Submit or Track your Manuscript LOG-IN

Gregg D. Caruso

Science, Religion and Culture
...of life and of the human species), ethics, and the human mind (minds, brains, souls, and free will)? Do science and religion occupy non-overlapping magisteria? How do science and religion support, oppose, and/or inform each other? What is the relationship between religion and modern culture? What is the relationship between science and modern culture? How do the various faith traditions view the relationship between science and religion? What, if any, are the ...

El-Sayed M. Abdelwhab, Jutta Veits and Thomas C. Mettenleiter

Avian Influenza H5N1 in Egypt: What we Know and What we have to Know?
...ut also many other avian species and mammals. Infections of humans were accompanied by mutations in the hemagglutinin (HA) protein which improved the binding affinity to human receptors but simultaneously retained its specificity for avian-receptors. Vaccines were applied nationwide to control the disease in poultry. Meanwhile, the viruses accumulated several point mutations in the HA immunogenic epitopes resulting in antigenic drift and the establishment of i...

David N. Livingstone, Dealing with Darwin. Place, Politics, and Rhetoric in Religious Engagements with Evolution, Johns Hopkins University Press, 2014, 265 pp., ISBN 13: 978-1-4214-1326-6

Reviewed by Francisco J. Ayala, University Professor & Donald Bren Professor of Biological Sciences, University of California, Irvine, email: [email protected]

Science, Religion and Culture

Hanqin Shen1,3, Boliang Wu1,2, Guangwei Li1, Feng Chen1, Qingbin Luo1,3, Yimin Chen1, Qingmei Xie1,2,3*

... identified from various species, including birds and mammals. H9N2 AIVs could spread through water, air, and live bird markets. Since the first isolate from 1994 in China, H9N2 AIVs have been prevalent over 20 areas of China, especially in South China, such as Guangdong, Guangxi, and Fujian provinces. Vaccination is the predominant strategy to prevent and control H9N2 AIVs. There are three inactivated vaccines of H9N2 AIVs have been used in domestic poultry i...

Xingdong Yang and Lijuan Yuan

...irus strain or bacterial species and being maintained free of unwanted microbiota in sterile isolators. The sterile surgical derivation and gnotobiotic status of the pigs allow studies of the infection, disease and immune responses caused by a specific pathogen in the absence of interfering maternal antibodies, other maternal immune regulators, and intestinal and environmental microbes. Due to the similarities between pigs and humans in terms of genetics, phys...

Ozgur Koca

...perennial problem of our species and is in no way specific to one religion, ideology, or culture. A quick look at any history book would make this blindingly evident. It is also true that under specific circumstances the use of violence escalates among certain human collectivities. At this point in history particularly Muslims appear to be subject to this problem as evinced by the emergence of many militant and terrorist organizations like al-Qaeda, ISIL, Boko...

Ghazalah Yasmin1*, Mir Ajab Khan2, Nighat Shaheen3, Umbreen Javed Khan4


E-mail | [email protected]

Sarhad Journal of Agriculture, Vol. 31, Iss. 1
...nd A. tortuosum) of five species distributed in Pakistan using light microscopy and scanning electron microscopy. Results showed that Aconogonon is characterized by tricolpate pollen with microspinulose type of exine ornamentation. One distinctive pollen type was recognized on the basis of aperture number and sculpturing of exine under SEM. Based on analyses in the present study, diagnostic keys to the three species were pro...

Youssef Lhor1*, Mounir Khayli1, Mohamed Bouslikhane2, Mehdi El Harrak3, Ouafaa Fassi Fihri2

Email: [email protected]

...most abundant Culicoides species were Culicoides imicola (94.2-95.85%) and Culicoides newsteidi (2.21-2.72%). The rate of prevalence of these species was bi-phasic and higher from April to June, and October to November 2009. Interestingly, the infectivity rate of BTV was also higher during these periods indicating that high risk of infection is directly proportional to that of transmission vectors. Moreov...

Ummara Waheed Khan, Raza Ahmed, Irum Shahzadi and Mohmmad Maroof Shah

Email | [email protected]

...portant cereal crop species since quite long time. Among the prominent techniques, traditional plant breeding has been on leading edge. The discovery of molecular genetics and biotechnological techniques, such as genome mapping, tissue culture, genetic transformation and in vitro regeneration offered new dimensions of research to improve important crop species including wheat. The tissue culture by i...

 Shubhada K Chothe, Bhushan M Jayarao and Suresh V Kuchipudi

... be conserved across the species. Here, we summarize our current knowledge about the role of lncRNAs in influenza virus infection and the exciting prospect of exploiting lncRNAs as targets to develop novel anti-viral therapies.

...

Khalid Ali1*, Amanullah Jan2

... two green manuring crop species (guar and millet), their incorporation age (40, 70 and 100 days after sowing, DAS) and parts (whole plants incorporation and stubbles incorporation) under varying nitrogen levels (0, 75 and 100 kg ha-1) on physiology, yield and economic returns of Canola (Brassica napus L. cv. Bulbul-98). The experiments were laid out in randomized complete block design with split plot arrangement having three replications. Findings of the expe...

Neil Levy

...tral to our success as a species, and AIs that rely on processing power alone, without the scaffolding of culture, are unlikely to outcompete us intellectually. There is, however, nothing to prevent AIs from having, and taking advantage of, a capacity for culture. AIs with such a capacity may have intellectual powers greater than ours currently are, but the collective deliberation that underlies the power of cumulative culture is more powerful when there is su...

Neil Levy

...tral to our success as a species, and AIs that rely on processing power alone, without the scaffolding of culture, are unlikely to outcompete us intellectually. There is, however, nothing to prevent AIs from having, and taking advantage of, a capacity for culture. AIs with such a capacity may have intellectual powers greater than ours currently are, but the collective deliberation that underlies the power of cumulative culture is more powerful when there is su...

Klara Fischer1*, Erika Chenais1,2, Emeli Torsson1, Jonas Johansson Wensman1

... and goats are important species for the livelihoods of poor people in many developing countries. Within societies where PPR is now spreading, poverty is widespread and the disease is expected to have significant negative impacts on livelihoods. In resource-constrained marginalised societies, it is often difficult to collect disease data in conventional ways. Participatory epidemiology (PE) has been suggested as a particularly suitable research method to study...

Christopher U Orji1*, Ignatius O Onyeocha2, Steven S Shaida3, Peter M Dede4, Bitrus Yakubu5, Elijah E Ella6 and Pam D Luka5

...enetic diversity between species’ population. Two species were studied: Glossina palpalis palpalis and Glossina morsitans submorsitans using two mitochondrial DNA fragment primers- Cytochrome oxidase subunit II (COII) and Cytochrome b (CytB). Twelve samples of laboratory-reared population of each species were used for the study. Sequencing data were used to calculate ha...

Jannatul Noor, Md. Ahaduzzaman, Mir Md. Afzal Hossain, Mohammad Alamgir Hossain, Sardar Abdur Rahim and Md. Samun Sarker

Sayeda Sarah and Muhammad Ibrar

...here was total seven AMF species that were observed and recorded. The dominant genus was Acaulospora which was followed by Glomus, Sclerocystis and Gigaspora. The average AMF spore density ranged from 56-260 spores/100g soil while root colonization ranged from 32-100%. Mycorrhizal enhancement regarding AMF spores density and root colonization ranked asRP0>RP1>RP2>RP3 in all hybrids i.e 0%>25%>50%>100%.

...

Usman Ijaz1, Muhammad Sajid Tahir2, Khalid Abdul Majeed3*, Shahid Iqbal4, Iffat Huma5, S. Firyal6, Ijaz Ahmed7, Shahid Chohan8 and Aamir Riaz Khan9 

...i>Panthera pardus subspecies found in Pakistan by exploring the partial DNA sequences of mitochondrial Cytochrome c Oxidase subunit I (COI) gene. Scat samples of 15 different known leopards were collected from Nathiagali, Khyber Pakhtunkhwa, Pakistan and Azad Jammu and Kashmir, Pakistan. After amplification with specific oligos, the amplicons of partial region of COI were subjected to sequencing, and then observed for single nucleotide polymorphisms (SNPs)...

Paul I. Ankeli, Mashood A. Raji, Haruna M. Kazeem, Moses O. Odugbo, Nendir J. Umaru, Idowu O. Fagbamila, Livinus T. Ikpa, Obinna O. Nwankiti, Issa A. Muraina, Pam D. Luka and Nicholas D. Nwankpa

...y Mycoplasma mycoides subspecies mycoides (Mmm) from the ear canal of apparently healthy cattle in Plateau State, Nigeria. One hundred and sixty six ear swab samples (n=166) were cultured from which eight (8) Mycoplasma species were isolated and characterized using conventional biochemical tests and polymerase chain reaction (PCR), respectively. Six (6) were observed to ferment glucose, reduce tetrazolium chloride and hydrol...

Zuhao Huang1, Feiyun Tu2 and Dianhua Ke1*

...es: Meropidae) is a bird species of family Meropidae with a very large distribution. The complete mitochondrial genome of Blue-throated Bee-eater M. viridis was determined. The mitogenome is a circular DNA molecule of 18,295 bp and comprises of 13 protein-coding genes, 22 tRNA genes, two rRNA genes and two control regions CR and CCR, which was first reported in the order Coraciiformes. The overall A+T content for the mitogenome is 52%, and the GC and AT...

Zisha Liu1, Na Song1, Takashi Yanagimoto2, Zhiqiang Han3, Bonian Shui3 and Tianxiang Gao3*

...ete mitogenomes of three species (O. lacepedii, O. rebecca and

Halide Nihal Açikgöz1*, Serdal Kenan Köse2 and Ali Açikgöz3

 

 

...entify the urban blowfly species having forensic importance on Ankara University Medical Faculty Cebeci Campus in Ankara. Eight small liver bait traps were used for catching flies. Chicken liver was used in the study to attract blowflies. Eggs and larvae of the flies that oviposited on the liver were raised and identified. Six different indices were used to determine diversity (Shannon-Wiener [H’], Simpson Dominance [Sd], Simpson Diversity [S], Margalef ...

Ai Ming Zhou1,2, Guang Wen Liang2, Ling Zeng2, Yong Yue Lu2 and Yi Juan Xu2*

...tion between the two ant species in the field. Here, we investigated the interference of the fire ant S. invicta on the interactions between the ghost ant T. melanocephalum and the invasive mealybug Phenacoccus solenopsis (Hemiptera: Pseudococcidae) in the field. The results showed that fire ant invasion significantly suppressed honeydew exploitation by ghost ant. Fire ant suppression markedly increased the ghost ant foraging activity both on plants and the gr...

Muhammad Khalid Mukhtar*

...ied in Pakistan. Two new species, Oxyopes chenabensis new species, and Oxyopes bidentata new species are being reported from Punjab.

...

Haji Muhammad, Zafar Iqbal* and Saira Saleemi

...tric characters. Seventy species belonging to 43 genera and 17 families were recorded from the study area of Indus River. Thirty two species were commercially important. Alpha Diversity Indices study showed that fish diversity of the River was quite rich (species richness, 70) and diverse, (Shannon’s index=3.66), (Simpson-D=0.96), Evenness was also high (Evenness (H/S) =0.55) and Cha...

Syeda Farzana Bibi*, Lal Badshah and Siraj-ud-Din

... A total of 30 different species ,which belong to 29 genera and 16 families, were recorded from the area.Poaceae was the most dominating family including 7 genera. Ecological characteristics like life form spectra indicated that Therophytes (53.33%) were the most dominating life form. Leaf size spectra showed that the most abundant leaf size was Microphyll (50%). This study not only gives information about the flora of motorway but can provide a baseline for f...

Siyu Yang1, Fukuan Du2 and Pao Xu1,2*

...is a rare and endangered species and also an important resource with high economic value. Somatostatin (SS) is a neuropeptide family which effects growth, development and metabolism. In this study, full-length of one type of SS cDNA from C. nasus was synthesized, cloned and sequenced. This SS cDNA encodes a protein with 114 amino acids that contains the SS14 sequence at its C-terminus. This putative peptide is identical to that generated by the SS1 gene in oth...

Ali Raza Awan*, Sehrish Firyal, Muhammad Tayyab, Lala Rukh, M. Zia ul Haq, Shagufta Saeed and Muhammad Wasim

... is sub-divided in 4 sub-species (P. krameri krameri, P. krameri parvirostris, P. krameri manillensis and P. krameri borealis). Identification of the sub-species is an intricate chore. This study aimed to genetically identify and classify the indigenous wild Rose-ringed Parakeet of Pakistan using Cytochrome b (Cytb) gene polymorphism. Mitochondrial DNA of 24 unrelated Pakistani wild Ring-rose Parakeets was isolated and utili...

Muhammad Sohail1,*, Muhammad Naeem Khan1, Naureen Aziz Qureshi2 and Abdul Shakoor Chaudhry3

...nta anatina), a sentinel species in aquatic environment. Freshwater mussels were exposed to none (0µg L-1), low (120 µg L-1), medium (240 µg L-1) and high (360 µg L-1) levels of lead (Pb), chromium (Cr) and copper (Cu) alone and in combinations (Pb + Cr + Cu) for 15 days under laboratory conditions. Gill cells of mussels were used to determine the DNA damage by comet assay. The tail DNA (%), comet tail length and olive tail moment (OTM)...

Abdullah Mart1* and Orhan Erman2

...n: justify;">Twenty nine species and 2 subspecies belonging to 10 genera of water scavenger beetles (Coleoptera: Hydrophilidae) collected from Bingöl province between May 2003-October 2004 have been described.

...

Abdur Rahim1, Ghulam Abbas1, Muhammad Naeem2, Sara Ferrando3, Lorenzo Gallus3, Noor Khan4, Muhammad Hafeez-ur-Rehman4, Abdul Ghaffar5 and Abdul Mateen6

...al composition, and fish species being used for producing fish meal. The overall production of single processing unit ranged from 40 to 500 metric tonns per month. Kampa Industry (Unit 1) was found to be the first largest contributor producing 100 metric tons in 24 h. The second largest producers of fish meal in this region were Abdul Baqi, Ghulam Hussain and Kampa Industry (Unit 2) which produced 300 to 500 metric tons per month. Proximate composition of fish...

Sabri Unal1, ASır Er2, Erol Akkuzu1* and Lubomir Salek3

Imed Ben Salem*, Aymen Ben Ibrahim, M’barek Chetoui and Said Nouira

...enetic analysis of eight species viz. Lemniscomys barbarus, L. bellieri, L. griselda, L. limulus, L. macculus, L. rosalia, L. striatus and L. zebra; which have practically similar external morphologies although they spread in completely different geographical areas. The approach adopted was to identify landmarks on the skulls of all specimens using the tpsDig software, and then analyzing them through the program MorphoJ. Our results show that L. griselda has t...

Abdul Sattar Baloch1*, Abdul Rasheed1,2, Rahmatullah Rind1, Jam Kashif Sahito1, Rehana Buriro1, Muhammad Faisal Ayoob1 and Parkash Dewani1

...s a wide range of animal species including human beings and is more severe in human than in animals. It imposes a huge burden on human health due to its zoonotic nature. Our study involves the testing of 100 sera samples and 50 milk samples from camels of three districts of Sindh province of Pakistan. Rose Bengal Plate Test (RBPT), serum agglutination test (SAT) and competitive-ELISA (c-ELISA) were used as screening tests, and overall seroprevalence of brucell...

Hussain Ahmad1, Inamullah1, Ijaz Ali2, Tauseef Ahmad3, Muhammad Tufail4, Kabir Ahmad5 and Bibi Nazia Murtaza3,6*

...affecting several animal species and human beings. It is caused by Brucella abortus in animals and Brucella melitensis in human. The current study aimed to find out the prevalence of Brucella and active brucellosis in the human population of district Swat. Total 300 individuals (both female and male of all ages, meeting our inclusion/exclusion criteria) with informed consent were included in the study. Blood samples were collected and brucellosis was detected ...

Muhammad Raheel1,*, Nazir Javed2, Sajid Aleem Khan2, Hafiz Muhammad Aatif3 and Sohail Ahmed4

...ial of native and exotic species of entomopathogenic nematodes (EPNs) was checked on Galleria mellonella larvae. The native species included Steinernema asiaticum and Heterorhabditis indica whereas exotic species were S. feltiae and H. bacteriophora. G. mellonella larvae were exposed to 300 IJs of each species. After inoculation at different temperatures...

Ahmed Samy, Wesam Mady, Naglaa M. Haggag, Samah H. Mohamed, Ebtissam N. AlShamy, M.K. Hassan

...ization of H9N2 in avian species. However little is known about the impact of different strains on the innate immune response. In the present study, using quantitative real-time PCR, cytokines gene expression were examined in response to infection with two strains of Egyptian H9N2 (namely V3 and RSF/1) in chicken peripheral blood mononuclear cells (PBMC). Hemagglutinin gene sequence analysis of the two strains reveal high similarity with difference close to cl...

Noor Us Saher1, Zunaira Amanat2, M. Asif Gondal3 and Naureen Aziz Qureshi4,*

.... Male specimens of both species (M. planipes: χ2 = 245.4, P < 0.005) and (A. lunaris: χ2 = 99.4, P<0.005) were significantly more than females throughout the study period. There was a significant difference in size of male and female crabs within sexes; (M. planipes: t = -4.93, P < 0.005) and (A. lunaris: t = -2.92, P<0.005). Various morphometrical relationships were demonstrated that the males of M. planipes and A. lunaris were larger in ...

Ibrar Khan1,2,3,*, Sadia Qayyum2, Shehzad Ahmed2, Kashif Syed Haleem2, Mujaddad-ur-Rehman1, Guang-Lei Liu3 and Zhen-Ming Chi3

...d fauna. The Penicillium species belongs to one of the most common and economically significant group of marine micro-fungi family. The study comprised isolation, microscopic observations and ribotyping, allowed discrimination of the marine fungal isolates as Penicillium viticola F1, Penicillium restrictum F2, Penicillium rubens F8, Penicillium implicatum F10, Penicillium piceum F11, Penicillium oxalicum F12, Penicillium sumatrense F15, and Penicillium vinaceu...

