feasible with financial injections in this sector. The study in hand has focused the role of credit in the cotton production of southern Punjab. Simple Random Sampling technique was used in the study for selecting the respondents in both districts of cotton area. Pre-tested questionnaire was developed for the c...
Farhana Gul1*, Dawood Jan1 and Muhammad Ashfaq2
... survey data from 150 farmers from different climatic zones of Khyber Pakhtunkhwa, Pakistan were measured in this study. TOA-MD model was used to measure the impact of climate change adaptation strategies. Adjustment in sowing time, improved fertilizer application method and increasing sowing densities were three-major adaptation practices whose benefits were analyzed. The adaptation results indicated that adopters of adaptation technology would range from 33 ...
Saeed Ullah1, Muhammad Israr1*, Shakeel Ahmad2, Nafees Ahmad3 and Asif Yaseen4
...Mardan. A total of 90 farmers were selected through proportionate simple random sampling from 857 register farmers. Primary data were collected through structured questionnaire from the heads of the farming households (HH) and analysed by descriptive statistics and Chi-square test. It was found that majority (62%) of the farmers were in the age groups of 41-60. HH size of the far
Jawaria Shaheen1, Samiah Shahid1, Sabahat Shahzadi2, M. Waheed Akhtar1,3 and Saima Sadaf1,*
...hich miR-specific DNA primers were used to increase sensitivity of reaction. Expression of miRNA panel was normalized with mir-16 and expression fold change was calculated by 2-ΔΔCt method. Further analysis was done by SPSS, medcalc and Graphpad prism software. Area under curve analysis was used to get diagnosis outcome of selected miRNA panel. Upregulation of miRNA panel (mir-376c, mir-155, mir-17a and mir-10b) has been seen in the plas...
Abdul Maalik1, Shahzad Ali1,*, Anam Iftikhar1, Muhammad Rizwan1, Haroon Ahmad2 and Iahtasham Khan1
...factors inquired from farmers were animal type, breeds, urbanicity, age (years), teat washing, bedding area, lactating stage and previous exposure of mastitis. Initially surf field mastitis test (SFMT) was applied for screening subclinical mastitis followed by bacteriological techniques on positive milk samples for confirmatory isolation of Staph. aureus as a bovine mastitis causing agent. These Staph. aureus isolates were further tested for anti...
Faiz-ul Hassan1,*, Muhammad Sajjad Khan1, Muhammad Saif-ur-Rehman1, Syed Muhammad Raihan Dilshad2 and Muhammad Amjad Ali3
... by PCR using 40 RAPD primers. PCR products were separated on an agarose gel electrophoresis and scoring of bands was performed. Phylogenetic tree was constructed by UPGMA method to determine the genetic similarity among the horse breeds. Thoroughbred and Arab horse breeds showed a higher similarity with Pakistani indigenous breeds, suggesting that these two exotic breeds had contributed significantly in the development of indigenous horse breeds of Pakistan. ...
Muhammad Adnan Islam1,2*, Muhammad Iqbal2, Zia-ul-Haq2,3, Muhammad Mohsin Ali1, Hafiz Sultan Mahmood1, Shabbir Ahmed Kalwar1, Liaqat Ali Shahid1, Badar Munir Khan Niazi1 and Muzammil Husain1
...od is delayed and the farmers sown wheat in the December and January due to long process of field preparation by conventional method. Zone disc tiller machine developed in the department of Farm Machinery and Power, was employed for sowing wheat instead of conventional tillage in cotton stubble to avoid further late sowing of wheat. Zone disc tiller drill sows crop in strips. Strip tillage of soil reduced labour, fuel, irrigation and machinery costs. Zone disk...
Abdul Kabir1, Laiba Uroog2*, Naushad Ahmad3, Fawad Ahmad3, Muhammad Saqib3, Noor Badshah4 and Taj Ali Khan3
...nomic losses to dairy farmers. It mainly occurs due to non-contagious environmental bacterial species. In Pakistan, it is the major disease of different dairy animals including bovines. However, only a little information is available about bacterial profile of the disease. A cross-sectional study was conducted to find the Etio-prevalence of bacterial species causing subclinical mastitis in a cohort of buffaloes at Khyber Pakhtunkhwa. 120 quarter samples were ...
Syed Atif Hasan Naqvi*
...mmercializing to help farmers to combat the disease. There is a need to use environmentally safe approaches to overcome the loss of grain yield in rice due to this disease. Climate change has a serious effect on this disease because in current scenarios cropping pattern has been changed and the stakeholders has shifted to some other crops rather the practicing ones. Since, farming community has adopted rice crop in non-core areas of Indian Sub-continent where ...
Zahra Nazir1, Saba Ijaz1, Roquyya Gul2 and Mahjabeen Saleem1,*
...mplex polysaccharide polymers of plant tissues into simpler monomer like D-galacturonic acids. In this study, polygalacturonase from grape skin was purified by salting out with ammonium sulfate, gel filtration on Sephadex G-75 column and ion exchange on Q-Sepharose column chromatography. Polygalacturonase was recognised as a protein with 47kDa molecular weight by SDS-PAGE. The optimum pH of purified polygalacturonase activity was found to be 4.5 and stable wit...
Arshad Farooq* and Muhammad Zafarullah Khan
...;was found among farmers of D.I. Khan district regarding land preparation, sowing and harvesting time while in case of Mardan district no knowledge gap was observed in sowing and harvesting time. Farmers of D.I. Khan district had low knowledge gap (1 to 20%) in cane varieties, seed quantity, sowing practices, irrigation application, stoppage of irrigation before harvesting and cane cutting where...
Hafiz Umar Farid1, Muhammad Zubair2, Zahid Mahmood Khan1, Aamir Shakoor1*, Behzad Mustafa1, Aftab Ahmad Khan3, Muhamad Naveed Anjum4, Ijaz Ahmad5 and Muhammad Mubeen6
...icy makers as well as farmers for sustainability of installed HEIS and up-scaling of these water saving techniques for the welfare of mankind. ...
An Empirical Analysis of Livestock Activities of the Model Farm Service Center in Khyber Pakhtunkhwa
Tariq Shah1*, Umar Hayat1, Muhammad Suleman Bacha2 and Muhammad3
...lore the knowledge of farmers and their linkages with government as well private sector for livestock improvement in Khyber Pakhtunkhwa (KP) province. A total of 480 respondents from four districts, namely Swat, Mardan, Abbotabad and Dera Ismail Khan were randomly selected for interview purpose. Descriptive statistical techniques along with independent sample t-test and dummy variable regression were used for analysis. It is observed during the study that live...
Shahid Ali1*, Asim Khan1, Aftab Khan1 and Bakhtawar Riaz2
...tomato production. 90 farmers were selected through multi-stage proportional allocation sampling techniques. Data was collected by using a well-structured interview schedule. Cobb-Douglas production function was employed to assess technical efficiency. Maximum likelihood estimation techniques were employed for estimation. Results showed that all explanatory variables except pesticides have significant effect on tomato production. The results showed that a 1% i...
Asim Khan1, Shahid Ali1*, Syed Attaullah Shah1, Aftab Khan1 and Raza Ullah2
...over, awareness among farmers on climate change is required regarding plantation of trees and afforestation ...
Ayat Ullah* and Ayesha Khan
...e effect of extension-farmers contact frequency on farmers’ knowledge of improved ways of chemical, biological and cultural control methods in the rain-fed districts of Khyber Pakhtunkhwa, Pakistan. Using multistage random sampling technique data were collected from 395 respondents according to Yamane’s formula. The study uses the Kruskal–Wallis H test for checking differences among far
Hayat Zada1, Ahmad-Ur-Rahman Saljoqi1,*, Ijaz Ali2, Bashir Ahmad1, Abdul Waheed Khan2 and Shabeer Ahmad2
...ons. Out of 30 tested primers, 21 amplified 157 polymorphic bands in three populations. The mean gene frequency (f), genetic distance (I) and Shannon’s information index (h) for three populations were 1.336, 0.304 and 0.437, respectively. Nei’s unbiased measures of genetic identity and genetic distance revealed that higher genetic distance was observed among the isolates from Kalam and Madyan (97.87 %) whereas low genetic distance (35.58%) was calc...
Waqar Akhtar1*, Munir Ahmad2, Nadeem Akmal1, Hassnain Shah1 and Asif Ali Mirani2
...ed dates) produced by farmers. The finding of positive Private Profitability and Private Cost Ratio (PCR) value less than 1 argues farm level competitiveness under small, medium and large farms in the study area. Fresh Dates has more competitiveness with less PCR value 0.62 compared to dry dates with PCR value 0.75.There is also influence of farm size on cost efficiency and competitiveness level. Domestic Resource Cost (DRC) ratio less than unity reveled overa...
Asghar Khan1,*, Aneela Zameer Durrani1, Arfan Yousaf2, Jawaria Ali Khan1, Mamoona Chaudhry1, Mumtaz Ali Khan3, Habibunnabi4 and Amjad Khan5
... face interviews from farmers, managers and owners. Milk samples collected were subjected to California Mastitis Test.Data entry and validation was performed through Epi-Data. Data analysis was performed through SPSS. Chi-square and regression analysis were conducted. An overall prevalence of 67.3% was found. On multivariable logistic regression several health (lactation stage, number of lactations, body mass index, udder shape and milk yield), management (udd...
Essossinam Ali*
...">This paper analyzes farmers’ attitudes towards climatic risks and assesses farmers’ risk aversion behavior on inputs use focusing on fertilizer, drought tolerant seeds (DTS) and labor allocation. Multi-stage sampling technique was used to collect data from 704 farm households in three regions (Central, Kara and Savannah) in subsistence agriculture in Northern Togo. Tobit and linear regression models were used t...
Mehran Ahmad, Syed Attaullah Shah and Shahid Ali*
...uction credit to poor farmers for purchase of chemical fertilizers for optimal utilization of these inputs....
Hafiz Abdul Ghafoor*, Muhammad Afzal, Muhammad Luqman and Muhammad Zeeshan Majeed
...ic pesticides, citrus farmers are unable to get rid of this pest. In order to find out alternate biorational pesticides, this laboratory study was carried out to evaluate few selected novel chemistry insecticidal formulations against 2nd instar nymphs of D. mangiferae using standard twig-dip bioassay method according to Completely Randomized Design. Results showed that both factors i.e. insecticidal treatments (F 9, 245 = 146.90, P < 0.001) and time (F 4, 2...
Shumaila Sadiq1,2*, Abdul Saboor2, Fouzia Jamshaid3, Abdul Qayyum Mohsin2 and Azeem Khalid2
...ommunity to determine farmers’ climate change vulnerability index among 9 agro-climatic zones of Pakistan by using data sets from PMD (1981-2010) and HIES (2010-11). Findings revealed that farmers in KPK and Balochistan were the most while farmers in Mixed Punjab and Cotton-Wheat Sindh were the least vulnerable to climate change. In depth analysis of variables of sub-indices suggeste...
Ali Mahmoud Zanaty, Naglaa Mohammed Hagag, Neveen Rabie, Mahmoud Saied, Karim Selim, Saad A. Mousa, Azhar Gaber Shalaby, Abdel-Sattar Arafa and Mohamed Khalifa Hassan
...-PCR using genotyping primers, with a prevalence rate of 16.2%. NDV outbreaks were recorded in 16 governorates, from total of18 investigated governorates and the recorded geo-prevalence of 89 %. Twenty-five samples were selected for further sequencing for the partial fusion protein. Phylogenetic analysis revealed that 20 samples are genotyped as very virulent NDVclass II of genotype VIIb, 4 samples were of high identity (94%-100%) with NDV class II of genotype...
Lusha Liu1,*, Lei Cheng2, Xingqi Zhang3, Yulong Li1 and Jianping Jiang1,*
...rosatellite to design primers and do genetic analysis in the Sichuan basin population of M. fissipes. Of all, 35 primer pairs (57.38%) successfully amplificated in M. fissipes, of which 14 (40.00%) were polymorphism. The observed and expected heterozygosity in the test population ranged from 0.02 to 0.92 and from 0.02 to 0.62, respectively. High transferability rates were detected in M. butleri (37.14%), M. heymonsi (45.71%), M. ...
Umar Hayat1*, Tariq Shah1, Muhammad Suleman Bacha2 and Muhammad3
... to livestock-related farmers and to promote agricultural exports for foreign exchange earnings to achieve the ultimate goal of agricultural growth in Pakistan....
Nazia Qamar* and Sher Khan Panhwar
...ecies Scomberoides commersonnianus (414), S. lysan (15), S. tala (8), S. tol (344) and Megalaspis cordyla (277) were collected from the commercial catches from July 2013 to March 2015. Fish length and otolith length for five species recorded as S. commersonnianus TLcm = 16.3−88.4, OLcm = 0.3−0.9; S. lysan TL=23.2−73, OL = 0.2−0.7; ...
Ayub Khan* and Ghaffar Ali
...cating and mobilizing farmers ...
Shujjah Haider1,*, Ayesha Maqbool1, Tariq Pervez1, Saima Parveen1, Arfan Ahmad2, Zahid Iqbal3, Javed Iqbal3, Shahid Mehmood3, Amanullah Khan4 and Sajid Umar5
...e concern for poultry farmers and cause huge economic loss to poultry industry every year. Various pathogens can initiate respiratory diseases in poultry, including mycoplasmosis caused by Mycoplasma gallisepticum (MG). The distribution pattern of MG in layer flocks is not known in Chakwal. Keeping this in mind, current study was designed to know about distribution of MG. The present study was conducted on 25 commercial layer flocks from different regio...
Aqsa Javaid and Nageen Hussain*
...ing specific designed primers. Gradient PCR was performed and the product length was 197 bps which was further analyzed on 1% agarose gel. Sequencing was done through genetic analyzer (3500 ABI). No mutation was observed in FOXP3 gene exon 1of Pakistani HIV patients.
...
Masooma Munir1,2*, Abdul Ahad3, Asra Gull1, Aqsa Qayyum2, Nouman Rashid Siddique2, Amer Mumtaz2, Naeem Safdar2, Barkat Ali2, Muhammad Nadeem1 and Tahir Mahmood Qureshi1
...n earth. Now a day, consumers prefer ready to eat and convenient food. Food bars are healthy nutritious, small meals having sensory attributes as well. In the present study, apricot based snack bars were prepared with spinach powder addition to enhance micronutrient status of snack food bars. Four treatments were prepared by increasing the level of spinach in apricot bars and storage was done up to 3 months. Moisture and sugar content decreased with storage t...
Zeshan Siraj1*, Amjad Farooq1 and Zahid Mehmood2
...recommended for local farmers to do some control measures to avoid attack of jassids in this month priorly in order to reduce the economic loss,.It was concluded that mid of September was more suitable for incidence of jassids ...
Haidar Ali1, Malik Muhammad Shafi1*, Himayatullah Khan1 and Hamra Haidar2
...arm households (small farmers) in the research area during February 15 to July 27, 2018 by using research tools such as interview schedule or direct observations. Random sampling technique was used for selecting a sample size of 195 small farmers. The present study is focused on two selected districts of Peshawar Valley namely Mardan and Peshawar. Analysis showed that there was a significant difference in the off-farm employ...
Jam Nazeer Ahmad1*, Taiba Sharif3, Samina J.N. Ahmad2, Sumaira Maqsood4 and Fariha Zafar3
...se I (COI) gene based primers. Phylogenetic analysis was also complemented to differentiate fruit flies identified from other countries of the world. The sequencing results and phylogenetic analysis of collected specimens indicated that sequences of B. dorsalis, B. cucurbitae and B. zonata have 99-100% similarity with fruit flies reported from other countries. This is the first report of molecular identification and characterization of Tephritid ...
Rizwan Ahmad and Muhammad Zulfiqar*
... gap by investigating farmers’ perceptions and adaptation about change in climate and impact of change in climate on wheat productivity in Lakki Marwat. A combination of multi-stage sampling and simple random sampling used to select five Union Councils (UCs), one village council from each UC and one village from each village council. Out of 611 households (HHs), 180 head/elders selected through random sampling process were interviewed. The secondary data...
Sanaullah and Urooba Pervaiz*
...in the empowerment of farmers and increasing crop yield in the study area. The study recommends need based trainings for growers, availability of credit/loan facilities, provision of subsidized inputs and irrigation water in the study area. ...
Zara Ahmad1*, Fazli Rabbi2, Muhammad Zamin3, Bushra Kiran2, Tariq Shah2 and Shahzad Kouser4
... from a sample of 110 farmers in the district of Faisal Abad, Punjab Pakistan. The data was analysed using Ordinary Least Square (OLS) technique. The results show that there is a significant difference between the on-season and off-season application of pesticides to bitter guard crop. The results clearly reveal that bitter guards’ yield is significantly higher in the off-season than on-season. It was also found that off-season bitter guard fetches 66% h...
Naveed Afsar* and Muhammad Idrees
... was done to know the farmers perceptions about agricultural extension services in disseminating climate change knowledge in Khyber Pakhtunkhwa. Data was collected from the 400 farmers of the two purposively sampled districts as these two were the highly vulnerable areas from climate change. The major source of climate change information of the majority of farmers was electronic media and ...
Syed Muhammad Hassan Raza1*, Syed Amer Mahmood1, Syeeda Areeba Gillani1, Syed Shehzad Hassan1, Muneeb Aamir1, Muhammad Saifullah1, Mubashar Basheer1, Atif Ahmad1, Saif-ul-Rehman2 and Tariq Ali1
...aluate accurately for farmers. This research was conducted in eastern Punjab Pakistan by incorporating yield/area as reported by Crop Reporting Service Department along with open source satellite datasets. We downloaded three images of each year (2008-2018) from Geological Survey of United States and applied geometric corrections. All the spectral wavelengths were transformed to Top of Atmosphere reflectance and processed the bands in infrared and red waveleng...
Mustasim Famous*, Obaidul Islam, Shameema Khatun, Mohammed Mustafizur Rahman and Tania Ferdoushi
...as taken of status of farmers, source of technical support, the turkey flock size (according to age variation), feed intake, housing system, feeding system, quantity of feed supplied to each turkey/day, floor space, feeder space, waterer space uses in turkey marketing age, weight, price of turkey. Among 6 farms only 66% of farms maintain a common vaccination schedule, other farms use only new-castle disease vaccine. Most of the turkey far...
Muhammad Ali1*, Norsida Man2 and Farrah Melissa Muharam2
...ms on ICT usage among farmers for the management of agricultural risk in Malaysia. Therefore, the present study was designed to meet the objective. The research data were collected through a field survey in which 360 farmers were interviewed through the multistage cluster sampling technique. The subjective norms were measured through 5 points Likert scale (ranging from 1 as strongly disagree to 5 as strongly agree) based sta...
Zia-ud-Din1, Muhammad Nauman Aftab2, Tanveer Hussain3,*, Irfana Iqbal4 and Asma Zafar5
...eholds and commercial farmers are suggested to prefer Mushki variety of Aseel chicken as attempt to produce Aseel females and probiotic supplementation would be of high economic viability for such flocks.
...
Ihsanullah*, Muhammad Subhan Qureshi, Sohail Akhtar and Syed Muhammad Suhail
... finding may help the farmers in culling of the lactating cows to maintain an optimum herd average for milk production.
...
Ejaz Ashraf1*, Hafiz Khurram Shurjeel2, Umar Mumtaz1, Muhammad Zafarullah Khan3 and Abdul Naveed4
...perceptions of senior farmers for their advisory role in capacity building of young farmers in Sargodha district-Punjab, Pakistan. As per list obtained from District Officer Agriculture Extension, Sargodha, tehsil Sahiwal was randomly selected. Sahiwal comprises of 17 union councils; four union councils were randomly selected and two villages per union council were randomly selected. The list of potential old aged far
Faheem Aslam1*, Aneel Salman1 and Inayatullah Jan2
... great importance for farmers and agriculture policy makers to improve production planning decisions. Numerous studies proved that traditional econometric techniques face significant challenges in out of sample predictability tests due to model uncertainty and parameter instability. Recent studies introduce several machine learning algorithms to improve time series prediction accuracy. The purpose of this study is to develop a precise wheat production mod...
Muhammad Nisar* and Muhammad Idress
...ic benefits for small farmers. Home gardening also called kitchen or homestead gardening. Home gardening study is necessary not only due to its social, food security and economic contribution, but its consideration’s negligence in development agendas. Home gardening data provide complete agricultural input in a nation’s domestic treasure. Therefore, the current study was carried out with the objective to assess small farmer...
Muhammad Qasim1*, Said Qasim2, Muhammad Naeem1, Amir Nawaz Khan3 and Shahid Iqbal4
...ming fishers, fishing farmers and occasional fishers, through two stage cluster sampling. Livelihoods asset pentagons were used for the analysis. Considerable decline in physical and economic assets were noted among all the three types of fishers, whereas the total value of livelihood assets for farming fishers deteriorated from 0.40 in 2001 to 0.33 in 2016. The study recommends that concerned authorities should take initiative to create awareness regarding co...
Beenish Zahid*1,2,7, Javed Iqbal Qazi2, Amir Zohaib2, Asim Aslam3, Raheela Akhter3, Haleema Sadia4, Qurat ul Ain5, Razia Sultana6, Irfan Irshad3 and Sobia Alyas7
...ied by using specific primers of reverse transcriptase-polymerase chain reaction (RT-PCR). Out of 50 field samples 11 cloacal swabs (34%), were positive and out of 50, nine oropharyngeal swabs (18%) were positive for NDV through RT-PCR. DNA sequencing was performed by amplifying the RT-PCR amplicon targeted the F gene. Phylogenetic tree was constructed. It was concluded that virulent strains were existed in ducks and more than one genotype of NDV was prevalent...
Muhammad Abdul Rahman1*, Abdul Saboor1, Gulnaz Hameed1, Ghulam Bilal2 and Farooq Tanwir3
...all, medium and large farmers. Input price mechanism, regularization of dairy sector, separate policy measures for meat and dairy animals and preservation of local breeds are few optimistic policy options to safeguard Pakistan’s dairy production system from environmental factor under climate change. ...
Muhammad Azam Niazi1* and Umar Farooq2
...veness of the Basmati farmers to various stimuli is important for the policy makers to plan resource allocation and output of Basmati rice. Supply response analysis was carried out to quantify the response of farmers to price and non-price factors. Most of the literature on supply response of crops in Pakistan has relied on the assumption that the data series used for analyses were stationary while most of time series are in...
Hina Fatima1*, Abdul Jabbar2 and Khurram Nawaz3
...vey of 430 wheat crop farmers was conducted in the district of Rahim Yar Khan in year 2014. In order to estimate the impact of farm inputs on wheat crop production, Stochastic Frontier Analysis (SFA) was used. The major objectives of this survey were to identify factors of variation and effect of planting of wheat after BT and Non-BT-cotton varieties on wheat production. In this study, the average technical efficiency of wheat farms on collective level was aro...
Hala Rajab1, Muhammad Sayyar Khan1*, Safdar Hussain Shah1 and Syed Mehar Ali Shah2
... NtSAT4 gene specific primers. The positive transgenic lines were successfully acclimatized to soil and glass house conditions. The developed transgenic lines have the potential to overproduce high levels of cysteine and glutathione for enhanced stress tolerance especially against heavy metals. ...
Jahangir Khan*, Syed Attaullah Shah, Khurram Nawaz Saddozai, Muhammad Fayaz, Shahid Ali, Abbas Ullah Jan and Ghaffar Ali
... study investigates consumers’ preferences and estimate willingness to pay for different quality attributes of apple in Peshawar district of Khyber Pakhtunkhwa. A sample 150 apple consumers were interviewed at different fruits retail shops to collect data on apple varieties, prices and quality attributes, such as color, size, shape, freshness and external defect. The data were analyzed using hedonic pricing model. Resu...
Yousaf Noor*, Zahir Shah and Muhammad Tariq
...areous soils at three farmers fields in Dubandai and Palai area of District Malakand of Khyber Pakhtunkhwa, Pakistan during 2009-2010. A randomized complete block experiment with split plot arrangement was used. Methods of application (Soil and Foliar) were assigned to main plots while micronutrients (Zn @2.5 kg ha-1, B @ 2.5 kg ha-1 and Zn plus B) were kept in subplots. The results showed that Zn, B and Zn + B and their methods of application significantly af...
Raheel Saqib1*, Muhammad Luqman2, Iqbal Javed3, Abdur Rehman4, Muhammad Yaseen2, Saleem Ashraf5 and Muhammad Zeeshan Majeed2
...tegies of small-scale farmers in rain-fed areas of Pakistan. The targeted area of the study was Potohar region of the Punjab Province. Quantitative data were collected from 200 households and analyzed by using SPSS. Results highlighted that the situation of livelihood assets possessed by the respondents was not satisfactory. Majority of the households had limited human, financial, physical, social and natural capitals. In the scenario of climate change, househ...
Shahid Ali1*, Farhan1, Murtaza1, Neelum Andaleeb2 and Amjad Ali1
...partment should train farmers to improve their farming skills and provide them formal as well as informal education to enhance the technical efficiency of wheat growers. ...
Muhammad Israr* and Noor Khan
...ntre (FSC) program on farmers’ adoption of improved wheat seed technology in Khyber Pakhtunkhwa province of Pakistan. A sample of 336 wheat growers, consisted of equal number of FSC registered and non-registered farmers, was selected from Northern, Central and Southern climatic zones of Khyber Pakhtunkhwa. The selected wheat growers were interviewed for data collection. Binary Logistic regression analysis was conducted...
Ankur Abrol, Madhumeet Singh, Akshay Sharma* and Pravesh Kumar
...onsiderable impact on farmers economically. From a clinical frame of reference, the etiology of dystocia is either of maternal or fetal origin although the exact etiology is multifaceted. Uterine torsion is considered as one of major contributors among the maternal causes. This condition exerts considerable stress on the animal and if not treated promptly, it can lead to deterioration of liver and kidney functions resulting in toxaemia followed by dam as well ...
Urooba Pervaiz1*, Madeeha Iqbal1 and Dawood Jan2
...e required sample, 80 farmers were randomly selected from five villages and data were collected through interview schedule. It was found that majority farmers were literate up to middle; young farmers showed more positive attitude towards extension recommendations, 93% farmers knew extension workers both by name and face and also knew extension recommend...
Shazia Akhtar1, Abdul Samad1*, Afshan Gohar1, Muhammad Munir Shahid2, Muhammad Ishtiaq1, Arslan Sarwer1, Adnan Khan1 and Karam Ahad1
...le the pesticides for farmers in peach orchards of Swat, Malakand Division. There should also be monitoring of the health status of farm workers. ...
Fayyaz Hussain*, Raza Ullah Khan, Asim Hayat, Humair Ahmed and Ahmad Khan
...nts were conducted on farmers field at two locations aimed at exploring the response of phosphorus (P) applied to rice at different growth stages.Phosphorus was applied in three interval i.e. at transplanting (0 DAT), 15 days after transplanting (15 DAT), and 25 days after transplanting (25 DAT), in addition to control (no P), and farmer fertilizer practice (FFP).Results show that mean paddy yield across both sites range from 2.972 to 4.334t ha-1, and maximum ...
Bibi Nazia Murtaza1, Mazhar Saeed Chaudry2, Shamaila Inayat Nadeem1, Muhammad Shahid Nadeem3 and Abdul Rauf Shakoori4,*
...t the 3′-end of primers to produce a BstNI recognition sequence at codon 12 while codon 13 was analysed by introducing HaeIII recognition sequence. By using RFLP and sequencing, point mutation substituting the glycine (GGC) to aspartic acid (GAC) was observed at codon 13. The p.G13D or cDNA.230G>A/ g.5590G>A is previously recognized as rs112445441 and being reported for the first time in NHL. By in silico analysis, it is anticipa...
Monica Paula Marin1, Elena Narcisa Pogurschi1*, Iuliana Marin2 and Carmen Georgeta Nicolae1
...e selection done by consumers. The natural, less expensive methods for improving the milk quality are the most studied by farmers and researches. Clinoptilolite, natural zeolite added to dairy cows diets, has been proven to be an efficient and economic solution. Starting from the fact that natural zeolites are recognized as having beneficial effects on the animal organism, being detoxifiers, immunomodulators, regulators of t...
Muhammad Bakhtiar Khan1 and Jangraiz Khan2*
... been adopted by many farmers. However, growing off-season vegetables in tunnels entails added efforts and cost. Through this research study the economic analysis of Tunnel farming of off-season vegetables has been done for district Peshawar. Primary data was collected from eighty-four farmers who had grown off-season vegetables through tunnel-farming, and seasonal vegetables without tunnel and their productivity were compar...
Majid Khan, Naveed Jehan*, Muhammad Zahoor and Nadia Naz
...uestionnaire from 159 farmers. Monthly farmers’ income was calculated from the total crop and non-crop income. The results revealed that the poverty ratio and Poverty Gap index were 8.3 percent and 0.016 percent for the Virginia tobacco growers and 42.52 percent and 0.076 percent for the non-tobacco growers, respectively. This shows that the Virginia Tobacco growers poverty status was better. Therefore, tobacco is reco...
Asif Yaseen1, Muhammad Israr2*, Allah Bux Khan1, Ahsan Javed3, Nafees Ahmad4 and Zia Ullah5
... analyzing smallholder famers’ selection of high value marketing channels to boost self-sufficiency in the Pakistani Citrus industry, and second, to identify the issues of greater importance pertaining to famers’ selection of high value market channels in the Pakistani citrus industry. The study employed survey technique to collect data from 300 citrus farmers in Punjab, and mu...
Rakhshanda Kousar1, Muhammad Sohail Amjad Makhdum2, Raza Ullah1, Aqeela Saghir3, Sohaib Usman3* and Tahira Sadaf1
...re collected from 120 farmers of rural area of Faisalabad. This study calculated the extent of land fragmentation by using Simpson index. Production function was employed to estimate the impact of land fragmentation on the crop productivity. The results suggested that higher the land fragmentation of the farms, negative is the impact on the productivity. The findings of the study have important implication for formulating of efficient land use policy.
Gulfam Hassan1*, Ijaz Ashraf2, Muhammad Qavi Irshad3, Shafiq-ur-Rehman Zia2 and Muhammad Idrees4
...world as it helps the farmers to access inputs and market outputs easily. Lack of sufficient training and low technical efficiency are some common barriers in low productivity of vegetables in Pakistan. This study assesses strengths and weaknesses of trainings conducted by public sector extension in peri-urban areas of Faisalabad, Pakistan. Two hundred and eight vegetable growers were interviewed using a validated and reliable interview schedule. Findings reve...
Saara Ahmad1,*, Iftikhar Ahmed2, Saida Haider3, Zehra Batool4, Laraib Liaquat3, Fatima Ahmed5, Asra Khan1, Tahira Perveen3, Mirza Jawad ul Hasnain6, Saima Khaliq7 and Saad Bilal Ahmed8
Saba1, Shahnaz Akhtar1, Waqar Khalid2* and Saifullah Khan3
...m sample of 110 women farmers from the union council of village Shewa, and a well-structured questionnaire was designed to accumulate the primary dataset from rural women through face to face interviews. A women’s participation index was designed to compute the degree of women’s involvement, and a multiple linear regression model was proposed to measure factors influencing women’s participation in livestock management practices. The computed ...
Nihat Yeşilayer*
...olour demand of the consumers. This study showed that SalmoFan CardTM scores could be practical and reliable tool for Salmonid farms as compared to other methods.