Nighat Sultana1,2,*, Shazia Iftikhar1, Nafeesa Qudsia Hanif2 and Iffat Tahira2

...×103cfu/ml for all species in both fresh and ensiled maize fodder. Total aflatoxins (AFB1, AFB2, AFG1 and AFG2) and ochratoxin A (OTA) analysis showed that AFB1was present with high frequency in fresh (37.5%) and ensiled (41.66%) fodder, with an average concentration of 9.49 and 8.36ng/g respectively. Aflatoxin B2 was detected in only two samples (16%) (1.2 and 1.3ng/g), aflatoxin G1 and G2 were not found. Ochratoxin A was found more frequently in fresh ...

Wang Tian1, Huayong Zhang1,*, Jian Zhang2, Lei Zhao1, Mingsheng Miao3 and Hai Huang1

... total of 76 zooplankton species were identified in the lake, including 17 protozoa, 36 rotifera, 12 cladocera and 11 copepods species, respectively. Zooplankton species richness changed slightly in the four seasons but varied a lot in different positions. Protozoa was absolutely dominated in zooplankton abundance and its mean value ranged from 2710.2 ind./L in winter to 4259.5 ind./L in s...

Fukuan Du1,2, Yan Li2, Zhixin Wen1, Ruguo Chen1 and Pao Xu2*

...caused extinction of the species in the the Yangtze River. Therefore, it is very urgent to carry out genetic breeding to improve yield. In this study, we developed SSR markers by transcriptome, which could be used to genetic research. In this study, we performed transcriptome sequencing of six libraries from hepatopancreas samples in E. sinensis. After removing low-quality reads, short reads and reads belonging to mitochondria, a total of 278,260,960 clean rea...

Iram Liaqat1*, Najma Arshad2, Muhammad Arshad3, Safdar Ali Mirza4, Nazish Mazhar Ali1 and Ammara Shoukat1

...hly resistant strains at species level. Antimicrobial activity of aqueous and methanolic plant extracts of Camellia sinensis (Green tea), Syzygium aromaticum (Clove) and Mentha piperita (Peppermint) was evaluated against identified isolates. Agar well diffusion assay was used to monitor the antimicrobial activity of these strains both in mono culture and mixed culture. Streptomycin sulphate (10 μgml-1) and Amphotericin B (5 mgml-1) were used as positive con...

Bin Wang, Bo Zhang, Nan Yang, Liang Dou and Jianghong Ran*

...e and demography of this species, however, have not been examined in natural populations. To determine if cooperative breeding occurs in populations unassociated with humans, we surveyed two natural populations in the Ganzi Tibetan Autonomous Prefecture in western China. We compared the demography of the natural populations with that of the habituated population. The results showed that facultative cooperative breeding occurred in the two natural populations, ...

Sana Irshad Khan1*, Zafar Iqbal2, Hamid Ullah Shah2 and Shaukat Hussain3

...eening of various fungal species for antimicrobial natural products. During this study five different fungi, including Alternaria alternata, Acremonium sp., Alternaria brassicicola, Pythium sp. and Aspergillus flavus were screened against Wilt causing pathogens using the dual culture assay. Among them, Aspergillus flavus was found active fungus against the selected vascular Wilt causing fungus and bacteria, i.e. Fusarium oxysporum (87.50 ± 0.11% inhibit...
Eman Mahmoud El-Diasty1,Madeha Abd El-Halim Ibrahimand Ghada Kamal El Khalafawy2,*
...f yeast to the genus and species level is necessary for effective antifungal therapy, and can also facilitate control of infections. A total of 50 isolates were isolated from 60 swab samples collected from two poultry processing plants represented broiler carcasses swabs and worker (hand swabs and nail scrapings). Phenotype-based methods for identifying yeast especially Candida species are often difficult, time-consuming and...
Muhammad Arshad1*, Hafiz Azhar Ali Khan2*, Faisal Hafeez3, Ravaid Sherazi1 and Naeem Iqbal4
...and four different aphid species (spinach aphid, Aphis fabae Scopoli; coriander aphid, Hyadaphis coriandri (Das); cabbage aphid, Brevicoryne brassicae L.;pea aphid, Acyrthosiphon pisum Harris) was evaluated in the laboratory in no choice and free choice feeding assays. In the no choice feeding assay, the stages of beetle (adults, 3rd and 4th instar) consumed more aphids than early stages (1st and 2
Waheed Anwar*, Muhammad S. Haider, Ahmad A. Shahid, Hamid Mushtaq, Usman Hameed, Muhammad Zia Ur Rehman and Muhammad Javed Iqbal
...ty among Fusarium species based on ITS showed that it is not enough to score diversity within species and isolates. Additionally pathogenicity of isolated Fusarium species was evaluated against nymph and adult of Bemisia tabaci. Under controlled conditions different species of Fusarium restrained the growth of B. tab...
Lingtong Ye1, Chao Cao1,2, Bin Tang1,2, Tuo Yao1, Ruixuan Wang1 and Jiangyong Wang1*
...ntification of polydorid species. Our results demonstrate that not only did all COI sequences from the larvae show greater than 99% sequence identity to those from adults, but some larvae share the same haplotypes as adults. These findings clearly indicate that the larvae collected from sea waters around an oyster farm belong to P. websteri, the same species as the adult worms collected from the oyster Crassostrea ...
Mahanama De Zoysa1, Si-yun Ryu1, Hyeon-cheol Kim2 and Bae Keun Park1*
... with all Argulus species, isolated fish lice was identified as Argulus japonicus Thiele, 1899. A. japonicus is native to Asia, which also is a habitat for its typical hosts, such as goldfish and common koi carp (Cyprinus carpio). A. japonicus has not previously been described from goldfish from the ornamental facilities in Korean. This is the first report of A. japonicus morphology with light and scanning electron mic...
Syed Fazal Baqi Kakakhel*, Asad Ullah and Abdur Rashid
...tened’ Markhor sub species Flare-horned Markhor (Capra falconeri falconeri Wagner 1839) in District Swat covering an area of 5337 km² in 2013. The population survey was conducted in two phases i.e. December 21-24 in Kalam and December 26-29 in Mankial valleys. Vintage point count surveys revealed that the Markhor preferred habitats in Kalam and Mankial valleys in District Swat. Among the six sub valleys of Kalam, only Shahoo and Mahoda...
Muhammad Afzal1,Naveeda Akhtar Qureshi1,*, Khalid Zamir Rasib2 and Irfan Hussain1
...ong the most devastating species causing significant loss annually in South Asia. Feeding deterrence of H. indicola among 10 different woods species were evaluated in choice and no-choice assays conducted under laboratory and field conditions. Visual rating according to (AWPA, 1997) scale, mass loss, wood consumption per termite and mortality rate were determined to evaluate resistance of wood against H. indicola
Md. Yeamin Hossain1,*, Md. Alomgir Hossen1, Md. Nasir Uddin Pramanik1, Fairuz Nawer1, Md. Mosaddequr Rahman2, Suraiya Sharmin1, Dalia Khatun1, A. H. Bahkali3, Abdallah M. Elgorban3 and Khairun Yahya4
...g the well-being of this species in the Ganges River. The WR was not significantly different from 100 for males (p = 0.298) and females (p = 0.650), indicating that habitat was still in good condition. Thecalculated a3.0 were 0.0120 and 0.0103 for male and female,respectively. The Lm for male and female B. dario were 7.32 cm and 7.90 cm in TL, respectively. Moreover, MW for t...
Muhammad Luqman Sohail1,*, Muhammad Sarwar Khan1, Muhammad Ijaz1, Muhammad Avais1, Muhammad Yasir Zahoor2, Omer Naseer1 and Muhammad Usman Saleem3
...g a wide range of animal species and humans. 18 Leptospira positive horses based on ELISA and 9 healthy horses were included in the study. Blood profile, serum biochemistry and mineral profile were analyzed at day 0, 7 and 21 of infection. Results showed significant decrease (P<0.05) in red blood cells (RBC), packed cell volume (PCV), hemoglobin (Hb), mean corpuscular hemoglobin concentration (MCHC) and platelets while total leucocytes count (TLC), n...
Amjad Islam Aqib1, Muhammad Ijaz1,*, Aneela Zameer Durrani1, Aftab Ahmad Anjum2, Riaz Hussain3, Saba Sana2, Shahid Hussain Farooqi1, Kashif Hussain1 and Syed Saleem Ahmad1
...ere Streptococcus species (17.45%, 11/63), E. coli (3.17%, 2/63), and Bacillus cereus (4.76%, 3/63). Coagulase positive Staph. aureus (41 out of 47), and hemolysin producing Staph. aureus (39 out of 47) primed among Staph. aureus isolates indicating very pathogenic nature of infection in the area. Risk factors determinants were found significantly (P<0.05) associated with mastitis occurrence except frequency of milk...
Jiancheng Zhai, Li Gao, Yanling Xia and Heping Li*
...y;">Reindeer is the only species in which the females carry antlers in Cervidae, and the differences between the antler tips of the two sexes are one of the most interesting scientific mysteries. The objective of this study was to isolate preliminarily differentially expressed genes in antler mesenchyme of both sexes. The genes were detected with three anchored primers and ten random primers using differential display reverse transcription PCR (DDRT-PCR). Five...
Rashid Mahmood1,*, Waqar Ahmad1, Muhamamd Khalid Rafique1, Ghulam Sarwar1 and Anjum Shahzad2
...tree. Eighteen different species were recorded under 16 genus and 07 families. Ceratina hieroglyphica, Halictus subauratus, Osmia caerulescens were reported first time from Pakistan.
...
Fazal Said1,Mian Inayatullah2 and Hussain Ali3*
... visitation rate of both species was noticed during evening after 1800 h. High frequency of both speciesfound engaged in foraging during 20th and 25th day after initiation of blooms on sunflower due to more number of pollen and nectar. Minimum number of honeybees was recorded during initial and very last days of flowering due to less number of plants with blooms and less availability of pollens and nect...
Fermín Lopez-Uriostegui1, Jesús T. Ponce-Palafox2,*, Fabiola Lango-Reynoso1, María del Refugio Castañeda-Chavez1, Virgilio Eugenio Arenas-Fuentes3 and Fernando Vega-Villasante4
...letion index showed both species feed 24 h, but forage activity differs in intensity in the two species. In M. tenellum repletion index was greatest during the day and M. americanum in the night.
...
Rashid Ahmed Khan* and Muhammed Naveed
...orldwide. Among the many species of fruit flies, Bacterocera zonata is a serious pest of fruits causing severe losses to the fruit production and quality, in Pakistan. In the present experiment the population of B. zonata was monitored using methyl eugenol traps during the year, 2015. Occurrence and population dynamics of the fruit fly were compared with meteorological factors, such as temperature, relative humidity and sunshine. The highest mean...
Mingqin Shao1*, Bin Chen1, Peng Cui2, Binbin Zeng1 and Jianhong Jiang1
...the daily habits of this species, such as dispersed foraging, collective maintenance and rest. Group size peaked in February (5.07 ± 4.166 individuals) and was smallest (2.91 ± 1.354 individuals) in December with significantly different group sizes in all months (F = 35.351, df = 3, P < 0.01). A total of 57.98% of all groups had a majority of females. A large difference in sex ratios was observed among different months. The actua...
Zafar Iqbal1* and Muhammad Khurshid2 
...plant viruses from plant species containing various forms of PCR amplification inhibitors. In current study, IC-PCR was used for the detection of Tomato leaf curl New Delhi virus (ToLCNDV) from plant extracts of Nicotiana benthamiana plants inoculated with ToLCNDV. To immunocapture the ToLCNDV, two antisera raised against Tomato yellow leaf curl virus-coat protein (TYLCV-CP) and African cassava mosaic virus-coat protein (ACMV-CP) were used. Howev...

Iftikhar Ahmad, Abdul M. Saleem, Ghulam Mustafa, Khurram Ziaf, Irfan Afzal and Muhammad Qasim

... mM KNO3 for both tested species. This was interpreted by reduced time to 50% germination (1.2 d for gerbera and 2.4 d for zinnia), higher final germination %age (11% for gerbera and 7% for zinnia), seedling vigor (83% for gerbera and 46% for zinnia), and fresh weight (0.95 g for gerbera and 2.29 g for zinnia) and dry weight (0.3 g for gerbera and 0.5 g for zinnia) of the seedlings. These halopriming treatments (25 to 50 mM CaCl2 or 50 to 100 mM KCl and KNO3&s...
Sehrish Rasool1, Zain ul Abdin1,*, Saqi Kosar Abbas2, Sumra Ashraf1, Maryam Anwer1, Atif Manzoor1, Muhammad Tahir1 and Hoor Shaina1
...fect of size of two host species Galleria mellonella (Pyralidae: Lepidoptera) and Spodotera litura (Noctuidae: Lepidoptera) was studied on larval competition, survival and development of a gregarious ectoparasitoid Bracon hebetor (Say.) (Hymenoptera: Braconidae). The number of adults, sex ratio and size of emerging adults were recorded. Smaller and larger host species were used to determine the su...

 Saqib Ali1, Suliman Ali1, Lina1, Wen Zhou1, Muhammad Irfan Waris1, Ashfaq Ali2 and Man Qun Wang1,*

...tree ailments. The alien species related to hardwood packing substances have been remarkable tree destroyers in the urban and semi-urban areas of China. In forests flora and fauna inhabitant species take action against disturbances, for instance fires in addition to windstorms, and start the bio-worsening of woody tissue. The females lay eggs on the bark surface of the stems and branches of trees as a result rotten wo...
Wali Khan*, Ghazal Mumtaz, Saima Bibi and Salma Afzal
...ith one or more than one species of parasites. Intestinal parasites Ascaris lumbricoides 26.7%, Trichuris trichura 19.6%, Taenia saginata 25 % and Entamoeba histolytica cyst 28.5% were detected. The highest prevalence was recorded for Entamoeba histolytica while Trichuris trichura was detected as the least parasitic infection. Coriandrum annum (Coriander) was found highly contaminated 14.2% with parasitic infection while Zingiber officinale (Ginger) with least...
Tausif Ahmad1, Iahtasham Khan2, Saddaf Razzaq1, Saeed-ul-Hassan Khan1,* and Raheela Akhtar3
...aloes and cattle (60 per species) at Civil Veterinary Hospitals, animal markets and peri-urban livestock holdings in Rawalpindi and Islamabad. Serum samples were initially screened by the Rose Bengal Plate Test (RBPT). RBPT positive samples were subjected to a B. abortus specific indirect enzyme-linked immunosorbent assay (i-ELISA). Serum samples that were confirmed to be positive for B. abortus through serology were subjected to an rPCR in order...
Irum, Akram Shah*, Sobia Wahid, Nazma Habib Khan and Qaisar Jamal
...ences and Cyclops species in drinking water sources. A cross-sectional household survey was carried out using in-person questionnaire evaluation along with microscopic assessment of water samples for Cyclops species. Based on previous clinical records of dracunculiasis, five villages of Dera Ismail Khan including Kath Garh, Wanda Dost Ali, Chah Mundar Wala, Ketch and Gara Baloch were surveyed for a total of 206...

Muhammad Asif Zahoor1, Zeeshan Nawaz1, Abu Baker Siddique1, Sajjad ur Rahman2 and Shahid Ali1*

...mples, either one of the species or simultaneous infection. M. gallisepticum was found in 39/96 samples (40.62%) and M. synoviae in 32/96 samples (33.34%), whereas 25/96 samples (26.04%) were detected with simultaneous infection with both species. Altogether, it has been observed that multiplex-PCR is a sensitive tool for early and accurate diagnosis of Mycoplasma infections from samples collected from clinically sick and ap...
Tianzhu Chao, Huiqiang Cai, Yuxun Zhou, Kai Li* and Junhua Xiao
...ify;">The patterns of subspecies distribution, diversity and differentiation of the house mouse Mus musculus provide insights into past dispersal events in natural populations of this species. We investigated the molecular phylogenetics of Chinese house mice based on 466 DNA sequences from mitochondrial D-loop fragments. Our analyses revealed that Mus musculus musculus and M. m. castaneus are older colon...
Matiyar Rahaman Khan1,*, Sabyasachi Pal2, Ghule Tushar Manohar2, Somnath Bhattacharyya3, Amit Singh4, Prahlad Sarkar5 and Samuel Lalliansanga6
...f the root knot nematode species was identified based on observations on morphology of different life stages, beta-esterase phenotype and amplification of rDNA and partial sequence homology of ITS-1and ITS-2. Host differential tests confirmed the race 2 of M. incognita infecting passion fruit. Pathogenic relationship with the passion fruit was proved through inoculation studies and inoculated plants also produced almost similar above-ground symptoms and...

Muhammad Khurshid1,2*, Muhammad Nafees1, Mehmet Somuncu2

...table or poisonous weeds species. Furthermore, this crops encroachment effected the capabilities of pastoral communities to keep large herds containing more livestock for their livelihood dependency. It is concluded that unsustainable crops expansion has triggered pastures resource degradation and is threating the traditional pastoral system in HKH region. Integrated and collaborative approaches are needed for pasture resources management with efficient and su...

Wazha Mugabe1,2, Lawrence Akanyang1, Mackenzie Nsinamwa1, Batanani Moatswi1, Naledi Matthews1, Kealeboga Dipheko1, Imtiaz Ahmed Ujjan3 and Assar Ali Shah2*

...r changes in fodder tree species composition caused by grazing pressure is critical since fodder trees form the base diet for browser such as goat as well as maintenance purposes for cattle in the dry season. Thus understanding the dynamics on rangeland response to grazing could prove worthy in finding an equilibrium point for optimizing animal productivity, with limited range degradation. Therefore, the current study was aimed at determining and comparing fod...