...
Nadeem Munawar1,2*, Tariq Mahmood2, Paula Rivadeneira1, Ali Akhter2 and Saqib Mehmood2
...ng crop season, local farmers in the Pothwar agro-ecosystem in Pakistan do not manage wild vegetation on the field edges, and that may impact rodent populations near their fields. This study was conducted to examine the effect of adjacent non-crop vegetation on rodent populations in the Pothwar agro-ecosystem in Pakistan. Over 14 months, vegetation analysis was conducted using the quadrate method to record the vegetation around rodents’ active burrows at...
Su-Hu Duan, Liu-An Li*, Zai-Qiang Li, Meng-Ran Qin, Zhen-Zhen Fan, Qian Wang, Ke-Yan Zhang, Zhong-Mou Zhang, Bai-Liang Yang and Tian-Ming Jin
...tical reference for customers for selection of eggs.
...
Haidar Ali1*, Malik Muhammad Shafi1, Himayatullah Khan1 and Hamra Haidar2
...sis showed that small farmers of developed villages perform more off-farm employment than small farmers of underdeveloped villages. This could be associated to the developed means of transport and communications, better education facilities, market facilities as well as availability of off-farm jobs locally. Furthermore, in developed villages average per month income of small farm households from farm output was higher than ...
Sanaullah1*, Urooba Pervaiz1, Shahid Ali2, Mohammad Fayaz2 and Aftab Khan2
... subsidized to enable farmers apply recommended quantities of these inputs for getting the optimum yield. Extension department needs to introduce improved farming practices among farming community to achieve higher maize yields. ...
Kanwal Nisa1, Sadaf Ashraf1, Masood Ahmed Siddiqui1*,Naila Taj1, Habib-Ur-Rehman1, Arifa Bano1 and Naeem Rashid2
...as a dimer of heterotetramers (αβɣδ)2 with molecular masses of 44, 36, 20 and 12 kDa, respectively. Both of the activities were oxygen sensitive. The apparent Km values for POR reaction towards pyruvate and CoASH were 0.49 µM and 115 µM, respectively, while for PDC reaction values these values were µM 0.34 and 42 µM. To the best of our knowledge this is the first report on purification and ...
Amna Shoaib*, Zoia Arshad Awan and Naureen Akhtar
...ndash;5.8S–ITS4 primers sequence and amplification of ISSR nucleotide sequences using three primers [P01 (AGAG)4 G, P02 (GTG)5, and P03 (GACA)4] confirmed that A. minisclerotigenes and A. flavus are two genetically distinct strains. Furthermore, both strains were qualitatively analyzed for aflatoxins (AFB1 and AFB2) production by thin-layer chromatography (TLC). A polyphas...
Veli Sel1, Isa Yilmaz2,* and Mete Yanar3
...ducation level of the farmers and the effect of the milker on the SCC were found to be significant (P <0.001). SCC value (65.930 ± 2.484 cells/ml) was found to be the lowest when the milker is the person from the household. The udder cleaning before milking was a significant factor (P <0.001), SCC was 66.330±2.570 cells/ml for the producers that applied hygiene and was 125.860±9.500 cells/ml for the ones that did not. Season was dete...
Meriem Msaad Guerfali1,*, Heitham Hamden1, Salma Fadhl1, Wafa Djobbi1, Lotfi Sillini1, Wafa Marzouki1 and Mohammed Ammar2
...rvey carried out with farmers and to give precise informations about treatment management state. Surveys and sampling of the wild strain of Ceratitis capitata were conducted in several regions to learn about the nature and number of treatments. The samples were subjected to ingestion toxicity bioassays of malathion and spinosad at different concentrations. Histopathol...
Ihsanullah Kakr1, Sarwar Khan2, Khalid Khan3* and Sajjad Ahmed1
...d for survey of Camel farmers and information regarding the age of respondent, experience, type of community, feeding/watering pattern of camels, prevailing camel diseases in the area, treatment facilities, traditional remedies used by them against various diseases in camels and economic losses were collected. A total of one thousand and forty (n=1040) camel owners/respondents from three groups viz settled, transhumants and nomads were interviewed in Districts...
Arjumand Nizami1, Muhammad Zulfiqar2*, Jawad Ali1, Naushad Khan2 and Imran Sheikh3
...ogy by the respondent farmers. The data were collected from the three selected villages using focused group discussions and individual interviews of 21 beneficiary rice producers. Out of 21 farmers, 7 farmers were selected each from head, middle and tail of the water channels located at Joyianwala, Saikhum and Kathianwala villages. The baseline data were collected in July 2017 while post t...
Bahadar Sher Khattak1, Muhammad Kaleem1, Waqas2*, Humaira Naz1 and Muhammad Yasir3
...nditions of the small farmers through various agricultural interventions. One of the important and essential interventions of CMP was micro-credit facilities to small farmers. The current research study focused on the core objective of the CMP aimed at finding out the effect of micro-credit intervention on small farmers and how their socioeconomic status improved during the span of the pro...
Aftab Khan1, Shahid Ali1*, Asim Khan1, Muhammad Waqas1 and Sufyan Ullah Khan2
...significant effect on farmers’ inefficiency. It is recommended that maize farmers need to be provided with formal as well as informal education, agricultural trainings and credit on easy terms for purchase of costly inputs. ...
Muhammad1*, Muhammad Suleman Bacha2 and Syed Akhtar Ali Shah1
...cing factors of urban farmers’ Willingness to Pay (WTP) for organic fertilizer in District Mardan, Pakistan. The Contingent Valuation Method (CVM) was used and data were randomly collected from 384 heads of the household of urban farmers. Data was set in SPSS software version 22.0 and analyzed using descriptive statistics and Logit Model. The study revealed that a major proportion (62.5%) of solid waste is generated fr...
Samia Afzal*,Sadia Zahid, Iram Amin, Muhammad Shahid and Muhammad Idrees
...Two different sets of primers were used for the identification of the viral genome. Thirty samples were found PCR positive and a subset of ten samples was direct sequenced. Sequence analysis showed 94% similarity to Stenotrophomonas maltophilia which is considered to be the second most prevalent bacterial species in mosquitoe’s midgut. This observation may lead towards the confusion that the outbreak is either of Dengue or Chikunguna virus. ...
Wen Qin1,2, YanGan Huang1, Lei Wang1, Gonghua Lin1, Jundong Yang1,2, Pengfei Song1,2, Hongmei Gao1,2, Jingjie Zhang1,2 and Tongzuo Zhang1,3,*
...winters to short, hot summers. The gut microbiota plays a very important role in host health, immunity, and digestion. Therefore, seasonal changes in gut microbiota can affect host digestion and metabolism in ways that help the host adapt to different forage conditions. Understanding the relationship between seasonal variations in the gut microbiota and host adaptability is a good basis for the protection of the goitered gazelle. Here, we present our findings ...
Amjad Ali1*, Lal Almas2, Syed Attaullah Shah1, Hina Fatima3 and Asim Khan1
...d to keep experienced farmers involved in sugarcane production, because of positive relationship between grower’s experience and technical efficiency. ...
Saeed Fatima1, Khalid Javed Iqbal1, Usman Atique2,3*, Arshad Javid4, Noor Khan2, Sonia Iqbal2, Hamid Majeed5, Hamda Azmat2, Bakhat Yawar Ali Khan6, Irfan7, Muhammad Tausif Shahid1, Gulnaz Afzal1
...in the fish and its consumers, therefore, it is not safe to consume these studied fish species from Head Punjnad.
...
Muhammad Shakeel1,2*, Salik Nawaz2, Yasar Saleem3, Shazia Shafique2, Ateeq Tahir2 and Muhammad Riaz2
...mabad. A total of 167 farmers and amateurs growers, engaged in the cultivation of high value or medicinal crops were contacted. Out of these, 68 found as broccoli growers and most probably due to shyness only 37 contributed in data collection process. In the perspectives of health-promoting properties of broccoli 62% were unaware of health benefits and 7% aware of beneficial properties against heart diseases. In case of selection of varieties 37% were unaware ...
Muhammad Jamal Nasir*, Anwar Saeed Khan, Said Alam and Riyasat Sultan
... before the onsets of summers, but today in Utla out of total 745 households, only 40 households practice seasonal migrations. Though seasonal migration in village Utla is as old as the village by itself, it is on decline. The field survey suggested that Decrease in the number of Livestock, increasing Employment opportunities, availability of dairy products in the market etc. are the most important causes contributing to the decline of seasonal migration. A ve...
Umar Hayat1, Khalid Khan2, Saima Liaqat3 and Guo Xiangyu4*
...al areas of Pakistan, farmers do not utilize all available resources efficiently. Therefore, it leads to inefficient choices which subsequently affect the production. This study evaluated determinants of rice production in the district Nasirabad, Balochistan by employing Neo-Classical and Cobb-Douglas production functions. The findings of the study show that education, fertilizers, rent, training and total area under the rice crop (wetland), labor, capital, av...
Muhammad Usman Saleem, Nadeem Iqbal, Shawaiz Iqbal*, Usama Bin Khalid, Adila Iram, Muhammad Akhter, Tahir Latif and Tahir Hussain Awan
...or-intensive and more farmers-friendly, time-saving and cost-effective technology than TPR. The Rice Research Institute, Kala Shah Kaku, has refined the DSR technology and production practices and conducted 20 field demonstrations of DSR with modified seed drills during 2017 in Gujranwala, Hafizabad, Narowal, Sheikhupura, and Sialkot districts. The super basmati rice variety was direct seeded in comparison with manually TPR. The DSR was carried out in well pre...
Khalid Khan* and Guo Xiangyu
...n and training of the farmers can significantly improve the technical efficiency. In other words, the extension department of Balochistan should take a step to provide all the necessary training and consultation to the farmers to improve the technical efficiency of the rice producers in the district. ...
Fazal Haq*, Asia Parveen, Safdar Hussain and Arshad Hussain
...m the random selected farmers were used as a tool for collecting primary data. The raw data is tabulated and analyzed using Microsoft Excel. The analyzed data is used to develop the mathematical model. Simplex method is applied to find the optimal solution of the model, which showed 10.18% increase in the net revenue per year. ...
Dil Afroza Khanom1, Amirun Nesa1, Muhammad Abu Sayed Jewel1, Muhammad Ayenuddin Haque1, Alok Kumar Paul1, Sonia Iqbal2, Usman Atique2,3*, Lubna Alam4
...genic threat to the consumers. In conclusion, this study provides useful insights into the identification of potential risks of these commercially valuable fishes to the continuous consumption of fish flesh originating from a contaminated water body may lead to heavy metals toxicity leading to mental retardation, kidney tissue damages, cancerous cell growth, and even death in case of chronic exposure.
Arshad Farooq1*, Muhammad Zafarullah Khan2, Abdul Hassan1, Muhammad Ishaq3 and Asif Nawaz2
...ind the influences of farmers’ characteristics on knowledge gap of sugarcane recommended production management practices in the research area. Data were collected personally through face to face interview schedule from 285 sample respondents randomly selected from eight villages of the eight selected union councils. The empirical results indicated that farmers of district Mardan had 41 percent knowledge gap with cane y...
Muhammad Ali1*, Norsida Man2, Farrah Melissa Muharam2 and Siti Zobidah Omar3
...havioral intention of farmers to use ICTs for agricultural risk management. The past research reveals that many researchers had tried to determine factors affecting behavioural intentions of the respondents and TPB has been applied as technology acceptance model in various contexts. However, predicting behavioral intentions to use ICTs for agricultural risk management has not been evaluated from the actual field. Therefore, the data were collected from 360 far...
Shah Nawaz Khuhro1*, Irshad Ali Junejo1, Muhammad Haroon Hullio1, Mohammad Farooque Hassan2, Sultan Ahmed Maitlo3 and Mukhtiar Ahmed Shaikh4
...on targeted vegetable farmers in three Districts Shikarpur, Larkana, and Dadu of northern Sindh, Pakistan. The effect of pesticides on human health and the environment is a main public health issue in Pakistan. These negative effects of pesticides can be minimized by awareness to the growers focusing more on alternative methods for sustainable crop production and by reducing the use of pesticides and trainings on pest counting helps in sustainable pesticide us...
Md. Zubael Islam, Rukhsana Amin Runa and Md. Mahmudul Alam*
... to foot diseases the farmers face a considerable amount of economic loss. The study was carried out to determine the prevalence of foot diseases in cattle and also to explore the risk factors having a promoting role in developing foot affections in three unions (Potazia, Jalalpur, and Kaijuri) of Shahjadpur Upazila. Foot affections were physically investigated and examined from May to October 2019 and a total of 257 surgical affections were recorded, among th...
Anurag Sharma*, Naresh Kumar, Geetanjali Singh and Anika Sharma
...urce-poor smallholder farmers. This article is a review of present literature data of Fenugreek and Giloy as potential nutraceuticals and galactagogue in animal husbandry. Both these herbs are known to have pharmacological effects which include hypoglycemic, hypo-lipidemic, antidiabetic, hepato-protective, anti-carcinogenic, anti-inflammatory, antibacterial, antifungal and galactagogue activity. The commercially available drugs pose health threats and prove de...
Zia-Ur-Rehman1, Faisal Sohail Fateh2*, Humayun Saleem1 and Muhammad Abu Bakar Siddique1
...l it reaches to the consumers. ...
Muhammad Abu Bakar Siddique1, Faisal Sohail Fateh2*, Zia-Ur-Rehman1 and Humayun Saleem1
...hat in Pakistan the consumers do not consider it as a threat, because it remains in potato peel only. ...
Muhammad Raheel Faiz1, Ijaz Ashraf1, Haq Nawaz2, Muhammad Zubair3*, Muhammad Sajid Mahmood4, Sajid Hussain5 and Abdul Qadeer2
...ensively grown by the farmers. There were total 58 rural union councils in Faisalabad Sadar, out of which 6 were selected through simple random sampling. From each selected union council, one village was selected at random and from each selected village, 20 vegetable growers were selected randomly thus making a sample size of 120 respondents. A well-planned interview schedule was prepared for the collection of data from the selected respondents. The survey sho...
Khalid Khan1, Marguerite Wotto2, Saima Liaqat3, Gulawar Khan1, Balach Rasheed1, Sara Rafiq4 and Guo Xiangyu5*
... for selection of the farmers. The Cobb-Douglas production function was used to estimate the technical efficiency and performance of the farmers. The study results disclosed that all explanatory variables have a positive impact on the farmers’ technical efficiency apart from pesticides. Additionally, the average technical performance of the farmer was 85% which shows that on average ...
Paul Oludare Adetunji* and Safiriyu Idowu Ola
...w to helping both the farmers and breeders in selecting the best performing variety for rearing and further genetic improvement. Eighteen cockerels of three plumage colours (brown, black and barred) were divided into 2 replicates with 3 birds per replicate. The study lasted for 38 weeks (Feb.-Nov., 2019). Data were taken on the onset of puberty parameters (age at first sperm cell and puberty) from 16-22 weeks of age, semen quality parameters (semen volume, sem...
Salman Khan, Irfan Ullah*, Shahid Ali and Murtaza
...and thereby profit of farmers....
Abdus Salam* and Muhammad Zafarullah Khan
...mpare and analyze the farmers’ perceptions regarding use of information and communication technologies (ICT) in agriculture extension at three selected districts of Khyber Pakhtunkhwa. Based on the multi-stage sampling technique, population for the current study, 3 zones from 5 were purposively selected on the basis of their different agricultural condition. Selection of sample size was made using Yamane formula. The number of respondents as per formula ...
Kemi F. Omotesho*, Adedamola V. Adetayo, Adeniyi F. Akinrinde and Deborah A. Olabode
Challenges to the Adoption of Agricultural Innovations: The Case of Yam Minisett Technology in Kwara State, Nigeria
...ints faced by adopter farmers in its use. The determinants of farmers’ adoption were also investigated. A four-stage sampling procedure was used to select 205 respondents on whom an interview schedule was administered. Descriptive statistics, Probit Regression Analysis and Pearson’s Product Moment Correlation, were used to analyse data. Result reveals that the farmers were most...
Hina Fatima1*, Sania Shaheen2, Lal Khan Almas3 and Sehrish Haroon4
Profit Efficiency among Transplanting and Direct Seeded Rice Producers (Case Study of Certain Rice Growing Areas of Province Punjab, Pakistan)
...imated with data from farmers belonging to various districts of Punjab. Gujranwala, Hafizabad, Sheikhupura, Jhang and Sialkot are the major rice producing areas of Punjab. The primary data is collected from the above mentioned areas through random sampling. Stochastic Frontier Analysis (SFA) serves as a tool of obtaining reliable estimations of profit efficiency of rice production. Findings from SFA reveal profit efficiency of rice far...
Muhammad Naveed Anjum1, Abdur Rehman1*, Muhammad Niamatullah Khan1, Raheel Saqib2, Mohammad Fayaz3 and Iqbal Javed4
Impact of Microfinance on Socioeconomic Status of Farmers in District Dera Ismail Khan
...crease in income, the farmers are able to get more access to the health facilities than before. 82.2% farmer’s response indicated that the microfinance have a positive and significant impact on the children’s educational status and due to microfinance their children were moved from government to private schools. Moreover, the parents whose children were not getting their education from the educational institutions due to their financial crisis and ...
Fcroz Shah*~ Mohammad A. Irfan**, Rizwan Gul*~ Abdul Shakoor*
ALGORITHM DEVELOPMENT AND IMPLEMENTATION FOR NUMERICAL DETECTION OF HOT SPOTS IN CASTING GEOMETRY
...h surround- ing edges, comers, curved surfaces, holes etc. of the geometry. These vectors develop a network of triangular segments, which define the boundar...
Farid Ullah Khan*, Sheraz Ali Khan*
A SMART STARTUP AND SHUTDOWN SYSTEM FOR DOMESTIC ELECTRIC POWER GENERATORS
...ay and step down transformers are used in the prototype circuit to control the functions required for startup, shutdown and switching onto and off the electric grid supply. Simulation of the developed system was performed in Proteus software and a prototype system has been implemented and tested with a 3500 W household electrical generator. The system performance has been analyzed for three different fUels i.e. Petrol, Liquefied Petroleum Gas and Natural gas.<...
Naeem Ejaz*, Daulat Khan**, Usman Ali Naeem*, Muhammad Ali Shamim*, Muhammad Fiaz Tahir*, Faisal Shabbir*, Jawad Hussain*
DETERIORATION OF ORDINARY PORTLAND CEMENT AND FLY-ASH BASED GEO-POLYMER CONCRETES DUE TO SULFATE ATTACK UNDER THE ACTION OF SULFURIC ACID AND WASTEWATER
...g, specimens were immersed in three types of sulfate containing solutions to check corrosion.. These sulfate containing solutions include static sulfuric acid, dynamic wastewater and static wastewater. Samples were tested at 28, 45 and 60 days after immersing in different type of solutions to find the corrosion depth. By visual inspection the corrosion depth and residual compressive strength were observed...
Asif Nawaz*, Muhammad Zafarullah Khan, Rehmat Ullah, Khalid Nawab and Urooba Pervaiz
Investigation of Professional Competency Level and Training Needs of Field Assistants in Khyber Pakhtunkhwa
...ability of motivating farmers. Regression analysis showed that rural domicile, job experience, and higher educational level of Field Assistants have positive and significant effect on the development of their competency. Therefore, it is suggested to provide in-service training for the Field Assistants in the identified areas for the adequate acquisition of relevant skills and knowledge....
Fazli Rabbi1*, Muhammad Idrees2, Shahid Ali1, Muhammad Zamin3 and Hazrat Bilal4
Farmers Perceptions and Adoption of Information and Communication Technologies (ICTs) in Peach (Prunus persica L.) Production and Marketing
...ncreasing trend among farmers from apple growing to peach (P. persica L.) production in the Swat valley of Khyber Pakhtunkhwa during the last couple of years. However, these peach growers face various contraints in peach marketing. The farmers are reverting to the use of Information and Communication Technologies (ICTs) to overcome marketing hurdles. This research investigates the farmers&...
Sajad Ali1*, Jangraiz Khan2, Arshadullah Jadoon3, Muhammad Riaz4 and Abid Khan1
Evaluation of Farmers Socioeconomic Characteristics Influencing Tomato Output in District Peshawar, Khyber Pakhtunkhwa, Pakistan
...mically attractive to farmers, due to its short duration for ripping which increases productivity. Thus, it is becoming an indispensable source of farmer’s income in Pakistan. The production of tomato has been decreased considerably during the last five years. The present study has been conducted to explore the farmer’s socio-economic characteristics, affecting the tomato production in district Peshawar, Khyber Pakhtunkhwa, Pakistan. A multi-stage-...
Syed Mufeed Hadi Naqvi1*, Badar Naseem Siddiqui1, Waqar-Ul-Hassan Tareen1, Muhammad Ameer Qarib Naqvi2 and Naseeb Hussain3
Usage of Mobile Phone by Vegetable Growers and its Impact on Vegetable Production
...inancial support five farmers from every village were selected to make a total one hundred and twenty respondents for the study. Most (44.2%) of the respondents of present study were present in middle age group and one out of three (31.7%) of the respondents were young and belong to age group of 15-35 years. Slightly more than one out of four (28.3%) of the respondent were owner-cum-tenant. Majority (76.7%) of them were literate at various level and they used ...
Ejaz Ashraf1*, Hafiz Khurram Shurjeel2, Saima Sadaf1, Adnan Ahmad1, Usman Rafique1 and Muhammad Arshad Javed1
An Assessment of Farmers’ Awareness Level Regarding Integrated Farming System in District Sargodha, Punjab, Pakistan
...IFS helps small scale farmers to increase cash income, improve quality and quantity of food produced by methodical exploitation of resources. Purpose of the study was to assess the awareness of the farmers to determine the impact of integrated farming system (IFS) on agricultural development and improving the livelihoods in the study area. To accomplish these objectives, an interview schedule was developed as a research inst...
Ejaz Ashraf1*, Hafiz Khurram Shurjeel2, Saima Sadaf1, Adnan Ahmad1, Usman Rafique1 and Muhammad Arshad Javed1
An Assessment of Farmers’ Awareness Level Regarding Integrated Farming System in District Sargodha, Punjab, Pakistan
...IFS helps small scale farmers to increase cash income, improve quality and quantity of food produced by methodical exploitation of resources. Purpose of the study was to assess the awareness of the farmers to determine the impact of integrated farming system (IFS) on agricultural development and improving the livelihoods in the study area. To accomplish these objectives, an interview schedule was developed as a research inst...
Asadullah Saleem* and Nadeem Ehsan*
STATUS OF PERFORMANCE MEASUREMENT SYSTEMS IN INFRASTRUCTURE CONSTRUCTION FIRMS OF PAKISTAN
...ers like employees, customers and suppliers. Further the system design is marred by short-termism and less attention is paid to non-financial
performance drivers necessary for achieving long term goals.
...
Faheem Ali1, Muhammad Amir1, Muhammad Iftikhar Khan1, Muhammad Naeem Arbab1, Abdul Basit2, Muhammad Kashif Khan1, Gulzar Ahmad1
AN SVC BASED POWER QUALITY IMPROVEMENT MODEL FOR CONSUMERS CONNECTED TO WEAK BUSSES IN DISTRIBUTION SYSTEMS
...y, residential consumers go with voltage stabilizers as a cheap solution consequently overstressing weak busses. Industrial consumers use other alternatives like switched capacitor banks to cope with low power factor but the limitation is step-wise reactive power injection which does not meet the changing load requirements. Real time improvement requires constant monitoring and real-time injection of Volt-Ampere-Re...
Uzma Nawaz1*, Muhammad Iftikhar Khan1, Muhammad Naeem Arbab1
TECHNO-ECONOMICS OF UPS SYSTEM AS BACKUP POWER SOURCE DURING LOAD SHEDDING
... forced electricity consumers to use backup power sources based on portable generator sets and Un-interrupted Power Supply (UPS) devices. In order to maintain continuity of supply to basic appliances such as lights and ceiling fans, the majority of consumers use UPS with battery backup due to its less initial cost compared to portable generator sets. Following the increased use of battery based UPS as bac...
Mohammad Enamul Hoque Kayesh1,2*, Mohammad Tufazzal Hussan3, Md. Abul Hashem2,4, Mohammad Eliyas5 and A.K.M. Mostafa Anower1
Lumpy Skin Disease Virus Infection: An Emerging Threat to Cattle Health in Bangladesh
...esh, and necessity of farmers’ awareness building and telemedicine service during the Coronavirus disease 2019 (COVID-19) outbreaks in controlling LSD....
Zakeer Ahmed Khan Abbasi* and Allah Nawaz
...han those employed by farmers in the developing countries like Pakistan. The climate change awareness obviously determines the nature, quality and strength of climate change adaptations. The current study measures the impact of climate change awareness on climate change adaptation and climate change adaptation issues (constraints) and their interactions to help in addressing the native agricultural issues emerging from global climate change. The statistical an...
Abdul Waheed*, Asim Faraz, Hafiz Muhammad Ishaq
Oluwatoyin Olagunju1* and Luqman Abiodun Akinbile2
Farmers Perceptions of the Effect of Rural Transportation Systems on Farming Income in Ondo State, Nigeria
...sportation systems on farmers’ income in Ondo State, Nigeria. A structured interview was used in eliciting information from 120 farmers in rural communities across the two local governments in the study area using a two-stage random sampling technique. Data used for the study were analyzed using descriptive statistics and inferential statistics such as chi-square and Pearson Product Moment Correlation (PPMC). The study...
Jam Nazeer Ahmad1,*, Samina J.N. Ahmad1,2,*, Mubashir Ahmad Malik1, Abid Ali1, Muhammad Ali3, Ejaz Ahmad1, Muhammad Tahir2 and Muhammad Ashraf2
...se I (COI) gene based primers. Gel electrophoresis of the PCR products of desert locustsindicated a 710bp amplified DNA fragment on 1.5% agarose gel. DNA sequence analysis of PCR product indicated that specimens shared a 99-100% identity with Schistocerca gregaria gregaria)(Forskål, 1775). Molecular phylogenetic analysis and evolutionary divergence study also revealed the formation of same cluster in phylogenetic tree with that of specific subspec...
Shahzad Malik* and Ayesha Khan
Gap Analysis of Farmers’ Capacity Building by Public and Private Agriculture Extension Sectors in Central Plain Valley of Khyber Pakhtunkhwa, Pakistan
... capacity building of farmers by public and private agriculture extension sectors. Three districts namely Peshawar, Mardan and Charsadda were selected purposively. In order to carry out the research, in the three districts of Peshawar, Mardan and Charsadda one tehsil was selected from each district i.e. Town-4 from Peshawar, Takhtbhai from Mardan and tehsil Charsadda from district Charsadda. Sample size for the present study was 270 respondents i.e. 90 respond...
Muhammad Jawad1*, Shahid Riaz Malik1, Rana Muhammad Atif2, Haris Ahmed2 and Muhammad Shahzad Afzal3
Species Identification of Gram Wilt Complex through ITS Region by PCR-RFLP Analysis
...otein source for poor farmers in the developing countries. Yield and production severely challenged by biotic stresses. Wilt complex is the major biotic factor that contribute significantly in yield loss. Wilt complex is caused by various pathogens, including diverse type of Fusarium species. Molecular approach is a useful technique for the identification of wilt complex pathogens. The study conducted to identify the polygenetic association of the pathogens of...
Murtaza, Shahid Ali*, Syed Attaullah Shah, Mehran Ahmad, Irfan Ullah and Jahangir Khan
Adoption of Hybrid Maize Technology in District Mardan of Khyber Pakhtunkhwa, Pakistan
...revealed that younger farmers were comparatively more adoptive of the hybrid maize technology. Education level, number of adult males involved in agriculture and land holdings of the farmers affected the adoption of the hybrid maize technology positively. The owners as compared to tenants and farmers having main sources of income other than agriculture were having lower probability to adop...
Arif Alam1*, Faridullah2, Ikram Shah1, Shahzad Khan3, Noor Elahi1 and Ehsan Inamullah1
Estimation of Farm Level Technical Efficiency in Maize Production at the High Mountain North Region of Pakistan
...l efficiency of maize farmers was estimated 73.6%. It was inferred that the productivity can be enhanced by reducing the inefficiency from the ecological factors, peasants’ personal characteristics and farming conditions....
Inam Ullah1, Mahfooz Khan2*, Munir Khan2, Himayatullah Khan2 and Azra3
Factors Affecting Different Wheat Varieties Yield in District Peshawar, Khyber Pakhtunkhwa, Pakistan: A Comparative Analysis
... that majority of the farmers were illiterate and do not apply the recommended amount of inputs due to its high prices/lack of availability of irrigation water. It is recommended that respondents should be encouraged to get training from the concerned Agricultural Research Centre in order to apply the recommended amount of inputs. The government should also provide inputs on subsidized rates and make irrigation water available through initiating different proj...
Dilshad Ahmad1* and Muhammad Afzal2
An Empirical Analysis of Economic Efficiency and Farm Size of Cotton Farmers
... efficiency of cotton farmers in southern Punjab of Pakistan. Farm-level allocative, economic and technical efficiency of samples of 240 small, medium and large-scale cotton farmers was estimated using Stochastic Frontier Approach of district Rahim Yar Khan Punjab, Pakistan. Empirical findings of the study indicated that medium farm size cotton farmers were more allocative, technically and...
Yasir Arafat1*, Syeda Nabahat2, Hafiz Ullah3, Afaq Ali Muluk4 and Azra5
An Analysis of Energy Supply and Oil Price Shocks on Agricultural Productivity of Pakistan
...e yield which affects farmers directly. Most of the farmers either use electricity or oil to run the tube well for irrigation, increase in the prices of both electricity and oil affect crop productivity negatively. Consequently, government should provide electricity and oil in subsidized rates to the farmers at the time of cultivation and irrigation....
Shahzad Khan*, Munir Khan, Inayatullah Jan, Mahfooz Khan and Fida Muhammad Khan
Determinants of Sugarcane Yield in District Charsadda, Pakistan
...ire. The selection of farmers was based on proportional allocation technique in the selected villages. For data analysis, profit margin, gross margin and Cobb-Douglas production function were applied. The study found that the per acre profit of sugarcane was 289.82 US$. Labour and fertilizers costs were found major components in the total variable cost. The profit margin was obtained as 37.37%. Empirical results of regression model found seed, farm yard manure...
Sajad Ali1*, Naeem Ur Rehman Khatak1, Iftikhar Ahmad2, Jangraiz Khan3 and Azra4
Impact of Socioeconomic Factors and farm Size on Wheat Productivity: A Case Study of District Peshawar, Pakistan
...educate and train the farmers in order to bring advance techniques or improve theirconventional agriculture practices to increase wheat productivity....
Muhammad Imran1,2*, Shahbaz Talib Sahi1, Muhammad Atiq1 and Amer Rasul3
Brown Leaf Spot: An Exacerbated Embryonic Disease of Rice: A Review
...ultivars) are used by farmers in different field areas of the world. The use of the resistant source is the simple, reliable, operative and cost-effective strategy to control the diseases and maximize the yield in limited time. Due to changing the environmental conditions and appearance of the disease epidemic, the use of fungicides judiciously is the alternate significant method for quick and efficient control of diseases and improving the yield of rice. Whil...
Kubilay Ucar1, Sait Engindeniz1* and Jozef Palkovic2
Risk and Return Analysis of Open-Field Tomato Grown in Turkey: A Monte Carlo Simulation Approach
...oice decisions of the farmers are affected by the risk in price, cost, and yield outcomes. One of the products that are grown in irrigable lands and has high returns is tomato. The aim of this study is to analyze production costs, return and the risks associated with open-field tomato grown in Izmir province of Turkey in 2011-2017 period. Statistical data used in the study have been obtained from FAOSTAT, Turkish Statistical Institute and Turkish Ministry of A...
Mehnaz Safdar and Urooba Pervaiz*
Constraints in Accessing Agricultural Extension Services by Rural Women: Evidence from Khyber Pakhtunkhwa, Pakistan
...tion sources of women farmers and constraints they were facing in carrying out agricultural operations, 128 women respondents from each district were randomly selected and interviewed through pre-designed interview schedule in 2018. Results indicated that 47% respondents were in middle age category (31-40 years), 59% were illiterate, 91% women respondents were married and 75% households were headed by male. It was observed that local fa
Muhammad Umer Khan1,2*, Muhammad Farooq Sabar1, Atif Amin Baig3, Arif-un-Nisa Naqvi4 and Muhammad Usman Ghani1
...cation using specific primers for the control region of mtDNA (covering positions 16024–16569 and 1–576), including the three hypervariable segments (HVS1, HVS2, HVS3). The PCR products were subjected to cycle sequencing and further evaluated through computational analysis. A total of 75 different haplotypes were identified in Shin people; among them, 72 were unique and 3 were shared by more than one individual. This study revealed the predominance...
Asma Rashid Tariq1,2*, Saadia R. Tariq2, Tariq Mahmud1 and Misbah Sultan1*
Selective Capture of CO2 from Mixture of Different Gases using Cellulose Acetate, Polyimide, Polysulfone and some other Polymers based Mixed Matrix Membranes: A Review
... number of different polymers have been employed for the fabrication of mixed matrix membranes for example cellulose acetate, polyimides, polysulfone, pebax, polybenzimidazole, polymer of intrinsic porosity, polyurethane, chitosan and many more. Likewise, along with other fillers, Metal organic frame works have also been tested as additive for the mixed matrix membranes as they offer several advantages over other fillers. This review majorly presents use of th...
Hassam Ud Din1*, Huma Rizwana1, Rameez Raja Kaleri2, Kaleem Ullah2 and Muhammad Din2
Evaluation of Production Performance and Marketing of Small Ruminants in District Dukki, Balochistan
...m the small ruminants farmers of five union councils i.e. Vialla Dukki, Thal, Nana Sahib, Sadar and Nasar Abad of district Dukki of Balochistan. The sample size was composed by producer (50), wholesalers (50) and retailer (50) for convenient sampling contribution of each selected producer involved in the business area. The result showed that in the study area (60.00%, 24.00% and 16.00%) farmers have kacha, pacca and semi pac...
Muhammad Yaseen1*, Muhammad Luqman1*, Zahoor Hussain2, Usman Saleem3, Asif Nawaz1, Tahir Munir Butt4 and Muhammad Umer Mehmood1
Assessment of Knowledge Level and Information Sources of Vegetable Growers regarding Tunnel Farming in District Sargodha
...quite satisfactorily. Farmers do not know how to overcome the increasing attack of insects, pests, and diseases in tunnel farming. Some areas were identified, which require the attention of responsible authorities for the relevant knowledge....
Taqiur Rahman1, Tabassum Yaseen1*, Ali Mujtaba Shah2, Samiullah3, Ghulam Jelani3, Gul Nawaz1,Qudratullah Kalwar2
...wledge from the elder formers (R1, R2 and R4) this study labels the ethno veterinary practices in different villages of District Shangla, where the documentation process is carried out through semi-structured questionnaires in 2017 (R1) where about seventy plant species belonging to different families of spermatophytes have been collected, among which forty-eight belonged to angiosperm families and 2 families were gymnosperms. This comprises 39 herb, 14 shrubs...
Agustine Christela Melviana1, Rizkita Rachmi Esyanti1*, Roy Hendroko Setyobudi2, Maizirwan Mel3, Praptiningsih Gamawati Adinurani4 and Juris Burlakovs5
Gene Expression Related to Steviol Glycoside Synthesis Produced in Stevia rebaudiana (Bert.) Shoot Culture Induced with High Far-Red LED Light in TIS RITA® Bioreactor System
...or Automated Temporary Immersion System) is used in the production of a large amount of stevia biomass in approximately a short period. The forming of flowers is one of the limiting factors interfering with the metabolite production, as the content of steviol glycoside will decrease after plant flowering dramatically. This mechanism happened because steviol glycoside synthesis and flowering process share the same precursor. However, this interfering factor cou...
Muhammad Abdullah1, Syed Attaullah Shah1, Khurram Nawaz Saddozai1, Jahangir Khan1*, Mohammad Fayaz1, Irfan Ullah1* and Sabeeh Ullah2
Analysis of Agricultural Land Price Determinants and Policy Implications for Controlling Residential and Commercial Encroachments: Facts from District Swabi (Pakistan)
...nt inputs could raise farmers’ returns from agriculture and could change their perception to favor using land for agriculture....
Sajid Khan* and Shahnaz Akhtar
Effect of Farm Labor Transformation on Households Income in Central Districts of Khyber Pakhtunkhwa, Pakistan
...technical training to farmers for the dissemination of the latest technology and skill enhancement for growing various crops and vegetables to enhance agriculture and rural development....
Syed Muhammad1*, Badar Naseem Siddiqui2, Farhat Ullah Khan1 and Nawab Khan3
Self-perceived Constraints of Extension Field Staff Affecting their Working Efficiency in Khyber Pakhtunkhwa, Pakistan
...logies to educate the farmers’ community about how to use new applications and techniques of modern technology for the purpose to increase agricultural production. The efficiency of EFS is, therefore, reflected by the farmers’ adoption level of modern recommended technology. The current study was designed and conducted during February 2018 for the purpose to find out self-perceived main constraints, affecting the...
Sanaullah1*, Abdul Basit2 and Inayat Ullah3
Challenges and Prospects of Farm Mechanization in Pakistan: A Case Study of Rural Farmers in District Peshawar Khyber Pakhtunkhwa
...nomic features of the farmers and available machinery. A total of 240 rural farmers were randomly selected from two local union councils of provincial government Khyber Pakhtunkhwa Peshawar. The accumulated data were analysed using mean and standard deviation with an acceptance mean value of ≥3.00 and estimating logit model. Socio demographic features revealed that majority (52%) were in middle age group of 41-50 years, 6...
Chibuzo Uzoma Izuogu1*, Robert Ugochukwu Onyeneke1, Loveday Chukwudi Njoku1, Gillian Chidozie Azuamairo1 and Mary Chikerenma Atasie2
Repositioning Nigeria’s Agricultural Extension System Towards Building Climate Change Resilience
...silience practices to farmers as well as ensuring that government and other agencies are kept abreast with farmer’s feedback on their challenges in building climate change resilience....
Shawaiz Iqbal1*, Nadeem Iqbal2, Usama Bin Khalid1, Muhammad Usman Saleem1, Adila Iram1, Muhammad Rizwan1, Muhammad Sabar1 and Tahir Hussain Awan1
Growth, Yield and Economic Analysis of Dry-Seeded Basmati Rice
...hnique, which enables farmers to harvest economical rice production. Field study was conducted at Rice Research Institute, Kala Shah Kaku, Pakistan in 2014 and in 2015 to evaluate the different planting methods. Three dry-seeded rice (DSR) planting methods viz. (i) DSR-broadcast, (ii) DSR-drill, (iii) DSR-ridges were compared with the conventional transplanting (TR) method in lines having row to row and plant to plant distance of 22.5cm distance, and farmer tr...
Muhammad Tariq Mahmood1*, Muhammad Akhtar2, Mushtaq Ahmad1, Muhammad Saleem2, Ali Aziz2, Irfan Rasool2, Zeshan Ali3 and Muhammad Amin2
An Update on Biology, Extent of Damage and Effective Management Strategies of Chickpea Pod Borer (Helicoverpa armigera)
...in as last option for farmers. However, management of chickpea pod borer through use of resistant cultivars, adopting recommended cultural practices and biological control measures have been found more effective, economical, sustainable and eco-friendly....
Luka Anthony*, Olugbenga Omotayo Alabi, Elizabeth Samuel Ebukiba and Vandi Gamba
...ase the income of the farmers. Primary data were used for this study. Data were obtained using a well-designed well-structured questionnaire. The questionnaires were administered to two hundred and seven (207) small-holder rural rice farming households. Multi-stage sampling technique was adopted. Data were analyzed using Multinomial Logit Model, Gini-Coefficient, Double-Log Regression Model, (Cobb-Douglas) and Principal Component Analysis. The results of the M...
Hillary M.O. Otieno
A Review of White Mango Scale (Aulacaspis tubercularis Newstead; Hemiptera: Diaspididae) in Sub-Saharan Africa: Distribution, Impact and Management Strategies
...t practices ready for farmers to implement. This has caused farmers to rely on nature and sometimes adoption of crude and ineffective traditional control methods. Farmers capable of using pesticides apply very toxic products that are not only harmful to the applicators but also to the beneficial organisms. Agronomic management strategies like right varieties, spacing, better fertilization ...
Ashara Sajid1, Muhammad Usman Ghazanfar1, Saeed Rauf 2, Zahoor Hussain3, Salman Ahmad1 and Yasir Iftikhar1,*
... (standardization) of primers used in previous and current studies. Characteristic symptoms combined with molecular detection would be useful to formulate the management strategies.
...
Tariq Mahmood Khalil1,2*, Muhammad Ajmal3, Iftikhar Zeb1,4 and Muhammad Azeem Khan1,5
...eas of the globe. The farmers in these areas especially in the developing countries are using saline water for irrigation. This laboratory scale study was aimed to investigate the effects of saline water irrigation on development of total water potential within coarse and fine textured soils using a novel method based on water potential dynamics. Chilled mirror dew point hygrometer accurately captured the water potential dynamics when soil samples were irrigat...
Mashal Malik and Mudassar Nawaz Khan*
...land owing to lack of farmers interest and government attention. Soybean lines; B24G14, B23G5, B20G16, B21G2, B21G9, B6G23, B23G16 and B29G11 were grown for one month and analyzed for morphological and molecular variations. In order to analyze genetic variations, Single sequence repeat (SSR) markers were used. The line B20G16 showed the highest morphological growth parameters of plant height, total number of leaves, ...
Muhammad Akram Muneer1, Khalid Munir1, Ghulam Abbas1’*, Isra Munir1, Mumtaz Ahmad Khan1, Asif Iqbal1, Munsoor ud Din Ahmad1, Muhammad Arshad Javid2, Zareen Fatima1 and Maria Arshad1
Dabesa Wegari and Fikiru Temesgen Gelata*
...hers, 12 hotels, 10 consumers and other institution actors; totally 476 respondents by using interview schedule, site visit and personal observation. Data analysis was made using descriptive and inferential statistics. In the study areas, the major beef cattle value chain actors were input suppliers, producers, traders, fatteners, processors, retailers, consumers and governmental and non-governmental institutions. The core f...
Grace Okongor, Chukwudi Njoku*, Pauline Essoka and Joel Efiong
...or better planning by farmers and policy makers....
Raheel Saqib1*, Muhammad Luqman2, Saleem Ashraf3, Tahir Munir Butt4, Abdur Rehman5, Imtiaz Hussain6 and Muhammad Umer Mehmood2
...eed to educate female farmers involved in family farming through extension activities to perform their activities effectively and efficiently. The major purpose of present study was to explore the constraints and potential benefits associated with family farming for livelihood improvement in the highlands of Pakistan.
...
Muhammad Yaseen1, Xu Shiwei2, Yu Wen2, Muhammad Luqman1*, Raheel Saqib3, Muhammad Ameen4, Sadia Hassan5 and Tahir Munir Butt6
...he farming community. Farmers use various traditional and modern information sources such as extension field staff, fellow farmers, private sector, electronic media, print media, and information communication technologies (ICTs) gadgets to get the latest information necessary for agricultural productivity. This study aimed to explore the patterns of farmers to access and receive informatio...
Tariq Ali Mastoi1, Zulfiqar Ali Mastoi2*, Zahoor Ahmed Khetran3, Ghulam Hussain Alizai2, Binish Baig4, Mitha Khan2 and Syed Jahangir Shah1
..., while 28.75% of the farmers having upto 20 acres landholding. Land tenure system of the respondents were examined and found that most samples i.e. 64 % were in absentia training load (zamindar). Samples were analyzed on the basis of farmers’ income, and it has been found that 34% respondent had income of Rs.45,000 and Rs.60,000 per acre respectively. However, remaining 47.50% of the respondents had old and outdated f...
Hazrat Ali1, 2* and Ezzat Khan1*
...health risk to fish consumers including humans. The aim of present research work was to study the bioaccumulation of Cr, Ni, Cd and Pb in the carnivorous fish Mastacembelus armatus at different sites of three rivers in Malakand Division, Pakistan. The study also investigated tissue-specific accumulation of these metals in M. armatus at one site of River Panjkora. Concentrations of Cr, Ni, Cd and Pb in the fish muscles ranged from 10.2 ± 3....
Saad A. Moussa1, Mohammed Ahmed Mahmoud Abdullah2*, Mahmoud Saied1, Mustafa Saleh1, Mohamed A. Soliman2 and Ali Mahmoud Zanaty2
...dardized NDV specific primers and finally eight viruses were selected for further sequencing for the partial fusion protein, The eight NDVs isolates of velogenic genotype VII and contain the unique cleavage site motif 112RRQKRF117 with high relation to very virulent NDV Chinese strain Chicken /China/SDWF07/2011 strain with nucleotide identity percentage (99.3% -100%). The main causative agent of recent ND outbreaks in vaccinated broiler flocks in Menofia gover...
Dara Jaff1,2* and Michael C. Jarvis2
...genotypes selected by farmers or breeders for dry climates need to cope with wide variation in rainfall from year to year. Vigorous vegetative growth is needed for yield when drought terminates growth early, but this character can lead to lodging in years with above average rainfall. Barley cultivars and landraces bred adapted to these conditions have thinner straw than higher-yielding cultivars adapted to more favourable growing conditions and may lodge in a ...
Chaogang Yao, Daxin Pang, Chao Lu, Aishi Xu, Peixuan Huang, Hongsheng Ouyang* and Hao Yu*
...ity for raisers and consumers in modern society. The objective of this work was to investigate the roles of the peroxisome proliferator-activated receptor (PPAR) and fatty acid metabolism signaling pathways in determining the IMF contentin the longissimus dorsi (LD) muscle of pigs. The expression profile of candidate genes involved in the PPAR and fatty acid metabolism signaling pathways were detected in the LD muscle of two pig breeds with different IMF conte...
Tanay Dineshkumar Shah
...nials as well as baby boomers, people from those age groups were also included in the survey. There were 213 responses on the questionnaire which contained 14 questions. The survey results show that 16% of the people consider mushrooms as non-vegetarian, about 14% of the people were not cleared whether they have consumed mushrooms in their lifetime. Among those who are regular mushroom eaters, 50% preferred eating button mushrooms and almost 32% of the people ...
Naveed Wahid Awan1, Asif Ali Abro2* and Ahmed Raza ul Mustafa3
...rovision of credit to farmers impact positively in the production of major crops and land revenue in Pakistan....
Manzoor Hussain Memon1, Khalid Khan2, Anjum Parvez3, Sarfaraz Ahmed Shaikh4, Khan Mir Khan2, Guo Xiangyu5*, Mohammad Nasrullah6 and Saima Liaqat7
... both producers and consumers are unable to reap the benefits. Consumers and poultry farmers, the two extreme of value chain are in surplus loss because of no. of agents in the supply chain. Keeping in view the importance of poultry industry, the study has attempted to assess the economic viability of the poultry farmers in district Mardan, Khyber Pakhtu...
Hamed A. Ghramh1,2,3, Zubair Ahmed1,2,4 and Khalid Ali Khan1,2,3*
...om India, while S. hammersteini Enderlein, 1908is recorded from Saudi Arabia. Affinities of the new taxa with related species have also been discussed. The genus Stantonia is also recorded for the first time from Saudi Arabia.
...
Syed Muhammad Aun Naqvi1, Sara Tahir1, Tanveer Ahmed2*, Huma Naz3, Amara Gilani4, Atif Liaqat5
...elpful for the fish consumers in selection the best weight category and animal feed formulators.
Novelty Statement | The present study inferences will be helpful in the selection of appropriately sized fish for human consumption. Further, fish visceral organs (not consumed by humans) can be used in the formulation of nutritionally balanced diets for fish, poultry and livestock.
...
Muhammad Adnan Islam1*, Zia-Ul-Haq2, Rana Shahzad Noor2, Matiullah Khan4, Muhammad Mohsin Ali1, Zulfiqar Ali3, Asif Ali Mirani3, Hafiz Sultan Mahmood1, Muzammil Husain1 and Badar Munir Khan Niazi1
...actice (Rabii Drill). Farmers were reluctant to adopt this fertilizer saving drill due to its heavy weight, which make it difficult to operate by commonly available 50-40 hp tractors. Keeping in view all these issues a low-cost version of fertilizer band placement drill was designed and developed with the help of local manufacturer. Over all Weight reduction (from 450 to 390 kg) and changing the drive wheel mechanism (from rear to front) for seed metering was ...
Muhammad Ashraf Sumrah1*, Muhamad Jan1, Azhar Hussain2, Shoaib Akhtar1, Hussain Nawaz1, Muhammad Afzal3 and Humara Umar1
...r olive growers and consumers. The last three-years (2017-2019) study was conducted with the objective to evaluate varietal performance of table olives i.e. Ascolana, BARI Zaitoon-1, Earlik, Gemlik, Hamdi, Hojiblanca, Manzanilla and Picual at Barani Agricultural Research Institute (BARI), Chakwal. Eight olives varieties were evaluated for their growth and yield under Pothwar region of Punjab, Pakistan. The trial was conducted with experimental design following...
Muhammad Adnan Fahad1, Muhammad Jamal Khan1, Sheraz Ahmed2* and Imtiaz Ali2
... flume, respectively. Farmers were interviewed to find out the effect of watercourse improvement on crop productivity and water management practices using questionnaire proforma. The losses in five improved watercourses (lined sections) were 9, 28, 5, 11 and 20% per 1000 meter, respectively while that of unlined sections of the same watercourses were 23, 30, 50 and 21 % per 1000 m, respectively. Losses in unimproved watercourses were 27, 62, 55, 55 and 40 % pe...
Yahong Guo1,3, Zeqin Fu1,3, Jiantong Feng1,3, Chengrui Yan1,3, Yingying Ye1,3*, Kaida Xu2 and Baoying Guo1,3
... For mussel breeding, farmers use wild individuals to multiply the cultured populations. However, blind selection of wild parents has inevitably resulted in inbreeding and decreased genetic variation. In this study, four wild specimens groups (ZSW, WZW, NNW, and FZW) and four cultured specimens groups (ZSC, WZC, NDC, and FZC) of M. unguiculatus were used to analyze their genetic diversity, population structure and understand the relationship between the...
Mohammad Tariq Aziz* and Ayesha Khan
...total 1120 registered farmers was drawn to collect primary data through pre-tested and well-structured interview schedule. Collected data was analysized using Statistical Package for Social Sciences (SPSS). Results show that 42% of the respondents were above 35 years of age, majority (80%) were literate having education from primary to above matric, 45.5% had farming experience of 1-10 years while 67% have knowledge about agriculture extension department. All ...
Chala Hailu Hussen and Fikiru Temesgen Geleta
...affecting smallholder farmers’ participation decision in cluster crop production. By employing two-stage sampling techniques, data was collected from 160 farm households of selected Western Shewa zone districts, namely Ejersa-Lafo, and Bako-Tibe. Data was emanated from primary sources, which administrated by semi-structured questionnaire using personnel interview. On top of this, the focus group discussion was carried out on particular topics to suppleme...
Mian Muhammad Arif* and Malik Muhammad Shafi
...t is recommended that farmers should be provided loan facilities with a low-interest rate.The profitability of broiler poultry farms can be increased by reducing high mortality rate through proper vaccination, medication, and better management techniques....
Wajid Habib1, Saira Rasul2* and Hafiza Sadaf Zahra3
...ice volatility by the farmers....
Muhammad Ibrahim Kubar1, Fahad Nazir Khoso1*, Imran Khatri1, Niaz Hussain Khuhro2 and Arfan Ahmed Gilal1
...ents and convince the farmers to use IPM methods for healthy vegetable with high yield....
Summara Abbasi* and Khalid Nawab
...ded, about 70% of the farmers were aware of artificial insemination and vaccination while at least 51% was reported about livestock management. Improved feeding was very active as 70% of farmers were well informed followed by breed status recorded by 70% of the farmers. Demographic results showed that 63% of respondents were literate with an average age of 51 years and farming experience o...
Mehnaz Safdar1, Urooba Pervaiz1* and Dawood Jan2
...ple size of 384 women farmers were selected through multistage sampling technique. Descriptive analysis revealed that 305 women farmers were involved in rearing poultry. A 5 point Likert scale was used, showed that women farmers had various constraints out of which Pardah, mobility and lack of information source were ranked on top with Likert score value of 4.12, 4.00 and 3.94, respectivel...
Shahinshah Khan1*, Aijaz Ali Khooharo1, Zaheeruddin Mirani1 and Velo Suthar2
...e by interviewing 360 farmers selected from six districts of Balochistan applying multistage cluster sampling approach. Survey data further revealed that 34% farmers produced their own seed. Regarding source of seed, dealers (96.8%) and neighboring (88.8%) farmers were observed to be the major sources of basic seed for multiplication. However, 36.8% of the farmers<...
Tahseen Ullah* and Noorul Amin
...ds of the cutting were immersed in the desired strength of the IBA. After treating the cuttings with solution they were planted in raised beds and covered with plastic sheets to maintain the humidity in the experiment plots. Types of stem cutting and IBA concentration have significantly affected (at P≤0.05) the sprouting %, survival %, sprout weight, dry leaves weight, leaf area, root diameter, chlorophyll content, sprout diameter, fresh root weight, number...
Shahzad Khan1*, Munir Khan1, Arif Alam2, Ikram Shah2, Mahfooz Khan1 and Fida Muhammad Khan1
...hus, selection of the farmers was based on the proportional allocation technique. However, primary data were randomly collected through face to face interview from the selected respondents with the help of a semi-structured questionnaire. For data analysis, profit margin, gross margin and Cobb-Douglas production function were applied. Therefore, the labour, tractor, and fertilizers were found major components in the total variable cost. The profit per acre was...
NawalM. Abdulla1, M. Haroun1*,Mohamed A. Shalaby2and Ahmed A. Elsanousi2
...alysis using the same primers.
...
Mokbel, Samah A.1,Ahmed K. El Attar1; Azza G.Farag2.
...>phytoplasma specific primers; P1/P7, R16F2n/R16R2.Witches‟ broom specific primers
SR1/ SR2, at the spacer region (SR), were used for the direct PCR. Amplicons of
expected size characteristic for phytoplasma associated witches‟ broom were obtained
from infected hibiscus samples. DNA sequencing and phylogenetic analysis of the 16S
rRNA gene fragment from the hibiscus witches...
Ebtisam, A. Abouel yazeed1; Yanni, M.I.1 and Hanan A. Fahmy2
...T-qPCR assay utilized primers and probe that were designed to the target gene for rotavirus. The presence of rotavirus in fecal samples obtained from neonatal calves suggested its etiological roles and it is the main causative virus involved in neonatal calf diarrhea....
Aya El-Turkey1, A. K. El-Attar1, A. E. Aboulata1, B. Othman2 and K. A. El-dougdoug2
...ed using specific PCR primers.PCR product was molecularly cloned in t E.coli cells using PCR2.1/TOPO/ TA cloning vector. HSV-2gD fragment was liberated from 1 μg recombinant plasmid by using the restriction endonuclease EcoRI. HSV-2gD was successfully sub-cloned into binary plant expression vector PBI-121. HSV-2gD subunit-containing binary vector PBI 121 were transformed into Agrobacterium tumifaciens LBA 4404 strain for Agro-inoculation. Tomato plants were...
Amro A. Farrag1; Ahmed K. El-Attar1; Om-Hashem M. El-Banna2; Ibrahim A. I.2; H.
M. Mazyad1
...cific oligonucleotide primers. SLCV (bean isolate) was
transmitted from naturally infected common bean onto twenty two species and varieties
belonging to six different families i.e. Moraceae, Solanaeae, Cucurbitaceae,
Leguminoceae, Chenopodiaceae, and Malvaceae using viruliferous whitefly (Bemisia
tabaci). Results revealed that SLCV could be transmitted to 16 out of 22 species and
positively back inoc...
Ahmed K. El-Attar; Samah A. Mokbel; Ali H. Hamed
...>using virus-specific primers. The molecular characterization for the Egyptian
isolate has been performed through cloning and sequencing for the OYDV CP gene
which amplified by RT-PCR then cloned and sequenced in the TOPO cloning vector. The
CP gene sequence has been submitted to the GenBank and compared to other available
isolates of OYDV. Sequence alignment and phylogenetic analysis showed that the
...
Amro A. Farrag1; Ahmed K. El-Attar1; Om-Hashem M. El-Banna2; Ibrahim A. I.2; H. M. Mazyad 1
...egenerate
primers and Squash Leaf Curl Virus (SLCV) specific primers. All bean varieties grown in
surveyed governorates were found susceptible to Geminivirus infection and the dominant
Geminivirus affecting bean fields was SLCV. Percentage of infection was higher at Nili
season than that at the summer season. Six different commercial varieties of common
bean were ev...
Amel, S.M. Abo-Senna1; M.A. Nasr-Eldin2; B.A. Othman3 and A.A. Megahed4
...e using high specific primers as 113 bp fragment within the nuclear inclusion protein b (NIb) coding region of the virus genome. The cytopathological effects of ZYMV on the infected cells were completely chloroplasts destruction, and deformation of vascular bundles. The effect of late ZYMV infection decreased fresh weight and yield of squash plants....
Aly M. Abdel-Salam
... utilizing degenerate primers for badnaviruses for the reverse trancriptase,
RT/RNase genome regions of ORF III detected the virus in infected sugarcane leaves
and in its vector Saccharicoccus sacchari and in another unidentified
Pseudococcidae- mealybug. Amplicons for the RT/RNaseH motifs of the two virus
isolates were cloned, sequenced, and submitted to the GenBanak. Pair-wise nucleotide
identity in...
Amira A. Mazyad1; A. A. Kheder1; Ahmed K. El-Attar1; W. Amer.2; Mahasen, H. Ismail.2; Amal, A.F.1
...bp fragment using PCR primers specific for the viral coat protein gene as a tool for molecular diagnosis. The PCR detection was confirmed with direct DNA sequencing and phylogenetic analysis for the coat protein gene. Further insurance of SLRSV infection was performed using light microscopy which showed presence of amorphous inclusion bodies, electron microscopy and chemical analysis....
Safaa M. Mohammed*, Shahira A. Abdelwahab**,Fetaih,H⃰ ⃰ ,Neveen,R⃰ ,Abdel satar ,A⃰ and Mohamed S. Elshahidy**
...ed using specific P4b primers and visualized by gel electrophoresis at 578bp....
Abd El-Hamid, M.I1, Seham, A.El-Zeedy1, El-Sanousi, A.A2, Reda, I.M2, Nehal, S. Saleh1, Abbas, A.M1
...y PCR using 2 sets of primers one of them includes the whole length of the gene about 1209 bp while the nested one from the start ATG is 1000 bp ,seven out of nine samples have been reported positive by the 2 sets of primers, then the specific band at the expected size of the whole length of EHV-1 (EHV-1gD) gene of the local isolate was sent for sequence analysis, multiple alignment revealed single nucleotide substitution at...
Manar F. Seioudy1, Magda M. Sayed1, Ahmed A. El-Sanousi2 and M. A. Shalaby2
...tested using specific primers and they were free from BVDV or mycoplasma contamination. Results in this study showed that molecular techniques could be used for rapid evaluation of PPR vaccine including RT-PCR for identity testing and for detection of BVDV as adventitious contaminant and PCR assay for detection of bacterial contaminants as mycoplasma....
Lala Rukh1, Muhammad Nadeem1, Tusneem Kausar1, Mian Anjum Murtaza1, Muhammad Luqman2*, Muhammad Bilal Shahid1 and Amal Shaukat3
...of health-conscious consumers. Moreover, date pit powder and soy protein isolate can be used as nutraceutical in different functional foods as a valuable nourishment source for target population....
Aly M. Abdel-Salam
...iruses using specific primers. DAS-ELISA and immuno-blotting were used for evaluating the induced antisera. Results: Antisera for CYSDV and CVYV were produced efficiently and used for virus diagnosis through DAS-ELISA, DBIA, and TBIA. RT-PCR confirmed the nature of the two viruses. However mixed infection was noticed for CVYV and CVYV upon using duplex RT-PCR. Conclusion: Mixed infection with WTV is common and complicates diagnosis and breeding for resistance....
Salama M. El-Saghir1, 2
...ularly using specific primers for PVS.
Methods: In-direct ELISA (I-ELISA) and dot blotting immunobinding assay (DBIA) were used for
detection of the virus in commercial potato plants. IC RT-PCR amplified 187 bp of the virus coat
protein using antiserum for PVS and the specific primer 5’TGGCGAACACCGAGCAAATG3’ (sense)
and 5’ATGATCGAGTCCAAGGGCACTG3’ (antisense).
Results: A specifi...
Salama M. El-Saghir1, 2
...d using the universal primers for phytoplasma detection, P1/P7, in the first step.
The PCR products were re‐amplified with nested‐PCR to verify phytoplasma incidence using the
nested primers R16F2/R2.
Results: DAS-ELISA confirmed the presence of PNRSV in the tested peach trees. For phytoplasma
incidence, the universal primers P1/P7 amplif...
Rasha M. Mahrous1,4, Ahmed K. El-Attar2, Ahlam A. AlWatban1, Sohair I. EL-Afifi3,
Nagwa M. Aref1,3
...es using the specific primers of their 16S-23S rRNA gene by PCR.
Results: The Phytoplasma was isolated on indicator (Vollka marina) plants. It was transmitted on
Lemon (Citrus limon) by grafting and on periwinkle by dodder. It was detected in the sieve tubes and
parenchyma cells of leaf midribs tissues using Diene's stain and TEM. Infection of Lemon trees with
Phytoplasma associated witches' Broom was detected by...
Ahmed A. Azab, Wesam H. Mady, Ali Zanaty, Mahmoud Samir
...CR) using IB specific primers. Comparison of different isolation methods was done
by generating a standard curve by real time PCR.
Results: The results revealed that the propagated virus in CEK showed the highest virus titer (5.952 x
106 and 3.245 x 106) than Vero cell line (7.184 x 101 and 2.14 x 103) and ECE (7.536 x 103 and 5.444 x
105) after both 48 and 72 hours respectively.
Conclusion: The chick...