Waqas Ahmed Dogar2, Arshad Ali Khan3*, Saeed Ahmed2, Sudheer Tariq2, Mukhtar Ahmad2, Muhammad Imran2, Muhammad Noman2 and Nadeem Khan1 

...d 22 x 22ft (T3) of both species. Musambi showed best results as compared to Kinnow. So this study helped to optimize best planting distance in citrus adopted for high yield and good quality fruit with some extra care and management practices in orchard and proved to be the best planting distance for citrus under agro ecological conditions of Punjab province of Pakistan.

...

Nirbhay Kushwaha, Achuit K Singh, Brotati Chattopadhyay and Supriya Chakraborty

Recent advances in geminivirus detection and future perspectives
...viral molecule to strain/species level for accurate diagnosis.

...

Bijan Kumar Das

Incidence of Aleurocanthus spp. (Aleyrodidae: Hemiptera) on betelvine (Piper betle L.) and their interaction with host plants
...rvey in betelvine, a new species of Aleurocanthus (description under process) was recorded from West Bengal. This had also been found to occur on Piper longum L. Another species, A. nubilance (Buckton) which was recorded on betelvine in Bangladesh during 1900, was not recorded in this area. Detection of host resistance against insect pests is very relevant for genetic improvement programmes. Till date, scanty information is ...

S. Subharani, S. S. Thorat, N. Abem, L. Amit Kumar and T. K. Singh 

A database on parasitoid of insect pests of crops in Manipur, India
...isting of 62 (sixty two) species records gathered by conducting a systematic survey of parasitoids on insect pests of crops in different localities of Manipur was developed by using MS-Access. The database is for academic purpose and it includes the taxonomic details of the parasitoid, host insect, host plant, morphological characters, geographical distribution, period of activity, parasitoid behavior and its biology etc. Image of the parasitoid

Sitansu Pan and Amrita Das

Population proliferation and spread of Trichoderma spp. in soil under two different delivery systems
...pectively. Among the two species of Trichoderma, T. harzianum have spread faster than T. viride.

...

M. S. A. Mamun and M. Ahmed

Integrated pest management in tea: prospects and future strategies in Bangladesh
...and weeds. Globally 1034 species of arthropods and 82 species of nematodes are associated with tea plants. Among them 25 species of insects, 4 species of mites and 10 species of nematodes are recorded from Bangladesh. Enormous crop loss was incurred due to the attack of these pests and largely responsible for the decli...

Goutam Samui and Shantanu Jha

Branch gall of mango (Oligotrophus mangiferae Keiffer) its bioecology and management
...nch gall is a univoltine species. Emergence of adults from gall could be found from 2nd week of February, which continued up to 2nd week of March. Incubation, larval and pupal period lasted for 3-5 days, 315 days and 30-45 days, respectively. Eggs were laid singly throughout the young vegetative shoots by puncturing the tissue. A full grown larva was yellow in colour with a clear dark brown constriction on head. Initially the pupa was creamy white in colour wh...

Rashid Pervez, Santhosh J. Eapen, S. Devasahayam and M. Dinsha

Characterization of entomopathogenic nematode, Stein-ernema carpocapsae from ginger (Zingiber officinale Rosc.) rhizosphere in India
...irulence on above insect species. This study reported occurrence of a isolate of S. carpocapsae from ginger rhizosphere from India. This indigenous isolate could be investigated further for managing insect pests of ginger.

...

A. K. Ganguly and Uma Rao

Decades of researches in biochemical and molecular nematology at IARI
...tant root knot nematodes species of India belonging to the genus Meloiodogyne. Further, molecular markers like RAPDs, AFLP, SSRs and PCR–RFLP of rDNA have been employed to study the molecular genetic diversity in major root knot and cyst nematode species of India to assist the breeding program for developing resistant varieties and other purposes like regulatory and nematode diagnostics. Attempts have also been to made...

Amitava Konar and N. Johnson Singh

Occurrence of aphids on various potato germplasms in eastern gangetic plains of West Bengal
...e application. The aphid species viz. Myzus persicae (Sulzur) and Aphis gossypi Glover were recorded first during third week of December and crossed the threshold limit (20 aphids/100 compound leaves) during first to second week of January in Kufri Chandramukhi whereas in Kufri Jyoti and Kufri Joawhar, the pest was observed first by fourth week of December and attained the critical level during second to third week of January. The pest initially occurred durin...

S. Pal and I. Sarkar

Pests infesting ornamental plants in hilly region of West Bengal
...lower. A number of aphid species were found infesting different ornamental plants viz. Myzus persicae on Carnation, gerbera and Anthurium; Macrosiphoniella sanborni on Chrysanthemum; Aphis gossypii on China rose. Other sucking pests infesting ornamentals included Bemisia tabaci on Gerbera, leafhopper on Gladiolus and scale insect (unspecified) on Anthurium. Amongst the thysanopteran pests Taeniothrips simplex was very much serious on Gladiolus and another
Nasreen Memon1,*, Rukhsana Parveen2 and Imtiaz Ahmad2, Nadir Ali Shah3
...tify;">Till to date nine species of the genus Halys are described from Asia. Of the nine species, five are described from Pakistan, including present two new species from Sindh province. These two new species are described, illustrated and compared with the allied species. Illustrations include dorsal view, scen...
Song Li1,* and Zuojian Feng2
... describe them as new subspecies P. a. muzongensis subsp. nov. Discussion on the relationships between the differentiation of P. albiventer and its environmental evolution in southwestern China are also provided.
...
Sohail Ahmed, Muhammad Arshad and Babar Hassan*
...s on woods of three tree species to ward off subterranean termites. Three resins types in three concentrations were applied by brushing and dipping on wooden stakes which were exposed to termites’ for a period of 4 weeks in the field. Weight loss before and after resin treatment was indicative of effectiveness. Highest concentration of all resins significantly reduced the chances of termites’ infestation as compared to other concentrations by dippi...
Freeha John, Noor Abid Saeed*, Sajid Nadeem and Muhammad Hamed 
...nd in mid January. Three species of aphids: Rhopalosiphum padi (L.), Schizaphis graminum (R.) and Sitobion avenae (F.) were found infesting the wheat crop. At the time of aphid invasion crops were at different growth stages such as 1st node (crop 1), at stem elongation (crop 2) and at end of tiller (crop 3). Maximum aphid infestation was recorded in all crops in the 3rd week of February when crops were a...
Yasemin Bircan Yildirim* and Hediye Tugce Vurmay
...cially important finfish species: saddled seabream (Oblada melanura), gilthead sea bream (Sparus aurata), Bogue (Boops boops), horse mackerel (Trachurus mediterraneus), red mullet (Mullus barbatus), brushtooth lizardfish (Saurida undosquamis), grey mullet (Mugil cephalus), threadfin bream, (Nemipterus randalli), which were caught from the Iskenderun Bay at 6 different locations (local fishermen’s fi...
Baohua Chen1,2, Wenzhu Peng3, Jian Xu2, Jingyan Feng1,2, Chuanju Dong1,2 and Peng Xu2,3,*
...GST class from different species share more similarity than genes of different classes in the same species. Copy number of GSTs examining showed that five classes of GST genes in common carp have undergone the gene duplications, including MGST1, GSTK, GSTM, GSTA and GSTT. Comparative genomics and syntenic analysis provided new evidences for better understanding on gene fates post whole genome duplication (WGD) of common carp...
Viram Kumar1,*, Moolchand Malhi1, Saeed Ahmed Soomro1, Toufique Ahmed Qureshi2, Muhammad Nawaz Sanjrani3 and Khushal Das Malhi1
...d conditions in the same species.
...
Ahmad Ali1,*, Sheikh Muhammad Azam2, Khalid Javed Iqbal1, Ghulam Mustafa1 and Mujahid Kaleem3
.... There are five big cat species in the genus Panthera and tiger is the biggest one. Data were collected by recording observations on breeding of Royal Bengal Tiger in captivity at Bahawalpur Zoo from June 2012 to July 2014 (two years) on prescribe sheets. Data from June, 2003 to December, 2011 (nine years) were collected from zoo management. In two years study Tiger breed once and produce four cubs (female) while in nine years it breed three times...
Muzafar Shah1,*, Mian Sayed Khan1, Muhammad Ather Rafi2, Habib Ahmed3 and James M. Carpenter4
Hazrat Ali1,*, Wajid Ali1, Karim Ullah1, Fazle Akbar1, Sher Ahrar1, Irfan Ullah1, Irum Ahmad1, Ashfaq Ahmad1, Ikram Ilahi2 and Muhammad Anwar Sajad3 
...nomically important fish species, an herbivorous fish Schizothorax plagiostomus and a predatory fish Mastacembelus armatus, from three rivers of Malakand Division, Pakistan. Concentrations of Cu and Zn were determined in fish samples by atomic absorption spectrophotometer. Highest Cu concentration of 4.52 ± 0.24 mg kg−1 wet weight was observed in muscles of M. armatus at Chakdara on River Swat while highest Zn conce...
Sogolo L. Lebelo1,* and Gerhard van der Horst2
...r, there also seem to be species differences among the mammalian group. The association of these cells with developing cells, and Sertoli cells was established. However, the association of Leydig cells with spermatogenic cells at different stages of spermatogenesis needs further investigation.
...
Saba Irshad1,*, Ayesha Ashfaq1, Ammara Muazzam1 and Abida Yasmeen2
...luence on Candida species and F. solani. These extracts fully inhibit growth of PC3 cells. Moreover, partially purified lectin, from Curcuma longa L. with a molecular weight of 17.3 KDa might be useful to treat patients as a considerably cheap herbal drug which can be prescribed to poor people efficiently at an affordable cost.
...
Yijin He1, Song Ma2, Bo Liu1,*, Ting Xue1, Qunlan Zhou1, Wu Jin1 and  Kui Chen2,*
...asciatus is a unique species of China which is distributed in the estuary of the Yangtze River, and belongs to the same genus with Red fin puffer T. rubripes which has been used as one of human genome model animal since mid-1990s. In this experiment, we cloned a pair of DNA fragment sequence including complete ORF (921bp) of taste receptor candidate gene T2R1 of T. fasciatus and studied the differential expression spectrum of tissues i...
Muhammad Hanif1,*, Naureen Rana1, Muhammad Akbar Khan2, Muhammad Javed1 and Muhammad Sajjad Khan1
...d molars. The identified species of hipparionines include Hipparion sp. small, Cormohipparion sp., Sivalhippus cf. nagriensis, and Sivalhippus cf. theobaldi. These specimens provide additional information about the recorded species and contribute to recent work of Perissodactyla from the Middle Siwalik Hills of Pakistan.
...
Ghulam Abbas1,Asif Nadeem1,*, Masroor Ellahi Babar2, Tanveer Hussain2, Muhammad Sajid Tahir3, Wasim Shehzad1, Rajput Zahid Iqbal3, Muhammad Tayyab1 and Maryam Javed1
...xt-align: justify;">Many species of mammals have declined within the past two centuries due to human caused disturbances and the unsustainable use of natural resources. Molecular methods have an important role in phylogeny and diversity analysis. In Pakistan hog deer (Axis porcinus) is an important wild species belongs to the family Cervidae. The hog deer is one of the least studied species
Rais Ahmed1,*, Khushi Muhammad1, Masood Rabbani1 and Muhammad Sarwar Khan2
...ustify;">Brucella species are cause of abortions and other reproductive disorders in animals and human beings. In this project, prevalence and distribution of soil borne Brucella species in nine districts of Punjab including Lahore, Faisalabad, Sheikhupura, Sargodha, D.G. Khan, Chakwal, Sahiwal, Gujranwala and Attock were determined. By using grid based sampling strategy, soil samples (n= 1280) were collected f...
Kanwer Shahzad Ahmed1, Muhammad Zeeshan Majeed1,*, Muhammad Ather Rafi2, Fatima Sellami3 and Muhammad Afzal1
... importance. Among 6,000 species of coccinellids described worldwide, only 75 species have been reported from Pakistan so far. Keeping in view the limited work on these important beetles, an extensive faunal survey was conducted in the district Sargodha (32°05’02’’ N and 72°40’18’’ E), Pakistan to assess the species richness and distribution of c...
Fareeda Tasneem1, Farah Rauf Shakoori1 and Abdul Rauf Shakoori2,*

 

...ons found in the ciliate species. Thus a fragment of histone H4 gene (160bp) was sequenced in ten locally isolated strains of Paramecium species including a standing-alone on the basis of 18SrDNA gene sequence strain FT8. In order to readdress the relationships of FT8 strain with other strains of Paramecium species, a molecular phylogenetic analysis was performed on the basis...
Shazia Rasheed1,* and Javed Mustaquim2
.../i>, they belong to five species; namely Octolasmis angulata (Aurivillius, 1894), O. cor (Aurivillius, 1894), O. lowei (Darwin, 1851), O. tridens (Aurivillius, 1894) and O. warwickii Gray, 1825. The rate of infestation was found markedly low in P. pelagicus (2.9 %) and P. sanguinolentus (10.8 %) during present investigation. Octolasmids prevalence was significantly higher in female P. pelagicus (81...
Lu Liu1, Sher Khan Panhwar2, Tianxiang Gao3, Zhiqiang Han3, Chunhou Li4, Dianrong Sun4 and Na Song1,*
...tify;">Three Liza species exhibiting a dorsal keel have been identified based on morphology: Liza affinis, Liza carinata, and Liza klunzingeri. To confirm the validity of the species by molecular methods, we sequenced a fragment of the cytochrome oxidase subunit I (COI) gene of mitochondrial DNA of Liza affinis and Liza klunzingeri from coastal waters of China and Pakistan, respectiv...

Muhammad Amin1*, Khalid Mahmood2, Imran Bodlah3, Muhammad Rahim Khan2 

...: justify;">Twelve aphid species, inclusive of 6 new records to Pakistan’s aphidofauna, were found infesting Rosa species in study conducted during 2015-2016 in Poonch division of Azad Jammu and Kashmir-Pakistan. Chaetosiphon (Pentarichopus) fragaefolii (Cockerell), Chaetosiphon (Pentarichopus) thomasi Hille Ris Lambers, Chaetosiphon (Pentarichopus) tetrarhodum (Walker), Metopolophium montanum Hille Ris Lambers, Myzaph...
Mohammad Umar Farooq1*, Sarfaraz Ahmad2, Ghulam Nabi1, Ijaz Ali1 and Imtiaz Ahmad1
...nd response of different species.
...
Wanchao Zhu1, Qinguo Wei1, Shuyu Xue1, Huanxin Zhang2, Tianshu Lv1 and Honghai Zhang1,
...lation structure of this species.
...
Zuhao Huang*, Meifang Li, Rujue Ruan and Jiawei Qin
...ntrol region genes of 20 species were analyzed. All the Ardeidae species had duplicate control regions, except four species having only single region. The control region spans the region between the genes for tRNAGlu - tRNAPhe in the most Ardeidae species. The length of the control region sequences ranged from 1427 bp (Ixobrychus...
Mushtaq Ahmad1,*, Mehboob Ahmed1,2 and Nasim Ahmad1
...tly. Though used in many species but the variability exists in technique. Therefore, the present study was aimed to optimize the steps of AO staining protocol for buffalo sperm which has not been explored yet. Semen was collected from two mature buffalo bulls, diluted in tris citrate egg yolk based extender and cryopreserved using standard protocol. The semen straws were thawed at 37oC and stained using different protocols as followed: Protocol 1 (w...
Muhammad Usman Qamar1, 2, Sidrah Saleem1, Usman Arshad1, Muhammad Farhan Rasheed3, Hasan Ejaz4, Naveed Shahzad5 and Shah Jahan6,*
...enem resistant bacterial species; E. coli, K. pneumoniae, E. cloacae, A. baumannii and P. aeruginosa, were isolated and identified using VITEK 2 compact system. Carbapenamase and metallo-β-lactamase (MBL) production by these isolates was confirmed by modified Hodge’s test and disc potentiation method, respectively. The blaNDM-1genewas amplified by PCR and sequenced. MIC of different antibiotics were determined by VITE...