Dina A. Abdulrahman1, Ayman H. EL-Deeb2, Momtaz A. Shaheen1 & Hussein A. Hussein2
...T-PCR using universal primers for detection of all seven
serotypes of FMDV. The positive-resulted samples were then tested using conventional PCR and pan
FMD primers. The same samples were tested again using serotype-specific primers to amplify the VP1
coding region and the products were sequenced for phylogenetic analysis.
Results: FMDV RNA ...
Ruqayya Bint Khalid1, Asif Nadeem1,2*, Maryam Javed1, Muhammad Zubair Shabbir3 and Masroor Ellahi Babar4
...y organic method. PCR primers were designed and optimized according to respective melting temperatures. PRALINE tool, MEGA 6.0 and POPGENE tool were utilized for phylogenetic tree construction and statistical analysis, respectively. Characterization of physical and chemical properties of β-casein protein was performed by ProtParam and SWISS MODEL was utilized for protein model prediction. Sequencing results of amplified PCR products revealed total 9 SNPs ...
Coronavirus Disease (COVID-19) with Special Reference to Pakistan: A Review on its Different Aspects
Sahar Mubashar*, Tariq Mukhtar and Nasir Ahmad Khan
... get testing kits and primers from other countries. Only few quarantine centers are available and there is shortage of drugs, beds, trained doctors and paramedical staff. Unfortunately, no vaccine is available yet so the only management strategy is the prevention of infection by wearing masks and following social distancing. Cleanliness, hygiene and quarantine measures are the key to stop any epidemic to pandemic and is known to human being throughout the hist...
Othman N. O. Mansour 1, Naglaa Hagag 2, Momtaz A. Shahein 1, Sayed S. Hassan 1 Ahmed
A. EL-Sanousi 3 and Mohamed A. Shalaby3
Allam A. Megahed, Badawi A. Othman, Samar S. El Masry, Abeer A. Faiesal and Mohamed A. Nasr Eldin
...protein gene specific primers with an expected amplicon of 520 bp. Electron Microscopy
examination revealed that, the viral particles were slightly flexuous rod shape with about 680 x 13 nm
in size. Ultrastructure analysis showed different degrees of chloroplast degradation in PVM-infected
potato leaf tissues.
Conclusion: Occurrence of PVM was detected and confirmed in commercial potato seed tubers in
Ahmed K. El-Attar1, Samah A. Mokbel1 and Om-Hashem M. EL-Banna2
...T-PCR using a pair of primers specific to the AMV-CP gene.
Phylogenetic analysis results indicated that AMV-Egypt that isolated from Basil is most closely
related (96.4%) to the AMV-Spain strain isolated from Hibiscus plants.
Conclusion: Pathological investigation may provide insights into the alterations of the cell after
viral infection and understanding of the data concerning the behavior of the virus. Phyloge...
Ahmed M. Soliman
...RT-PCR) with specific primers designed for the coat protein gene of CMV were used to detect the virus. RT-PCR products (657 bp) of coat protein gene of CMV were cloned and then sequenced.
Results: CMV was isolated from four vegetable crops (cucumber, tomato, pepper and watermelon) using ELISA and RT-PCR assays and the coat protein gene of the four isolates were submitted to GenBank. The CMV isolates showed nucleotide sequences similarity between th...
Wesley D. Nafarnda, Japhet H. Baraya, Olatunde H. Olabode, Malang K. Simon
...ing household poultry farmers alongside administration of feed based
V4 thermostable ND vaccination in chickens. Sera obtained from forty (40) chickens per LGA during
pre-vaccination, post-vaccination and post-booster vaccination with NDV4 thermostable vaccine were
subjected to Hemagglutination Inhibition (HI) test.
Result: Antibody detection showed seroconversion in chickens 28day post vaccination and post
...
Hadeer M. Mossa, Ausama A. Yousif, Emad A. Aboelsoud, Mahmoud El Gamal, Ahmed El-
Sanousi
...niversal and specific primers
for virus identification and confirmation. The size of the produced amplicons was 192 pb for the
universal primer and 502pb, 1452pb for the specific primers respectively. Metagenomics is done to
evaluate a virus harvest for standardization by applying a suite of genomic technologies and
bioinformatics tools to directly represent the genetic content...
Nadeem Anwar1, Muhammad Luqman2*, Shaoib Nasir3, Moazzam Sabir1, Hafiz Bashir Ahmad4 and Saleem Ashraf5
...sting behavior of the farmers that they do not harvest the fruit by their own. Only a small number of the citrus growers harvest the fruit by their own. Majority of the farmers were found to be unsatisfied about the role of intermediaries and termed these intermediaries as profit-making group indenting the share of farmers. The Harvesting behavior of the farmers
Ayesha Manzoor1, Muhammad Saqib Naveed1, Sayed Rashad Ali1, Danish Ibrar2, Sairah Syed1, Sharmin Ashraf1 and Rafiq Ahmed1*
...er crop production for famers and is a foundation of any crop species. Root to seed method is widely used in Pakistan for radish seed production but still low and inferior quality seed is being produced that cause a significant loss in yield due to lack of standardization of seed production technology.Therefore, to improve seed yield and quality, present research was conducted toevaluate the effect of steckling size on plant growth and seed yield of radish.Ste...
Ameer Hamza1, Mukkram Ali Tahir1, Noor Us-Sabah1, Ghulam Sarwar1 and Muhammad Luqman2,*
...ity water compels the farmers to use brackish water. Use of saline water along with leaching fraction could be useful by keeping low concentration of salts in the root surrounding area. This study assessed the role of leaching in alleviating the negative effect of saline water on soil characteristics. Results of the studies indicated that 6.57% reduction in soil pH (7.6), 46.06% reduction in EC (1.3 dS m-1), and 46.41% reduction in SAR (5.3) while 17.34%, 5.4%...
Md. Sahidur Rahman1*, Tishita Ape1, Md. Islam1 and Sharmin Chowdhury2
... perspective of dairy farmers regarding antibiotic use as well as its residual and resistance effect. We collected data from 101 dairy farmers in Chattogram, Bangladesh. The results revealed that ceftriaxone, gentamicin, streptopenicillin, amoxicillin, and sulfur drugs were the most frequently used antibiotics in the study area. Among the participants, 99% did not follow the withdrawal period of the drugs and claimed their p...
Ghani Akbar*, Muhammad Asif and Zafar Islam
...tely located rain-fed farmers in the country in general and Potohar region in particular. However, these findings may be valid for the site-specific conditions, thus needs to be evaluated for recommendations under the wide environmental conditions of rain-fed areas of the country....
Hina Afzal*, Sarfraz Hassan, Muhammad Khalid Bashir and Asghar Ali
...y the government. The farmers’ level of education makes a significant contribution to TFP development. It is concluded that education funding be increased for the farmers to accelerate TFP growth in Pakistan....
Sami Ullah1, Bernhard Brümmer2 and Umar Ijaz Ahmed1*
...hnical information to farmers which enhance their skills and in turn farm productivity. Livestock sector in the main sub sector of agriculture in Pakistan that contributes nearly 60% to agricultural value addition. In this study, we investigated the effects of extension services on market oriented dairy farms’ technical efficiency in Pakistan. The data was collected from 345 dairy farmers of Punjab through field survey...
Muhammad Jan1*, Muhammad Ashraf Sumrah1, Shoaib Akhtar1, Inam Ul Haq2, Muhammad Ramzan Anser1 and Iqra Yasmin1
... previous one decade. Farmers have a lack of trend for fertilizer application to Olive orchards in a proper dose. Olive intensification for new orchard enhanced fertilizer use especially Nitrogen (N), Phosphorus (P) and Potassium (K) and in micronutrients especially Boron (B) to control alternate bearing of olive. In Pakistan, olive plantation is an initiative to minimize the Olive import, and to maximize olive plantation in Pothwar area as well as control cli...
Khalid Mehmood1*, Abdul Rehman2 and Ammara Khan1
...ect the data from the farmers of Potwar Plateau of Pakistan. Farmers’ preferences and perceptions of varietal characteristics were investigated. The elasticity of production was measured to compare the performance of improved and conventional groundnut varieties. Logit model was estimated to determine the factors affecting the adoption of improved groundnut varieties. The empirical findings suggested that the input ela...
Asim Mushtaq1*, Asra Nafees1, Raza Muhammad Khan1, Amina Israr1 and Zaeem Uddin Ali2
...="font-size: small;">Polymers can contribute to the strength and flexibility of concrete formulations. A freshly assorted cement-based material is a particulate suspension far from its equilibrium state and possesses very non-linear and irreversible characteristics. The pavements made by bituminous and the requirement of continuous maintenance and even constructing it again guide us towards the cement concrete pavements. Cement concrete is advantageous over bi...
Hina Fatima1*, Bushra Yasmin2 and Lal Khan Almas3
...e need of time to get farmers involved in advanced and intensive farming techniques to attain self-sufficiency in production. This study conducted the efficiency and productivity analysis by applying the parametric and non-parametric techniques to evaluate the optimal utilization of farm resources in multiple cropping system and the efficiency gains from tunnel technology. The data were collected from 150 multiple bitter gourd-capsicum cropping system farms. T...
Izaz Hussain, Ahmad Khan* and Habib Akbar
...spread application by farmers as a source of nutrients. With the objectives of improving soil mineral N availability and its impact on maize growth, two years field experiments were conducted at the University of Agriculture Peshawar in 2017 and 2018. The experiment included three factors i.e. beneficial microbe (BM: 25 and 50 L ha-1) as effective microbes, humic acid (HA: 3, 6 and 9 kg ha-1) and FYM (10, 15, 20 Mg ha-1) obtained from cattle dung, urine and le...
Zhongyong Wu1, Wenzhu Li2, Chunxia Ni1, Zhuolin He1, Xiao Hou1 and Wanxia Pu1*
...three oligonucleotide primers. In total, 177 Staphylococcus aureus isolates were obtained from dairy farms in 5 different provinces in China, including Guizhou, Inner Mongolia, Shanghai, Sichuan, and Gansu. The results showed that the amplified product bands with three primers per isolate ranged from 1~9 and the product sizes from 240 to 4,500 bp. Primer OLP13 had the highest discriminant coefficient. The Staphyloc...
Aqsa Shahid1, Saima Muzammil1, Farhan Rasheed2,Bilal Aslam1, Muhammad Akhtar Ali3, Syed Zohaib Haider4, Masroor Ellahi Babar4, Muhammad Saeed1, Umair Waqas1 and Mohsin Khurshid1,*
... and species-specific primers. The susceptibility to various antimicrobial agents including the aminoglycosides was determined by the Kirby-Bauer method and minimum inhibitory concentration (MIC) to aminoglycosides was evaluated by the broth microdilution method. Moreover, the armA genes were studied by PCR followed by Sanger sequencing. The isolates showed a high rate of resistance to cephalosporins, carbapenems, aminoglycosides, and fluoroquinolones w...
Rosidah Rosidah1*, Angga Nugraha1, Yuli Andriani1, Kiki Haetami1, Olga Anne2 and Agus Heri Purnomo3
...The treatment used was immersion with A. vera extract with a concentration of treatment A
(0 mg kg–1), B (150 mg kg–1), C (300 mg kg–1), D (450 mg kg–1) and E (600 mg kg–1). The variables observed were i...
Naveed Farah1*, Izhar Ahmad Khan1, Asif Ali Abro2, Jehanzeb Masood Cheema3 and Muhammad Luqman4*
...ood transformation of farmers at urban fringes in two contrasting cities of Punjab province of Pakistan. A mixed method approach was employed for data collection and at first, a longitudinal analysis of Landsat imagery of land use was done through GIS and Remote Sensing for a time period of 2001-2016. The results of GIS analysis revealed that during the period 2001 to 2016, Faisalabad showed 24% increase in urban area and 23 % of this expansion consumed agricu...
Muhammad Nauman1, Iftikhar Ali3, Nazir Ahmad1,2*, Fazli Ahad1 and Touheed Iqbal4
...major thrust of early farmers since the dawn of agriculture. This study aimed to estimate genetic variability, heritability, and genetic advance for quality characters in Brassica carinata L. A total of 22 genotypes comprised of six parental lines and their 16 bulked F2 populations were evaluated in a randomized complete block design with three replications at The University of Agriculture Peshawar during 2013-14. Data were recorded on oil content, protein con...
Liyun Chang1, Yingbin Chen1, Qian Kang1, JianhuaQin1,* and Zhiyong Liu2,*
...ΔCt). The primers were designed according to the sequence of mouse cytokines in GenBank. The expression levels of the cytokines were normalized to GAPDH gene expression. Fluorescence threshold (Ct value) obtained from RT-QPCR2-ΔΔCt method with GAPDH standard curve (linearity R2=1), followed by sequencing analysis showed that all tested cytokines were amplified. The PCR products exhibited consistent melting curves, ...
Kemi Funmilayo Omotesho1*, Philip Akintunde Fatodu1 and Toyin Benedict Ajibade2
... record keeping among farmers in Nigeria greatly impedes the evaluation of the performance of farms, national planning, budgeting for commercial agricultural development, and control of postharvest losses. The study analysed the record keeping behavior of youth farmers in Ekiti State. Specifically, it assessed the level of record keeping among farmers; examined their attitude towards recor...
Malik Muhammad Shafi, Rabia Habib and Haidar Ali*
...key factors affecting farmers’ savings the study was designed in district Kohat (KP, Pakistan). For the purpose of data collection, interview schedule and direct observation was used as a research tools. Through random sampling technique, a sample size of 90 households from 452 farm households were taken. Total consumption expenditures, total income, and land size were the variables which showed significant results. Because their overall p-values indicat...
Shahid Ali1*, Murtaza1, Waqas Ahmad1, Muhammad Israr2, Aftab Khan3, Hamdullah1 and Syed Attaullah Shah1
...pectively. Therefore, farmers need to increase labor hours, application of urea fertilizer and irrigation for accelerating rice output. Decreasing return to scale (DRS) was found in the use of all inputs, therefore reallocation of these inputs is suggested and application of tractor hours and chemicals need to be rationalized....
Theophilus Miebi Gbigbi* and Rodney Akpoviri Isiorhovoja
... pick a sample of 120 farmers from whom data were elicited using structured questionnaire. Data were analyzed using descriptive and inferential statistics. The findings indicate that the average age of respondents was 43 years; majority (85%) of respondents were males with 16 years’ experience in exotic chicken production; 75% were married and 48% had secondary education. The mean household size was 5 persons. Budgetary analysis showed a net return of �...
Saadu Mustapha1,2, Norsida Man1*, Jasmin Arif Shah1, Nitty Hirawaty Kamarulzaman1 and Ahmadu Abubakar Tafida3
...ch, extension and the farmers. The evolving new model of agricultural production and the small number of extension agents question old ways of providing valuable knowledge to farmers. The goal was to define the respondents’ socioeconomic characteristics, classify the types of ICT tools adopted by the respondents and identify factors influencing the adoption of ICT in extension service delivery among the respondents. Pr...
Nazeer Ahmed Lashari1*, Saghir Ahmed Sheikh2, Aijaz Hussain Soomro2 and ShamsuddinTunio3
...pful to the exporter, farmers and households in the selection of packaging material and storage environments for white rice storage....
Usman Asghar1*, Muhammad Faheem Malik1, Umer Rashid2, Naeem Mahmood Ashraf2, Sumera Afsheen1 and Muhammad Hashim1
...A set of degenerative primers was designed for Polymerase Chain Reaction (PCR) of the cytochrome b gene fragment. All PCR was accomplished at the same reaction conditions. Amplified products had a length of 400 bp, which was our estimated length. After the sequencing of these amplicons, In silico restriction analysis was performed for each specie. Restriction endonuclease TfiI was selected for further analysis. Restriction fragment length polymorphism (RFLP) w...
Sheikh Muhammad Azam1,2 and Muhammad Naeem1*
...tatus of Scomberoides commersonnianus. Therefore, current study analysis was performed to analyze body composition of the studied fish. A total of 73 specimens of S. commersonnianus having different size, ranged 94.5 to 1183g of body weight and 20.5 to 56.9 cm in total length were randomly chosen from Arabian Sea Karachi, Sindh, Pakistan for analysis of proximate study. The mean percent values of different constituents were ...
Muhammad Yaseen1*, Muhammad Sallam Shahzad2, Farhat Ullah Khan2, Muhammad Luqman1, Usman Saleem3 and Shoaib Nasir4
... union council and 10 farmers from each village were selected randomly. Thus, a total sample comprised of 120 rice growers. A well-structured interview schedule was used for data collection. Descriptive statistics i.e. frequency, mean and standard deviation were applied through Statistical Package for Social Sciences (SPSS). Results showed that the use of farmers’ training as an extension method for promoting rice prod...
Madiha Nawaz and Shoaib Freed
...boratory conditions by immersion method. Three entomopathogenic fungi; Beauveria bassiana (isolates Bb-01, Bb-08), Metarhizium anisopliae (isolates Ma-11.1, Ma-2.1) and Isaria fumosorosea (isolates If-2.3, If-02) showed percent mortalities of (61.0%, 85.0%), (78.0%, 56.0%) and (52.0%, 54.0%) with LC50 values of (4.25×108, 2.54×108 spores/ml), (3.26×108, 5.08×108
Rajesh Kumar Oad1, Nasir Rajput1, Imdad Hussain laghari1, Hidayatullah Soomro1, Muhammad Azhar Memon2, Abdul Sattar Baloch5, Qudratullah Kalwar3, Mashhood Ahmed1, Zubair Ahmed Soomro2 and Waseem Ali Vistro4*
...mum net return of the farmers.
...
Dilshad Ahmad1*, Muhammad Afzal2 and Asif Ali Abro3
...0 livestock household farmers and employed regression analysis model to estimate credit impact on household income and livestock production. An economic technique of log-linear regression model was applied to identify the factors influencing dairy production and estimate household income difference from dairy production due to formal credit from Zarai Taraqiati Bank Limited (ZTBL). Estimates of the study indicated that agricultural credit facilitated to enhanc...
Ayesha Khan1*, Asmatullah2, Urooba Perviaz1, Khalid Nawab1 and Mahmood Iqbal1
...-Technology using 128 farmers’ data were gathered from the District Director Agriculture of six districts. Each farmer was interviewed face to face to collect accurate information of EM-Technology used through fermenter. Majority of the farmers 93.8% were provided the EM-Bioaab solution by extension department. The extension department provided training to 96.1% farmers on formation ...
Yaregal Tilahun1*, Benyam Tadesse1, Getachew Mekonnen2 and Tilahun Bekele3
...kill and knowledge of farmers through increasing extension service and training, on-time delivery of farm inputs, create market linkage, and improved tea nursery management were some of the suggestions made to alleviate the study areas’ tea production and marketing difficulties....
Nawab Khan1, Ram L. Ray2, Muhammad Ihtisham3*, Badar Naseem Siddiqui4*, Muhammad Khayyam5, Raheel Anjum6 and Simplice A. Asongu7
...of landholding of the farmers with their awareness and adoption level was measured through the chi-squire (χ2) test. The research outcomes showed that 49.2% of the respondents were middle-aged (35-50 years), the majority (72.5%) were illiterate, and 45% of respondents had medium-sized landholding, and they had excellent farming knowledge and apple growing experience. Furthermore, a non-significant association exists between age and adoption, and a signific...
Samreen Khan*, Salma Javed, Tabassum Ara Khanum, Nasira Kazi
...may be distributed to farmers to reduce use of insecticides already in practice and to control hazardous effect of chemical pesticides on both crops and human beings.
Novelty Statement | The present research effort was elaborated to conduct surveys and to ascertain the evidences of entomopathogenic nematodes from one of the southern districts i.e., Lakki Marwat, Khyber Pakhtunkhwa province of Pakistan...
Iqra Mobeen1*, Rabia Arif1*,Maimoona Ilyas1, Siu Fai Lee2 and Muhammad Saleem1
...gning allele specific primers via amplification refractory mutation system–PCR (ARMS-PCR) yielding amplicons of different sizes. This study concluded that SNP markers are an efficient and informative marker system in S. fimicola. Most of the studied SNPs are non-synonymous substitutions, which might underpin functional differences in their protein products.
...
Funda Turan1*, Ihsan Akyurt2 and Sehriban Cek-Yalniz1
...ontrol were applied by immersion method on C. gariepinus larvae for 30 days, and the effects of red clover extract on sex reversal and gonadal development were also examined at the end of 120 days.At the end of experiment, highest feminization (89%) was observed at 50 mg L-1 red clover group. Morphological and histological examinations of the gonads in all groups revealed no intersex fish. Histological examination of fish treated with red clo...
Eman H. Mahrous1, Mohamed. W. Abd Al -Azeem2, Faisal A. Wasel1, Waleed Younis2*
...sing species-specific primers by conventional PCR with an incidence of 6.7%, besides belonging to serogroup A by multiplex PCR. Serologically only eight isolates belong to somatic serotypes 1, 3, and 12 with a percentage of 20%, 10%, and 10% respectively, while other isolates were untypable. All the recovered isolates were further subjected to multiplex PCR screening of some common virulence genes and revealed the presence of pfhA, hgbB, tbpA, toxA, sodA, ptf...
Safdar Ali1*, Muhammad Umar1, Bashir Ahmad Khan2, Ijaz Ahmed3, Amir Manzoor1, Muhammad Saqib Riaz1, Muhammad Irfan Arif1 and Asif Nawaz1
...r unit area income of farmers is very low and the soils of this region are very poor. Mostly mono-cropping system is prevailing here. So, the pearl millet and mung bean were selected as test crops to evaluate the intercropping system in this region for the ultimate improvement of the net profitability of the farmers per unit area simultaneously not compromising with the food security and soil health. Different line spacing&r...
Sanjeela Sabahat1*, Juliya Abbasi2, Mushtaq Ahmad1, Saima Mumtaz1, Taj Naseeb Khan1, Sudheer Tariq1 and Muhammad Imran1
...oduced by small scale farmers. However, the changing climate from the past few years has affected strawberry production in Pakistan. Heavy rainfall, along with hailstorms causes damage at the fruit initiation stage. Moreover, the rainfall also lead to the leaching down of the essential micronutrients in strawberry farms. In this study we have tested the foliar application of four micronutrients, iron, zinc, copper and boron, at different concentrations under t...
Arshad Farooq1, Abdul Hassan1, Muhammad Ishaq2, Asif Nawaz3*, Iltaf Ullah4 and Hidayatullah5
...objectives to measure farmers’ knowledge level in fourteen climate smart recommended agricultural production technologies. The data were collected randomly from 60 sample respondents comprised of 30 respondents each from Charsadda and Nowshera districts through pre-tested interview schedule. The empirical results indicated that majority (68%) farmers of both districts had medium knowledge level (35.19%). The lowest kno...
Asad Ullah1*, Umar Sadique2, Ibadullah Jan2, Imad Khan1, Raheela Taj3, Mumtaz Ali Khan4, Salah-ud-din4, Naimat Ullah Khan1
Rehman Shahzad1, Saba Irshad1*, Malik Saddique Mehmood1 and Faisal Amin2
...conomic losses to the farmers. Avian influenza H9N2 virus were isolated from infected birds of different poultry farms in the Province of Punjab, Pakistan. Segment eight gene of the virus was amplified using RT-PCR and sequenced to analyze mutations in this viral segment. Phylogenetic tree analysis showed sequences from 2015 to 2017 form a single evolving clade. Valdar residues conservation scores by multiple sequence alignment showed the C terminal region of ...
Syed Sikandar Habib1*, Saira Naz2, Sehar Khalid3, Rimsha Kanwal2, Iqra Ameer1, Sadia Nawaz1 Aamir Khan4, Abid Ur Rehman5, Muqaddas Kousar6, Shafa Ullah Khan7 and Nadia Nazir7
...ant, and can help the farmers to overcome the emerging aquaculture problems....
Sameh Abdel-Moez Ahmed Amer1*, Mohamed Abdel-Aziz Kutkat1, Mohamed Mahmoud Abdel-Baki1, Asmaa Mahmoud Maatouq1, Omnia Mohamed Kutkat2, Hagar Magdy Ahmed1, Khaled Mohamed El-Bayoumi1
...T-PCR) using specific primers to amplify 1681 base pair (bp) of the whole NDV F-gene was carried out to confirm the presence of NDV and then sequenced. Our results demonstrated that, RT-PCR was successfully detecting 62 NDV samples. While, Sequencing and phylogenesis of six selected isolates revealed that, all isolates were virulent NDV with amino acid motive 112RRQKRF117 at F protein cleavage site. Furthermore, all isolates were clustered together with NDV ge...
Neven Waheeb1*, Sherif Marouf2, Essam Nasr3, Shaymaa Abdelmalek2
... PCR by using 16srRNA primers through a semi-nested PCR technique.
Keywords | ELISA, PCR, 16srRNA
...
Esraa Yosry Abdel Halim1, Hamdy El-Essawy1, Abeer Abdel Nasser Awad1, Mona S. El-Kutry2, Lamiaa Ibrahim Ahmed1*
...0.408). Aerobic spore formers were recovered from in 50%, 66.67% and 86.67% of the tested samples with a significant difference between the mean count of milk powder and that of labneh and cheddar cheese (P> 0.05). 66.67% of milk powder samples were contaminated with coliforms, followed by cheddar cheese (43.33%) and labneh (23.33%), E. coli could be isolated from milk powder samples, while Salmonella species couldn’t be detected in any of the examine...
Pham Tan Nha1*, Nguyen Thi Kim Dong2, Le Thu Thuy1
... health of chicken. Consumers using low triglyceride and total cholesterol chicken meat will be good for their health as well. It was concluded that ginger supplementation in the diet at a level of from 0.3 to 0.4% DM improved growth performance and digestin for growing Tau Vang chicken production. It showed that ginger made quantification of triglycerid and quantification of total cholesterol in chicken blood decrease.
Keywords | Tau Vang chicken, Gin...
Masouras P.K.1, Nikolaou K.1,2, Laliotis G.P.1*, Koutsouli P.1, Bizelis I.1
... although influence consumers’ preferences are not used for grading purposes of beef carcasses and meat cuts in Europe. In Greece, a variety of breeds is used for beef production, but their meat quality characteristics have not yet been evaluated. The aim of the study was to determine meat quality characteristics on samples obtained from cattle reared for meat purposes in Greece and to investigate if any correlation between these characteristics, IMF and...
Mahreen Alam*, Muhammad Ashfaq, Sarfraz Hassan and Asghar Ali
...ciency. It found that farmers with good groundwater quality were technically more efficient. Tobit model used to analyse the impact of water quality parameters on the dairy animal’s efficiency. It is concluded that water quality was minimizing the potential gain from dairy animals. The study recommended that groundwater quality management be required to enhance the milk yield to improve the farming community’s economic status. ...
Abdul Jabbar*, Anees-Ul-Hussnain Shah, Abdul Basit, Ghulam Ahmad, Aftab Ahmad Khan, Suleman Raza, Muhammad Sultan Ali Bazmi, Imtiaz Akram Khan Niazi and Ahmad Hussain
...nology of berseem for farmers, it will enhance the seed production of berseem in Pakistan in future....
Shuangye Wang1,2, Yunlin Zhao1,2, Zhenggang Xu2,3,*, Junzhi Chen3, Guiyan Yang3, Song Wang2 and Kangkang Jiang2
Dyah Roeswitawati1*, Iva Kristova1, Muhidin Muhidin1, Otto Endarto2, Manar Fayiz Mousa Atoum3,4, Irum Iqrar5,6 and Luqman Ali Shah7
...s leaves. So far, farmers have dealt with chemical pesticides that contain compounds with high toxicity. The purpose of the study was to assess the effect of type and concentration of natural pesticides soursop (Annona muricata L.) leaves, papaya (Carica papaya L.) leaves, chrysanth(Chrysanthemum morefolium Ramat.) leaves on the persistence of red mites. This research was conducted at the Research Institute for Citrus and Tropical Frui...
Evaluation of Temporal and Differential Fertilizer Application on Growth, Yield and Quality of Wheat
Raheela Naz1*, Muhammad Aftab1, Ghulam Sarwar2, Ana Aslam1, Qudsia Nazir1, Asifa Naz3, Abid Niaz4, Farah Rasheed1, Amina Kalsom1, Nisa Mukhtar1, Sadia Sultana1, Ifra Saleem1, Arfan ul Haq1, Muhammad Arif1, Aamer Sattar1, Sarfraz Hussain5 and Muhammad Adnan Rafique6
...of soils is very low. Farmers apply fertilizer but below the recommended doses. As we know that for the better quality and yield of crops, time and method of fertilizers application are the most important factors. Some growth stages are very sensitive, at those stages of growth; the addition of fertilizers is more responsive than others. In order to nutrients to become available when the plant needs them and to make maximum benefits, fertilizers should be appl...
Ghassan Zahid1, Sania Begum2, Sikandar Almani3, Sahir Hameed Khattak2, Rajesh Kumar Soothar4 and Shakeel Ahmed Soomro4*
... checks and three SSR primers were also included in the study to check the durability i.e. Opata-85 Sr2/Lr27check, Pavon-76 (Yr-29/Lr-46) and Tukuru (Yr18/Lr34) respectively. The molecular markers screening results indicated that the primer Sr2/Lr27 was present in almost all of the double haploids and genotypes except the Nesser and Tukuru varieties. The Yr29/Lr46 gene complex was present in all double haploids and genotypes except for Nesser, Opata-85, inqila...
Chukwudi Njoku1*, Inyang Etim-Inyang2, Prince-Charles Itu1 and Arinze Uzoezie1
...rge-scale aquaculture farmers and the application of geospatial tools and findings for real-world decision making in Nigeria’s aquaculture and agriculture sector.
...
Javed Khan1, Abdul Majid1, Mohammad Nisar2*, Ali Hazrat2, Nausheen Nazir3, Muhammad Zahoor3, Mohammad Ihsan2, Azhar Hussain Shah1, Muhamad Ajmal Khan4 and Muhammad Yahya1
...help the breeders and farmers to select the best variety. Alnus nitida is one of the native and most important plants in District Dir Lower, Khyber Pakhtunkhwa, Pakistan, mostly used for medicinal purposes. In the present study, total 50 genotypes of Alnus nitida were collected from Dir lower and evaluated for morphological traits (leaf, petiole, nut, and catkin size). A significant level of variations was observed in the size of the leaf (10.22%), petiole (24...
Maid Zaman1*, Imtiaz Ali Khan1, Amjad Usman1 and Ahmad-Ur-Rahman Saljoqi2
...will help scientists, farmers, foresters, and policy makers for the successful management of the pests in the studied area....
Muhammad Niamatullah1, Abdur Rehman1* and Raheel Saqib2
...nly 100 sampled farmers were interviewed with the assistance of a well-designed structured questionnaire using simple random sampling procedure. Regression analysis as a statistical method was used to assess the impact of tube well irrigation on agriculture production, household annual income, poverty line, kinds of land, sources of irrigation and inputs used on land. The significant (P<0.05) impact of household annual income of far
Hams M.A. Mohamed1, Mona A. El-Zamkan2*
...mall scale producers, farmers and markets at Qena city, Egypt, were examined for the presence of Streptococcus species. The preliminary identification was confirmed by using VITEK®2 system which revealed the presence of four isolates of S. thoraltensis. The antimicrobial susceptibility of the obtained isolates was detected phenotypically and genotypically, in addition to the ability of these isolates to produce biofilm and protease enzyme. All the isolates...