Carolina Torres Alejo1,2, Laila Andreia Rodrigues Beserra1,2, Paulo Eduardo Brandão1,2, Luis Ramiro Luna Espinoza1,2 and Fabio Gregori1,2* 

...nteric diseases in avian species, causing decreased growth performance and mortality. In this study, 59 pools of intestinal content of layers, broilers, and breeders were investigated from different Brazilian regions for the presence of rotavirus (RVA, RVD, and RVF), avian coronavirus (ACoV), and avian astrovirus (AAstV), using PCR reactions followed by nucleotide sequencing and analysis. Twenty-nine pools (29/59; 49%) appeared positive for AAstV, 6 pools (6/5...
Shahid Hussain Farooqi1,*, Muhammad Ijaz1, Muhammad Hassan Saleem1, Muhammad Imran Rashid2, Muhammad Oneeb2, Amjad Khan3, Amjad Islam Aqib1 and Shakeel Mahmood4
...rious Ixodid tick species and risk factors associated with tick infestation and burden levels were studied in bovine from three distinct temporal zones of Khyber Pakhtunkhwa province of Pakistan. Twelve hundreds ticks were collected from four hundreds animals comprising of two hundred and fifty cattle and one hundred and fifty buffaloes. Descriptive statistics with Pearson’s Chi-square test and regression model were applied to analyze the data. Th...
Jie Wu1, Jiagui Zhu2, Ke Wang2, Dejing Cai2, Yingying Liu1, Yanzhen Bu1,* and Hongxing Niu1,*
...e reintroduction of this species, the process of pairing, nest site selection, egg laying, incubation and brooding of the crested ibis in the wild was studied in Dongzhai National Nature Reserve, Luoshan County, Henan Province, China. From October 2013 to May 2015, a total of 78 captive-bred individuals have been released into the reserve and monitored through radio transmitters or satellite transmitters. Twelve nests of 10 pairs were recorded over three breed...
Nargis Bano and Khalid Mahmood Qureshi*
...found to protect several species of plants against environmental stresses by initiating different processes that are involved in the mechanism of stress tolerance. SA is part of an extremely complex signal transduction network’s part and it works differently in different systems. Drought stress is a major restraint for crop production in arid and semi arid states such as Pakistan. In this study experiments were conducted against the responses of strawber...
Rabia Arif*, Shahar Bano, Muhammad Ishfaq and Muhammad Saleem
...aria and the topmost species in this investigation was fimicola. Circular Phylogram showed close relatedness among the strains under study and potential association with the Ascomycetes. This study for the first time reports the variations at the molecular level between strains from two different environments. V3 and V4 regions showed genetic variations at two sites i.e., 212 A (C); 213 G (A) in strains isolated from the stressful environment...
Naheed Bano* and Muhammad Afzal
...ction is less than other species due to its slow growth and high mortality due to unavailability of suitable diet especially at juveniles stage. This study focus on the healthy production with low cost by using sunflower meal to some extent replace fish meal. In this 3× 3 factorial and completely randomized design study 324 fish were used. The acidification levels were (0, 1.5 and 3%) whereas the phytase levels were (0, 500 and 1000 FTU). The addition of...
Nosheen Rafiq1, Asmatullah Kakar2,*, Arshad Ghani3, Asim Iqbal2, Wali Mohammad Achakzai2, Shagufta Sadozai2, Mohammad Shafiq4 and Mohammad Alam Mengal5 
...etermining the hard tick species and their abundance with respect to host-related risk factors in Bos permiginu s cattlewas conducted in farm houses at three main regions (Western by-pass, Spiny village, and Sariab region) of District Quetta from March, 2013 to March, 2014.   Around 1649 ticks were captured from six main body parts of 404 cattle. Of these 346 (65.96%) were observed to be plagued by one or more tick infestation. Compositions ...

Attaullah Ansari* and Nasreen Memon 

...specimens belonging to 8 species, 6 genera of two subfamilies were collected, among which Episurphusbaltatus, De Geer, Eritalinus aeneus, Scopoli, and Ischiodon scutellaris, Fabricius were found to be most prevalent whereas; Eristalis arbustorum was found least in number during study period. The abundance of hoverflies fauna varied seasonally, the highest abundance was recorded in spring while lowest in autumn. Pearson’s correlation coefficient resu...
Faiz Muhammad1,*, Syed Khurram Fareed1, Urooj Zafar1, Taseer Ahmed Khan2 and Aqeel Ahmad1
... of other mycoplasmas (5 species from avian origin and 3 other mycoplasmas species) but it produced only the genus specific band. The optimized ratio of tPCR primers were 1: 1: 10: 1. For Outer F, Inner R, and Inner F and Outer R, respectively. MgCl2 concentration did not affect and added at 2.0 mM. Four different culture methods were compared for their efficiency for avian mycoplasmas culture. The B method (parts...
Liana Mihaela Fericean1* and Mihaela Corneanu2
...nbach) is a cosmopolitan species who can cause direct damage to the plants by extracting the sap, and indirectly it is a vector to 16 plant viruses. The study presents data referring to the external morphological characteristics, to the biometrical measurements and to the life cycle of Aphis nasturtii. The researches have been carried out for a period of four years on the potato and for a period of two years on the orchards from Romania. At the Aphis...
Saba Manzoor1,*, Ali Raza Awan1, Abdul Wajid1, Sehrish Firyal1, Muhammad Tayyab1, Muhammad Mansha2, Asim Khalid Mahmood3, Abu Saeed Hashmi1 and Muhammad Wasim1,*
...ow any variation in both species. While expression of c-Myc gene was found to be up regulated in different canine (62.5% in mammary adenocarcinoma, 75% in oral squamous cell carcinoma, 66.6% in peri-anal sac adenocarcinoma, 80% in mast cell tumor and 100% in soft tissue sarcoma) and feline (60% in mammary adenocarcinoma and 100% in soft tissue sarcoma) tumors studied. These findings might support the established role of c-Myc in tumor pathogenesis but h...
Müge Aliye Hekimoğlu*, Cüneyt Süzer,Şahin Saka andKürşat Firat
...on of some aquarium fish species. The induction and recovery times were determined at five stages of melanistic and not melanistic clownfish (Amphiprion ocellaris) and different sexes of Swordfish (Xiphophorus helleri). Clownfish were tested with 0.4, 0.6 and 0.8 ml/l phenoxyethanol and 0.5, 1 and 1.5 ml/l clove oil. Swordfish were tested with 1, 3 and 5 ml/l phenoxyethanol and 2, 4, 6 ml/l clove oil. For short-term application the safe dose for ...
Mahreen Yahya, Noor Abid Saeed*, Sajid Nadeem, Muhammad Hamed and Sajid Shokat 
...h of plants. Three aphid species were recorded i.e., Rhopalosiphum padi (L.), Schizaphis graminum (R.) and Sitobion avenae (F.). Mean seasonal aphid population (no. of aphids/tiller) on wheat plants during the whole season was the highest in NW-1-8183-8 and NW-3-3341-7 and the lowest in Faisalabad-08. However, grain yield was the highest in Galaxy-13 and the lowest was in Lasani-08 variety. Two applications of insecticide, (imidaclo...
Mubashir Hussain1,Safdar Ali1, Muhammad Naveed Tahir1, Ghulam Abbas Shah1, Ijaz Ahmad2*, Muhammad Aqeel Sarwar3 and Sohail Latif4
...uency, diversity of weed species and relative importance value. The input and output data was also collected to find out the socioeconomic feasibility of the techniques. The comparative analysis of seed bank extraction methods revealed higher weed seeds density, weed frequency with more diversity of weed species under sieving method in comparison to seedling emergence method. Therefore, sieving method was considered superior...
Carolina A. Bonin1,2, Eric A. Lewallen2,3, Andre J. van Wijnen3, Marta Jussara Cremer4 and Paulo C. Simões-Lopes5*
...tions of coastal dolphin species indicate that marine mammal populations are susceptible to rapid decline. Yet, effective conservation efforts depend on population-level ecological data. To obtain principal baseline data that will inform management efforts, we characterized the habitat and recorded the behaviour of a Guiana dolphin (Sotalia guianensis) population within one of the most well-preserved estuaries off southern Brazil. Monthly surveys were c...
Liushuai Hua1,3, Shiping Gong1,*, Xiangjing Zhong2, Jun Tao2, Yu Chen2 and Jieming Deng2 
...ngered freshwater turtle species.
...
Minmin Chen1, Xiaoke Zhang1, Kexiong Wang2, Zhigang Liu1, An Wan3, Daoping Yu1,*, Hong Ji3 and Fangzhen Peng1
... a critically endangered species, as the whole population in the wild suffered sharp decline and fragmentation. Observations of the local spatial and temporal distribution dynamics can help establish better conservation strategies. In order to understand the characteristics of habitat chosen, a continuous 15 months observation on the distribution patterns of the Yangtze finless porpoise at the confluence of Yangtze and Wanhe rivers was conducted. The results s...
Jianping Li1, Qian Jiang2, Wei Chen2, Yumei Li3, Huaizhi Jiang4, Jinlong Huo5 and Qiaoling Zhang2*
...r, comparison with other species revealed three dramatic amino acid mutation areas. Our results also indicated that c-kit expression was higher in the white cashmere goat than in the black goat, and this significant difference was detected by q-PCR and western blotting. All cashmere goats of different colors examined by immunohistochemical analysis showed either weak (the black cashmere goat) or strong (the white cashmere goat) expression of the KIT pro...
Muhammad Khaled Siddiq1, Ayesha Riaz2, Muhammad Akbar Khan1, Muhammad Adeeb Babar1, Khalid Mahmood1,* and Muhammad Akhtar1
...k Group. The Pleistocene species, Boselaphus cf. namadicus, was adapted to open and dry habitats of the Siwaliks.
...
Saba Khalid*, Muhammad Saddique Awan, Riaz Aziz Minhas, Nasra Ashraf, Khawaja Basharat Ahmed, Nuzhat Shafi and Sajid Abassi
...ites. Seventy eight bird species were recorded that belonged to 34 families and 11 orders. Passeriformes was the dominant specie. The habitat destruction due to deforestation, agricultural activities, infrastructure and land sliding and disturbances by the increasing human population were major threats to the avian fauna of Rawalakot.
...
Sher Khan Panhwar1,2,3, Zhou Yong Dong1,4,*, Gao Tianxiang1,3, Wang Ping5, Han Zhiqiang1, Wang Zhongming1,4 and Wang Yang1,4
...d ecologically important species in the ECS.
...
Semra Benzer1,* and Recep Benzer2
...growth estimation of the species in biological systems. Another outcome of this study is that crayfish of Uluabat Lake well accommodates itself to the ecologic features of the environment and so its growth features are similar to the values of other water systems.
...
Jie Wu1, Jiagui Zhu2, Ke Wang2, Dejing Cai2, Yingying Liu1, Yanzhen Bu1,* and Hongxing Niu1,*
...e reintroduction of this species, the process of pairing, nest site selection, egg laying, incubation and brooding of the crested ibis in the wild was studied in Dongzhai National Nature Reserve, Luoshan County, Henan Province, China. From October 2013 to May 2015, a total of 78 captive-bred individuals have been released into the reserve and monitored through radio transmitters or satellite transmitters. Twelve nests of 10 pairs were recorded over three breed...
Medeni Aykut
...identified. In total, 40 species in 17 genera of family Dytiscidae were recorded, of which 37 were new to the study area. Eretes sticticus (Linnaeus, 1767) is the second record for Turkish fauna. Furthermore, Hydroporus inscitus Sharp, 1882 is new record for the Turkish fauna.
...
Ümit Kumbıçak, Zübeyde Kumbıçak* and Gülnare Huseynli
...karyotype formula of the species was 2n♂=35 (X1X2X30) which is the first record for the family Hersiliidae. Both autosomes and sex chromosomes were acrocentric. The lengths of the chromosomes indicated no significant difference between autosomal pairs, however, X3 was the smallest chromosome but X1 and X2 were intermediate in the karyotype.
...
Rana Manzoor Ahmad1,2, Abdul Majid Khan1,*, Ghazala Roohi3 and Muhammad Akhtar1
...n seven extinct giraffid species to determine and compare stress periods during the early Miocene to Pleistocene ages of the Siwaliks of Pakistan. Enamel hypoplasia is a tooth malady which is caused by the deficiency of food/nutrients. The feeding deficiency is directly linked to the physiological or environmental stress. In this study occurrence of enamel hypoplasia in giraffids has been observed in species of all time inte...
Saswati Roy1, Rakesh Pashi2, S. Dey3 and Shantanu Jha
... Total 74 number of bird species were recorded which belonged to 18 orders. Out of 74 bird species 23 species (31.08%) were recorded as insectivorous, 16 species (21.62%) as omnivorous, 13 species (17.57%) as granivorous, 11 species (14.86%) as carnivorous, 7
Muhammad Siraj-ud-Din1,2, Riaz Aziz Minhas1, Usman Ali3,*, Mayoor Khan2, Muhammad Siddique Awan1, Nuzhat Shafi1 and Basharat Ahmad1
...vation management of the species in the area. The habitat use of urial was determined on the basis of direct or indirect evidence (e.g. animal sightings, fecal pallets and hairs) in different habitats. Information on food consumption was collected by using scan sampling technique and also collected from local people, hunters and shepherds (n=78). During scan sampling, focused feeding animals were observed with the help of a telescope and spotting scope. Ladakh...
Hayat Badshah1, Farman Ullah1, Paul-André Calatayud2, Hidayat Ullah3 and Bashir Ahmad1
...mbawalei, Five plant species, commonly found to be host of P. solenopsis, were tested: hibiscus, potato, okra, eggplant and tomato. Under no choice test conditions, the results showed that the % parasitism did not differ significantly between different host plants in laboratory and field conditions. In contrast under multiple choice test conditions, the % parasitism (65.00±3.75, 60.00±2.83, 51.88±1.88, 69.38±2.54, 60.63&p...
Sayyed Ghyour Abbas1, Muhammad Adeeb Babar1,*, Muhammad Akbar Khan1, Kiran Aftab2, Ayesha Riaz3, Abdul Ghaffar4 and Muhammad Akhtar1
...age presents seven bovid species Pachyportax latidens, P. cf. nagrii, Selenoportax cf. vexillarius, Tragoportax punjabicus, T. cf. salmontanus, Elachistoceras khauristanensis and Gazella lydekkeri. The boselaphines are predominant at the type locality. The taxa are consistent with a Late Miocene-Early Pliocene age of the deposits. The findings expand our knowledge on the dental anatomic features of the described
Salma Javed, Saima Majeed, Nasira Kazi and Shahina Fayyaz*
...mus mubarakvilli new species is described and illustrated from specimens collected from sediments of Mubarak Village in Karachi, Pakistan. The new species is characterized by a cuticle bearing 20-22 longitudinal ridges, tail conical, tapering evenly to narrow terminus 116-128 µm long. Cellular body content extending 2/3 of the tail length. Heterodorus longidens (Jairajpuri and Loof, 1968) Andrassy, 2009 is r...
Tariq Mahmood*1, Syed Wasif Ahmed Shah1, Muhammad Rais1, Hira Fatima1, Faraz Akrim1 and Muhammad Sajid Nadeem2
...ated nesting use of tree species by avifauna at Pabbi Range Forest Kharian (32.811°N and 73.865°E), District Gujrat, from September 2013 to June 2015. Data were collected from five selected sampling sites by searching and identifying nests of different bird species in various vegetation types and observing birds on the nest. The nests were monitored for breeding activity of the particular bird <...

Haji Muhammad1, 2, Zafar Iqbal1, Qamar Bashir2, Muhammad Amir Hanif3

...on factor of 18 cat fish species belonging to five families of Indus River in Taunsa barrage from Punjab, Pakistan. The value of length weight relationship (LWR) equation and condition factor (K) ranged W= -0.249 TL0.79 – W= -2.803 TL3.55 and 0.07 – 1.69 respectively. The objective of this study was to determine LWR and condition factor of cat fish species of Indus River that could help in
conservation and...

Naeem Iftikhar1, Qamar Zaman Qamar2, Usman Ali3, Muhammad Siddique Awan4, Syeda Shaista Bibi4, Riaz Aziz Minhas4*

... to the survival of this species in AJK. This study recommended the immediate formulation and implementation of Cheer pheasant conservation action plan along with declaration of its potential habitats as protected area to ensure the further survival of this important species.

...
Ikramul Haq1, Aneela Zameer Durrani*1, Muhammad Sarwar Khan1, Muhammad Hassan Mushtaq2, Imtiaz Ahmad3, Amjad Khan2 and Mehboob Ali1
...e of different bacterial species shows that E. coli was the most prevalent bacteria with 48.77% as compared to Clostridium perfringens (18.56%) and Salmonella (17.9%). It was concluded that bacteria were the major cause of foal diarrhea in Punjab, Pakistan. 
...
Tariq Mahmood1,*, Fakhra Fazal1, Faraz Akrim1, Hira Fatima1 and Muhammad Sajid Nadeem2
...gt; 0.05).
...
Abu ul Hassan Faiz1,*, Fakhar-i-Abbas2 and Lariab Zahra Faiz2
...re captured belonging to species of Nesokia indica, Mus musculus, Mus budooga, Millardia meltada, Tatera indica and Golunda elliotti. The maximum number of rodents was captured in loamy soil type with population density (53.3±19.8) per hectare. The lowest rodent population density was captured in silty clay loam soil type with population density (22.5±5.7) per hectare. The population density in other soil types differ significantly ...
Zahid Farooq1, Sufi Muhammad Akram2, Muhammad Saleem Khan3,* and Muhammad Wajid4
...milies, 16 genera and 25 species. Indian cobra (Naja naja)(8.83%; N = 46), Glossy-bellied racer(Coluber ventromaculatus)(7.87%; N = 41) and Common krait (Bungarus caeruleus)(7.49%; N = 39) were higher in prevalence. Northern wolf snake (Lycodon striatus striatus), Sind long-nose sand snake (Lytorhynchus paradoxus)and Afghan awl-head snake(L. ridgewayi)(0.38%; N = 2) were the least abundant. Snakes were more freq...

 Addishiwot Fekdu, Afework Bekele and Demeke Datiko*

...one recorded as observed species during both dry and wet season. They were identified into six species. Among these, 458 (99.1%) were rodents and 4 (0.9%) were insectivores. The trapped species were: Lophuromys melanonyx (242), Stenocephalemys albocaudata (126), Arvicanthis blicki (86), Mus Mahomet (3), Dendromus lovati (1), and Crocidura fumosa (4). Tachyoryctes macrocephalus was recorded...