Mohammed H. Galhoum1, Hamza M. Eed2, Essam S. Soliman1*
...lla ...
Ndumiso Malusi1, Andrew Bamidele Falowo2, Yiseyon Sunday Hosu3,4, Emrobowansan Monday Idamokoro3,4*
...roduction among rural farmers who happen to be a major player in cattle production in South Africa. Such prevalent factors that have been identified to decline cattle productivity include poor animal breeding, lack of available feed resources, marketing constraints and animal health challenges among others. These limiting constraints have in turn negatively affected the potential of communal cattle farmers from exploring bot...
Heba Mohamed Shaheen1, Ali Meawad Ahmed1*, Hosny Abdelltief Abdelrahman1, Rania Helmy Abohatab Abdou2, Aya Salama Mohamed Kamel1
...st method guarantee consumers almost safe of broiler chicken meat.
Hassan Ali1, Abu Bakar Muhammad Raza1, Muhammad Zeeshan Majeed1* and Muhammad Imran Hamid2
...ded to the indigenous farmers as biorational options for the management of T. granarium and other stored grain insect pests....
Zulu Blantina Fangele, Tyasi Thobela Louis, Gunya Busisiwe*
... of eggs laid, most consumers prefer their flavoursome meat. Despite that, there has been a research gap in the genetic, physiological, and nutritional aspects of indigenous chickens of Africa over the past decade. The use of citric acid has higher economic potential owing to its numerous applications to chickens. This article critically reviews a detailed understanding of the description, advantages and limitations of using citric acid on indigenous chicken. ...
Hilarius Yosef Sikone1*, Budi Hartono2, Suyadi2, Bambang Ali Nugroho2
...ents consisting of 90 farmers, ten collectors, four inter-island cattle traders, six cattle butchers, and five meat retailers. The data was analyzed quantitatively, the presentation of the data was descriptive, and the added value of marketing was calculated using the Hayami method. The supply chain channel that occurs was quite simple, and there were five supply chain channels where identified. Channels 1 and 2 were the supply chain flow of live cattle to int...
Palwasha1, Siraj-ud-Din1 and Muhammad Fahim2*
...edge and awareness of farmers are playing a major role in food insecurity and perhaps in implementations of SDGs. ...
Naila Shahzadi1, Hafiz Muhammad Tahir1*, Shaukat Ali1, Muhammad Farooq Bhatti2, Azizullah1, Shafaat Yar Khan3, Abdul Khaliq4
... being faced by local farmers in Pakistan and impact of natural food supplements on silkworms growth and cocoon yield.
Novelty Statement | In this review article current activities related to sericulture and methods to improve economic and biological traits through diet supplementation have been discussed.
...
Noor-us-Sabah1*, Mukkram Ali Tahir1, Ghulam Sarwar1, Muhammad Luqman2, Amir Aziz1, Muhammad Zeeshan Manzoor1 and Muhammad Aftab3
... fulfill crop demand. Farmers are unable to apply adequate levels of fertilizers due to poor economy and unavailability of fertilizers at the time of crop requirement. Among alternative cheaper sources of P, one is use of phosphate rock (PR). Pakistan is blessed with huge reserves of PR but poor solubility at higher pH makes it unsuitable for application as such. Thus, solubility of PR needs to be enhanced in a sustainable way. This review documented possible ...
Mubashir Ali Rather1, Ambreen Hamadani2*, Syed Shanaz2, Nusrat Nabi2, Showkat Ahanger1, H. Hamadani2, Ruksana Shah2
...ck of awareness among farmers, non-availability of proven sires, small flock size, lack of infrastructure, and non-availability of digital records were reported among major constraints in exploiting the genetic worth of Kashmir Merino sheep. However, owing to the high production potential of this breed, its conservation, and selective breeding are highly recommended and there is a need for further research to understand the potential of this breed more compreh...
Magdy M. Fahmy1, Nisreen E. Mahmoud 1*, Mohamed R. Mousa2, Manal M. Zaki3, Elshaimaa Ismael3, Mai Abuowarda1
...lso the dependency of farmers on fish seeds for farm stocking from natural open water instead of the hatcheries should be avoided to prevent the entrance of parasites and other undesirable organisms from open seas to the lake and corresponding fish farms. This study is the first to investigate the prevalence of parasite infestation in relation to water deterioration and their role in the mass mortality of fish during 2019 in Manzala Lake and corresponding...
Husmaini1*, Riza Andesca Putra1, Indri Juliyarsi1, Tevina Edwin1, Linda Suhartati1, Aditya Alqamal Alianta1, Harmaini2
...tudy were fifty-seven farmers who kept the KBC. The method was survey method and purposive sampling to determine the respondents. The observed variables were breeder profile, maintenance management, number of KBC, actual population (Na), effective population (Ne), and inbreeding rate. The total population of KBC in Nagari Batu Bajanjang, Tigo Lurah District is 1960, with an actual population of 610 chickens, an effective population of 600 chickens, and an inbr...
Mashakgene Isaac Senoamadi, Thobela Louis, Tyasi Teedzai Chitura*
...ed by the smallholder farmers was gathered through a questionnaire-based survey that was carried out by interviewing forty-seven Small ruminants farmers (both males and females) of mixed ages. The average FAMACHA© score for the goats was three while for sheep the average score was 2.62. Ninety-eight goats (60%) had a FAMACHA© score of three and above while fourteen sheep (52.4%) had a FAMACHA© score of three a...
Jabbar Khan1, Mehwish Jehan1, Zeeshan Mutahir2, Muhammad Rafi1, Muhammad Ismail1, Aamer Abbas1 and Jabbar Tanveer3
...rofession of marginal farmers and landless workers in different regions of under-developed countries. The present study was conducted to determine the effect of vitamin E and selenium (Se) on physiological and hormonal status of Damani goat in Dera Ismail Khan, under high ambient temperature. Forty Damani healthy, non-pregnant goats having similar initial body weight were selected. The diets of goats in the treated groups were supplemented with Se (0.3 mg/Kg) ...
Sajad Ali1*, Naeem Ur Rehman Khatak1, Shahab E. Saqib2 and Saleem ur Rehman1
...valuate the impact of farmers’ tenancy status on wheat productivity in selected districts of Central Khyber-Pakhtunkhwa. In this context, 350 wheat growers were purposively selected with 150 landowners and 200 tenants in the study area. A multi-stage sampling technique was employed. Furthermore, to estimate wheat productivity, differences in wheat productivity and socio-economic factors between owner and tenant wheat growers, a log-log regression model a...
Thobela Louis Tyasi1*, Lubabalo Bila2, Nkgaugelo Kgasago3, Siza Mthi4
... might also help goat farmers to have a better understanding of monitoring the growth development, and further assist in selecting replacement males and females using morphological traits.
Keywords | Body weight, Heart girth, Rump weight, Sternum height, Withers height
...
Mona M. Osman1, Kamelia M. Osman2, Manal Abu Elmakarem Mohamed1, Mahmoud E. Hashad2, Jeeser Alves Almeida3, Alaa Saad4, Octavio Luiz Franco5,6, Heba N. Deif 2*
...asma species-specific primers. MIC testing of the axenic isolates showed that 19 of them were 100% susceptible to tulathromycin, streptomycin, oxytetracycline and tylosin and highly resistant to danofloxacin, lincomycin and florfenicol. Some interactions demonstrated significance (p <0.05), such as hemolysis/ tulathromycin (-0.607), tylosin/streptomycin (0.519), lincomycin/ florfenicol (0.808), lincomycin/ oxytetracycline (0.47) and oxytetracycline/H2S (0.7...
Masudul Haq Wani and Arshad Bhat*
...study is to encourage farmers to adopt the new production system module developed by Sher-e-Kashmir University of Agricultural Sciences and Technology of Kashmir for getting doubly benefited though production gains and employment avenues. Keeping in view the benefits and economic value of this legendary crop, the present study is undertaken in the state of Jammu and Kashmir, which enjoys virtual monopoly in the cultivation of saffron, producing around 99 perce...
Muhammad Ali Raza1*, Aneela Zameer Durrani1, Muhammad Hassan Saleem1, Kamran Ashraf2, Muhammad Muddassir Ali3, Kumayl Hassan Akhtar4 and Nazia Rubab5
...s, lawyers, livestock farmers, managers and other literate stakeholders. This survey comprised of a variety of questions related to one-health, use of antibiotics, antibiotics (ABs) residues in milk, meat and yogourt, the role of food safety, organizations, antibiotic resistance, compromise on human health and harmful implications upon animal welfare and eventually one-health due to unnecessary over or under label use of ABs. The results have delineated the ed...
Basanta Kumar Adhikari1*, Deepak Subedi1*, Sumit Jyoti1, Krishna Kaphle2, Chet Narayan Kharel3, Doj Raj Khanal4
...erned authorities and farmers to be vigilant for keeping this disease at bay....
Bridget Adah1*, Clara Kwanashie2, Haruna Kazeem2 and Samuel Mailafia1
...rtance especially pig farmers and veterinarians. The findings of this study indicates the need for further research to illuminate predisposing factors, patterns of distribution and clinical manifestation of leptospirosis in porcine inhabitants in different regions in Nigeria....
Muhammad Tahir Latif1*, Muzzammil Hussain1, Ayesha Latif2, Majid Hamid Bajwa1, Iftikhar Ahmad1, Ali Zohaib1, Naeem Faisal1 and Muhammad Hamza3
...ion of MTR would give farmers the opportunity to increase the productivity of rice crop and their farm income by coping the issues like labor scarcity, less plant population, delay in transplanting with more aged nursery, improper fixation of nursery plants in the soil etc. The study results projected mechanically transplanting area (ha) for riding type MT as well as for walk after type MT respectively as 64.78 and 28 annually. Accordingly, there would be 36.1...
Arshad Farooq1, Muhammad Ishaq2, Abdul Hassan1, Muhammad Zafarullah Khan3 and Asif Nawaz3*
...on knowledge level of farmers about improved agricultural management techniques. Out of 203 subscribers (beneficiary farmers), sixty farmers were interviewed through interview schedule. Knowledge index was used for measuring farmers’ knowledge level. The study revealed that application of mobile phones decreased the communication gap (88%) between ...
Bambang Yudi Ariadi1*, Rahayu Relawati1, Barbara Szymoniuk2 and Waris Ali Khan3
...About psychography, consumers’ concern regarding the environment is more critical than health motivation, primarily in influencing the purchase of organic vegetables. The essential indicators of demography are education and income. Meanwhile, the purchase does not affect the WTP. This research contributes to marketing theory in determining the price of organic products. The practical contribution of strengthening the quality attributes of organic ve...
Syarif Husen1*, Devi Dwi Siskawardani2, Setiawan Deny Rexmardi1, Erny Ishartati1, Muhidin Muhidin1, Jumpen Onthong3 and Ivar Zekker4
...tatoseedsplantedby thefarmers.Inincreasingpotatoproductivity,innovativetechnologyinpotatoseed productionintubersorseedscuttingisrequisite.Thisresearchinvestigatestheeffectof growingmediacompositiononthepropagationofstemcuttingpotato(G0)plantedinthe screenhouse.ConductedinSumberBrantasVillage(1700ma.s.l.),BumiajiRegency,City ofBatu,EastJava,Indonesia,thisresearchutilizedRandomizedCompleteBlockDesign withsevengrowingmediacompositionsandfourreplicatesinamicro-cut...
De Hu, Jia Wang, Huan Wang, Xiang-Yang Leng, Tian-Yi Zhao* and Shu-Min Wang*
...r was induced by water-immersion and restraint stress (WIRS) after 10 days of drug administration. To observe the histopathological changes of gastric mucosa. the activities of pepsin, superoxide dismutase (SOD), malondialdehyde (MDA), nitric oxide (NO) in gastric tissue and the levels of tumor necrosis factor (TNF–α) and interleukin (IL-6) in serum were measured through ELISA, and the contents of NLRP3, ASC, caspase-1 and IL-1β in gastric tis...
Nour H. Abdel-Hamid1*, Walid Elmonir2, Eman I. M. Beleta1, Rania I. Ismail1, Momtaz Shahein1, Mahmoud E. R. Hamdy1
...5). The ERIC and RAPD primers (ERIC2 and Operon 18/ RAPD4) used in this study created polymorphic band patterns in all Brucella isolates and the reference strains. ERIC-PCR and RAPD-PCR Dendrograms clustered the B. melitensis isolates into two clusters and three clusters composed of 16 and 13 genotypes with genetic similarity percentages of 62% and 54% with a diversity index of 0.82 and 0.88. Both ERIC-PCR and RAPD-PCR dendrograms clustered B. abortus isolates...
Zilu Zhang1, Ning Wang2, Ce Hou1, Laiba Shafique1, Saif ur Rehman1, Zhuyue Wu2, Zhiqiang Wang1, Mingsong Wei3* and Kuiqing Cui1*
... goats, four specific primers (PIS1-1, PIS1-2, PIS2 and PIS3) covering PIS fragment were designed, and four DNA fragment were amplifed and sequenced. A 12.814kb sequence was assembled containing the whole goat PIS region both in horned goats and in polled goats, which mean there were no 11.7 kb deletion in the Guanzhong dairy goats.The polymorphisms sites in PIS region of horned and polled Guanzhong dairy goats were identified, and a total of 30 polymorphisms ...
Phassakon Nuntapanich1*, Hathaichanok Nuntapanich2 and Woraman Maicharoen3
...in the community. The farmers in the study site obtain benefits from ecosystem services such as increasing income and maintaining food security (rice and fish) by using local wisdom. Therefore, to ensure sustainable development of rice-fish farming system in the TKR, these things should be implemented: (1) Enhancing the number of fish and biodiversity in paddy fields by reducing using chemical fertilizer and eliminate using chemical pesticides in cropping area...
Muhammad Ismail1,*, Abu Bakar Muhammad Raza1, Muhammad Zeeshan Majeed1 and Umair Abbas1 and Riaz Hussain2
...ach year in Pakistan. Farmers rely on persistent synthetic insecticides for fruit fly control. Insecticidal phytoextracts are biorational alternates to hazardous synthetic insecticides. This study evaluated the efficacy of aqueous extracts of neem (Azadirachta indica A. Juss), garlic (Allium sativum L.), ginger (Zingiber officinale Roscoe) and lime citrus (Citrus aurantifolia (Christm.) Swingle) on the fruits of five citrus cultivars (i.e. bitter orange (Citru...
Ghassan Zahid1, 2*, Sara Iftikhar3, Muhammad Umer Farooq4 and Shakeel Ahmed Soomro5
... conditions allow the farmers to cultivate a variety of fruits which ultimately uplifting the burden from traditionally cultivated crops. In recent years, the cultivation and yield of different fruit trees are declining in the country. The key contributors to the decline in fruit crop yield include abiotic stresses, biotic stresses, certain pathogens and nematodes, market devaluation and access, urbanization, poor gardening, poverty climate change, small landh...
Chandni Wajid1, Abdul Hameed Baloch1, Ahmed Nawaz Khosa1*, Hubdar Ali Kaleri2, Nasrullah Bangulzai1, Sarfraz Ali Fazlani1, Haleema Sadia3, Saeeda Kalsoom4, Muhammad Bilawal Arain2, Wassem Ali Vistro2
...d for DNA extraction. Primers were designed using Primer 3 software and PCR was performed. PCR products were sequenced and analyzed for observing genetic variation in PROP1 gene of these four sheep breeds of Balochistan. The result for PROP1 gene analysis showed 7 variations including 3 frame shift and 4-point mutations with c.63G>A, c.83G>A, c.94G>T, c.104C>G, c.237G>A, c.432T>C and c.450C>T were observed in all three exons of PROP1 gene ...
Preparation and Evaluation of Cattle Feed by Ensiling Wet Rice Straw, Market Fish Waste and Molasses
Avijite Sarker, Sharmeen Islam, S.M. Ariful Islam, Md. Rokibul Islam Khan*, Md Mukhlesur Rahman
... straw which provides farmers with cheap and environmentally friendly cattle feed.
Keywords | Environmental pollution, Silage, Metabolizable energy, Organic matter digestibility, Physical properties
...
Rubaijaniza Abigaba1,4*, Pharaoh C. Sianangama1, Progress H. Nyanga2, Edwell S. Mwaanga3, Wilson N.M. Mwenya1
...emale traditional pig farmers toward reproductive biotechnology application. A cross-sectional descriptive survey was employed to obtain sex-disaggregated data from 622 respondents using a semi-structured questionnaire. Descriptive statistics including frequencies, mean, and standard error of the mean as well as inferential statistics, namely, Chi-square, Mann-Whitney U test, independent samples t-test, ANOVA, and the post-hoc tests were used to analyse the da...
Adil Ali Gadahi1, Wajid Ali Jatoi1, Saima Mir Arain2, Jay Kumar Sootaher1*, Piar Ali Shar1, Sadaf Memon1, Muhammad Saleem Chang3, Zeeshan Majeed Kumbhar1 and Kirshan Kumar Menghwar1
...r deficiency areas of farmers....
Asim Zubair1*, Iffat Batool2 and Ghulam Akbar Malik3
...income and resources, farmers in the selected area were still forced to take out loans to satisfy their basic needs, and the requirement of collateral places them at the mercy of the black market. Mostly people in that rural areas were depending a lot on NGOs for their basics needs. So, the Purpose of this research was to identify the possible role of NGOs in Pakistan’s Agriculture sector. The experience of non-Governmental and community-based organizati...
Abid Hussain1, Mubbashira Nazir2*, Saira Batool2 and Sidra Majeed1
...istics of the adopter farmers have also been studied. The study is based on primary data that was collected from 110 sample farmers in the year 2018. It is found that adopters of the gypsum technology are more educated, having large family size, operational land and livestock holdings. Gypsum application at a rate of 0.26 ton per acre doubled the productivity (26.80 mounds/ 40kg) of groundnut crop than without its use. Benef...
Naseem Sharif1,2*, Imran Muhammad Siqqique2, Muhammad Kashif Raza3, Urwa Irshad1, Muhammad Ikhlaq Khan4, Ammara Noreen4 , Muhammad Ahsan Qureshi1, Mohsin Abbas5, Muhammad Maaz Aziz5, Sitwat Riaz5, Komal Aslam5 and Naseem Akhtar6
... shifting attitude of farmers towards other cash crops, the specie is in high risk of extinction. In this study, sixteen naturally growing wild jujube accessions were analysed based on multivariate analysis. Significant diversity was counted for selected morphological and biochemical traits like leaf length (1.8-5.4cm), thorn length (0.6-2.9 cm), fruit weight (1.88-4.72g), fruit length (8.83-19.34mm), fruit width (11.03 -22.74mm), stone weight (0.32-1.09g), TS...
Oluwaseun Adetarami1*, Oluwatoyin Olagunju2, Babatunde Adebayo Oyebamiji1, Adegboyega Abel Odeyemi3 and Sina Basil Johnson4
... on cocoa smallholder farmers in Ondo and Osun States of Nigeria. Multistage sampling procedure was used to select (160) respondents. The primary data were collected through structured questionnaire. For the data analysis, statistical tools such as budgeting technique and logitistic regression were used. Results of the budgeting technique showed that each farmer of the FBS approach had a mean profit of ₦ 81,134.65 with a cost benefit ratio of 1.09. The resul...
Muhammad Luqman1*, Adeel Mustafa1, Sheer Abbas2, Muhammad Yaseen1, Muhammad Umer Mehomood1 and Raheel Saqib3
...ding to the livestock farmers cow has proven the least productive species in the study area. There is an ignorable trend of spending on mechanized livestock management/handling, paid extension services, and loan repayments. Almost 81% of the livestock farmers said that they only keep the health record of their livestock head. Above 50% of the farmers said that are unable to afford the vete...
Ch. Muhammad Rafiq1, Muhammad Rizwan1*, Bilal Atta1, Arshed Makhdoom Sabir1, Misbah Rizwan2, Muhammad Arshad3, Muhammad Zeeshan3, Hamza Latif3, Usama Bin Khalid1, Shawaiz Iqbal1
...hopperburn’ and farmers face great yield losses. The experiments were performed to evaluate the planting geometry and nutritional effects on N. lugens abundance and yield attributes of the crop using susceptible rice (var. Basmati 515). Results indicated that planting geometries with more space (60 and 90 cm) after 12 lines with a uniform number of plants in each plot had less incidence of N. lugens as compared to narrow spaced (0 and 30 cm) geometries. ...
Imtiaz Ahmed*, Imran Khan and Zia Ud Din
...f the bread and was consumers acceptable....
A. El-Shemy1*, Hoda M. Mekky2, M. A. Bosila2, A. M. Allam1, Kh. M. Elbayoumi2, M. M. Amer3
...livers using specific primers aiming the 3D gene of duck hepatitis A virus-1 (DHAV-1) showed the output of the amplified band in all examined specimens at the certain supposed size of the 3D encoding gene (467 bp). The successfully amplified 3D gene of DHAV-1 isolates, namely DHV/Duck/Egypt/Monofia-Shemy-1/2018, DHV/Duck/Egypt/Al-Gharbia-Shemy-3/2018, and DHV/Duck/Egypt/Monofia-Shemy-2/2018, was subjected to sequencing and then submitted to NCBI GenBank, and t...
Abdullah Channo1*, Asmatullah Kaka1, Qudratullah Kalwar2, Imdadullah Jamali3, Ghulam Jelani2, Muhammad Bakhsh4, Ghulam Nabi Dahri5 and Jai Parkash Goil6
...or economic losses to farmers. COD affects fertility of animal which is important to reproduce young ones, that occurs due to negative impact factors on hypothalamus-pituitary stalkand normal function of the ovarywhich leads to alteration in follicular development, ovulation, reduced reproductive performance, unsuccessful ovulation, increased interval between parturition and conception, low conception rate, decrease in calving rate, increase in number of insem...
C.A. Angel-Sahagún1, J.E. Ortega Palomares1, A.A. Hernández-Rangel1, C. Cruz-Vázquez2, R. Montesinos-Matias3, M. Valencia-Posadas1 and A.M. Cruz-Avalos4*
...ogenic when exposed by immersion at a concentration of 1x108 conidia/ml, causing between 10-100% mycosis at ten days post-inoculation. Four isolates identified as Bb9, Bb6, Ma9 and Ma10, were the most pathogenic as mycosis reached 100%, which places them as potential candidates to be used as biological control agents....
Reyad R. Shawish, Reda E. Hamed*, Zakaria H. Elbayoumi
... health risk to the consumers, followed by kofta, shawarma and burger, respectively. Besides that, positive samples were compared with the European Commission Regulations (EC) of the maximum permissible PAHs limits in the meat products (≤12 µgkg); so, 20 (25.0%) of the examined samples were compatible for human consumption safely. Conclusively, the present surveillance indicated the safety of some grilled commercial RTE meat products in Egypt for huma...
Khalid Khan1*, Ahmed Farhan Saeed2, Sanam Wagma Khattak3 and Saima Liaqat4
...ect the samples of 75 farmers from five tehsils of Lasbela namely Hub, Gadani, Uthal, Dureji, and Bela. Around 15 farmers were randomly selected and questioned in each of the tehsil. To achieve the objectives of study nonparametric correlation coefficient test and regression analysis are carried out. The study accentuated various factors which are responsible for the adaptation of poultry technologies and their standard prac...
Mostafa El-Sebelgy1*, Hanafy Madbouly2, Sabry Tamam2, Nagwa Ata1, Kawther Zaher1
...h RefSeq proteins and primers for multiple sequence alignment. Multiple extrinsic proteins [NS1, NS3 and VP3 of African Horse Sickness Virus (AHSV) and NS3 of Equine Encephalosis Virus (EEV)] were detected and at the same time, integration events were examined in this study. This research work entails unpredicted integration of foreign non-BTV viral proteins (NS1, NS3 and VP3 of AHSV and NS3 for EEV). The multiple sequence alignment models elucidated the exten...
Farmer’s Access to ICTs Tools and Productivity Enhancement in District Charsadda, Khyber Pakhtunkhwa
Ayesha Khan*, Mohammad Tariq Aziz, Urooba Pervaiz and Muhammad Zafarullah Khan
...total 1120 registered farmers. A pre-tested and well-developed interview schedule was used to collect primary data. Statistical Package for Social Sciences (SPSS) was used to analyze the data. Results indicated that 42% respondents had age above 35 years, literate respondents were 80%, 45.5% had farming experience of 1-10 years, half of the respondents (50.1%) were owners, 40.2% had land size of 5.1-10 acres and the majority (78.6%) is indulged in agriculture ...
Khaliq Dad1, Fenliang Zhao2, Rumsha Hassan3, Kainat Javed3, Humaira Nawaz4, Muhammad Usman Saleem5, Tahreem Fatima6 and Muhamad Nawaz3*
...ts because most of the famers have no idea of using these chemicals substances. Pesticides are absorbed by soil particles which are transported to plants as well as animals through food chain and severely affect the ecosystem by causing acute or chronic disorders in the people of all ages. Similarly these pesticides cause serious threats to the aquatic ecosystem after their release by comprising different toxic substances, heavy metals and contaminants. This r...
Rahmat Ullah Khan1*, Asif Sadam2, Karim Gabol1, Waheed Ali Panhwar3, Sajid Mahmood4, Mustafa Kamal5, Hamid Ullah6, Syed Abidullah7, Muhammad Tufail8, Bashir Ahmad4, Gul Bacha Khan4 and Habib Ul Hassan1
...ired among locals and farmers....
Abid Ali1*, Safia Naureen Malik3, Muhammad Akmal2, Hafeez Ullah Rafa2 and Abid Subhani3
...s were collected from farmers’ tube wells during random survey of four tehsils of Gujranwala district, i.e., Gujranwala, Kamoke, Wazirabad and Noshera Virkan. The water samples were analyzed in Soil and Water Testing Laboratory Gujranwala for electrical conductivity (EC), sodium adsorption ratio (SAR), residual sodium carbonate (RSC), chloride (Cl) and sodium (Na) of the groundwater. The results revealed that out of 565 samples, 231 (41%) were fit; 149 (...
Muhammad Akram1*, Muhammad Imtiaz Shafiq2, Amber Malik3, Farmanullah Khan4, Munir Ahmad Bhinder5 and Muhammad Sajjad6
...ed using the specific primers designed by Primer-3 software. GSTT1 and GSTMI genotypes were determined by comparing the sizes of amplified PCR product of genotypes with β Globulin gene, used as internal standard and 100-bp DNA ladder. GSTP1 genotype was determined using the PCR-restriction fragment length polymorphism. Analysis of data was carried out using SPSS software Version 22.0. Statistical significance of p< 0.05 was considered as valuable resul...
Muhammad Jalees
...s to convince their customers/consumers for selling their items. Electronic marketing is an integral part of SCM to attract consumers around the globe, which may extend to the next level when the incorporation strategy between the supply chain partners starts to exist. This study helps to analyze the relationship between SCM profitability, design elements, and the moderating effect of coll...
Hanan Saad El-Samahy, Amani Abd El-Naby Hafez, Mohamed Talat Ragab, Disouky Mohamed Mourad*
... that make the turkey farmers take far away from the turkey production as a result of difficult treatment, medication cost, difficult isolation of causative bacterial agents, weight loss, reduced fertility, and hatchability, so this study aimed to determine the bacterial causative agents using multiplex PCR as an accurate rapid diagnostic technique. Exudates of swollen infra-orbital sinus were aspirated and aseptically collected from affected turkeys of seven...
Victoria Rankotsane Hlokoe, Thobela Louis Tyasi*
...ngs might help cattle farmers to predict body weight using biometric traits.
Keywords | Body length, Correlation, Heart girth, Rump height, Sternum height
...
Khurram Sheraz* and Taj Ali Khan
... and Parachinar while summers are experiencing decreasing temperature trends. Rainfall trends were dominated by positive trends. The results from the DWT and MK tests (at 5% significance level) on the different data types revealed that for higher-resolution data (monthly); the high-frequency intra-annual periodicities affecting air-temperature trends were dominated by 8-monthly fluctuations, and for the lower-resolution seasonal and annual data the interannual...
Auzair Javaid Butt, Irfan Ullah*, Shahid Ali, Khurram Nawaz Saddozai and Jahangir Khan
...ket to facilitate the farmers for selling their produce at a reasonable price and make it accessible for ultimate consumers in preferred shape and location in the required duration. This research is carried out to analyze the existing marketing channels, marketing costs and margins of different market functionaries of potato crop in the selected villages of district Peshawar, Khyber Pakhtunkhwa Pakistan in 2019. For this pur...
Ghalib Ayaz Kachelo1, Nasir Ahmed Rajput1*, Muhammad Atiq1, Shahbaz Talib Sahi1, Nasir Ahmad Khan1, Akhtar Hameed2, Noor Muhammad1 and Muhammad Saqib Mushtaq1
... it is recommended to farmers that, Alternaria leaf spot disease of spinach can be managed by using tilt fungicide and moringa extract....
Djoko Kisworo*, Martina Safitri, BRD Wulandani, Bulkaini, Syamsuhaidi
...he results showed that immersion in SSF and storage decreased (P<0.5) the HU and egg’s weight. While the air cavity and pH increased significantly (P<0.05). The treatment of 0% SSF, 10% SSF and 20% SSF decreased HU values (66.56 ± 0.84 - 58.22 ± 2.83), (63.33 ± 7.43 - 64.94 ± 3.49), (72.07 ± 2.10 - 68.64 ± 3.32) during storage. Likewise, the rate of egg weight loss increased successively (2.20 ± 0.11...
Shahid Ali1*, Murtaza2, Waqas Ahmad1, Nargis Bibi3, Aftab Khan2 and Jahangir Khan1
...farming experience of farmers are considered the most important factors in allocation of inputs during production process. This study, therefore, aimed at evaluating effect of education and farming experience on technical efficiency of rice farmers in Khyber Pakhtunkhwa, Pakistan. A sample of 300 rice growers was drawn randomly using a multistage sampling procedure through a well-organized pretested interview schedule. Stoch...
Hassan Raza1, Muhammad Zeeshan Majeed1*, Muhammad Irfan Majeed2, Mujeeb-Ur-Rehman1 and Muhammad Asam Riaz1
...oden infrastructures. Farmers rely primarily on direct applications of liquid insecticides which usually get off the target site resulting in unsatisfactory and short-term termite eradication along with environmental contaminations. This situation necessitates looking for more target-oriented and ecologically safer strategies such as baiting insecticides with some cellulose attractant. In this study, 5% technical grade fipronil was formulated as small beads (3...
Madumetja Cyril Mathapo and Thobela Louis Tyasi*
...ted Boer goat’s farmers to select their bucks for breeding and also to improve their body weight....
Arshad Mahmood Malik1*, Nigah Hussain1 and Nasim Akhter2
... capacity building of farmers for improving agriculture labor supply in rural agriculture labor market....
Olufemi Bolarin, Sijuade Adebukola Adebayo and Sola Emmanuel Komolafe*
...climate change by yam farmers in Benue State, Nigeria was investigated in this study. One hundred and eighty (180) yam farmers were sampled for the study. Primary data was gathered with the use of interview schedule. Descriptive statistics and regression were used to analyze data collected. The result shows that the mean age of the farmers was 45.3 years and 83.3% were males. The result al...