 Mohammed Mahbub Iqbal*, Mehedi Hasan Kanon, Mohammad Amzad Hossain, Abul Hossain, Shamima Nasren, Md. Jahidul Islam, Md. Arifur Rahman

...ater. A total of 37 fish species belong to 7 orders including prawns were found. Among the 37 species 5 were vulnerable, 7 endangered, 1 critically endangered, 3 exotic, 20 not threatened and 1 not evaluated according to IUCN, Bangladesh, 2000. The Shannon-Weaver diversity index was found highest (3.12) in June and lowest (2.9) in January. Margalef richness index was found highest (3.02) in July and lowest (2.70) in December...
RuiHua Zhang, YongFang Jia, TingTing Liang, QianWen Yang, QiYan Du and ZhongJie Chang*
...ich was conserved in all species; however, there were no conserved regions flanking CcSox6. Numerous essential transcription factor binding sites (TFs) were predicted within the 2000 bp upstream of the 5’ end of these genes. These TFs include BSX, BRN4 and NGN–NEUROD, which have been shown to be involved in the early stages of neuronal determination and neurogenesis in vertebrates. Tissue distribution analyses by Quantitative real-time RT-PC...
Yunjun Yan, Zhenming Lü, Tianming Wang, Yongjiu Chen, Jingwen Yang, Baoying Guo, Lihua Jiang, Changwen Wu and Liqin Liu*
...ip with other cephalopod species. The results show that the mitochondrial genome of O. dollfusi composed of 15843 nucleotide pairs and encodes 13 proteins, 2 ribosomal RNAs (rRNAs), 22 transfer RNAs (tRNAs) and a major long noncoding region (LNCR) of the mitochondrion’s own protein synthesizing system. Seven of thirteen proteins, eight tRNAs are encoded by the plus strand, while the other proteins and tRNAs, as well as two rRNAs are encoded by the...
Abd El-Nasser Ahmed Mohammed*
...lity and conservation of species.
...
Shahid Mehmood1,*, Bushra Nisar Khan1, Hassan Raza1, Rida Ahmad1, Azhar Muhammad3, Zulfiqar Ali2, Farhan Abid1, Fehmeeda Bibi4 and Syed Maviz Ahmed5
...erve the year round bird species diversity from October 2014 to September 2015 at Safari Zoo Lahore (31°2257 N, 74° 12 47 E and elevation 208m) located in district Lahore, Punjab, Pakistan. In total, 5456 birds belonging to 71 species, 40 families and 12 orders were recorded. Bird species distribution was: year round residents 50 (70.4%), winter ...
Tasleem Akhtar*, Muhammad Asif Aziz, Muhammad Naeem, Muhammad Sheraz Ahmedand Imran Bodlah
...urvival of several plant species. Agricultural productivity depends on population interactions of these pollinators. A field experiment was conducted at PMAS-Arid Agriculture University Research Farm, Koont, Gujar Khan during 2015 to compare the diversity and abundance of different insect pollinators on canola (Brassica napus L. Var. Chakwal Sarsoon) crops along with managed Apis mellifera. Thirty five insect species
Kashif Prince1,*, M. Sarwar Khan1, Muhammad Ijaz1, Aftab Ahmad Anjum2, Muhammad Asad Ali2, Jawaria Ali Khan1, Nisar Ahmad3,Rais Ahmed2, Aamerzish Mushtaq4, Sajid Umar4 and Yung-Fu Chang5
Alptug Sari*, Ahmet Arpacik and Sagdan Baskaya
...observed.
...
Ali Murad Rahoo,1,2,* Tariq Mukhtar,1,3 Shoukat Ibrahim Abro,4 Barkat Ali Bughio5 and Rehana Kanwal Rahoo6
...tly affected by nematode species. Significantly higher numbers of IJ were produced by Heterorhabditid species than Steinernematid species in the cadaver. The production of IJ was the maximum in the case of H. bacteriophora which was not statistically different form H. indica. Minimum IJ were produced by S. feltiae. The IJ produced by S. kraussei and S. carpoc...

 S. Shahid Shaukat*, Mian Sayed**, Aly Khan, M. Azhar Khan* and Babar Qazi***

...lation of three nematode species associated with guar (Cyamopsis tetragonoloba) and the yield of guar were investigated. The chemical nematicides and plant extracts significantly reduced the population densities of all three nematodes. Carbofuran was most effective against all the nematodes. Apart from other three treatments, Tridax procumbens emerged as an effective phytonematicide. Helicotylenchus indicus, Rotylenchulus reniformis and Meloidogyne incognita h...

 Aly Khan* and S. Shahid Shaukat**

...anate. The most dominant species was Meloidogyne incognita. Species diversity (H’) was highest in Wadh while lowest in Ali Dasht. Equitability (J’) component of diversity was highest in Kork and lowest in Ali Dasht, while species richness (d’) component was highest in Alat. The soils associated with Pomegranate orchards were coarse-structured, alkaline with low maximum wa...

 Sarfraz Ahmad, Shaista Koukab, Nayyar Razzaq, Muhammad Islam, Aneel Rose*, and Muhammad Aslam**

...ing. Traditionally these species are used for the treatment of fever and pain. Annual or German chamomile (Matricaria recutita L.), and perennial chamomile (Chamaemelum nobile) are the most important species all over the world due to multipurpose uses. Field experiments were conducted at Arid Zone Research Centre, Quetta to evaluate the growth and production potential of Matricaria recutita. Two crops a year are possible in ...

 Shazia Erum*, Muhammad Naeemullah, Shahid Masood** and Muhammad Irfan Khan*

... present study different species of Ocimum (Ocimum basilicum and O. sanctum) were collected from different agro-ecological zones of the world and compared for their phenotypic (qualitative and quantitative) and biochemical trait. Comparatively high variation was seen for seed germination, canopy and spikes/plant, florets/spike and leaf area. A UPGMA cluster, grouped the 9 Ocimum genotypes into two major clusters on the basis of total seed protein and phenotypi...

 Rahila Nazli, Tehmina Sohail, Bushra Nawab and Zahra Yaqeen*

...as also extended to some species of fungi. Results showed that the activity was more pronounced against gram +ve organisms and fungi. Maximum inhibition activity was calculated against all the groups of organisms, which was between 0.5 and 1mg ml-1 against bacteria and 2.5 mg ml-1 against fungi. It is therefore concluded that G. sepium provide a lead towards the exploration of new antimicrobial agent.

...
Nazish Shaukat1, Muhammad Javed1,Faiza Ambreen2* and Fariha Latif1
...ation of reactive oxygen species (ROS) which ultimately leads to tissue damage and oxidation of biomolecules. Aquatic organisms possess antioxidant system to cope with the oxidative stress. This research was conducted to see the effect of lead on peroxidase activity (antioxidant enzyme) in the gills and liver of Labeo rohita. Experiment was conducted in the laboratory by exposing four groups of Labeo rohita to different doses of PbCl2 ...
Haixia Liu, Yuwei Ye, Yang Li, Xiaolin Liu, Dongmei Xiong* and Lixin Wang
...ation of this endangered species.
...
Hina Safdar1,*, Nazir Javed1, Sajid Aleem Khan1 and Muhammad Arshad2
...ded upto four days. Both species of entomopathogenic nematodes proved effective against all larval instars. Maximum mortality was observed in 2nd and 5th larval instar. After the fourth day 100% mortality was observed in all larval instar. Mortality was increased with an increase in exposure time. Nematodes were harvested using White Traps. Multiplication of entomopathogenic nematodes was also recorded in all larval instar. The maximum nu...
Naveed Akhtar,1,* Riaz Muhammad2, Kausar Saeed2, Muhammad Fiaz Khan1, Muzaffar Shah3, Jehan Zeb2, Shahid Ahmad2, Azam Jan Afridi4 and  Aftab Hussain5
... this study 10 different species belonging to 9 families, 5 orders and 10 genera of mammalswere identified. The reported species are Naemorhedus goral, Panthera pardus, Sus scrofa, Lepus nigricollis, Macaca mulatta, Canis aureus, Vulpes vulpes, Myotis myotis, Herpestes edwardsii and Hystrix indica. During the research jackals and fox species were dominant in the area. ...
Xia-Lin Zheng1, Pan Wang2, Jun-Yan Liu1, Yu-Jing Zhang1, Jun Li1 and Wen Lu1,*
...wintering stages of this species in Wuhan City.
...
Lin Wang1,2, Ye Gong3, Kelin Chen1, Haitao Wang3 and Xianguo Lyu1,*
... is listed as vulnerable species by IUCN. For improving the research on conservation of this species, we tested the cross-species amplification of 90 microsatellite loci developed for eight other species. Eleven out of them were successfully amplified and polymorphic with 2-10 alleles. The observed heterozygosities ranged from 0.481 to 0.827 and the poly...
Qin Liu1,2, Feiwei Liu1, Xiuyue Zhang1, Nan Yang1 and Jianghong Ran1,*
...enyii) is an endemic species which is protected in first-grade state in China. Here, 22 polymorphic tetranucleotide microsatellite markers were isolated from T. szechenyii using a next-generation sequencing technology. The allele number of these loci ranged from two to six in genotyped 35 individuals. Polymorphism information content ranged from 0.2735 to 0.7717 with an average of 0.5149. Observed and expected heterozygosities at each locus ranged f...

 Shazia Erum*, Muhammad Naeemullah and Shahid Masood**

Corresponding author: [email protected]

PHENOTYPIC VARIATION AMONG MENTHA SPP.
...n 17 genotypes of mentha species. Different species of Mentha were collected from different ecological zones of the world. Great variation was observed in stem length with the coefficient of variation of 198.7% and standard deviation of 14.1. Among the 17 mint collection, nine special aromas was smelled including mint gum, strong camphoraceous, mint like, spicy, lemon, pungent, musky and acrid due to the presence of diverse ...

 Naheed Akhtar, Yasmin Ahmad, Muhammad Shakeel, Waseem Ahmad Gillani, Javed Khan, Tahira Yasmin and Irshad Begum*

RESISTANCE IN PEARL MILLET GERMPLASM TO GREENBUG, SCHIZAPHIS GRAMINUM (RONDANI)
...laucum L.) against aphid species greenbug, Schizaphis graminum (Rondani). It was determined by the ability of seedlings to resist for plant stunting caused by aphid's feeding at seedling stage. The results indicated that out of 135 pearl millet entries tested, 21 were resistant, 69 were moderately resistant and 45 were susceptible to greenbug feeding. The resistant entries were: C-591, Pak-75211, Pak- 75212, Pak-75219, Pak-75194, Pak-75227, Pak-75238 Pak-75272...

 Muhammad Zubair Anwar, M. Azeem Khan, Ikram Saeed, Akhtar Ali*, Shafique Zahid and Abdul Majid**

SMALL FARMERS PERCEPTIONS REGARDING IMPROVED FODDER AND FORAGE VARIETIES: RESULTS OF PARTICIPATORY ON FARM RESEARCH
...der varieties and forage species were introduced. About 52 % women were of the view that in rabi season 50% grain yield was increased and 44% said that the increase in dry stalk was about 50%. While in kharif 72% respondents pointed out 55% increase in grain yield and similarly majority of the farmers (68%) pointed out 50% increase in dry stalk yield. Majority of the respondents (83%) appreciated the newly introduced plant species
EVALUATION OF LEGUME HERBS NUTRITIVE VALUE AS A RUMINANT FEED AND NITROGEN SUPPLY ON SOIL IN WEST TIMOR, INDONESIA
...justify;"> The four species of legumes used as ruminant feed were Clitoria ternatea (CT), Centrosema pascuorum (CP), Dolichos lablab (DL), and Macroptilium bracteatum (MB). The study was conducted in Randomized Complete Block Design. The research showed that the highest -l NO concentration after planting was in CP (5.72 mg ), followed by CT 3 -l -l -l (4.21mg ), MB (3.44 mg ), and DL (2.83 mg ). The species of legume wa...

 Shahid Ali*, Anjum Shehzad*, Muhammad Ather Rafi* and Ahmed Zia*

INSECT POLLINATORS OF LITCHI ( ) FROM DISTRICT HARIPUR, PAKISTAN
...llected which yielded 20 species under 16 genera of eight families belonging to orders Diptera and Hymenoptera. Family Calliphoridae, Muscidae, Sarcophagidae and Syrphidae, represented the order Diptera, while families, Andrenidae, Apidae, Halictidae and Vespidae belonged to order Hymenoptera.

...

 Mustaring,* I. Subagyo,** Soebarinoto** and Marsetyo*

 
GROWTH, YIELD AND NUTRITIVE VALUE OF NEW INTRODUCED BRACHIARIA SPECIES AND LEGUME HERBS AS RUMINANT FEED IN CENTRAL SULAWESI, INDONESIA
...mised block design. Each species was planted on 2.5m x 3m plot, and repeated 6 and 4 times in experiment 1 and 2, respectively. Parameters measured include plant height, tillage number, dry matter (DM) yield, in vitro digestibility and nutrient contents. Plant height and tillage number were monitored at week 4, 6 and 8 then harvested at week 8. Results revealed that the Brachiaria mutica (8 weeks old) had highest plant height (207 cm), but lowest tillage numbe...

 Nazir Ahmad*, Sultan Ayaz*, Sumaira Shams**, Karimullah*** and Riaz Ahmad****

PREVALENCE AND MORPHOLOGY OF HELMINTH PARASITES OF FISH FROM RIVER SWAT, KHYBER PAKHTUNKHWA
...g to five genera and six species were examined. The parasites collected were Diplozoon khyberensis, Bathybothrium rectangulum, Bothriocephalus, Nippotaenia, Cucullanidae, Proteocephalus, Rhabdochona charsaddiensis, Rhabdochona schizothoracis and Neoechynorhynchus devdevi. They were identified by morphological characteristics through microscopic techniques. Overall prevalence of the fish parasites was 58% (145/250). Among these Schizothorax plageostomus fish 93...

 Mian Sabahatullah*, Manzoor Ahmad Mashwani**, Qurratul Ain Tahira* and Mian Inayatullah*

NEW RECORD OF SUBFAMILY CHARMONTINAE (BRACONIDAE: HYMENOPTERA) IN PAKISTAN WITH THE DESCRIPTION OF A NEW SPECIES
... A cosmopolitan braconid species, Charmon extensor (Linnaeus), is first time recorded from Chitral area of Pakistan. A new species, Charmon ovchinnikovi, is described, illustrated and compared with its closely related species Charmon extensor. The new species is different from C. extensor because of different sculpture of metasomal tergum 1 and shape of ...

 Gul Zamin Khan*, Imtiaz Ali Khan**, Inamullah Khan* and Mian Inayatullah**

OUTDOOR BREEDING OF MOSQUITO SPECIES AND ITS POTENTIAL EPIDEMIOLOGICAL IMPLICATIONS IN KHYBER PAKHTUNKHWA
...ative abundance of Culex species in different districts were: Peshawar (32.3), Nowshera (18.8), Mardan (20.3) and Charsadda (21.0). Higher numbers of Aedes mosquitoes were observed in Nowshera (19.3), Peshawar (16.4), Charsadda (13.1), and Mardan (9.8), respectively. Mean monthly positive ovitraps of species was high in May and October collected from Peshawar (32.5, 31.5), Nowshera (25.3, 26.8), Mardan (22.2, 16.8) and Chars...

 Maimoona Bashir*, Imtiaz Ahmad Qamar*, Muhammad Fateh Ullah Khan* and Abdul Razzaq*

EFFECT OF MIXING LOW PALATABLE GRASSES AND IPIL IPIL LEAVES ON FORAGE QUALITY
..., 25:75, along with sole species on their chemical composition. Samples were analyzed for proximate parameters (crude protein (CP), crude fiber (CF), total ash and ether extract (EE)). The results revealed that there were significant differences in dry matter (DM) among different grasses. DM content of low palatable grasses was generally high (70-75%) as compared to Ipil ipil leaves (45-55%). DM content among mixtures was also variable. For the treatment grass...

 Maimoona Bashir*, Imtiaz Ahmad Qamar*, Muhammad Fateh Ullah Khan* and Raheel Babar*

EFFECT OF MIXING LOW PALATABLE GRASS OF HETEROPOGON CONTORTUS WITH IPIL IPIL LEAVES ON DIGESTIBILITY IN GOATS
..., 25:75, along with sole species on their digestibility in small ruminants. Goats fed II , HC II , HC II , HC II and HC had similar 100% 25% 75% 50% 50% 75% 25% 100% dry matter (DM), crude protein (CP) and crude fibre (CF) consumption among all the treatments. The digestibility percentage of dry matter intake (DMI) varied among the treatments ranging from 68.25% to 41.66%. Mixtures of low palatable grass and Ipil ipil were in general more digestible with more ...

 Sameera Arshad*, Iftikhar Hussain*, Maqsood Anwar* and Sarwat Naz Mirza*

HABITAT SURVEY FOR RECOGNIZING BIRD ATTRACTANTS AROUND BENAZIR BHUTTO INTERNATIONAL AIRPORT, ISLAMABAD, PAKISTAN
...fields that attract bird species, pose serious threat to aviation industry. Habitat survey for recognizing bird attractants and hazardous bird species was carried out at 8 selected study sites within 8 km radius of Benazir Bhutto International Airport (BBIA), Islamabad. Each site represented a different habitat and was ranked for the presence of bird attracting sites using Habitat Composite Index (HCI). Habitat representing ...

 Raja Zoq-ul-Arfeen*, Aamir Saleem*, Sarwat Naz Mirza*, Muhammad Akmal**, Hafiz Muhammad Tayyab* and Obaid Afzal***

BIODIVERSITY AND PHYTOSOCIOLOGICAL STUDIES OF UPSTREAM AND DOWNSTREAM RIPARIAN AREAS OF PAKISTAN: SPECIAL REFERENCE TO TAUNSA WILDLIFE SANCTUARY AND KETI SHAH FORESTS
...which belong to 54 plant species with 18 different families. In Taunsa pre-monsoon survey, total 30 plant species were found with 4476 plants from 16 different families. In Taunsa post-monsoon survey total 3348 individuals were recorded from 20 plant species and 9 families. Similarly, in Keti Shah forest, total 3975 individual were recorded from 22 species

 Farid Asif Shaheen*, Sadia Parveen*, Ahmed Zia**, Ghulam Qadir*,
Mureed Husain*** and Rifat Ullah Khan****

PREDATORY APTNESS OF ANTS AGAINST RED FLOUR BEETLE, TRIBOLIUM CASTANEUM HERBST (TENEBRIONIDAE: COLEOPTERA) IN WHEAT FLOUR
...in laboratory. Three ant species namely, Dorylus labiatus, Camponotus rufipes and Monomorium minimum were collected from forest and non-forest habitats and compared for their predation against different life stages of RFB. Results showed D. labiatus of forest habitat as an efficient pupal predator that consumed 91.66% pupae of RFB. It was significantly different from non-forest ant population and control with 73.33% and 11.66% pupal predation, respectively. C....