Oluwatoyin Adenike Fabiyi
...cides by small holder farmers under unregistered informal sector in vegetable farming has culminated in severe environmental pollution, increase in unacceptable percentage of residue in vegetables and resistance of nematodes to the currently used nematicides. This has prompted the evaluation of medicinal plants as probable sources of nematicides. A study was conducted in the screenhouse to evaluate the nematicidal potential of Tridax procumbens and Sida acuta ...
Onwusiribe Ndubuisi Chigozirim*, Okpokiri Chibuzo Ikechukwu, Agu-Aguiyi Fortune Nneka and Oteh Ogbonnaya Ukeh
...ctices of smallholder farmers in southeast Nigeria. The policies, programs, projects, activities of private and public organizations to intervene on climate change-related issues are referred as institutional interventions. The study therefore, identified the institutional interventions and support available for farmers affected by climate change. In addition, identified the climate-smart practices used by the smallholder fa...
Hafiz Qaisar Yasin1*, Dora Marinova2 and Muhammad Naveed Tahir3
...ts inefficient use by farmers. Under the rapidly increasing water scarcity and climate change issues, it is inevitable to assess the actual economic value of canal irrigation water in Punjab. This study applied the Residual Valuation Method to assess the real economic value of canal irrigation water of four major crops (wheat, rice, cotton and sugarcane) in Punjab. The study found that the average economic values of wheat, rice, cotton, and sugarcane crops are...
Hurriya Alzahra1, Susmiati Susmiati2*, Sri Melia3
...and is preferred by consumers, allowing it to be recommended as a functional food.
Keywords | Antioxidants, Fermented milk Lactiplantibacillus pentosus, Oranges, Organoleptic, Total phenols
...
Rijumoni Daimari, Silistina Narzari, Jatin Sarmah*
...edible foods by the consumers. Therefore, the current study aims to examine the nutritional composition of edible viscera namely, liver, kidney, spleen, heart, large intestine and small intestine of Doom pig of Assam, India. The samples were collected from semi-extensively reared pig farms of Kokrajhar district, Assam. The approximate composition range of these edible viscera was found to be: moisture 50.67-68.47%, fat 0.47-9.85%, ash 0.16-0.92%, protein 6.85-...
Marcos E. Bollido1,2*, Renell Jay G. Villaluz1,2 and Ronald L. Orale1
...be filled in by local farmers/raisers with an overall market opportunity of 70,996 kilograms monthly....
Shandana* and Ayesha Khan
...ologies (ICTs) tools, farmers can get timely, up-to-date, relevant, accurate technical information and advice and extension agents can effectively answer farmers’ abundant information needs. Thus, the present study was conducted to investigate the usage of ICT tools in agricultural extension services in Khyber Pakhtunkhwa. For the study three districts (i.e. Swat, Haripur and Mardan) of Khyber Pakhtunkhwa were chosen a...
Naheed Zahra1*, Saira Batool1, Mubbashira Nazir1, Ghulam Akbar Malik2 and Iffat Batool3
...o see how many female farmers contribute to farming and livestock activities. The formal survey collected data from eighty (80) female farmers using the random sampling technique. Research was based small landholders. The study’s main findings demonstrate that agriculture, together with livestock rearing is the primary occupation of the area’s residents. Females were completely involved in all aspects of farming....
Ejaz Ul Haq, Urooba Pervaiz*, Muhammad Zafarullah Khan and Ayesha Khan
...the problems faced by farmers in cultivation of off-season vegetables, evaluate the yield and income of off-season vegetables and the role of extension workers in creating awareness among farming community regarding off-season vegetables. Data were collected from 60 sample respondents from three circles (Mattani, Peshawar and Tarnab) through pre-tested and well-structured interview schedule during February- March, 2020. The results showed that 48.3% far
Ali Ahmad1*, Zubair Aslam1, Korkmaz Bellitürk2, Ehsan Ullah1, Ali Raza1 and Muhammad Asif3
...t. End users, such as farmers, may benefit significantly from the vermicompost generated, since it can be used to replace chemical fertilizers and get higher price for organic products by utilizing locally available composting material....
Khalid Hussain1, Muhammad Younas1*, Niaz Hussain1, Abdul Ghaffar1, Muhammad Raheel2, Anees Akhtar3, Muhammad Irshad1, Munir Abbas1 and Farah Shabir4
... also helpful for the farmers for timely management of fusarium wilt....
Muhammad Usman1*, Aneela Zameer Durrani1, Nasir Mehmood2, Muhammad Hassan Saleem1 and Mamoona Chaudhry3
...dorferi s.l. specific primers through conventional PCR. We found that 4.3% dogs and 8.9% tick pools were positive for B. burgdorferi s.l. Rhipicephalus sanguineus (86.5%) was the most abundant tick species. 57.1% I. gibbosus and 8.4% R. sanguineus pools tested positive for B. burgdorferi s.l. Phylogenetically, our sequences clustered with B. burgdorferi sensu stricto, B. bavariensis, B. garinii, and B. bissettii sequences sourced from different hosts worldwide...
Pharaoh C. Sianangama1*, Brian Tembo2, Sylvia J. Harrison1, Rubaijaniza Abigaba1,3
...lly among smallholder farmers. The study involved four treatment groups: distilled water (DW), urine from artificially inseminated cows (AIC), non-inseminated cows (non-AIC), and non-inseminated heifers (non-AIH). Free-catch urine samples, from 18 randomly selected dairy animals, were collected on day 15, 22, 30, and 35 after insemination and used at a dilution rate of 1:4. Maize seeds were soaked in different treatment groups, followed by observation for germ...
Lobna M.A. Salem, Nashwa O. Khalifa, Marwa O. Abd El-Halim*
...l losses for affected farmers. In order to control the disease and raise farmer awareness, it is vital to implement the appropriate preventive measures.
Keywords | Fasciola species, Prevalence, Phylogenetic analysis, ITS2 gene, Public health.
...
Muhammad Said1, Amjad Hussain Mirani1, Abdul Kabir*1,2, Muhammad Haris Raza Farhan3, Abdul Latif Bhutto1, Ghulam Shabbir Barham1, Khaleeq Ur Rahman Bhutto4, Muhammad Uzair1, Maaz Khan1
...as an impact on dairy farmers’ livelihoods and family nutrition, resulting in significant losses. Because the quantity and quality of milk are so important in the dairy sector, there have been significant financial losses. As a result, adequate maintenance and preventative measures must be maintained in order to ensure any dairy business is viable and sustainable. Various strategies for detecting mastitis have evolved, including proteomic approaches, par...
Nishim Bhusal1, Bhuwan Raj Bhatt2*, Saroj Shrestha3 and Arjun Chapagain4
...conomic losses to the farmers. A cross-sectional study was conducted to determine the prevalence of fasciolosis in commercial cattle farms of Tilottama Municipality, Rupandehi district, Nepal. A total of 270 fresh faecal samples were collected purposively from the study area with different ages, sex, stage, and breeds for examination (sedimentation method) to visualize eggs of Fasciola microscopically. The obtained data were coded and analysed using Microsoft ...
Muhammad Tariq Navid1,2*, Mian Muhammad Awais2*, Muhammad Irfan Anwar2 and Masood Akhtar2
... same specific set of primers. This study concludes that asymptomatic backyard poultry birds can carry AI viruses and act as potential reservoirs that might be responsible for recurrent episodes of AI outbreaks in a region. The viral shedding through oral and/or cloacal route may be the best way to disseminate infection towards the susceptible ones. Lastly, this study urges to vaccinate the rural poultry birds to prevent further spread of the AIVs that interru...
Adefunke Fadilat O. Ayinde1*, Peter Allison Johnston2, Olanrewaju Olusoji Olujimi3, Purnamita Dasgupta4 and Dare Akerele5
...sparity exists in how farmers perceive and adapt to climate variability that influences their production decisions and improved livelihoods. We analysed the perception of cassava-based farmers to climate variability in two ecosystems in Nigeria. Climate data (spanning 1951 to 2010) were used to corroborate and evaluate the perceptions of farmers. Four hundred smallholder far
Sherif Abdelghany1, Hossam Mahrous Ebeid2*, Ahmed Abdelkader Aboamer2, Mohamed Ali Radwan1, Rania Agamy1
... by smallholder dairy farmers. The main objective of the study was to develop an assessment protocol to evaluate feeding practices at small dairy farms. The study was based on 56 smallholder farms that raised crossbred cows and local buffaloes in mid-lactation, with an average of 4.4 parties and an average herd size of 1.28 and 1.19 head/farm for Nile Valley and Newly Reclaimed districts, respectively. A structured questionnaire survey was designed, and field ...
Masixole Maswana, Thinawanga Joseph Mugwabana and Thobela Louis Tyasi*
...tudy will help donkey farmers, extension officers and researchers to understand the morphological variation among donkey breeds....
Muhammad Mansoor1, 2, Sheheryar1 and Shahid Ali Khan1*
...tion is uncertain for farmers. In addition, through adding nitrogen via nodulation, it can also be intercropped with cotton as it can give fair yield without presenting any competition with cotton crop....
Muhammad Mansoor1, 2, Sheheryar1 and Shahid Ali Khan1*
...tion is uncertain for farmers. In addition, through adding nitrogen via nodulation, it can also be intercropped with cotton as it can give fair yield without presenting any competition with cotton crop....
Bilal Saeed Khan1*, Muhammad Arslan1, Abdul Ghaffar2, Muhammad Farooq2, Saghir Ahmad3, Sami Ullah4 and Awais Rasool5
...uld be concluded that farmers should consider conservation activities of mite fauna through intercropping to enhance the soil fertility thereby fruit production....
Neni Widaningsih1,2*, Budi Hartono2, Hari Dwi Utami2, Eni Siti Rohaeni3
...ers, retailers, and consumers. The number of respondents in this study was 135 persons. Methods of data analysis carried out include; qualitative analysis and quantitative analysis. Qualitative analysis is intended to find out the characteristics of marketing institutions, and the marketing channels of buffalo cattle. While quantitative analysis is intended to find out margins and farmer share and marketing efficiency. The results of the study obtained that th...
Abdul Kabir1, Muhammad Rasheed2, Hubdar Ali Kaleri5, Depeesh Kumar Bhuptani3, Mithan Kumar4, Raza Ali Mangi6, Abdul Wahid Solangi4, Sheva Dari1, Saqib Kakar4, Panah Munir4, Ekra Akbar4 and Rameez Raja Kaleri4,5*
... both producers and consumers, we need an effective and quick action plan. The first step is to ensure that farm produce, livestock feed, and veterinary medication can circulate freely. Many critical services, for example, were not affected by the lockdown. Essential services such as food, feed, and agricultural inputs have been identified....
Supply Response Analysis of Gram in the Context of Prices and Non-Prices Factors in Punjab, Pakistan
Naheed Zahra*, Muhammad Qasim, Muhammad Azam Niazi, Muhammad Ishaq and Mubbashira Nazir
...insurance packages to farmers that motivate them to enhance the area under gram. To make gram competitive there is need to provide level playing field i.e., support price policy, for gram as is provided to wheat the major competing crop in the pulses area....
Ahmed Abdul Gafar
...ctivities of the rice farmers, the rice supply chain to find out if the general view of the impact from literatures is similar or different and then propose pro-active measures/strategies to mitigating shocks against any future outbreak. Data were collected from over 300 households which include about 165 rice farmers. All the rice farmers are male, with an average age of 34 years with maj...
Mochamad Rizal Umami1, Zainuri*2, Sebastiana Viphindrartin2 and Rafael Purtomo Somaji2
...dertaken by sugarcane farmers, to reveal the role of social capital in shaping the sugarcane trade system during the pandemic. This research is a qualitative research that uses primary data from interviews with key informants by multistage sampling technique. The data processing includes data reduction, data display using Decision Explorer version 3.3 software. Data were analyzed through descriptive methods and content analysis. The study found that the COVID-...
Khalid Farooq, Muhammad Tahir and Nazir Ahmad Khan*
Muhammad Saif-ur Rehman1, Faiz-ul Hassan1* and Muhammad Sajjad Khan2
...s. A total of 80 RAPD primers were used for PCR amplification of DNA from the cattle breeds. The PCR products were analyzed by agarose gel electrophoresis. Scoring of bands were performed to generate dendrogram using unweighted pair group method of arithmetic means (UPGMA). Six hundred and four amplified bands were observed from successful amplifications of 73 primers (average 8.2 bands per prime). Only seven pri
Lei Zeng1,2,3,4, Pimao Chen1,2,3,4, Zhenzhao Tang1,3,4, Jie Yu1,2,3,4 and Guobao Chen1,2,3,4*
Muhammad Yaseen1*, Muhammad Luqman1*, Bushra Pervaiz2, Rana Shahzad Noor3, Muhammad Ameen4, Sadia Hassan3 and Wassi Abbas1
... of the study was 120 farmers. An interview schedule was used as a research instrument for data collection using the face-to-face interview method. Descriptive statistics; mean, frequencies and percentages were applied to draw results and to interpret. The prominent mode of rural advisory services by the public sector was ‘training program’ whereas for the private sector it was ‘advice on phone’. The public and private sectors should co...
Faisal Khurshid1*, Asad Ullah1 and Sana Manan2
...innovations among the farmers community. The data were collected by using stratified random sampling technique. A sample size of 322 farmers was selected randomly from three villages namely Palosai, Badizai and Shahi Bala of the District Peshawar, Pakistan. The conceptual framework of the study comprised of an independent variable (knowledge of innovations) and dependent variable (adoption of agricultural innovations). Chi-s...
Barbosa Carla1*, Gregori Fabio2, Thomazelli Luciano1, Oliveira Amanda1, Araújo Jansen1, Ometto Tatiana1, Marcatti Roberta3, Nardi Marcelo3, Paludo Danielle4, Utecht Nathalia1 and Edison Durigon1
...ed-PCR protocol, with primers targeting RdRp region. Positive samples were confirmed using Sanger followed by Ion Torrent S5 sequencing platforms and results were submitted to phylogenetic analysis. From total of 8 confirmed samples, 3 clustered to Deltacoronavirus genus and 5 to Gammacoronavirus. Two of those samples showed partial sequences of other regions of CoVs confirming their genotyping to Gammacoronavirus genus and proximity to important poultry disea...
Y. I. Erum and F. Shahina†
...re generated using 14 primers with an average of 28.8 bands/genotype. Maximum
percentage of polymorphic loci was 92.86% for genotype TJ-83. Inferences have been made regarding bioassay and
molecular characterization that the most diverse and resistant genotype against CCN was Moomal-2002 as compared to the
rest of the genotypes studied and the most effective loci to screen diversity was OPA-09.
...
I. Umar† and A. Mamman*
...ecommending to cowpea farmers.
...
Farhana Binte Zalal, Prodip Kumar Sarkar*, Mahbuba Sultana, M H Kawsar, Swapon Kumar Fouzder
...randomly selected 150 farmers (50 broody hens/Upazila) practicing natural incubation from three Upazilas in the Barishal district. The results show that mainly females (93.3%) were engaged in family poultry production and they used indigenous hens to incubate eggs. An average egg number per clutch was 12.6 and farmers set 12.3 eggs per broody hen for incubation purposes. The hatching egg weight was 37.3 g with egg hatchabili...
Ahmad Abrar Khan1*, Ghulam Qadar1, Asif Ali Abro2 and Muhammad Awais3
...et dealers and fellow farmers were the key factors of yield losses. It is recommended to spray on the proper time along with follow-ups and physical control techniques. Selection of right time, control methods, appropriate insecticides/pesticides along-with recommended dose and treatments must be defined by the recommendations of agriculture experts instead of fellow farmers and agrovet sellers. Trainings, workshops and fiel...
Hendro Prasetyo1*, Diah Karmiyati2, Roy Hendroko Setyobudi2, Ahmad Fauzi2, Trias Agung Pakarti1,3, Mardiana Sri Susanti4, Waris Ali Khan5, Leila Neimane6,7 and Maizirwan Mel8,9
... large number of rice farmers continue to grow local rice variants. This study aims to identify, analyze, and describe farmers’ attitude and behavior. A survey was employed for quantitative data gathering and an interview was for the qualitative ones. A total of 52 respondents were of local rice farmers in Sidodadi and Banturejo villages of Ngantang district, Malang Regency, East Jav...
Aulia Evi Susanti1*, Rudy Priyanto2, Muladno2, Dewi Apri Astuti3, Lucia Cyrilla2
Sutawi*, Ahmad Wahyudi, Abdul Malik, Suyatno, Asmah Hidayati, Imbang D. Rahayu, Endang S. Hartatie
...avy social impact for farmers such as illness, stress, depression, stroke, divorce, and even suicide.
Keywords | Airborne disease, Cattle agribusiness, Economic bioterrorism, Economic losses, Foot and mouth disease
...
Abdul Hadi Wasil1,2*, Jasmin Arif Shah1, Nur Bahiah Mohamed Haris1, Sardar M. Hashimi3 and Khal Mohammad Ahmadzai4
...to almond smallholder farmers in the Tarin Kowt district. The results revealed a medium level of knowledge and attitude, and a high level of practice toward organic fertilizer adoption among the almond smallholder farmers. The finding showed that 97.4% of the farmers used cow manure and 20.7% used poultry manure. About 62.9% of the farmers used 0.67-1.08...
S.H.M. Faruk Siddiki1*, Md. Golam Morshed2, Md Robiul Karim1, Lutfun Naher1, Md. Sodrul Islam3
...onomic losses for the farmers. This study was conducted to determine the clinical prevalence of diseases in cattle attended at the Upazilla (sub-district) Veterinary Hospital, Mirzapur, in the Tangail district during the period between January 2017 and December 2018. A total of 22,418 clinical cases of cattle were diagnosed using general, physical, clinical, and microscopic examinations, as well as other conventional laboratory procedures. The recorded clinica...
Hendrikus Fatem1,3, Abdul Latief Toleng2, Muhammad Yusuf2*, Herry Sonjaya2
...esearch that involved farmers and Bali cows reared under palm oil plantations. A total of 71 heads of Bali cows that have been calving for two consecutive times were used in the present study. The parameters measured were services per conception, length of pregnancy, the interval from calving to the first AI, the interval from calving to conception, and the calving interval. The results of this study showed that the number of services per conception (±S...
Muhammad Humayun Kabir* and Md. Saiful Islam
...lding capacity of the farmers and to make a comparison between public and private extension services regarding their effectiveness towards farmers’ capacity building. A multistage (both purposive and random) sampling method was applied to select the study location as well as the sampling unit (farmer/household head). Data were collected from randomly selected 336 farmers of Dhamrai U...
Trisiwi Wahyu Widayati1*, Aris Triyono Syahputra2, Andoyo Supriyantono1, Onesimus Yoku1, Deny Anjelus Iyai1, Priyo Sambodo1, Iriani Sumpe1
Hasnain Raza1,2, Qun Liu1*, Muhammad Tariq Hanif2 and Yanan Han1
..., while Scomberomorus commerson and Parastromateus niger were overfished and Lutjanus argentimaculatus was strongly overfished. However, all the stocks were subjected to overfishing. Therefore, the parameters estimated from our study may be used as indicators for the sustainable management of the fisheries in the country....
Safriyanto Dako1, Nibras Karnain Laya1, Syukri I Gubali1, Ari Ardiantoro2, V.M Ani Nurgiartiningsih3, Gatot Ciptadi3, Desinta Wulandari3, Suyadi Suyadi3*
...17, HEL13, and BM1818 primers. A total of 74 alleles were identified across entire populations. The expected heterozygosity ranged from 0.407±0.216 (Bali) to 0.716±0.050 (Gorontalo), and the observed heterozygosity ranged from 0.471±0.084 (Bonebolango) to 0.778±0.222 (PO). F statistical analysis includes FIS 0.038, FIT 0.248, and FST 0.231. The three microsatellite markers were moderate (0.25-0.5) to highly informative (PIC>0.5)....
Muhammad Yaseen1, Muhammad Luqman1*, Sheer Abbas2, Usman Saleem1, Abdul-Gafar Ahmed3 and Muhammad Salman Aslam1
... changing conditions. Farmers have not appropriate resources to recover these gaps produced by climate changes. This study makes an attempt to check farmers’ awareness regarding climate. It also inspects the inferences of climate change on major cereal crops like wheat, maize and rice at district level. It is expected that majority of crops under consideration to be harmfully affected by increasing temperature and irre...
Zubair Ali, Muhammad Sohail*, Yasir Ameen, Hamidullah, Ishtiaq Ahmed and Mehwish Malik
...udy area due to which farmers were complaining about reproductive issues of their animals. Therefore, this study was conducted for assessment of reproductive health of cow genital tract using real time B mode Ultrasonography in order to improve the economics of the farmer through decreasing calving interval and improvement of fertility and conception rate. Out of total cows (n=261) observed, 79% of the cows were found positive for various reproductive disorder...
Doungnapa Promket1,2,4*, Khanitta Pengmeesri2,4, Jennarong Kammongkun3, Thassawan Somchan2
...typing using specific primers and restriction enzymes for each gene, and polymerase chain reaction-restriction fragment length polymorphism was used to identify the genotypes (PCR-RFLP). Three genotypes were found for each gene as BB, Bb and bb for NPY; TT, TC and CC for DRD2 and II, ID and DD for VIP. Genotype frequencies of NPY (range 0.13-0.58), DRD2 (range 0.06-0.55) and VIP (range 0.14-0.57) were reported. For the NPY gene, allele frequency of b (0.72) wa...
Faradji Khalil1*, Slimani Noureddine2 and Senoussi Abdelhakim3
...ation (2021-2022), 50 farmers who agreed to cooperate in the research were randomly selected to engage in agriculture and animal husbandry. These farms are also located in a lower arid bioclimatic zone with cool winters. The methodological approach followed to carry out our study requires the use of appropriate observation or survey methods and the use of analysis means adapted to the situations encountered. In this context, the means used to carry out this wo...
Siti Azizah1*, Salsa I Latifah1, Irfan H Djunaidi1, Anif M Wati1, Achadiah Rachmawati1, Siti Hamidah2
...rmer households cause farmers to try various ways to meet their family’s needs. One way is to involve family members, especially wives, in economic activities. We conduct this research as a prior study about women’s inclusion in forest-dependent communities that highlight women’s productivity and the contribution of women’s income to beef cattle farmers in Karangtekok, Baluran National Park, Situbondo...
Enas K. Abo El-Maged, Azza H. El-Salakwy, Safia A. El-Gamal and Gehn Allam
...g one pair of general primers which allowed for the amplification of HPV types 16, 18, 31, 33, 52, & 58. These primers were designed to amplify E6/E7 gene junction sequences. Twenty nine out of 100 (29%) samples of aborted products of conception were positive for HPV E6/E7 sequences. In comparison. only one of the placental tissue specimens was positive. All the specimens were positive for ꞵ-globin DNA. Positive PCR pr...
M. A. Abou El- Nasr1, Kh. A. Dougdoug1, Hayam S. Abdelkader2, and Rehab A.
Dawoud2
...rated oligonucleotide primers were designed to amplify the N-terminal portion of the capsid protein of PPV. The amplified products were cloned into pGEM-T-Easy vector and hybridized to PPV DNA specific probe labeled with Dig-I 1dUTP. DNA sequencing using fluorescent dideoxy nucleotides showed that the capsid protein region of PPV-EA strain had about 65% sequence homology with other strains of PPV and 45% similarity to the CP or PPV-D strain. A PCR fragment cod...
A.S. Gamal El din1; Sohair I. El-Afifi2; A. S. Sadik 2; Nashwa M. A. Abd El-Mohsen1; and H. M. Abdelmaksoud1
...the use of degenerate primers through polymerase chain reaction (PCR). Large-scale amount of PVY (N-Egypt) coat protein produced by gene expression technique in E. coli through: (I) Insertion of CP gene isolated by RT-PCR into Pinpoint Xa-l Vector by ligation and propagation after transformation process in E. coli. (2) Isolation of plasmid DNA. then used restriction enzymes Bam HI and Bgl II to identify clones containing inserts. To confirm the fragment insert...
A.Y. Ahmad1, M. A. Amer2, T. A. Mostafa1, F. M. Abo El-Abbas1, and M. El-Hammady1
...cters. Three pairs of primers were selected to react with 5'-non-translation region (5'-NTR) and PI gene from the PVY genome. PCR products yielded by one primers pair reached 835 bp. while reached about 1 kb (974, 926 bp) by the other primers. Partial sequencing or fragment 835 bp was performed. Comparing with standard PVY strains showed highest similarity with PVY NTN -H followed by PVY N...
E. K. Allam.1; B. A. Othman.1; Hayam S. Abdelkader2; and Noher A. Mahmoud2
...on (RT-PCR) using two primers specific for the coat protein gene or GFLV. Nucleotide sequences of the RT-PCR products confirmed that these sequences were amplified from the GFLV coat protein gene. A specific GFLV Dig labeled DNA probe was prepared by PCR and detected the GFLV virus in fresh leaves up to 10-5 dilution in dot blot hybridization assay. It was suggested that the inhibitory compounds released during the extraction of RNA constitute a limiting facto...
Characterization and Molecular Detection of Tomato spotted wilt Tospovirus Infecting Tomato in Egypt
Hayam S. Abdelkader1; Gamalat M. Allam1; T. A. Moustafa2; and M. El-Hanunady2
.... RT-PCR assays using primers complementary to the nucleocapsid protein gene (NPs) were used to detect two isolates of TSWV from Lycopersicum esculentum and Physalis peruviana plants. Total nucleic acids were reverse transcribed using Retrotool reverse transcriptase enzyme and the PCR reactions were performed for 30 min in a capillary thermal cycler. RFLP analysis of the PCR products was performed using Msel restriction enzyme. The results showed a dimor...
Om-Hashem M. El Banaa l, A.A. Abou Zeid2, Fawzia I. Moursy3 and Azza, G. Farag
...solid-phase. Specific primers based on the sequence of the Morocco strains of S. citri Saglio (R8A2HP and G113) were used. Two pairs of primers SC. SC’ and SC8. SC9 were used. PCR fragment of correct size 330bp was amplified with primers SC. SC expressing spiralin gene and 760bp was amplified with primers SC8, SC9 for recA gene. No amplified produc...
Sahar. A. Shoman1 and B. A. Othman2
...rate and undegenerate primers. The primer pairs generated two specific PCR fragments of 3428 base pair (bp) and 3836 bp of the whole TMV genome. The intensity of these RT-PCR amplified products was estimated, and it indicated relatively to the amount of the virus in the infected plant, The specificity of amplification was verified using internal primers through nested—PCR (n-PCR) to demonstrate the specificity of this ...
A. S. Gamal El din1; Sohair I. El-Afifi2; A. S. Sadik2; Nashwa M. A. Abd El Mohsen1; and H. M. Abdelmaksoud1
... RT-PCR with specific primers. ...
Muhammad Zeeshan Khan1*, Umar Khitab Saddozai1, Abdul Aziz Khakwani1, Mohammad SafdarBaloch1, Atiq Ahmad Alazai2 and Muhammad Amjad Nadim1
...e awareness among the farmers to choose the proper weedicide among the current weedicides available in the market for controlling weeds in wheat. The present research work was conducted to evaluate the efficacy of newly approved weedicides to control weeds in spring wheat (Triticum aestivum L.) at Dera Ismail Khan, Pakistan, during season of 2019-2020. The experiment was laid out in randomized complete block design with split plot arrangement having 3 replicat...
Tarique Ahmed Khokhar1*, Atta Hussain Shah1, Muneer Ahmed Jamali1 and Asghar Ali Kamboh2
...banization, most of consumers purchase the meat in fresh form because they hardly find time to purchase daily fresh meat. Therefore, they purchase the meat in bulk quantity to meet their daily necessities and stored in freezer or refrigerator and consume after certain intervals. Hence the present study was designed to evaluate the effect of chilling, freezing and repeated-thaw cycles on chemical quality of various meats. The influence of different time was obs...
Hassan Raza1, Muhammad Kashif Afzal2, Muhammad Luqman1*, Tahir Munir Butt3, Muhammad Yaseen1 and Muhammad Umer Mehmood1
...imate goals. However, farmers struggle to manage the olive crop due to a lack of practical knowledge and training sessions on advanced production techniques. Keeping in view the above-mentioned facts, it was imminent to assess the awareness level and adoption of olive growers of the Pothwar region of Punjab so that they can contribute effectively to the uplift of agriculture as well as their livelihoods. Pothwar region comprises Attock, Chakwal, Jhelum, and Ra...
Seyi Olalekan Olawuyi1*, Adedotun Oluwagbenga Anjorin2, Oluwagbenga Titus Alao3, Tosin Dolapo Olawuyi3, Rachael Ajibola Ayinla3 and Rasheed Ayodele Ayinla3
...text-align: justify;">Farmers are faced with the problem of food insecurity, which is driven by climate extreme events, soil degradation, economic instability, lack of sound agricultural policy, unstable political situation, herders-farmers crisis, and other pressing challenges. Most notably, bio-security threats, and other unobserved events ravaging the agri-food system, and causing significant loss of farm output, disrupti...
Abid Hussain1*, Hassnain Shah1, Muhammad Nadeem Iqbal2 and Tariq Sultan3
... respectively. Sample farmers reported that use of the technology resulted in premium prices of the produce by ten percent. Benefit cost ratio of micronutrients use for citrus orchards was 5.71. Use of micronutrients for off-season vegetables resulted into even better gains; increased productivity of chili pepper, cucumber, bottle gourd and bell papers by 31.9, 40.6, 29.9 and 11.1 percent; with benefit cost ratios of 28.1, 17.4, 15.0 and 11.4, respectively. Si...
Nitya Salsabila, Djalal Rosyidi, Agus Susilo*
... can be accepted by consumers and can be applied in the development of the latest innovations in the production of beef jerky by the public.
...
...
Natalia Shchur1,2*, Olha Chechet1, Tetiana Mazur2, Oleksandr Martyniuk2, Olga Gorbatiuk1, Halyna Buchkovska1, Iryna Musiets1, Diana Ordynska1, Olena Finkova3, Larisa Moskalenko3, Tetiana Ponomaryova-Gerasimyuk3, Maksym Lusta3, Vitalii Nedosekov2
...al health hazard to consumers posed by the presence of Campylobacter jejuni in industrial poultry and poultry products, as well as its resistance to various antibiotics. The study also reports a high rate of detection of resistant Campylobacter spp. among agricultural animals and the population in Ukraine, necessitating the introduction of an effective strategy for systematic monitoring of campylobacteriosis. Research results showed a high rate of detection of...
Syed Muhammad1*, Badar Naseem Siddiqui2, Farhat Ullah Khan1, Muhammad Adnan3, Sami Ullah3 and Nawab Khan4
...ion technology to the farmers. Main objective of the existing study was to understand the technical competencies possessed by public agricultural extension field workers (EFS) in the Khyber Pakhtunkhwa (KP) province of Pakistan.Data were collected through a validated and pre-tested structured questionnaire from 300 randomly selected farmers of five districts of KP (namely Karak, Swabi, Mardan, Upper Dir and Charsadda), and a...
Abdul Hassan1*, Arshad Farooq1, Muhammad Ishaq2, Ghulam Sadiq2 and Asif Nawaz3
...This study focused on farmers’ perceptions regarding climate and non-climate risk, their coping strategies and association to socioeconomic attributes. The study was carried out in two districts Nowshera and Charsadda of Khyber Pakhtunkhwa, Pakistan using principal component analysis approach and regression analysis. The data were collected randomly from 130 sampled vegetable growers comprised of 65 respondents each from Nowshera and Charsadda districts ...