 Abdul Haq*, Anjum Shehzad**, Muhammad Ilyas**, Muhammad Ishaque Mastoi**, Abdul Rauf Bhatti** and Mian Inayatullah*

DIVERSITY AND RELATIVE ABUNDANCE OF CITRUS POLLINATORS IN DISTRICT HARIPUR, PAKISTAN
...ts i.e., Diptera with 16 species, Hymenoptera with 14 species, Lepidoptera with 3 species and Coleoptera with 2 species. The calculated values of relative abundance showed that is most abundant species in ecosystem followed by sp. and . All calculated values of diversity indices except Shannon-H does not show significa...

 Dilawar Khan*, Abid Saeed*, Junaid Ahmad*, Imtiaz Qamar**, Fazal Yazdan**, Saleem ud Din** and Muhammad Tariq**

ASSESSMENT OF RIPARIAN VEGETATION IN DHRABI WATERSHED AND CHAKWAL REGION IN PAKISTAN
...t Chakwal. There were 88 species reported in the study area. The five plant communities recognized in the Dhrabi watershed on the basis of importance value (IV) by using line transect sampling method. On the basis of top three highest IV plant community were identified at western side of the Kallar Kahar Lake while plant community was observed in eastern side by using 1x1 m quadrat method.

...

 Syed Waqar Shah* and Muhammad Ather Rafi*

PIERID (LEPIDOPTERA: PIERIDAE) PESTS AND THEIR NEW CRUCIFERS HOSTS IN POTHWAR REGION OF PAKISTAN
... above reported Pieridae species is reported for the first time however, is also a new record from districts Rawalpindi and Chakwal and from Jhelum, Rawalpindi and Chakwal. However, the non-cultivated host plants in the region were , , and . Among noncultivated hosts was the new host for . C. was found common host for , and from the study area. Among non-cultivated host plants was found for and for and . All the non-cultivated host plants were new records from...

  Mohammad Umar Farooq* , Sarfraz Ahmad ** , Mohammad Islam and Imtiaz Ahmad Qamar ***

ASSESSING THE STATUS OF CARBON POOL IN TWO RANGELAND GRASSES ( ) IN POTHWAR, REGION, PAKISTAN
...nd response of different species.

...

 Ghazala Nawaz*, Muhammad Nawaz Malik**, Muhammad Hassan
Mushtaq***, Fraz Munir Ahmad****, Ali Abdullah Shah*****, Farooq
Iqbal******, Shinawar Waseem Ali*******, Zahida Fatima******** and
Amjad Khan*********

SURVEILLANCE OF BRUCELLOSIS IN LIVESTOCK IN RURAL COMMUNITIES OF PUNJAB, PAKISTAN
...g in different livestock species and requires to develop prevention and control strategy, that hasn't been done in Pakistan. Active disease surveillance at door steps was conducted to collect blood samples from small and large ruminants of subtropical rural communities in the province of Punjab during January-March, 2015. Total 59665 sera samples from apparently healthy animals were collected and screened by Rose Bengal Plate test and confirmed by Complement f...

 Asif ullah Khan*, Faizan Ullah*, Sultan Mehmood*, Muhammad Irshad* and Farhat Ullah Khan**

ALLELOPATHIC EFFECTS OF JATROPHA CURCAS L. LEAF AQUEOUS EXTRACT ON EARLY SEEDLING GROWTH OF L. PARTHENIUM HYSTEROPHORUS
...lants but also with weed species before its introduction into agroforestry systems. During present investigation, allelopathic potential of leaf aqueous extract was investigated on seed germination and seedling development of L. Extracts were applied at 25%, 20%, 15%, 10% and 5% as seed soaking for 8 hours prior to sowing. Phenolics compounds were found in aqueous extracts and were higher in 25% extract (52.72 mg gallic acid eq. / gm of extract). Higher concen...
Dachuan Cheng1,2, Md Mahbubul Hassan3, Zhenhua Ma1, 2, 3,*, Qibin Yang1 and Jian G. Qin3
...geny and anomalies among species of the family Lutjanidae. This study describes the skeletal ontogeny and anomalies of crimson snapper Lutjanus erythropterus larvae and juveniles from hatching to 36 day-post hatching (DPH). Mandible, ceratobranchial, cleithrum and gill arches were the initial skeletal structures appeared at 3 DPH that supported the vital life functions such as feeding and respiration. Ossification of premaxilla and maxilla and dentary s...
Zheng Quan Jiang1,2, Feng Shan Li3, Jiang Hong Ran1,*, Chen Hao Zhao1, Man Zhang1 and Hua Li4
...is the only alpine crane species, whose distribution is restricted to the Tibetan-Qinghai Plateau and the adjacent high altitude areas of China, Bhutan, Pakistan, and India. Study on nest type and size is useful for understanding the life history, evolution and adaptation of birds. A survey was conducted on nest size and the underlying regulatory factors of Black-necked Cranes from 25 March to 31 July in 2013 and 2014 at Ruoergai Internationally Important Wetl...
Yanxiao Meng1, Guihua Wang1, Dongmei Xiong1,*, Haixia Liu1, Xiaolin Liu1, Lixin Wang1 and Jianlu Zhang2
... on the validation of subspecies B. lenok tsinlingensis Li for a long time. Some ichthyologists thought that there should be two species (B. lenok and B. tumensis) in Amur River and a subspecies (B. lenok tsinlingensis) in the Qinling Mountains, while others believed no division of the subspecies. Thus, 169 specimens of...
 Nazia Qamar1, Sher Khan Panhwar1,* and Ralf Riedel2,*
...riance (permanova), with species, life stage (juvenile and adults), gender, and weather (rainy and dry season) as factors. Patterns of empty stomachs were investigated to estimate feeding intensity. Feeding intensity was estimated with logistic regression, using the same independent variables as above. Prey importance was also investigated. Prey importance was assessed using a Wilcox Rank Correlation analysis on the Index of Relative Importance (IRI) by
Burcu Onuk1,*, Murat Kabak1, Bünyamin Sahin2 and Nazan Gezer İnce3

 

...l difference between two species. Our findings suggest that the nasal structures of the two-different species have similar architecture, which may be linked to the same function in flying birds.
...
Abdul Nabi Jatt1,*, Sarfraz Ali Tunio1, Shaista Bano Memon1, Abdul Sattar Qureshi2 and Muhammad Aqeel Bhutto
...c potential of bacterial species is an essential feature to carry out a wide range of biological and physiological processes, particularly involved in the hydrolysis of complex organic materials. Several pathogenic microbial species utilize enzymes as virulence factors to cause diseases. The aim of the present study was to evaluate enzymatic activities of the bacterial strain Shigella dysenteriae IM using API-ZYM test...
Wei Dang1, Ning Xu1, Wen Zhang1, Jing Gao2, Handong Fan1 and Hongliang Lu 1,*
...expression in six lizard species to investigate the variation in Hsp70 response contributing to thermal adaptation. At first, we collected three lizard species of the genus Takydromus from different geographical locations. We found that either the constitutive expression pattern in different organs or the inducible expression pattern under higher ambient temperature were the same. The expression of Hsp70 was higher in...
Grace Chinenye Onyishi, Ifeanyi Oscar Aguzie, Joseph O. Okoro, Christopher Didigwu Nwani*, Ngozi Ezenwaji, Ndubisi Stanley Oluah and Fabian C. Okafor
...ne the terrestrial snail species and associated helminth parasites in Ugwueme agricultural zone of Enugu State, Nigeria. The snails were collected from two communities. Light and teasing methods were used for recovery of parasites from the snails. A total of 618 snails belonging to 7 species (Achatina achatina, A. belteata, A. degneri, Limicolaria aurora, L. flammea, Lamellaxis gracilis and Orthalicus sp.) were...
Chuanpeng Zhou1, Heizhao Lin2,*, Zhong Huang2, Jun Wang1, Yun Wang1 and Wei Yu2
...metabolic burden in this species

...
Mubashar Hussain, Muhammad Faheem Malik, Sehreen Siddique, Muhammad Umar, Tamkeen Zainab, Fatima Zafar
...d a representation of 14 species, 6 genera and 3 sub families across all sites. Maximum abundance was noticed for Coccinella septempunctata (19.63 %) followed by Coccinella undecimpunctata (14.70 %), Coccinella transversalis (11.14 %) and Coccinella sexmaculata (10.29 %). Greater diversity (H´: 2.481), dominance (1-D: 0.8964) and evenness (J´: 0.7474) of coccinellid beetles were recorded from under-study sites. Ho...
Zahida Parveen1, Safdar Sidra1*, Bushra Nisar Khan2
..., most time spent by all species and varieties of peafowls was in walking around within the enclosure (20.6%), followed by litter pecking (13.8%), feather pecking (13.0%) and standing (12.7%). Feeding and drinking consumed approximately 4.6% and 2.1% of time, respectively. 
...
Olaniyi Alaba Olopade1,*, Henry Eyina Dienye1, Bosede Jimba1, Nathanael Akinsafe Bamidele2, Iyabo Olusola Taiwo2
...at the well-being of the species was slightly better in Buguma Creek than New Calabar River. Collectively these findings confirmed the ability of the species to thrive in brackish water and freshwater, and that these parameters support the assessment of the well-being of different fish in different locations.
...
Muhammad Arshad,1* Sajjad Ahmad1, Muhammad Sufyan1, Zain-ul Abdin1 and Sumaira Maqsood2
...ip intercropping promote species composition; richness and abundance in general and predators in particular.
...
Ligia Neves Scuarcialupi, Laila Andreia Rodrigues Beserra, Julia Rosas Hochheim, Rodrigo Martins Soares, Fabio Gregori*
...is and diarrhea in avian species, resulting in negative impact on egg and poultry production. The objective of this work was to detect and characterize Rotavirus F (RVF) and G (RVG) found in Brazilian commercial avian farms. A total of 97 intestinal contents was collected between 2008 and 2015 from 10 Brazilian states, and submitted to two different RT-PCR, targeting a fragment of viral VP6-coding nucleotide sequence of each viral group. Amplicons were further...
Lotta Wahldén1, 3, Ulf Emanuelson1, Torsten Møller2 and Jonas Johansson Wensman1*
...us) is an endangered species and captive populations are important for conservation. Canine distemper virus (CDV) and canine parvovirus (CPV) are two infections threatening the survival of this species. Based on a limited number of animals, live attenuated vaccines have been suggested to provide protective immunity in the African wild dog; however, their use has been hampered by the fear of vaccine-induced disease. Kolm&...
Waqas Ali1,*, Arshad Javid1, Syed Mohsin Bhukhari1, Ali Hussain1, Syed Makhdoom Hussain2, Hira Rafique1
... amphibian and reptilian species attracted attention of the conservation biologists worldwide to monitor herpetofunal diversity for effective conservation planning and management. Different sampling techniques are applied during herpetofaunal surveys and some of them might be expensive, time intensive and their effectiveness in different regions of the world are still debatable. Moreover, data recorded from inappropriate designed surveys are not suitable for s...
Muhammad Umar1, Mubashar Hussain1,*, Ghulam Murtaza1, Farid Asif Shaheen2 , Fatima Zafar1
...ctices (Ducks), invasive species (Little egret and Night herone) and illegal hunting (Geese, Ducks, Siberian cranes and Bustards) have resulted in the decline of species abundance.. Regular conduct of surveys for important migratory birds to assess the population trend, abundance and patterns of their migration is another important step towards conservation of birds. To make an effective conservation of migratory birds, inte...
Archana Naithani, Pongthep Suwanwaree* and Bartosz Nadolski
...dentification of 94 bird species belonging to 12 orders and 35 families. Altogether 3,328 individuals were observed. Out of 35 Families, Sturnidae and Sylviidae hadthe highest number of species (5 species each).Six simple dietary guilds were observed during the present study; the maximum number of species belonged to insectivore group and minimum to nect...
Pei-Ying Peng1,2, Xian-Guo Guo1,2,* and Dao-Chao Jin2
...font-size: small;">A new species of gamasid mite, Laelaps jinghaensis sp. nov., was described. The new species was collected from the body surface of red spiny rat, Maxomys surifer Miller, 1900 in Jingha, Yunnan province of southwest China. The sternal shield of L. jinghaensissp. nov. is deeply concave anteriorly with serrate internal sides. There are many distinct transverse lines in the presternal area...
Nanjing Zeng1, Guanhua Liu1, Sibiao Wen1 and Feiyun Tu2,*
...imited checklist of bird species has been available. In order to investigate the bird diversity and avifauna of PLNNR, complete species checklist was strictly checked according to systematic analyses of species records from multisource. Fifty-seven species were newly recorded based on the previous study of 330 bird species...
Huma Ayub1,Iftikhar Ahmad2, Syed Lal Shah3,*, Muhammad Zafarullah Bhatti4, Nuzhat Shafi5 and Mazhar Qayyum1
...tribution of zooplankton species at Chashma Lake during June 2014 to May 2015. The samples were collected from three partially separated stations of the Chashma Lake on a monthly basis. A total 42 species of zooplankton were identified from the Chashma Lake belonging to three taxa viz.; copepoda, rotifera and cladocera. The diversity of the zooplankton species in the lake was determ...
Amna Kausar1,2, Sana Anwar1, Naila Siddique2, Safia Ahmed1 and Javid Iqbal Dasti1,*
...ld and domesticated bird species across Pakistan. During January-December 2013, in total 700 samples were collected from different species of non-vaccinated birds inhabiting diverse ecological zones of Pakistan. Altogether, 507 tissue and swab samples were screened for the presence of viral RNA by reverse transcriptase polymerase chain reaction (RT-PCR). Same samples were further processed for the isolation of virus by embry...
Hafiz Azhar Ali Khan1,*, Waseem Akram2, Sumi Lee3, Shakir Manzoor1, Syed Rajab Ayub1, Khalil Ur Rehman1, Shinawar Waseem Ali1, Muhammad Bilal Chattha1 and Sumaira Maqsood1

Mohammad Javad Golmohammadi1, Hamid Reza Mohammaddoust Chamanabad1*, Bijan Yaghoubi2 and Mostafa Oveisi

...count existing genus and species of weeds. According to the results, the highest frequency was related to weed species of Echinochloa crusgalli (96.9%), Paspalum distichum (78.8%) and Eclipta prostrate (51.8%). Cyperaceae and Poaceae families showed the highest frequency with 13 species (20%) and 8 species (12%), respectively. The RC of E. crusgalli ha...

Mahwish Rehman1*, Sajjad Ahmad1, Maqsood Shah1 and Inamullah Khan

...o discovered Varroa mite species. Identification was done by using key developed byDe-Guzman and Fernandez and Coineau, (2007), i.e. body size (length and width), location of seta, shape, size (i.e. bristle hair, stiff) on dorsal shield, chaetotaxy and structure of the sternal, , metapodal, anal, and epigynal shields, periterme, morphology of setae on the legs and palps and its arrangement and number were observed. Results of the present study showed that the ...
Shuai Shang1,2, Honghai Zhang2,*, Xiaoyang Wu2, Qinguo Wei2, Jun Chen1, Huanxin Zhang1, Huaming Zhong2 and Xuexi Tang1,*
... been identified in many species, but the evolution and repertoire of Tas2r genes in raccoon dog (Nyctereutes procyonoides) was still unknown. As a true omnivorous mammal, the Tas2r genes may play a critical role in food selection of raccoon dogs. Thus, we explored the evolution of Tas2r genes in raccoon dogs. In this study, Tas2r genes including eleven intact genes and four pseudogenes from raccoon dogs were identified for t...
Muhammad Akbar Khan
...Hexaprotodon and the species Hex. sivalensis. Due to rarity of this taxon, its morphological characters are incompletely known. Hippopotamid material recently excavated in the middle Pleistocene locality of Bhimber (Azad Kashmir, Pakistan) includes an almost complete mandible that provides a better knowledge of the taxon morphology. Hexaprotodon sivalensis is reported for the first time from the Bhimber Pleistocene locality of Azad Kashmir, P...
Jiji Li*, Tianyang Zu, Xiangli Dong, Xiao Yang, Wei Liu and Changwen Wu
...immune responses in fish species. The current study reports on the gene expression and molecular characteristics of three members of the CC family of chemokines: 1) dual chemokine ligand CCL17; 2) homeostatic chemokines ligand CCL21; and 3) CCL24 in response to bacterial challenge in large yellow croaker (Larimichthys crocea). The results revealed that the immunological effect of CCLs in the croaker is weaker than that of other fish, and revealed the in...
Ghulam Muhae-ud-Din1,4, Anam Moosa1, Umer Farooq Ghummen1, Muhammad Jabran1, Amjad Abbas1, Muhammad Naveed2, Abdul Jabbar1 and Muhammad Amjad Ali1,3,*
...plant parasitic nematode species that infects a huge number of crop plants. It also infects the ornamental plants resulting in a serious growth-limiting factor in ornamentals. In this study, the response of ten ornamental plants to M. incognita was assessed in pot experiments. All the ornamental plant species showed varying degree of infection of M. incognita. Rhapis excels and Ophiopogan japonicas

Muhammad Suhaib1*, Ijaz Ahmad2, Masooma Munir3, Badar-Uz-Zaman1, Bushra Atta4 and Muhammad Khubaib Abuzar5 