Muhammad Mukhtar1*, Lely Ummi Wakhidah2,Mohammad Zubair Hippy3
...e income of livestock farmers is the livestock business actor himself with an interest weight of 0.399. In conclusion, taking into account aspects of supporting strategies, namely improving livestock technology and reporting systems, improving animal disease management and feed quality, facilitating business licensing, and strengthening legal regulations on livestock. ...
Rogia SA Gomez*, Said H Mbaga
...es adopted by broiler farmers in the Pwani region, Tanzania. A structured questionnaire was administered to 78 broiler farmers complemented with on-site observations. Data collected were related to the socio-demographic characteristics, the structure of broiler farms, the level of biosecurity in the farms as well as the constraints related to levels of adoption. Descriptive statistics were used to determine the relative freq...
Endang Baliarti1*, Muh Auliya Rozzaq2, Adi Tiya Warman2, Sigit Bintara3, Tri Satya Mastuti Widi1, Diah Tri Widayati3, Bayu Andri Atmoko4, Tristianto Nugroho1
...d on information from farmers. Data were analyzed by analysis of variance followed by Duncan’s Multiple Range Test, Pearson’s correlation, principal component analysis (PCA), canonical discriminant analysis (CDA), and canonical correlation analysis (CCA). Results showed that Bali Cross (Limbal and Simbal) have higher body morphometric (P<0.05) but lower reproductive performance (P<0.05) compared to Bali Cattle. The first three principal compo...
Martin-Luther Oseni Okolo1, Monday Eneojo Akor1, Cornelius Arome Omatola1*, Zainab Penninah Ochada1, Ugbane Eleojo Okolo2, Benjamin Mudi Idache3, Andrew Isiramen4, Julius Akor Omatola5 and Moses Adaji David6
...revalence showed that farmers had the highest prevalence (2.56%) followed by those who identified as traders (2.16%) and civil servants (1.79%). Yet among patients who identified as students, no incident of TB was observed. Patients with secondary education had the highest prevalence (3.08%) followed by patients with tertiary education (1.58%). Patients with no formal education and primary education had no co-infection. Between the sociodemographic factors tha...
Md. Saiful Islam Siddiqui1*, Sharmin Akter2 and Mohd. Riajul Islam2
...aluate factors govern farmers “selection of antibiotics” and to assess the status of poultry farmers knowledge about antibiotic resistant (ABR). A cross-sectional survey was conducted over a period of around one year among 50 broiler farms of about 25000 birds at Sylhet district in Bangladesh. Data revealed that Amoxicillin, Enrofloxacin, Ciprofloxacin, Levofloxacin, Azithromycin, Cephalexin, Erythromycin, Neomyc...
Budi Guntoro1*, Agung Triatmojo1, Bambang Ariyadi2, Nguyen Hoang Qui1
...d FMD. A total of 868 farmers from 4 regions in Yogyakarta Province participated in this study through face-to-face interviews using a multi-stage random sample method and quota sampling. Descriptive statistics were used to analyse primary data from the survey. Farmers were chosen by the criteria of who are staying and raising beef cattle in Yogyakarta. The results showed that farmers had ...
Winda Sartika1*, Budi Hartono2, Hari Dwi Utami2, Lilik Eka Radiati2
..., distributors, and consumers of rendang with qualitative and quantitative descriptive data analysis. The results of the study show that the resilience of the beef rendang industry during and after the Covid-19 pandemic caused good collaboration and cooperation between the institution chain involved; supply begins with the provision of beef raw materials in terms of information flow, financial flow, and product flow. Vertical collaboration from rendang raw mat...
Muhammad Usman Shafi1, Hafiz Azhar Ali Khan1*, Tiyyabah Khan2, Waheed Anwar2, Adnan Akhter2 and Muhammad Zubair3
...sks and storage among farmers in Lahore division of Punjab, Pakistan. And, to get knowledge from farmers regarding local knowledge system (LKS) and Integrated Pest Management (IPM). Most of respondents 97% (out of total 250) were male and 28% were between the ages of 26-45 years. Thirteen percent respondents had acquired education up to secondary level, and 92% respondents got knowledge about pesticide usage from pesticide r...
Sigit Bintara1*, Riyan Nugroho Aji1, Panjono2, Ali Agus3
...s. Freezing was run by immersing the forage in liquid nitrogen for 24 hours before the post-thawing examination. Results showed that spermatozoa diluted with egg yolk citrate supplemented with 3% lycopene (P3) had better quality than that found in the other four treatments, namely motility before freezing (70.86%) and post thawing (53.00%); viability before freezing (76.00%) and post thawing (60. 14%); plasma membrane integrity before freezing (71.29%) and pos...
Fakhra Nazir1*, Sahar Fazal1 and Fakhar-i-Abbas2
...ified using universal primers and PCR products were confirmed by 1% agarose gel electrophoresis. Sequencing was carried out by Sanger’s method and BLAST analysis identified these samples as five species (Urocissa flavirostris, Dendrocitta vagabunda, Corvus splendens, Corvus corax and Corvus macrorhynchos) from three genera of family Corvidae. The nucleotide sequences were submitted to the Barcode of Life Data System (BOLD) and the eligible sequences were...
Navjot Hothi
...bution to small-scale farmers. The summer and monsoon months of 2022 witnessed a sudden spurge across 14 states and 1 union territory in India, with a spread spanning 251 districts and 43,759 epicenters. Around 2.4 million cattle were affected in India, and 0.11 million cattle succumbed to the disease. The 10 most affected states have been analyzed for mortality and morbidity. The mortality rate in different districts in India varied between 5% and 45%. The mo...
Abdul Zahir1*, Asad Ullah1, Muhammad Jawad1 and Syed Attaullah Shah2
... this research study, farmers’ awareness of water uses rights and their satisfaction with irrigation water distribution were assessed. For this purpose, 466 farmers were randomly selected through a multi stage stratified random sampling technique from three irrigation sections in District Malakand, District Charsadda, and District Mardan, Khyber Pakhtunkhwa (KP). This study revealed that majority of the respondents did...
Monis Hussain Shah1*, Riaz Ur Rehman2, Riaz Ali Shah1, Farwa Batool3, Rizwan Rafique4, Muhammad Usman5, Sajida Bibi6, Sadia Yasin7 and Samida Qamar8
...commendation to local farmers for better yield. Four tulip varieties cv. Antarctica, Oxford, Ballerina and Apeldoorn were purchased for evaluation. The 100 bulbs of each variety were planted in the bed. The performance of the plants during 2017-18 were judged by observing the bulb germination percentage, leaf width (cm), leaf length (cm), scape length (cm), flower size (mm), primary color of the flower, secondary color of flower, no. of large, medium and small...
Siswanto Imam Santoso*, Agus Setiadi, Wahyu Dyah Prastiwi
...sia. Two hundred duck farmers in Brebes Regency were randomly selected as research respondents. Brebes is the duck production center of Indonesia. Approximately 80% of duck egg production originates in this area. The variables utilized include socioeconomic characteristics of duck farmers, social variables, age, education, medicinal seeds, feed, dried-cooked rice, trash fish, processing, business pattern, marketing, technolo...
Samin Ullah1, Huma Rizwana1, Abdul Kabir1,2*, Atique Ahmed Behan1, Muhammad Naeem1, Ghulam Shabbir Barham1, Abdul Hafeez Bukero1, Anees ur Rahman1, Naseeb Ullah1 and Shafiq ur Rahman Shah1
...provides evidence for farmers to consider increasing colostrum feeding quantity in their management practices to improve the health and growth performance of their calves. Information aids farmers raising crossbred Holstein Friesian calves; cut vet expenses, boost calf productivity, and increase profitability. Overall, this study highlights the importance of adequate colostrum feeding in the early life of calves, which has s...
Mehwish Malik1*, Zanib Sadia2, Muhammad Sajid3, Hammidullah1, Yasir Amin1, Zubair Ali1 and Sohail Ahmad1
... economic loss to the farmers and consumers and many other workers related to this industry. The aim of this study was to isolate the E. coli from slaughtered chicken of open poultry markets and to check that how much the Cephalosporins are resistance to ESBL E. coli in Abbottabad region. E. coli is isolated through General microbe’s culture methods and biochemical tests. The E. coli isolated is further tested for ESBL...
Abdullah*, Imtiaz Khan, Muhammad Ishfaq Khan, Muhammad Ibrahim and Muhammad Fawad
... helioscopia L. Thus, farmers and the scientific community found the information from this study to be extremely helpful in developing a strong integrated weed management plan for the chickpea crop in District Karak....
Saqib Ali Rustam1, Shoaib Sultan Afridi2, Muhammad Inamullah Malik1*, Shakeeb Ullah1, Syed Muhammad Kamal Shah1, Faiqah Ramzan1, Arsalan Khan3, Israr ud Din3, Wasimullah3, Hafiz Ahmad Raza4
...cement in input rates farmers need economical and efficient source of feeding. After sugar cane, sugar beet is major crop of area and its pulp is easily available as there are four function Sugar Mills in the district. Its first study to check the effects of urea treated sugar beet (Beta vulgaris) pulp feeding on weight gain of Bulkhi sheep.
...
Abiyu Tadele 1,2*, Gebreyohannes Berhane2, Wondmeneh Esatu3
...n are essential for consumers and chicken husbandry, helping them to anticipate yield, market, and exploitation of the genotypes in future breeding plans. The main ecotypes in Southwest Ethiopia are the indigenous naked-neck and normal-feathered chicken genotypes, and the exotic Tetra H, a dual-purpose genotype that was imported from Hungary. Data were collected from 168 hens of the three genotypes kept under intensive management for 20 weeks. The Tetra H geno...
Yingying Ye1, Chengrui Yan1, Kaida Xu2, Jiji Li1, Jing Miao1, Zhenming Lü1 and Baoying Guo1*
...s study, we developed primers for nine microsatellite loci resulting from an enrichment process based on the Wenzhou population. Eight out of nine microsatellite loci were used to analyze population genetic diversity of cuttlefish in China Sea. The results showed high levels of genetic diversity in all populations with highest mean number of alleles and mean effective alleles estimated in population Ningde and lowest in Qingdao. Heterozygosity at species level...
Nadia Jabeen1, Abdul Mubeen Lodhi1*, Rehana Naz Syed1, Muhammad Ali Khanzada2 and Alia Gul3
... ITS4 and ITS1F primers designed from the conserved regions as described in the previous studies. The amplified PCR products were sequenced from Macrogen Korea, via worldwide scientific Pakistan. Phylogenetic analysis of the obtained sequences was done based on the maximum similarity method using Mega 6.0. The spore was smaller as compared to Marasmiellus scandens (6.2-8.7 µm). The newly described species i.e., Marasmiellus agrianum N. Jabeen and M...
Asim Zubair1*, Anam Farid Chishtti2, Zohaib Atta Mehdie3, Aamna Arshad3, Ghulam Akbar Malik4 and Iffat Batool5
...n of Pakistani female farmers to the production of animals. In many nations, including Pakistan, women are essential to the care of cattle. They carry out a variety of livestock management tasks, such as cutting fodder, watering and feeding animals, cleaning animal pens, and milking. In order to ascertain the involvement of women in livestock husbandry, a survey was carried out in the area of Dera Ghazi Khan. A well-structured questionnaire was utilized to col...
Saddam Hussein Mahmoud* and Shaimaa Nabhan Yassein
...lbicans isolates, by polymers chains reaction (PCR) to detect the KER1 gene revealed that all 25 samples were positive with the product size (658bp). Phospholipases B1 (PLB1) and the secretion of aspartyl proteinase 1 (SAP1) gene were used to detect C. albicans virulence with 100% and 80% accuracy, respectively, while Hyphal Wall Protein 1 (HWP1) gene was not detected. It is expected that these C. albicans isolates contained a significant proportion of virulen...
Irtaza Hussain1, Muti ur Rehman Khan1*, Asim Aslam1, Masood Rabbani2 and Ahsan Anjum1
...lop awareness amongst farmers but will also provide guidelines to government officials about the prevention and control of the disease....
Rosidi Azis1, Gatot Ciptadi2, Sri Wahjuningsih2, Dwi Nur Happy Hariyono3, Yuli Arif Tribudi4, Veronica Margareta Ani Nurgiartiningsih2*
...indings might benefit farmers in Bali cattle breeding through the estimation of BW from BMs. ...
Ishtiaq Ahmed1*, Hamid Ullah2, Zubair Ali2, Muhammad Sohail2, Yasir Amin2 and Afrasyab1
...tion and awareness of farmers regarding husbandry practices may be implemented in the study area to boost the economy of the farmers....
Muhammad Noman Khan* and Ghulam Nabi
...poor yield discourage farmers from its cultivation. Plant nutrients particularly Potassium plays critical role in growth and yield of citrus crops. Therefore, for the possible solution the current study Potassium fertilizer source and timing regulate growth, flowering and yield in trees of sweet lime (Citrus limetta L.) was conducted during the year 2019. Experiment was laid out in RCBD split plot arrangement with 2 factors and 3 replications. Potassium source...
Xu Yun-Ming1*, Sun Zhi-Yuan1, Yang Jian-Bo1, Bian Rong-Rong2, Ren Hong-Lin3, Zhong Si-Yuan1, Cai Yu-Hong1, Peng Jing1 and Bao Hua-Xia1
...ne of B. cereus, four primers were designed, and reaction components and conditions optimized. Sensitivity was compared between optimized LAMP assay and the conventional PCR. The optimal reaction conditions of LAMP assay (25uL each reaction) comprised 1.0 mol/L betaine, 6 m mol/L Mg2+, 1.4 mmol/L dNTPs, 1.6 μmol/L inner primers (1:1), 0.2 μmol/L outer primers (1:1), 2.5 μL 10&time...
Md. Abdullah Al-Mamun1,2, Al-Mamun2,3, Sanjay Kumar Mohanta2,3, Md. Farhan Tazim2,3, Mohammed Rashed Parvej 2,3, Md. Sharif Uddin2,3, Suman Barua1,2 and Liu Qun1*
...production. Our study in mers of 655 Silver Pomfret, Pampus argenteus, 366 females and 289 males, collected monthly between February 2019 and January 2020, provides insight into the characteristics of size at sexual maturity, peak spawning season, and sex ratio of the species. Monthly variation in the gonadosomatic index (GSI) values and histological observations has revealed two spawning peaks, in spring (April-May) and fall (September). The maximum GSI has a...
Nwafili Sylvanus Anene, Ibinabo Jessica
...es adopted by catfish farmers in Obio/Akpor District of Rivers State with respect to hatchery operations. Data was collected from 49 catfish farmers by interview and structured questionnaire. Descriptive statistics was used to analyze data obtained based on 4-point Likert scale. The result show that 81.63% of the catfish farmers had previous experience with eggs and fingerlings mortality. ...
Yousef Ahmed Alkhamis1,2*, Basanti Mondal3, Roshmon Thomas Mathew2, Ganesan Nagarajan4,5,6, Sheikh Mustafizur Rahman3, Md. Mostafizur Rahman7, Adnan Alhajji1 and Md. Moshiur Rahman3,8*
...ing issue for tilapia farmers and other stakeholders. However, the compensatory development of certain traits through phenotypic plasticity can minimize at least these losses....
Asifa Majeed*, Amir Rashid, Palvasha Waheed, Asma Faryal, Aden Razaq and Ayesha Maryam
... chain reaction using primers of the APOA1 gene and ABCG1 gene. The amplicons were subjected to Sanger sequencing on Automated DNA Genetic Analyzer. The sequence data was analyzed on BioEdit7.2 biological software and Basic Local Alignment Search Tool against the human genome database to find any genetic variation. It has been found that ABCG1 gene and APOA1 gene exhibited a pattern of the normal nucleotide sequence in all subjects of three groups with no path...
Amistu KU1,2*, Monahan FJ2, Wims P2, Yonatan KY1 , Fahey AG2, Takele TA3
...ocal cattle fattening farmers (n=306) using a semi-structured questionnaire. The majority (94.4%) of respondents depend on the mixed crop-livestock farming activity as a source of income. The major feed resources for beef cattle fattening during the dry season are Desho grass (30.7%), hay (15.0%), and crop residues (14.7%) as basal diets, whereas for the rainy season fatteners almost fully depend on natural pasture (97.7%). However, fatteners use corn/fresh ma...
Stepanus Pakage*, Daud Krey, Trisiwi. Wahyu Widayati, Deny Anjelus Iyai, Agustinus Gatot Murwanto, Alnita Baaka, Daniel Yohanes Seseray, Djonly Woran
...Indigenous Papuan pig farmers in Manokwari Regency. The method used is the Ordinary Least Square (OLS) and Maximum Likelihood Estimation (MLE) methods on the Cobb-Douglas production function model and the Technical Efficiency Effect Model option. The results showed that piglets, feed, and firewood had an effect on pig production. Pig farmers in Manokwari Regency have been allocatively efficient, but technically and economica...
Nida Sadaqat1, Sheheyar Ahmed Khan1, Amna Bibi1, Sadaf Zahra1, Muhammad faisal Salamt1, Noreen Latief2 and Fatima Ali1*
...in burn was induced by immersing an iron mold (1.0 cm2 in diameter) in boiling (100°C) water for 5 min and placed on the back of the rats for 20 sec without applying pressure. Rats were divided into three groups; control group, burn injury group, burn injury + NAC group. Wound size and histopathological changes of epidermis were evaluated for the various groups. Hydroxyproline was estimated in wound tissue. Wounded skin tissues were cut off and stored at &...
Sami Ullah1, Choudary Ihtasham Ali1, Umar Ijaz Ahmed1*, Shoaib Nasir1 and Amjad Masood2
...rion for low-income consumers. Based on the findings, the availability of good quality vegetable oil to the masses requires time which can be ensured by enhancing local vegetable oil production and market competitive prices....
Nadeem Akmal1, Abid Hussain1*, Muhammad Yousaf2, Waqar Akhtar1 and Hassnain Shah1
...or is supporting rice farmers through the knowledge dissemination and service provision in the country for the mechanization of rice crop. In this article economic comparison of mechanical and conventional rice sowing methods in the rice-wheat cropping zone of the Punjab province has been made by applying economic analysis technique. As, Basmati-Super and Basmati- 386 are main rice varieties grown in the country. Thus, this study is based on data of 46 purposi...
Comparing Traditional and Contemporary Approaches to Integrated Pest Management in Major Field Crops
Muneer Abbas1*, Sohail Abbas2, Imran Faraz3, Niaz Hussain1, Muhammad Aslam1, Muhammad Irshad1, Mudassar Khaliq1, Abdul Ghaffar1, Zubeda Parveen1, Muhammad Nadeem1, Sana Ullah4* and Malik Akhtar Iqbal5
...remains limited among farmers, resulting in a lack of significant success stories in this regard. In light of the challenges posed by pest adaptation and pesticide resistance in the context of climate change, it becomes imperative to consider IPM as a viable solution. Farmers aiming to implement successful IPM programs should prioritize understanding pests, crops, and the environment. Rather than seeking complete pest eradic...
Olabode, H.O.K1, Mailafia, S1, Martha Echioda-Ogbole1*, Ameh, J.A1, Amadi, K.I1 and Meseko C.A2
... appraisal of poultry farmers’ knowledge, attitude and practice in Abuja Municipal Area Council, Nigeria. One hundred (100) blood samples collected randomly post slaughter from chickens in live bird markets were screened and characterized using Agar Gel Immuno Diffusion and Haemagglutination Inhibition Tests at the Avian Influenza laboratory, of the National Veterinary Research Institute, Vom Plateau State. A structured Questionnaire was also administere...
Blessing Ndenum Peter1, Olufemi Bolarinwa Adedeji1, Reuben Chukwuka Okocha2,3*, Ekemini Moses Okon4
...ked in Nigeria, and consumers are unaware of the risk of ready-to-eat (RTE) shrimps purchased in Ibadan seafood markets. Therefore, this study determined the microbial quality of ready-to-eat shrimps from three major seafood markets in Ibadan. Ready-to-eat shrimps were collected from 80 outlets at the three major seafood markets in Ibadan (50 from Bodija, 15 from Alesinloye and 15 from Eleyele) and checked for microbial presence, microbial counts, and antibiot...
Razia Sultana1, Shinawar Waseem Ali1*, Ghulam Murtaza2 and Shahid Mahmood2
...n the health of its consumers. For decades yogurt has been prepared traditionally by the method of back-slopping. Recently, it is also prepared commercially by using bacteria in different combinations. In this study, we aimed to detect and identify bacteria present in locally processed yogurt using the advanced next-generation sequencing (NGS) method. Yogurt samples were collected from open-air shops located in different areas of Pakistan. All yogurt samples w...
Liyun Chang*, Yazi Li, Yumei Cai and Chenghui Li
... we designed specific primers based on the conserved gene sequences of the three pathogens available in GenBank. After optimization of the reaction conditions and system, we successfully established a novel multiplex PCR method for detection of the aforementioned three pathogens. The results show that the amplified fragments of interest were 280 bp, 151 bp, and 111 bp for BVDV, BRV, and BCV, respectively. The method had no cross-reaction to Escherichia coli, S...
KHALID JAVED IQBAL1, ARSHAD JAVID2, NOOR KHAN3, IRFAN BABOO4, AHMED ALI5, KASHAF
MOHSIN6, AZRA ANWER7, USMAN ATIQUE8, MUHAMMAD ALTAF9, DILAWAR HUSSAIN10 & ASMA
CHAUDHRY11
...d education of fish consumers. Percentage
of those fish consumers found to be higher which were with age of <25
(43%), master passed (40%), students (49%). Quality, quantity and
effectiveness of fish consumption were also found to cause a
considerable difference across consumer‘s attitude. Based on type of
meat, quantity and effectiveness of fish consumptio...
SAGHIR AHMAD*, WARDA HANIF & SANA YOUNAS
...en from sheep, goats, farmers and non-farmer humans (160 each). Blood sera were examined to detect anti-Toxoplasma antibodies (IgG) by employing latex agglutination test (LAT). The findings showed the seroprevalence of T. gondii 36.25% (58/160) for sheep, 28.1% (45/160) for goats, 21.2% (34/160) for farmers and 6.8% (11/160) for non-farmers. A significant difference (P-value 0.00; OR: 3.65...
SADAF IFTIKHAR1, SAMAN SHAHID2*, MUHAMMAD UMAR HASSAN1 & UBAID ULLAH3
...hlighted the role of D-dimers, platelet count and LDH (lactate dehydrogenase) as primary biomarkers in diagnosing the COVID-19-associated coagulopathy (CAC) in severe and critical cases. 141 COVID-19 patients of severe and critical categories, were enrolled from an epicenter tertiary care hospital. The mean values of platelets were found normal, whereas, the mean values of LDH were found elevated in both severe and critical cases. There was no patient with low...
Shakirat Bolatito Ibrahim1, Raheem Olatunji Aminu1,2*, Aisha Olushola Arowolo1 and Adams Sanusi Musa1
...ults show that 73% of farmers owned the cultivated land, while 26% had rights over the cultivated land. The average distance of the sampled households to public and private hospitals in the study area is 2.33km and 0.88km. Most households consume cereals, roots, and tubers. As indicated by the household dietary diversity score, 85.64% of households showed a high level of dietary diversity. The food expenditure data shows that food insecurity affected 59% of ho...
Romaan Hayat Khattak1, Liwei Teng1,2*, Naimat Ullah Khan3, Aamir Ali3, Abdul Hadi4 and Zhensheng Liu1,2*
...arge-bodied primary consumers are limited. This note presents the first photographic evidence of yellow-throated marten from Nizampur National Park (NNP), Nowshera district Khyber Pkahtunkhwa (KP) Pakistan. The presence of this species indicated that this ecosystem has rich biodiversity, providing plenty of resources for the survival of yellow-throated marten. However, keeping in view the diet ecology of yellow-throated marten we assume that it may have some n...
Jaweria Iqbal1, Muhammad Tanveer Altaf2, Muhammad Faheem Jan3, Waqas Raza4*, Waqas Liaqat5, Ikram ul Haq6, Amna Jamil7, Sameer Ahmed1, Amjad Ali2 and Arif Mehmood8
...ies. ISSR and EST-SSR primers yielded 108 and 28 loci, respectively. The polymorphism was found 32.40% for ISSR, while 89.28% was recorded for SSR primers. Cluster analysis revealed a high level of genetic similarity for ISSR (average 0.92) and EST-SSR (average 0.85) among cotton genotypes. The mean polymorphic information content (PIC) value was 0.25 for ISSR, whereas it was recorded 0.48 for EST-SSRs. Confusion probability...
Slamet Widodo1*, Mohammad Ikhsan Shiddieqy1, Teguh Wahyono2, Yeni Widiawati1, Zultinur Muttaqin1
...search scientists and farmers.
Keywords | Correlation, Digestibility, Forage, Gas production, Nutrient content
...
Maria Endo Mahata*, Yose Rizal, Zurmiati, Sepri Reski
...eaweed P. australis by immersing it in flowing water. We used a completely randomized design (CRD) with different immersion durations (0, 4, 8, 12, 16, 20, and 24 h) of P. australis in flowing water. Each treatment received four replications. We evaluated dry matter (DM), organic matter (OM), crude protein (CP), ash, salt, and alginate contents. The results revealed a significant (p<0.05) impact on OM, CP, ash, salt, and ...
Rokhani Rokhani1, Amam Amam2*, Mochammad Wildan Jadmiko2, Dhimas Yusantoro2
...s were 36 beneficiary farmers of the One Thousand Cattle Village Program. The data were analyzed using simple linear regression. The results showed that the farmer empowerment positively and significantly affected the economic dimension with the equation Y = 27.712 + 0.305X and the social and cultural dimension with the equation Y = 13.531 + 0.310X. It is concluded that it is necessary to increase the implementation of farmer empowerment regulated in the Gover...
Rini Widyastuti1*, Rangga Setiawan1, Nurcholidah Solihati1, Siti Darodjah1, Kundrat Hidajat1, Mochamad Ali Mauludin2, Alkaustariyah Lubis3, Mas Rizky Anggun Adipurna Syamsunarno4, Sigit Prastowo5, Takdir Saili6, Arief Boediono7
...study aims to explore farmers’ profiles, behaviours, and existing knowledge about reproductive management practices in traditional dairy goat farming. The study were carried out among Simpay Tampomas Farmers Group in Sumedang, West Java, Indonesia. The sample population consisted of thirty participants and the reproductive performance of 96 goats was investigated. Sociodemographic characteristics and reproductive knowl...
Lawrence Olusola Oparinde1*, Adewale Isaac Olutumise2,3 and Ademola Adegoroye4
...gender of arable crop farmers in Southwest, Nigeria. A multistage selection process was employed to pick 450 arable crop farmers. The collected data were analyzed with the use of descriptive statistics, probit regression model and Gini coefficient analysis. Findings from this study revealed that the adoption of agroforestry technology increased income inequality among male and female crop farmers
Aishat Adetola Anifowose*, Nkechi Betsy Izuogu and Benoit Katchitche Sossou
...r use by the potatoes farmers for adoption....
Tevina Edwin, Arfa’i*, Olivio Dickresna
...earing by smallholder farmers is needed to see how successful the livestock business is and how much the livestock business contributes to the livestock farmer’s livelihood. We aimed to examine the husbandry system and income of beef cattle enterprises located in Luak Sub-district, Lima Puluh Kota District, West Sumatra Province, Indonesia. We used a total of ninetyseven farmers who agreed to participate in the study. ...
Abir Ishtiaq1*, Abdul Ghaffar2, Maria Younas1, Tasveer Ishtiaq1, Zara Naeem3 and Muhammad Naeem4*
...heries industry and consumers as the awareness about fish proximate composition is crucial for its maximal consumption....
Hafiz Nawaz1*, Kashaf Nawaz2, Attiq ur Rehman1, Muhammad Bashir3, Mussera Hira2 and Mariyam Nawaz4
...tension agencies, and farmers must work together....
Dwi Desmiyeni Putri1*, Nurhayati1, Intan Kamilia Habsari1, Ni Luh Putu Ika Mayasari2
...f pathotypic-specific primers to detect ND viruses circulating in Indonesia. This study used 4 ND isolates characterized by RT-PCR and amino acid sequencing (Putri et al. 2018). The 4 ND isolates used as isolates represented the NDV currently circulating in Indonesia. The study used 4 pathotype-specific primers. The first step of the study was to analyze the compatibility of the primers an...
Lu Yang1,2*, Ke Zhang3 and Jin-Hui Wang1,2,4
..., ten N-acetyldopamine dimers, named Cicadamide C1–C10 (compounds 1–10), were isolated from Periostracum Cicadae. One-dimensional NMR, two-dimensional NMR, mass spectrometry, CD spectroscopy, and chemical evidence were performed to further determine their structures. In the results, ten N-acetyldopamine dimers were isolated and their structures were elucidated. This study provides a basic reference for further bi...
Hassan Anwar1, Talha Anwar2, Khurram Muaz3, Muhammad Riaz4* and Rabia Anwar5
...e less appealing to consumers due to their texture, taste, and chewability. This study aimed to prepare chapatis from wheat, barley, and oat flour mixed in different proportions to achieve a consumer acceptable combination. Gluten was also added to give better texture, chewability and taste. To test the likeliness of people, we tested 14 chapatis on a hedonic scale of 1-9 by ten participants. The panellist liked equally mixed wheat and gluten chapatis with an ...
Muhammad Luqman1*, Muhammad Talha Shoaib1, Muhammad Yaseen1, Umair Safdar2 and Hassan Raza2
...n higher farm yields, farmers use different fertilizers and pesticides to protect their crops from diseases and insect pest attacks. In this perspective, current study was designed to explore negative consequences of pesticides applications on human health and environment in district Sargodha. A cross sectional survey method using convenient sampling was adopted for this research and data was collected from 300 respondents with the help of structured interview...
Muhammad Farooq Bhatti1, Hafiz Muhammad Tahir1*, Aamir Ali1, Hooria Ashraf Khan1, Rabia Fajar Ali2, Ayesha Muzamil1, Fariha Munir3, Fatima Ijaz1, Rizwan Khurshid3
...mitation faced by the farmers is the availability of most appropriate silk seed that suits the local environmental conditions. This research study suggests that the silkworms of Chinese race are better adapted and produce more yield in local climatic conditions of Punjab, Pakistan.
...
Arslan Muhammad Ali Khan1, Rao Zahid Abbas1*, Zia ud Din Sindhu1, Muhammad Shahid Mahmood2
...ere observed via adult immersion test (AIT), the larval immersion test (LIT), egg hatchability test (EHT), and the tick repellency assay. GC-FID provided that the main compounds of A. subulatum essential oil were monoterpenoids (limonene and α-terpinene, and α-terpineol) (33.8%) while other chemical compounds were α-terpinolene (9.5%), sabinene (9.3%), 1- Carveol (8.9%), α-phellandrene (7.8%), linaloo...
Sidra Hafeez1, Tayyaba Sanaullah2, Hafsa Naeem3, Mah Noor Hassan4, Muttalib5, Farhana Kausar6, Muhammad Salman Hameed7*, Muhammad Anayat Ullah8, Abdul Samad9, Memoona Bashir10 and Sadaf Shabbir11
...y, by using universal primers ITS1/ITS4. The analysis of polygenetic of an amplified product revealed that black rot caused by D. bryoniae in pumpkin....