... certain reactive oxygen species are produced that damage the vital plant organelles causing disturbances in the normal functioning of the plant and even may lead to death in severe cases. The results of this study conferred that there were genotypic variation found in two genotypes regarding salinity tolerance. SARC-4 was found to tolerate more salt stress as compared to Parwaz-94 and performed better at both salinity levels then Parwaz-94. Salicylic acid ind...
Ayesha Munir, Hafiz Muhammad Umer, Anjum Nasim Sabri and Imran Sajid*
...man being caused by multispecies of bacteria. Among the causative agents of dental caries, notable one is Streptococcus mutans, which is an obligate parasite. In this study eleven S. mutans strains were isolated from carious lesions on Mitis Salivarius Bacitracin agar along with twenty potentially active Streptomyces strains were isolated from the soil of agriculture farmlands. The biochemical and physiological characterization along with ...
Muhammad Mohsin Ahsan1, Hafiz Muhammad Tahir2,*, Khizar Samiullah3
...bitat structure of known species is also ambiguous. In this study, we report the scorpion Androctonus finitimus (Pocock, 1897) from several areas of Punjab, Pakistan. This scorpion species has not been previously documented from this part of the country, highlighting the wide distribution of this specie across the country. We identified that A. finitimus prefers dry sandy habitat with lower vegetation. T...
Muhammad Adeeb Babar1,*, Sayyad Ghyour Abbas1, Muhammad Akbar Khan1, Kiran Aftab2, Muhammad Hanif1, Muhammad Asim1 and Muhammad Akhtar1
...). The identified cervid species include Rucervus cf. simplicidens, Cervus cf. triplidens and Cervus cf. sivalensis. These specimens provide additional information about the recorded cervid species and contribute to recent work from the Middle Siwalik Hills of Pakistan.
...
Baoying Guo*1, Yu Chen1, Chuan Zhang2, Zhenming Lv1, Kaida Xu3, Hongling Ping4 and Huilai Shi4
...A genes of 37 cuttlefish species. S. lycidas have a close relationship with S. pharaonis, S. aculeata, and S. esculenta. This result confirmed the relationships of S. lycidas as being similar to the traditional taxonomy. This study plays an important role in the investigation of phylogenetic relationships, taxonomic resolution, and phylogeography for Sepiidae species.
...
Mehmet Aydın*

 

... the fiveDecapoda species (Pachygrapsus marmoratus, Carcinus aestuarii, Liocarcinus depurator, Liocarcinus navigator, and Eriphia verrucosa) living in the Black Sea. The crab samples were obtained between 2010 and 2016 by SCUBA, trawl, trammel net, and dredges at six locations (Kastamonu, Sinop, Samsun, Ordu, Giresun, and Trabzon). Total carapace length (CL) and weight (W) of each individual were recorded with an accuracy of 0.01 cm a...
Muhammad Shahbaz1,*, Muhammad Anwar Iqbal1, Arshad Javid2, Abu ul Hassan Faiz1, Irfan3 and Muhammad Irshad Arshad4
...lus belonging to six species i.e. P. pipistrellus (n = 43), P. paterculus (n = 12), P. javanicus (n = 39), P. tenuis (n = 18), P. cylonicus (n = 40) and P. dormeri (n = 20) were captured. Out of these six species, four are reported for the first time from the study area, whereas, P. pipistrellus and P. paterculus has already been reported from other districts of Pun...
Ye Gong, Nehafta Bibi and Haitao Wang*
... Mandarin duck and other species over 11 breeding seasons (2004 - 2014). We monitored the frequency of occurrence and the fate of eggs in those nests and recorded fourteen cases of mixed clutches that contained Mandarin duck eggs. Nine cases were classified as successful nest usurpation: in six cases nests of other birds were usurped by Mandarin duck and in three cases nests of Mandarin duck were usurped by other birds. The remaining mixed clutches may be inco...
Zeqin Fu, Yunfang Tian, Yingying Ye*, Pengzhi Qi and Changwen Wu
...s one of the main mussel species in China, with a widely range of aquaculture markets and importantly economic value. In this study, we used one hundred and twenty primers pairs to screen all microsatellite loci and twenty-three polymorphic loci were identified. The number of alleles per loci ranged from six to twenty-one with an average of 12.913 and the allele size varied between 161 and 470 bp. The observed and expected heterozygosity varied from 0.143 to 1...

Xiangbin Meng1,Tianxiang Gao2, Chunhou Li3, Na Song1, Lu Liu1, Liqin Liu2 and Xiumei Zhang1,*

 

...the conservation of this species. We performed next-generation sequencing and de novo assembly to obtain potential useful microsatellite markers for S. esculenta. Among 80 tested microsatellite markers, 19 showed polymorphism among S. esculenta individuals. The allele number of all polymorphic microsatellite markers ranged from 6 to 10. Expected and observed heterozygosity varied from 0.260 to 0.904 and from 0.292 to 0.861, with an average...
Nausheen Irshad1,*, Imran Yousaf1, Tariq Mahmood2 and Muhammad Saeed Awan1
...of formal studies on the species. A survey was conducted from June to December 2014 to document existence of the leopard in Abbaspur area, Azad Jammu and Kashmir. Direct field observations (opportunistic survey) and indirect observations based on signs of the species were recorded. This was supplemented with information collected through questionnaire survey. Results confirmed the occurrence of leopard at six out of twelve s...
Tariq Mahmood1,*, Shafqat Rasool1, Faraz Akrim1, Shaista Andleeb1, Muhammad Sajid Nadeem2 and Fiaz Nadeem3
...cording diversity of owl species inhabiting Margalla Hills National Park, Islamabad (MHNP). Three owl species viz., Spotted Owlet (Athene brama), Little owlet (Athene noctua) and the Tawny Owl (Strix aluco) were recorded from the park at five different sampling sites, at elevations ranging from 615 m to 655 m above sea level. Only one of the three species Tawny ...
Nadeem Munawar, Iftikhar Hussain and Tariq Mahmood*
...ence of different rodent species inside the crop fields and at field edges, associated with four major crops (wheat, groundnut, millet and maize) in the Pothwar Plateau. In all four crops, maximum number of rodent burrows was recorded at maturity stages of the crops. The maturity stage of wheat crop coincided with spring breeding season while the maturity stages of millet/maize and groundnut matched with monsoon/autumn breeding peak of the rodents in the study...
Adel A. Basyouny Shahin,1,* Amira M. Metwally Mohamed2 and Abd El-Reheem A. El Shatter2

 

...t from those of the same species occurring elsewhere. The means of expected (He) and observed (Ho) heterozygosity were 0.175 ± 0.503 and 0.124 ± 0.496, respectively, the mean percentage of polymorphic loci (P) was 29.42%, while the mean number of alleles per locus (A) was 1.30 ± 0.11. In addition, the mean levels of genetic identity (I) and genetic distance (D) were 0.932 and 0.070, respect...
Danyu Zhang1, Ying Liu1, Qinxin Shi1, Zhiwei Peng1, Yan Hua1 and Zhijun Hou1,2,*
...v>...
Zihong Chen1, Ling Xu2, Xiaona Yang2, Yaguan Zhang3* and Yuming Yang4
...ogical protection. A new species of the genus, collected from Taibao mountain, Baoshan City, Yunnan Province, southwestern China, was described here as Metarhizium baoshanense. It was proposed and determined based on morphological characters combined with a multigene phylogenetics analysis involving 5.8S–ITS, nrSSU, nrLSU, EF–1α, RPB1 and RPB2. In multilocus phylogeny, M. baoshanense was grouped as a sister clade to Metarhizi...
Wael S. El-Tohamy1,*, Russell R. Hopcroft2 and Nagwa E.M. Abdel Aziz3
...), the variations in the species data were significantly (P< 0.05) related to salinity, temperature, phosphate concentration and phytoplankton biomass. The main spatial gradients along the estuary were associated with salinity. The high salinity zone in the estuary downstream was dominated by the calanoid paracalanidae and the harpacticoid Euterpina acutifrons. In the lower salinity transects, the tintinnid Favella serrata dominated the estuar...
Qaisar Jamal1, Muhammad Idrees1, Saif Ullah2, Muhammad Adnan1, Farrah Zaidi1, Qaiser Zaman1,3 and Syed Basit Rasheed1,*
...hwa Pakistan contains 11 species of lizards (Calotes versicolor farooqi, Laudakia agrorensis, Eublepharis macularius, Cyrtopodion scabrum, Hemidactylus brookii, Hemidactylus flaviviridis, Ophisops jerdonii, Asymblepharus himalayanus, Eurylepis taeniolatus, Eutropis dissimilis and Varanus bengalensis) and 16 species of snakes (Eryx johnii, Amphiesma stolatum, Boiga trigonata, Lycodon striatus, Oligodon arnens...
Mumtaz Ali Khan1, Aneela Zameer Durrani1, Sher Bahadar Khan2, Shehla Gul Bokhari1, Ikramul Haq1,*, Imdad Ullah Khan3, Naimat Ullah4, Naimat Ullah Khan4, Kashif Hussain1 and Azmat Ullah Khan2
... healthy animals of each species and were divided into three equal groups (n=18). The antibody titers were evaluated with indirect haemagglutination test. The results indicated significantly higher (P< 0.05) immune titer in animal group vaccinated with toxoid vaccine prepared from pathogenic isolates and provide best protection against challenge infection.
...
Abdul Wajid1,*, Asma Basharat2, Muhammad Akbar Shahid3, Sidra Tul Muntaha1, Abdul Basit4, Tanveer Hussain5, Muhammad Farooq Tahir6, Muhammad Azhar7, Masroor Ellahi Babar1 and Shafqat Fatima Rehmani2
...g to fowl adenoviruses C species and serotype FAdV-4. The similar viruses have been commonly isolated since late 1980s from the poultry flocks. In addition, seven genetically related FAdV isolates were from fowl adenovirus type 11 in D species. To our knowledge, this is the first report of FAdV-11 strains identified in poultry production facilities in Pakistan. This study reveals the presence of two distinct groups of FAdV-4...
Sahar Naz1, Farhan Rasheed2, Muhammad Saeed3*, Shagufta Iram4 and Ambereen Anwar Imran5
...30) Acinetobacter species were MβL positive, Pseudomonas species 38.5% (n=22), Escherichia coli 69.5% (n=16), Klebsiella species 37.0% (n=10), Proteus 66.6% (n=2) and 0% Citrobacter sppwere MβL positive. 32.5% MβL positive isolates were from ICU, 21.2% were from OPD, 12.5%were from Surgical Units, 12.5% were from Medical Unit, 17.5% ...
Ayesha Noreen1, Dilara A. Bukhari2 and Abdul Rehman1,*
...
The reactive oxygen species (ROS) can be generated by intake of environmental pollutants, smoke, tobacco, xenobiotic, drugs, medical materials, radiations, pesticides, industrial solvents and ozone. The processes running in the cell membranes, peroxisomes, mitochondria and endoplasmic reticulum also generate ROS. ROS can be activated by numerous external factors, and play an important role in cancer growth and metastasis. ROS and tumor cell interaction co...
Maryam Javed*, Farwa Saghir, Naveera Aziz, Maham Saeed, Asif Nadeem and Wasim Shehzad
...the four domestic bovine species of Pakistan, which are normally less aggressive. Selected animal species were cattle (Bos indicus), buffalo (Bubalus bubalis), sheep (Ovis aries) and goat (Capra hircus). Selected marker V158M is present in exon-8 of COMT gene. Each specie was subjected to blood sampling (n=20 each). DNA was extracted, purified, quantified and amplified through PCR by using specifi...
Xia Lin Zheng1, Zhen Hua Xian1, Zhen De Yang2, Xiu Hao Yang3 and Wen Lu1,*
...v>Damaging effect of two species of gall midges (Diptera: Cecidomyiidae) have been investigated on Castanopsis hystrix Miq. (Fagales: Fagaceae) in Pubei County of Guangxi, China were investigated from December 2012 to December 2013. Jaapiella sp. damaged leaves, while Contarinia sp. damaged stems and leafstalks. The damage ratio and the index of Jaapiella sp. in December 2012, March, July and December 2013 were 9.7±2.0%, 14.8...
Nuzhat Huma1, Fozia Ghaffar1, Saima Rafiq2,*, Imran Pasha1, Aysha Sameen1, Imran Hayat2 and Imtiaz Hussain2
...f whey proteins of these species, β-Lg was found to be the major protein in sheep and buffalo milks, while in goat it was the second predominant protein and it was absent in the camel milk. The concentration of immunoglobin was found higher in camel and goat milks as compared to other species. Moreover, the strength and mobility of bovine serum albumin (BSA) was different in all milk species
Hanif Ur Rahman1, Umer Saddique1, Zahoor-ul-Hassan1, Shakoor Ahmad1, Muhammad Kamal Shah1, Said Sajjad Ali Shah1, Farhan Anwar Khan1Fazli Rabbani2, Muhammad Asif Hussain2, Attaur-Rahman2, Irshad Ahmad3,4 and Sadeeq ur Rahman2,*
... a cluster of six member species. However, literature is not available regarding the causative agents of CCPP in sheep and goats in Northern Pakistan. The current study was thus aimed to identify relative abundance of members of MM in small ruminants suspected of CCPP in Northern region of Pakistan. A total of 300 samples, (150 sheep and 150 goats) were randomly collected from nasal discharge, pleural fluid and lung tissues, and streaked into Pleuropneumonia l...
Matiyar Rahaman Khan1,*, Sabayasachi Pal2, Amit Singh2, Ashok Dhananjaybhai Patel3, Bhagubhai Ambaram Patel3Tushar Manohar Ghule2 and Victor Phani1
...ecorded and the nematode species was authentically identified as Meloidogyne indica Whitehead, 1968 which was first time described on citrus from Delhi, India. The species is further characterized based on detailed morphological, morphometric descriptions and beta-esterase phenotyping. The present study elucidated information on M. indica for its easy detection, diagnosis, dimension of damages on citrus, and Bt...

G. Venkatesan* and Amit Kumar  

...st-vaccination in target species and repeated host susceptibility. However, these genes are variable among ORFV isolates/strains as they are not located in central part of genome and some of them are either virus specific namely Viral interferon resistant (VIR) and GM-CSF/IL2 inhibition factor (GIF) genes and or host specific namely vascular endothelial growth factor (VEGF-E) and viral IL-10 genes. ORFV can cause high morbidity in adults along with considerabl...
Manzoor Hussain*, Miloslav Zouhar and Pavel Ryšánek

 

...eriment. Only the fungus species A. arthrobotryoides repelled the nematodes.
...
Zhu-Mei Ren1,*, Xu Su2, Carol D von Dohlen3 and Jun Wen4,1,*
...w Rhus gall aphid species Nurudea zhengii Ren, sp. nov. collected from the Mountain Qixing in Shangrao County, Jiangxi Province, China is described and illustrated from alate viviparous female. The new species differs from the other Nurudea species in the length and proportion of antennal segments, the structure of antennal secondary sensilla, and the flower-like shape...
Ayesha Aihetasham, Saira Shariq and Javed Iqbal Qazi*
...identification of fungal species from cadavers of notorious subterranean termite, Heterotermes indicola. Virulence of Rhizopus stolonifer isolate and resultant variations in food consumption of H. indicola workers were evaluated over a period of one month by employing surface culture method. Following different time exposures, R. stolonifer significantly produced epozootics on the tested insects, with resultant decrease in food cons...

Muhammad Khalid1,2 and Muhammad Naeem2* 

...ximate analysis for this species from farming system of southern Punjab, Pakistan is provided. 

...
Wei Meng1,3, Tianyan Yang2,*, Yunguo Liu1, Mahmut Halik1 and Tianxiang Gao2
...variation existed within species and the sample from Kaidu River in South Xinjiang might be a cryptic species or subspecies of G. dybowskii. The phylogenetic analyses from 12 concatenated H-strand-encoding protein genes were conducted by Neighbor-Joining method to reveal the evolutionary relationships within subfamily Schizothoracinae. Three different grades of schizothoracine fishe...
Ai Guo1,2,3, Jiaguang Xiao4, Binbin Shan4, Tianxiang Gao5 and Yongdong Zhou3,*
...tion among Coilia species was detected in length of the control region, mainly caused by the variable number of tandem repeats. Phylogenetic analysis was performed based on 13 concatenated mitochondrial protein-coding genes from 8 Coilia mitochondrial genomes. The results supported that C. lindmani at first clustered with C. nasus and C. grayii which had close relationships (d=0.028), then clustered with C. mystus whic...
Zisha Liu1, Na Song1, Takashi Yanagimoto2, Zhiqiang Han3, Bonian Shui3 and Tianxiang Gao3,*
...te mito-genomes of three species (O. lacepedii, O. rebecca and Odontamblyopus sp.) were sequenced, their genomic structure examined, and their genome organization, arrangement and codon usage analyzed. Phylogenetic Bayesian and ML analyses were conducted, using a concatenated set of 12 protein-coding genes, and adding 16 other species of gobies (Gobiidae). The mitogenome sequences of O. lacepedii,...
Junaid Akhtar1,2, Sidrah Saleem1, Naveed Shahzad3, Abdul Waheed1, Iqra Jameel1, Farhan Rasheed4 and Shah Jahan5,*
.... In a nutshell, several species of MBL-positive gram-negative rods are distributed broadly in different hospitals of Lahore region of Pakistan. The findings of the present study should be considered for planning strategies to treat and prevent the further spread of MBL-producing gram-negative rods infections.
...