Siswanto Imam Santoso*, Agus Setiadi, Maulina Syafa’ati Ningrum
...sus with a total of 6 farmers. The sample was divided into two levels: strata I 1-30,000 broilers and strata II > 30,000 broilers chicken. The data analysis method used was descriptive statistical analysis. Data were analyzed using the formula for production costs, total revenue, and profitability, BEP, payback period (PP), and R/C ratio. The statistical analysis used was the normality test and the one-sample t-test. The results of this study show that the ...
Nguyen Huu Van1*, Nguyen Thi Mui1, Dinh Van Dung1, Van Ngoc Phong1, Tran Ngoc Long1, Le Tran Hoan1, Le Duc Thao1, Vo Thi Minh Tam1, Ngo Mau Dung1, Bui Van Loi1, Nguyen Xuan Ba1, Ton Nu Minh Thi2, Nishino Naoki2
... economic benefit for farmers without any adverse effects on nutrient digestibility and rumen fermentation of the animals.
Keywords | Phan Rang sheep, Concentrate, Rumen fermentation, Digestibility, Growth, Carcass
...
Merita Ayu Indrianti1,2*, Didi Rukmana3, Eymal Bahsar Demmallino3, Muh. Hatta Jamil3
...ted to incentives for farmers whose land is determined in the LP2B program.
Keywords | Sustainable food land, LP2B, Gorontalo district, Regulations, Staple feed
...
Abida Mushtaque1, Ali Ahmad Sheikh1, Aamir Ghafoor1*, Wasim Shehzad2 and Nadeem Ahmad3
...ith in-house designed primers, the amplified gene (1002 bp) was cloned into pET 40-b (+) vector and transformed into E. coli BL21 (DE3) competent cells using heat shock transformation method to get expression. The product size was confirmed by restriction digestion. The rOmpH protein was purified by immobilized metal affinity chromatography by using His-Ni resins to get desired protein and characterized qualitatively by SDS-PAGE by using His antibodies and wes...
Farhana Umer1, Muhammad Sheryar2 and Sangam Khalil3*
...substations then to consumers and its own environment is tremendous. Among various hazards, the overhead wires associated with power lines are the most fatal hazard to birds. The power lines and poles have caused fatal risks for birds and have affected their habitats significantly. Dangerous types of power poles in the middle voltage lines which have small distances between the lines and short insulators cause short-circuits between conductor wires or ground-f...
Shehar Bano Bhatti1, Muhammad Irfan Malik2, Rabia Faryad Khan1, Mahmood Ul Hassan2, Muhammad Shahbaz Aslam3 and Zaigham Abbas1*
...ing sequence-specific primers (SSP). Total immunoglobulin E (IgE) was estimated by ELISA. Graph pad Prism 8 was used for statistical analysis. HLA DRB1* 0701-02 and HLA DRB1* 1301-04 showed a positive association with atopic asthma having an odd’s ratio (OR) of 2.173 and 3.564 respectively. While HLA DRB1* 1101-04 and HLA DRB1* 1201-02 showed a negative association having OR of 0.4853 and 0.4299 respectively. HLA DRB1* 0701-02 had a positive association ...
Akram A. Salama1, Moustafa A. Zaghloul2*, Ahmed A. Zaghawa1, Mohamed A. Nayel1, Ahmed M. Elsafey1, Mohamed F. Azooz2, Hanem S. Harb1 and Walid S. Mousa1
...on (PCR) and specific primers designed from the EEV gene, tissue samples from skin nodules (N = 40) and blood samples (N = 60) were collected from diseased animals. Sequencing and a phylogenetic tree construction were done on the amplified byproducts of samples from blood and nodules on cattle skin. By PCR technique, 55 samples out of 100 (55/100; 55%) were positive for LSDV. A representative sample was sequenced and had a very high identity percentage of >...
Wang Teng1,2,3,4, Li Chunhou1,2,3,4, Liu Yong1,2,3,4* and Zhu Ren5*
...rge predatory fish and demersal fish. Now, overfishing, habitats destruction, pollution and eutrophication, and non-native species are important threat to native fish biodiversity. The results shed light on the importance of conservation and ecosystem-based fishery management. For better to protect fish biodiversity and fisheries resources, more international cooperation on protected areas, fishing ban, and scientific research should be implemented for effecti...
Budi Utomo1*, Amaq Fadholly2,3, Endang Tri Margawati2, Alek Ibrahim2, Ristaqul Husna Belgania1, Muhammad Fajar Amrullah1, Rimayanti1 and Hermin Ratnani1
... with SRY F and SRY R primers with a PCR product length of 318 bp. Based on these results, Madura, Limousin, and Madrasin cattle had similarities based on the SRY gene (paternal pathway)....
M. Azalou1,3*, C. C. Kpomasse1, A. S. Assani3,4, I. T. Alkoiret3,4, Wéré Pitala1,2
... profile of the goose farmers, the modes of operation of the farms, and their constraints. Data were collected through a retrospective survey from 102 farms in four agro-ecological zones (AEZ) of northern Benin: the far northern zone of Benin (FNZB), the cotton zone of northern Benin (CZNB), the food-producing zone of southern Borgou (FZSB), and the West Atacora zone (WAZ). Multiple correspondence analysis (MCA) and ascending hierarchical clustering (AHC) iden...
Khalid Alhudaib
...NRSV and PPV specific primers. RT-PCR resulted in the amplification of a 346 bp fragment as expected and negative result with PPV and PDV. The obtained result indicating the presence of PNRSV, in Apricot and Peach in Saudi Arabia, is recorded. The amplified fragment was sequenced and deposited in GenBank (Accession No. HM584814). The sequence was compared with PNRSV isolates and had 100% identity with AF170170 from Czech Republic while 97% identity for PNRSV f...
El-Absawy, E.A.; Mahmoud, Amal; Hemeida, A.A. and Helmy, M.
...Y was amplified using primers represented portion of the coat protein (CP) gene and 3' untranslated regions (UTR). Phylogenetic tree showed two main strain groups: Group I regroups PVYN and PVY stains, while Group 11 includes pvy0, pvyw and PVYN:O strains. The Egyptian PVY isolate was clearly classified within group I, and was more closely related to PVY strains. Ten nucleotide substitutions resulted in 3 conserved amino acid substitutions (VI*I, G7*E, M or V ...
Aboud*, K. A; Gomaa**, Hanaa H. A.; El—Taholowy***, Mohage, A. and El - Sugher**, S.
...D- PCR. Only two RAPD primers (among 10 tested) were chosen as producing polymorphic DNA bands differentiating the investigated micropropagated plants. Based on DNA markers, the genetic stability between micropropagated plants were estimated. The morphological variations were recorded in shoots of micropropagated clones more than healthy clone. The developed RAPD profiles of different micropropagated clones were untypical to that of the healthy clones. The phy...
Soliman*, Ahmed M.; Mahmoud**, Sabry Y. M. and Dawood*, Rehab A.
...presence of OYDV. PCR primers were used to ampli$' about 1.1 Kb fragment from the viral genome using RT-PCR from infected garlic plants, such fragnent were not obtained from healthylooking plants and/or virus-free seedlings of shoot-tips. The amplified products of OYDV was cloned into pGEM@-T Easy vector, and transformed into Escherichia coli (E. coli) strain DH5a. The recombinant plasmids were obtained and sequenced. The nucleotide sequences were compared wit...
El-Dougdoug, Kh.A.; Rezk , A.A.; Dawoud, Rehab A. and Sofy, A.R.
...piviroid-CCR specific primers. Purified gel RT-PCR product (⁓199) was cloned into the PCR Il TOPOvector then it was sequenced. Partial sequence 199 bp of CSVdEG is almost identical to that of the prototype 199 bp Canada and USA isolates of CSVd with 96% homology. The sequence of CSVd-EG can be arranged into viroid specific rod like structure. CSVd-EG differ from the prototype isolates Canada and USA at sites occur in regions corresponding to the conserved, v...
Alhudaib, Khalid
...ession using specific primers gave positive results and non with FLMaV-2. Mixed infection of FLMaV-1 and FMV were found. To our knowledge this is the first record and identification of FLMaV-1 and FMV in Saudi Arabia. Further studies are needed to investigate the fig mosaic disease throughout the country....
Eman, Abo Hatab*; Hussein, HA.; El-Sabagh IM. and Saber, MS.
...uses and RT-PCR using primers specific for VP6 and VP7 of group A rotaviruses was employed and confirmed the molecular characterization Of the isolates viruses with the correct and expected bands. The RT-PCR specific band of VP7 gene of two selected isolates was eluted from the agarose gel and sequenced using VP7 specific primers sequence. The obtained sequence was analyzed using computer software (BLAST) which revealed that...
Ashraf M. Metwally*, Ausama A. Yousif*k , Iman B. Walaa A. Attia M. Samy * , and Ismail M. Reda *
...CR tested using novel primers flanking VP2 region coding the two major and two minor hydrophilic peaks. IBDV was detected in tested samples. Phylogenetic analysis of the sequenced PCR product and deduced amino acid sequences of IBDV Giza2008 VP2 demonstrated the continued circulation of very virulent IBDV (vvIBDV). The mutations reported in Giza2008 demonstrate that Egyptian field viruses are isolating from their European ancestors. Some of the aa mutati...
Sabry Y. M. Mahmoud; Maher H. Hosseny and Mamdouh H. Abdel-Ghaffar
...upply or indirectly by immersion of plant tissue in electrified water in a wide range of intensity-time. Axillary buds excised from electric-shocked stems or tissues immersed in electrified water, were transferred into the medium supplemented with or without ribavirin (RBV) •to examine its combination effect. With an electric shock treatments alone (5, 10 and 15 mA electric current), the replicates bec...
*Amal Abou El-Ela A., M. A. Amer and Eman A. H. Khatab,
... utilizing degenerate primers derived from conserved regions in the genome of potyviruses was designed to amplify a 335 bp cDNA fragment from infected plant using degenerate oligonucleotide primers specific for detection of Potyvirus group. Amplification of total RNA extracted from infected carnation suggesting the presence of one Potyvirus in the tested carnation plant. Nucleic acid spot hybridization assay also was used to...
* Amal Abou El-Ela, A.
... indica L.) using the primers Macl and Mac2 specific to Prunus necrotic ring spot virus (PNRSV) which were designed to amplify of the 3' end of the coat protein gene (RNA-3)- Nucleic acid hybridization was useful for the detection of PNRSV in herbaceous and woody plant tissues. In successful attempt to eliminate the virus from infected dormant rose cuttings by heat therapy resulted in 29.6% virus elemination of (PNRSV).
A. A. Kheder1; I. A. M. Ibrahim2; H. M. Mazyadl
...V cDNA using specific primers designed to amplify 200bp of the coat protein gene as a molecular procedure for diagnosis. Electron microscopy of purified preparation of PRMV showed presence of isometric particles 28 nm in diameter. Ultrathin section for electron microscopy examination of infected peach leaves shows virus particles in vacuoles. Tubules structure scattered in the cytoplasm or associated with plasmodesmata was shown. Extensive severe degeneration ...
A.A.Farrag; I.A.M. Ibrahim and, H.M. Mazyad
...ing coat protein gene primers (358bp) of the viral coat protein gene. PCR product was used to generate ACLSV-specific probe to detect the virus in infected plants using non-radioactive molecular hybridization methods. The result showed that it is more sensitive than DASELISA and can be used for large scale detection. PCR product was cloned and sequenced. Comparison between local isolate sequence and other published sequences of the Same virus shows 79.4% - 84%...
M.R. Abd-El Wahab l, H.A. Hussein2, T.M. Asfourl and M.A. Shalaby2
...RT-PCR assay based on primers located at the non-translated region of BVDV genome to detect BVDV RNA in some buffy coat samples, collected from the cohoused camels in the area where dead camels were found (BVDV-positive). revealed positive results. However. genotyping of such positive samples using RT-PCR genotyping based assay revealed negative for the presence of BVDV type I, II, and border disease virus. After 3 passages of the detected positive buffy coats...
Makmun1, Imam Mujahidin Fahmid2, Muhammad Saleh S. Ali2*, Muhammad Yamin Saud2, Rahmadanih3
...purposive sampling of farmers and the Animal Husbandry Department of Blitar Regency. The study’s findings indicated that actors involved in the laying hen farming business were small farmers, medium farmers, large farmers, farmer groups, poultry shops, the Animal Husbandry Department, Ministry of Agriculture-Directorate General of Livestock and Ani...
Divanildo Outor-Monteiro1,2,3*, José António Silva2,3,4, José Luís Mourão1,2,3, Victor Pinheiro1,2,3
...fy;">Actually, some consumers have displayed a growing preference for rabbit meat sourced from alternative rearing systems as opposed to intensive cage-based systems. This trial was designed to explore the influence of production systems (cages - Cg; 13.3 rabbits/m2, closed parks - CP; 7.7 rabbits/m2, and open-air systems - Oa; 0.25 rabbits/m2) and slaughter age (70 and 84 days) on the growth, carcass traits and meat quality of growing rabbits. 120 animals wer...
Compatibility of Selected Insecticides Against Sucking Insect Pests of Cotton Under Field Conditions
M. Tariq Mushtaq1, Faisal Manzoor1, M. Ishtiaq1*, Mirza Abdul Qayyum1, Muqarrab Ali2, M. Akram3, M. Rafiq Shahid3 and Saleem Riaz1
...fective way among the farmers for controlling these insect pests. Present study was designed to evaluate the compatibility of different insecticide mixtures against sucking insect pests i.e., whitefly and jassid. Compatibility of four insecticides combinations i.e., buprofezin + flonicamid, buprofezin + nitenpyram at recommended and half dose of recommended for two years. In separate experiment two combinations of pyriproxyfen + imidacloprid and pyriproxyfen +...
Hillary M.O. Otieno1,2*
... resource-constrained farmers in the Sub-Saharan Africa region. However, the land sizes are small and pose a big question as to whether it is economical to embrace the technology. Again, if not used well, these products could be harmful to humans and other non-targeted organisms that significantly contribute to the well-being of the ecosystem. This review, therefore, explores the potential benefits of widespread herbicide adoption in the region. Also, the stud...
Ahokpossi AGAC1,2*, Salifou CFA2, Youssao Abdou Karim I2, Ameyapoh Y3
...recently developed by farmers with those of local chickens and exotic chickens commonly found in Benin. Thus, data on carcass characteristics, and sensory meat quality were collected on 120 chickens divided into four groups: (1 and 2), each composed of 20 males and 20 females Goliath chickens, group 3 was composed of local chickens (10 males and 10 females) and group 4 was composed of 20 Cobb 500 broilers. These birds were reared in intensive system (IS) and ...
Qing Cao1, Wei Jiao2, Huihui Lu1, Jing Zhang2, Meiling Ren3, Yan Xu1* and Shuyang Hu1*
... fibrinogen (Fb) and D-dimers (D-D) in serum of patients in the hyperglycemia group were much higher than those in the hypoglycemia group, while serum plasma prothrombin time (PT) and activated partial thromboplastin time (APTT) were much shorter than those in the hypoglycemia group (all P < 0.05). Thrombus precursor protein (TpP), P-selectin (Ps), maximum platelet aggregation rate (MAR) and mean platelet volume (MPV) of patients in the hypoglycemia and hyp...
Qing Cao1, Wei Jiao2, Huihui Lu1, Jing Zhang2, Meiling Ren3, Yan Xu1* and Shuyang Hu1*
... fibrinogen (Fb) and D-dimers (D-D) in serum of patients in the hyperglycemia group were much higher than those in the hypoglycemia group, while serum plasma prothrombin time (PT) and activated partial thromboplastin time (APTT) were much shorter than those in the hypoglycemia group (all P < 0.05). Thrombus precursor protein (TpP), P-selectin (Ps), maximum platelet aggregation rate (MAR) and mean platelet volume (MPV) of patients in the hypoglycemia and hyp...
Limbang Kustiawan Nuswantara, Eko Pangestu, Marry Christiyanto, Santoso Dwi Pratomo, Elyza Zahrotul Muhtaromah
... are usually given by farmers. The parameters observed were Dry Matter digestibility (DMD), Organic Matter digestibility (OMD) and Total Digestible Nutrient (TDN). The results showed that giving treatment feed in the form of the addition of concentrate at different levels containing additional tree legume did not significantly of DMD, OMD and TDN in dairy goats (P>0.05). The conclusion of this research is that feeding treatment in the form of different leve...
Yongtao Xu1, Dandan Wang1, Xiaolong Hu1, Minling Li1, Ming Tang1, Wuhua Liu2, Jianwen Zhan2 and Weiwei Zhang1*
...lified with universal primers and sequenced by high-throughput. We found that 28 out of 30 valid samples had a total of 677,856 valid amplified sequences with an average valid sequence of 24,209.14±323.83. A total of 326 OTUs were obtained from 28 valid samples, and the MP, SS, and NJS groups shared 222 OTUs, accounting for 68.09% of the total OTUs. OTUs alignment indicated that the forage plants of sika deer belong to 82 families, and 110 genera. An al...
Muhammad Tahir Latif1*, Muzzammil Hussain1, Ali Zohaib2 and Ishtiaq Hassan3
...re, twenty innovative farmers were included in sampling frame with non-probability sampling procedure for field survey as well as six field experiments were conducted in Gujranwala zone, Pakistan to evaluate four sowing techniques, i.e., CT, happy seeder, ridge sowing and SS with Randomized Complete Block Design. As compared to CT the SS has been estimated as resource conservation technique regarding sowing time (62.50%), irrigation time (7.69%), seed cost (14...
Muhammad Usman1*, Muhammad Uzair Khalid2, Muhammad Hasnain3*, Muhammad Tauseef4, Ali Raza4, Muhammad Akram4, Muhammad Shahid4, Abrar Ahmad4, Muhammad Shoaib Ismail1, Rabia Afzal2, Atta-Ulla2 and Muhammad Hussnain Babar3
...o-priming is best for farmers to reduce the negative effects of zero tillage and by time of bed sowing, and then it will produce maximum results. Further, it will helpful for the farmers to enhance their income....
Thobela Louis Tyasi*, Lebo Ngorima, Victoria Rankotsane Hlokoe
...y outcomes may assist farmers in the egg quality traits to consider during breeding to improve the egg weight of the Lohmann Brown chicken breed.
Keywords | Best-fitted model, Correlation, Egg length, Egg width, Shell weight
...
Phoebe Lyndia Tolentino Llantada1,2*, Midori Umekawa2, Shuichi Karita2
...sing species-specific primers, most fibrolytic bacteria were detected in the foregut and hindgut, whereas most non-fibrolytic bacteria were located in the foregut and midgut. This study provides a preliminary glimpse of the bacterial microbiota profile of dairy buffaloes’ gut in a qualitative and semiquantitative way. Thus, the results of this study can serve as a reference for future researches on gut microbes to better understand their localization, an...
Ruth Dameria Haloho1*, Jisril Palayukan1, Agus Setiadi2, Edy Rianto2, Nadlirotun Luthfi3
.... One hundred buffalo farmers were taken as respondents by a multistage random sampling method. The data were obtained by observation and direct interviews the farmers. The data was analysed descriptively and quantitatively. The study showed that there are two kinds of buffalo in West Sulawesi, the first one is the expensive buffalo and raised by intensive system. The expensive buffalo were consisted of Saleko, Doti Salamba ...
Babi Kyi Soe1*, Toe Win Naing2, Su Lai Yee Mon1, Nay Chi Nway3, Hiroshi Sato4
...t impact on livestock farmers with major economic constraints and eventually threaten human health in cases of zoonotic species involvement. Therefore, our study aimed to identify Anaplasma spp. infection in a bovine host using both microscopy and molecular techniques. A total of 59 samples were collected from Mingaladon township, Yangon region, and the presence of infection was assessed using a Giemsa-stained thin blood smear and PCR of 16S rRNA gene amplific...
Ida Indrayani*, Andi Andri, Tevina Edwin
...a from 60 beef cattle farmers in Pesisir Selatan Regency, West Sumatra, Indonesia. Livestock feed requirements are based on dry matter digestible (DM) originating from food crop waste. The sustainability of the beef cattle business was assessed based on four indicators economic, social, environmental, and institutional. The total feed availability of Pesisir Selatan regency was 251,378 Tons DM/year, while the current total feed needs are 78,823.93 Tons/DM/year...
Shirina Akter Toma1, Shah Ahmed Belal2, Md Abdul Baset3, Md Nazim Uddin3*
...tal requirement for consumers. We aimed to assimilate the physicochemical properties of drumstick, wing, thigh, and breast meat of commercially spent hens and broilers. The commercial spent hens (n=30) and broilers (n=30) were slaughtered at market age (306 days spent hen and 28 days broiler). The thigh, drumstick, breast, and wing muscles from both sides of the carcasses were separated. The right thigh, drumstick, breast, and wing meat was vacuumed pack and k...
Rogia SA Gomez*, Said H Mbaga
...classify the surveyed farmers in the coastal region of Tanzania based on their rearing characteristics. It also aims to evaluate their productivity by establishing an operating account for one broiler per group of identified farmers. Additionally, the study seeks to identify the factors that may influence the productivity of broiler farms. To this end, 78 broiler farmers were selected usin...
Faris Sahib Imran1*, Layth Hamzah Merzah2, Mohammed Mohsin Kareem3
...ustify;">Ceratophyllum demersum, commonly known as coontail or hornwort, is a submerged aquatic plant native to many parts of the world. C. demersum is used in aquaria and pond gardens for its fast growth rateability to improve water quality by excess nutrients, and toxins, and can be included in the sheep diet as a protein source at certain levels. The study was conducted in Karbala province, using the Al-Husseiniya River a...
ZAFAR IQBAL KHAN1*, KAFEEL AHMAD1, KHALID NAWAZ2, MUHAMMAD NADEEM3, ASMA ASHFAQ1,
BABAR MUNIR1, HAFSA MEMOONA3, MADIHA SANA3, FARZANA SHAHEEN1, NAUNAIN MEHMOOD4, HIRA MUQADAS4, MAHPARA SHEZADI5, IJAZ RASOOL NOORKA6, HUMAYUN BASHIR1,
MUDASRA MUNIR1, ILKER UGULU7 & YUNUS DOGAN7
...ultural area enforced farmers to use industrial effluent and domestic wastewater for irrigation purpose. Ramzan sugar mill industry located at Chiniot discharges high amount of effluent which is used by farmers for irrigation purpose. Current experiment was conducted in Sargodha, Punjab, Pakistan to assess the level of different heavy metals such as Mn, Ni, Pb and Zn in wheat variety (Chagi-4) irrigated with varying quantity...
MUBEEN RIAZ1, KIRAN ZAHID1, SUMAIRA ASLAM CHOHAN1, MUHAMMAD ASHFAQ*2, MUHAMMAD ALI2, RIFFAT SIDDIQUE1, NUDRAT ANEES1 & FARAH KHAN1
...pose a total of seven primers viz, OPH_01_F, OPH_01_R, OPH_01_RC, OPI_05_R, OPI_05_RC, OPG_10 and OPC_06 were used. PCR amplification was followed by gel electrophoresis (1.2% agarose gel) and visualized by UV light, which revealed the presence of monomorphic and polymorphic bands in the amplified products. During this analysis, two primers (OPH_01_F and OPH_01_RC) produced a total of 10 bands. Six of the bands were monomorp...
AMBASH RIAZ1, SHAHID RAZA2* & HIRA MUBEEN3
...lified using specific primers which gave successful PCR results of 3.5 kb long gene amplification. The amplified gene was further verified by inserting it into the expression vector. Furthermore, a computational approach was used to understand evolutionary relationships among Cry1AB gene and to identify conserved protein domains in Cry1AB proteins. Use of insilico approach provided new insights of understanding functional characteristics of Cry1AB gene and its...
UZMA PARVEEN1, MASROOR ELLAHI BABAR1*, NIDA BABAR2, TAHIRA MUGHAL3 & AKHTAR ALI1
...echnique was applied. Primers were designed, amplified by PCR and RFLP were performed to identify the TNF–alpha -308 and -238 polymorphisms. The frequencies of TNF-alpha -308 genotype TNF GG, GA and AA were 37%, 10% and 3% with measurably estimation of 0.07039 (P<0.05) as indicated by HWE for the preterm and postterm conveyances while for the typical one proportion of GG, GA and AA were of 5%,10% and 5% with factually critical esteem is 1.000 (p<0....
Lendrawati*, Tinda Afriani, Eli Ratni
...e findings could help farmers in adult female Kacang goat breeding by estimating body weight from body measurements.
Keywords | Does, Morphometric, Regression model, Rural farm
...
Firda Arlina1*, Mangku Mundana1, Linda Suhartati1, Agmelia Jasfaria2
...chicken reared by its farmers in Solok Regency, West Sumatra. There 60 Randah Batu Kokok Balenggek chickens were sexually mature. This study used a survey method, and sampling was carried out using purposive sampling. The parameters observed were qualitative and quantitative phenotypes. The data obtained were analyzed by descriptive statistical analysis. The results showed that the qualitative variety of the Randah Batu Kokok Balenggek chicken reared by the Ko...
Teedzai Chitura*
...en growing calls by consumers and international health organizations for reduced application of antibiotic growth promoters in livestock production. To address this problem, several animal feed commissioners and summits have legislated and banned the use of antibiotic growth promoters in livestock feeds. Given these scenarios, animal nutritionists embarked on the quest for the search of alternative and sustainable growth promoters, as a replacement for antibio...
Habibeh Jabbari
...cruciferae. Different primers for amplification of ITS1-5.8S-ITS2, D2-D3 rDNA and hsp 90 genes, showed similarity between the nematode populations. ITS-RFLP profiles generated by 16 different restriction enzymes did not differentiate the populations, too. In phylogenetic analyses of partial sequences of 28S rDNA D2-D3, a clade clustering the four populations of cabbage cyst nematode was formed along with the sequences of H. cruciferae populations deposited in ...
Waseem Abbas, Imtiaz Ahmed* and Imran Khan
... was acceptable for consumers....
Addisu Jimma1,2*, Aberra Melesse1, Aynalem Haile3, Tesfaye Getachew3
...260 randomly selected farmers, with 130 being CBBP members and 130 non-members owning sheep from similar locations, was conducted. The results revealed significant differences (p<0.05) in various aspects between CBBP members and non-members. CBBP participants showed higher numbers of lambs below 3 months, male lambs between 3-6 months, intact males between 6-12 months, breeding rams, mature ewes, and the mean flock size of sheep at the household level. The ...
Nadia Kèmi Assana Chabi1, Gildas Codjo Tchemadon1,2*, Olaïgbé Lydie Hounkpatin3, Paul Kouété Jimmy4 and Leonard Antoine Chaffara Afouda1
...tudy aims to evaluate farmers’ knowledge and perception of viral diseases that can affect sweetpotato, as well as the control strategies used to manage them. A semi-structured survey was conducted in March and October 2022 among 156 sweetpotato farmers in 11 townships in agro-ecological zones (AEZ) II, VI and VIII of Benin. Among the respondents, 96.3% do not recognize symptoms of sweetpotato viral diseases, although 8...
Muhammad Usman1, Majid S. Hashmi1, Ayaz Ahmad1*, Fawad Ahmad2 and Zahid Alam1
...threat to health of consumers generally and diabetes patients particularly. Moreover, some low-calorie products did not meet sensory preferences of consumers. Therefore, this research was conducted to evaluate the quality and acceptability of a low-caloric orange drink by incorporating various concentrations of stevia powder and storing it within a temperature range of 20±0.4°C. The investigated treatments include...
Muhammad Asif Iftikhar1, Talat Naseer Pasha2, Saima Inayat1, Khalid Javed3 and Rahman Ullah4*
...cceptability to the consumers....
Gilmar Jesús Cañarte-Cañarte1, Ernesto Gonzalo Cañarte-Bermúdez2*, José Bernardo Navarrete-Cedeño2, Luis Fernando Díaz-Toral1, Carlos Eddy Alvarado-Zamora1 and Fernando David Sánchez-Mora1*
...ional spacing used by farmers).
...
Muhmmad Asif1, Khunsa Khakwani1, Muhammad Hasnain1*, Farrukh Ilahi1, Muhammad Hussnain Babar1, Shahid Munir Chuhan1, Jehanzeb Farooq1, Hafiz Ghazanfar Abbas1, Iqra Parveen1, Ghulam Sarwar2, Saeed Ahmad2 and Hammad Hussnain2
...CLCuD. The demands of farmers, laborers who harvest crops, and other investors including those in the cotton industry may be met by the introduction of this variety. The present study signifies for recommended as the most suitable commercial cotton cultivars for agro-climatic conditions of Faisalabad....
Asmit Subba1*, Jash Hang Limbu2 and Laxman Khanal1*
...ta, and Ceratophyllum submersum). The type locality of the H. nani in Bangladesh and the newly reported locality in Nepal share similar tropical monsoon climates and river connectivity that might have facilitated their dispersal. Further studies are warranted to understand the detailed taxonomy and distribution pattern of H. nani in Nepal.
Novelty Statement | This st...
Moazama Batool1*, Syeda Ansa Fatima1, Saima Naz2*, Qurat Ul Ain1, Sheeza Bano1, Ghulam Abbas3 and Ahmad Manan Mustafa Chatha4
...as opercular movement, somersaulting activity, convulsions rate, air gulfing was significantly (p<0.05) increased by increasing the bifenthrin concentration. Fin movements and swimming rate was also increased with increase in bifenthrin concentration but at later stage fish became motionless and sluggish. Body color was changed from grey to pale and gills from bright to light red color as bifenthrin concentration increased. Blood parameters such as red bloo...
Khurram Nawaz Saddozai1, Muhammad Nasrullah2, Jahangir Khan3*, Syed Attaullah Shah1, Raheel Saqib4, Naheed Zahra5 and Mansoor Rasheed6
... last unit supplies consumers with a marginal gain equal to the marginal cost of production in an economy. The study in hand was designed to assess the allocative efficiency of tobacco growers during 2019. Primary data was collected through face to face interview and a sample of 120 tobacco growers was selected. These growers were randomly selected from three villages namely Takar Kaly, Garo Shah, and Pasand Kaly of tehsil Takhtbai, district Mardan of Khyber P...
Akbar Khan Khajjak1,4*, Adnan Nazir2, Tehmina Mangan1 and Ali Raza1
... meat. A total of 300 farmers were interviewed, therefore 150 farmers from each district Naushehro Feroze and Benazirabad were recorded. In this study, the Cobb-Douglas stochastic production frontier approach was employed for examining the technical efficiency and inefficiency factors in wheat production. The results indicated that the improvement in wheat production is due to the preferable utilization of land and practices...
Hilarius Yosef Sikone1*, Gomera Bouk2, Edelnia Kristina Bere2, Yohana Kamlasi2, Elisabeth Yulia Nugraha1
Saad Parvaiz1, Khuram Mubeen1*, Mudassir Aziz1 and Tanveer-ul-Haq2
...can be concluded that farmers should control horse purslane within first 45
days in maize field.
...
Muhammad Usman1, Ghulam Murtaza2, Allah Ditta3, Tamana Bakht3 Muhammad Asif4,
Muhammad Nadir1and Sehar Nawaz5
...e awareness among the farmers about the identified weeds so that weed infestation
could be controlled with the recommended practices.
... 