Ashraf Khan1*, Suliman Shah2, Maid Zaman3 and Komal Habib2

...xious pest of almost all species and varieties of citrus and its infestation found throughout the world. It is becoming serious threat to the brightening future of citrus growing areas of Pakistan. Thirteen different insecticides were usedfor effective control against citrus psylla under field conditions. Population density of pest was recorded as number of adults per branch. Efficacy of the insecticides was evaluated as percent mortality (%) of citrus psylla....
Lamiaa Elsayed Mokhtar Deef
...Egypt (Gebel Elba). This species is greatly distributed across central and eastern Africa. The exact identification of species is fundamental for an efficient assessment of changes related to the appearance of non-native species in an environment. The biometrics and molecular markers were used to confirm the identification of A. albiventris at the species

Yasir Ali1*, Muhammad Aslam Khan1, Muhammad Atiq1 and Muhammad Hussain2

...tivars and related local species using different molecular approaches. This review provides a detailed discussion of the different aspects for controlling three rust diseases caused by P. recondita Rob. exdesm f. sp. tritici , P. striiformis West. f. sp. tritici, P. graminis Pers. f. sp. tritici and the importance of race specific and non-specific rust resistance genes in in global wheat varieties. This knowledge will help as basis for plant pathologist, plant...
Qiang Li1,2, Guo Qiao2, Li Wang1, Jipeng Zhang1, Ruijun Li1, Ping Ni1, Yi Guo1 and Shigen Ye1,*
...he predominant genus and species, respectively. In addition, challenge tests demonstrated that 13 out of 70 isolates were strongly pathogenic and identified as V. harveyi. This study illustrated that V. harveyi could be considered as main pathogen. These investigation results would provide useful information for disease prevention in T. rubripes culture.
...
Ali Murad Rahoo1, Tariq Mukhtar2,*, Barkat Ali Bughio3 and Rehana Kanwal Rahoo4
...y differ among different species of EPN and hosts of various sizes. Therefore, the objective of conducting the present study was to compare the productivity of two EPN (Steinernema feltiae and Heterorhabditis bacteriophora) in G. mellonella larvae of different sizes. The size of G. mellonella had significant effect on the emergence of IJ. Significantly greater numbers of IJ both of H. bacteriophora and S. feltiae emerg...
Peng Xu1, Bin Liu1,2, Yongqiang Zhao3, Shicheng Lv3 and Changhu Lu1,*
...eat significance for the species protection and management. Here, based on the annual maximum population size of red-crowned crane wintering in Yancheng Nature Reserve (YNR) from 1981 to 2016, we tested the correlation between population size and the climate variables. The results showed that mean air temperature in wintering period showed a linear upward trend. Annual maximum wintering crane population was 623±33. Fitting the population size and the cl...

Zulqarnain and Zafar Iqbal* 

...y to identify the fungal species with their potent antifungal activity against the Fusarium wilt of tomato. Six distinct fungal species including Penicillium sp., Aspergillus niger, Aspergillus flavus, Trichoderma harzianum, Alternaria solani and Pythium aphanidermatum showed growth inhibition (%) against the pathogen. Penicillium sp. showed maximum growth inhibition (63.85 ± 3.26 %) and its extract showed 9.20 &plusm...

Bata Shalangwa Ishaku1*, Maimadu Abdullahi1, Dakwang Nalong1, Rengkat Jonah1 and Olabode Mayowa

...ence based on the animal species (P=0.023; odds ratio=7.688) screened in the study. In pigs, T. gondii seropositivity was found to be higher (46.2%) and about five times more likely to occur in males than in females (33.3%) (P=0.016; Odds ratio=5.15; 95%CI=1.040-1.844). The seropositivity was also found to increase with age. The prevalence was higher (44.1%) in animals older than 2 years than in those below 2years (31.3%) (P=0.022; OR=4.58). In sheep and goats...
Tahira Jamil*1, Mohammad Asghar1, Fatma Husain1, Haq Nawaz Bhatti2
.... Among Pleurotus species (P. nebrodensis, P. sepidus, P. spodoecus), P. spodoecus expressed best statin formation i.e., 9.1±1.4 mg/g. Four physical parameters including temperature, pH, inoculums size and fermentation time (each at five levels) were optimized using central composite design (CCD) design in 30 triplicate experimental runs. The maximum statin formation (19 mg/g) was achieved at 25oC, pH 5.5, i...
Fehmeeda Fatima, Asif Nadeem* and Maryam Javed
...) is a vulnerable subspecies of wild goat (Capra aegagrus), which faced serious population threats. In the present study, HSP70.1 gene has been partially sequenced (1344 bp) to study genetic diversity and evolutionary characteristics of Sindh ibex. In this research, samples of Sindh ibex were collected from Kirthar National Park, Sindh, Pakistan, the gene of interest was amplified, PCR products were sequenced and data was analyzed. The results of ge...
Mouslim Bara1,2,* and Luciano N. Segura3
...ex. Two key conservation species were observed regularly in the Garaet: near threatened Ferruginous Duck (Aythya nyroca) and endangered White-headed Duck(Oxyura leucocephala). Our results highlight the importance of preserving the Garaet Hadj Tahar as a water bird refuge. 
...
Tariq Mahmood1,*, Ijaz Ahmad1, Faraz Akrim1, Abdul Hamid1, Muhammad Waseem1, Abid Hussain1 and Muhammad Sajid Nadeem2
...t breeding season of the species starts from February: peak breeding months being March and April, during which frequent breeding calls were heard. The calling frequency ranged from 0.15 per minute to 0.3 per minute. Six active nests of Chukor were found at five different sampling sites; nest location was mostly on sloping areas under sanatha Dodonaea viscosa shrubs. Nesting material consisted of dry leaves of annual grass Poa annua, small twigs ...
Muhammad Mohsin1, Dai Guilin1,*, Chen Zhuo1, Yin Hengbin1 and Muhammad Noman2
...commercially hunted fish species. In this study maximum sustainable yield (MSY) of Carangoides fishery from Sindh, Pakistan is estimated by using catch and effort data. For data analysis, two specialized fishery software CEDA (catch and effort data analysis) and ASPIC (a stock production model incorporating covariates) were employed. Three surplus production models (SPMs) viz., Fox Model (FM), Schaefer Model (SM) and Pella-Tomlinson Model (PTM) were use...
Zafar Iqbal*, Farah Ansar, Zil-e-Huma
...elonging to 10 different species were examined for parasitic, fungal and bacterial infection. The fish species studied were; Carassius auratus and its six varieties (shubunkin, comet, black moor, oranda, double tail and fantail); molly Poeciliasphenops; platy Xiphophorus maculates; sword tail Xiphophorus helleri; guppy Poecilia reticulata; tiger oscar Astronotus ocellatus; koi c...

Nadia Khan1*, Abdul Waheed1, Farrukh Siyar Hamid1, Naveed Ahmed1, Zafar Iqbal2, Seemab Ali1, Madiha Bashir1 and Hina Gul3  

...hytopathogenic bacterial species (Clavibacter sp. and Xanthomonas sp.) and a human pathogenic bacterium (Escherichia coli) in 2016. Experiment was carried out by using complete randomized design with three replications in vitro. Phytochemical analysis reveals that the methanolic fraction of oil possesses metabolites like carbohydrates, amino acids, alkaloids, flavonoids and glycosides. To test the antibacterial activity of the extracted seed oil, Agar well dif...

 Phong Huy Pham

Nesting biology of a spider wasp Auplopus sp. (Hymenoptera: Pompilidae) in Vietnam
...ders were immatures of a species of the genus Heteropoda, family Sparassidae. Developmental time of egg, larva, pre-pupa, pupa, and pre-adult was 6 - 7, 13 - 14, 5 - 7, 41 - 43, and 3 - 4 days, respectively. The duration of egg to adult development ranged from 68 to 75 days.

...

 Muhammad Mohsin Ahsan1, Hafiz Muhammad Tahir2*, Muhammad Khalid Mukhtar1, Arshad Ali3, Zafar Iqbal Kahan4, Kafeel Ahmed4

Intra- and inter-specific foraging in three scorpion species
...aviour of three scorpion species: Mesobuthus tumulus (Fabricius, 1798), Odontobuthus odonturus (Pocock, 1897), and Androctonus finitimus (Pocock, 1897) inhabiting Punjab, Pakistan, was studied under laboratory and field conditions. Results of the study revealed that all three scorpion species were cannibalistic. Mesobuthus tumulus attacked and fed more upon juvenile and sub- adults (medium- sized), scorpions. They also cons...

 Hamda Azmat1, Waqas Ali2, Arshad Javid2, Ali Hussain2, Syed Makhdoom Hussain3, Zara Saeed1,Syed Shafiq Hussain Bukhari4

Chromium contamination in water, sediment and its bioaccumulation in Indian major carps in River Chenab, Pakistan
...Among all the three fish species, maximum metal concentration was accumulated by Cirrhinus mrigala followed by Catla catla and Labeo rohita. Among fish organs, maximum Cr concentration 4.75±0.78 (µg/g) was recorded from liver whereas minimum 1.10±0.21 (µg/g) from muscles of the fish.

...

 Haji Muhammad1, Zafar Iqbal1, Tanveer Akhlaq2

Length-weight, length-length relationships and condition factor of fishes of family cyprindae from the Indus River, Pakistan
...ng to 20 freshwater fish species of family cyprinidae. Fish samples were
collected on a monthly basis from August 2013 to July 2014 at Taunsa barrage from the Indus River, Punjab,
Pakistan. The values of parameter b for LWRs ranged from 2.16 – 4.10 suggesting the isometric and allometric
growth pattern in fishes of family cyprinidae. The results of K factors ranged from 0.645 – 1.836 also determine both
negative growth t...

Mohammad Salim1, Arshad Javid2*, Ali Hussain2, Faiz-ur-Rahman3, FarmanUllah4, Hamidullah5

Distribution records of fruit bats Cynopterus sphinx and Rousettus leschenaultii from Khyber Pakhtunkhwa, Pakistan
...in identification of bat species and was applied
for species confirmation of R. leschenaultii. R. leschenaultia has been already reported while C. sphinx being
reported for the first time from the study area. Pteropus giganteus is another new record from the region.

...

 Muhammad Mohsin Ahsan1, Hafiz Muhammad Tahir2, Muhammad Khalid Mukhtar1

Effect of lunar cycle on active population density of scorpions, their potential prey and predators
...vities of three scorpion species, Hottentotta tamulus,
Odontobuthus odonturus, and Androctonus finitimus, and their potential prey and predators were observed in the
field. The result showed that H. tamulus and A. finitimus were more active during dark nights compared to moonlight
nights; however, there was no obvious effect of the lunar cycle on the activity of O. odonturus. Young (Immature)
individuals of all scorpion

 Mirfa Murtaza1, Sajid Abdullah1, Wardah Hassan1*, Khalid Abbas1, Huma Naz1, Muhammad Anjum Zia2

Studies on amylase and lipase activity in fishes fed with diet containing different feed ingredients
...s;2×2 ft) for each species and ten fish in each
aquarium. Fish in one aquarium were fed on rice polish and fish in second aquarium were fed on corn gluten @ 3 %
of their wet biomass for 70 days. Results showed that fish wet weight varied significantly between the rice polish and
corn gluten fed fishes. The corn gluten fed fish showed significantly better growth performance than fish fed with rice
polish. The activity of amylas...

 Muhammad Moosa Abro1, Ali Murtaza Dharejo2, Muhammad Munif Khan2, Nadir Ali Birmani2, Saima Naz2*

Description of first record of Petasiger exaeretus Dietz, 1909 (Trematoda: Echinostomatidae) in avian host from Pakistan.
...us is a common parasitic species of Cormorants. However, it has not been reported from
Pakistan in Little Cormorant, Phalacrocorax niger prior to the present study.

...

 Saima Naz*, Adil Ali Rajpar, Abdul Hameed Chandio

New Records of some Phthiraptera (chewing lice) of birds from urban areas of Hyderabad, Sindh, Pakistan
...on, which reported eight species of
Menoponidae and eleven species of Philopteridae. These species were Campanulotes compar (Burmeister, 1838),
Colpocephalum turbinatum (Denny, 1842), Columbicola columbae (Linnaeus, 1758), Hohorstiella lata (Piaget, 1880)
on pigeons and doves; Brueelia subtilis (Nitzsch, 1874), Menacanthus eurysternus (Burmeister, 1838) and
Stur...

 Abbas Ali1, Muhammad Altaf2*, Muhammad Samar Hussain Khan3

Winter survey of birds at Keti Bunder, district Thatha, Pakistan
...of 49 winter season bird species belonging to 33 genera
and 21 families were recorded. A total of 4280 birds were recorded dedicated survey effort from the Keti Bunder.
Dominance (D), Shannon-Wiener diversity Index (H’), Simpson Index (S), Evenness (E) and Margalef (R) were
observed form the study area as; 0.06, 3.23, 0.94, 0.52 and 5.74 respectively. During the surveys noted that most
abundant species...

 Abir Ishtiaq, Muhammad Naeem*

Length-weight relationships and condition factor for farmed Catla catla (Hamilton, 1822) from southern Punjab, Pakistan
...r /> management of this species in the farming system and can be used to fill a gap in the current knowledge in this area.

...

 Jhan Zeb, Muhammad Javed

Forecasting percentage contribution of plankton biomass towards increase in fish yield under composite culture conditions
...were five different fish species in
each of the triplicate group viz. Labeo rohita, Catla catla, Cirrhina mrigala, Ctenopharyngodon idella and
Hypophthalmichthys molitrix in the ratio of 27:10:10:07:13, respectively. Each triplicate group of fish T1 to T6 were fed
supplementary diets at varying protein level viz., 22, 24, 26, 28, 30 and 32% digestible protein (DP), respectively @
2% of their wet body weight daily. However, control f...

 Zafar Iqbal*, Hafiza Madhia Imtiaz

Parasites of double tail goldfish, Carassius auratus L. imported to Pakistan
...(1x1cm). Eight different species of parasites were observed on the fish.
The gills showed 100% infection by Dactylogyrus sp. and mean intensity was 35.4. Fins of the fish also
showed high infection (68%) and mean intensity (13.82) by Gyrodactylus sp. Argulus foliaceus infection
on skin and fins was 40% and its mean intensity was found 4.2. Metacercariae of an un-identified
digenean were also found encysted on gill filaments (infecti...

 Hafiz Muhammad Awais Sarwar, Muhammad Tahir Waseem, Abdul Majid Khan*, Rana Manzoor Ahmad

Propotamochoerus hysudricus remains from late Miocene deposits of Hasnot, Pakistan
...ssil remains of the Suid species, Propotamochoerus hysudricus are described in this paper on the basis of
their morphometric characters. This is perhaps the only known species of the genus Propotamochoerus in the
Siwaliks. The specimens are collected from the outcrops of Hasnot type locality, Punjab, Pakistan. The present
findings will strengthen the previous records of the speci...

 Bushra Siyal1, Sanjota Nirmal Das1, Rafia Rehana Ghazi2, Aly Khan3

Heterotestophyes gibsoni sp.n. (Trematoda: Heterophyidae) from the bird little tern (Sternula albifrons) in Sindh, Pakistan
...arasites of birds, a new species of trematode genus Heterotestophyes gibsoni
sp. n. was recorded from the intestine of little tern (Sternula albifrons) collected from Jamshoro, Sindh, Pakistan. The
new species is characterized by having small body, maximum width attained at the level of mid body region and
twisted at the level of pharynx. Oral sucker terminal, rounded and broader than long. Esophagus lon...

 Waqas Ali, Arshad Javid, Ali Hussain, Syed Mohsin Bukhari

Public attitude towards amphibian and reptiles in district Kasur, Punjab, Pakistan
...o unnecessary killing of species. Among all the
herpetiles, snakes are most disliked taxa and killed by the locales. Conservation
education and awareness campaigns are recommended to avoid unnecessary
killing of the amphibians and reptiles of the study area.

...

 Zafar Iqbal1, Muhammad Farooq Nasir1, Imran Bodlah1*, Rahmatullah Qureshi2, Ayesha Aihetasham3

Notes on three morphs of Bulaea lichatschovii (Hummel) (Coleoptera: Coccinellidae) from Northern Pakistan
...as well as pollinivorous species
on many plants. In this study, three morphs of B. lichatschovii are reported during
2015-2017 from different localities of Northern Pakistan (Gilgit-Baltistan and Azad
Jammu and Kashmir). Three food plants of the coccinellid are, Krascheninnikovia
ceratoides, Artemisia vulgaris and A. maritima, are documented. Notes on
diagnostics of the species are given wi...

Muhammad Asghar Hassan1, Imran Bodlah1* , Ayesha Aihetasham2 

First record of the oriental species, Saltella setigera Brunetti, 1909 (Diptera: Sepsidae) from Pakistan
.../p>...

 Halil Erhan Eroğlu

The comparison of the Felidae species with karyotype symmetry/asymmetry index (S/AI)
...symmetry, so that
species, genera, families and orders can be compared. Also the evolutionary
relationships of higher organisms can be determined. The symmetry/asymmetry
index is applied to the Felidae species. After a comprehensive literature search,
karyotype formulae, S/AI values and karyotype types of 23 species were
determined. According to the S/AI ...

 Muhammad Khalil Ahmad Khan1*, Muhammad Zafar2, Munazza Perveen3, Munir Ahmad3, Asia Iqbal4, Asmatullah3

Efficacy of malathion and carbosulfan against crop invadedaphid types Aphis craccivora (Koch) and Aphis gossypii (glover) on bean and brinjal plants
...ant crop infesting aphid species Aphis gossypii
(Glover) and Aphis craccivora (Koch) were reared on brinjal and bean plants
respectively. In the laboratory, the vegetable plant leaves being applied by residual
film technique with tested Aphid population. The most toxic insecticide was found
to be malathion with LC50 as 20.11 μg cm-2 for A. craccivora and 25.28 μg cm-2 for
A. gossypii while carbosulfan was found to be le...
Muhammad S. Waqas, Ali A.Z. Shoaib, Xinlai Cheng, Qianqian Zhang, Asem S.S. Elabasy and Zu-hua Shi*
...vasive, polyphagous pest species. Reproductive biology of this mealybug species is poorly known, which hinders the development of an effective management program. In this study, the reproductive mode, male’s mating capacity, influence of female’s age and density on male’s mating capacity, as well as the influence of copulation on female’s longevity were investigated under the laboratory condition. Our...

Muhammad Shahzad Akbar, Muhammad Zeeshan Majeed* and Muhammad Afzal 

...mic subterranean termite species in Indo-Pak region. Label-recommended dose rates of insecticides were tested against worker termites using modified filter paper disc method according to completely randomized design. All insecticides caused significant mortality of termites as compared to control treatment. Formulations of chlorantraniliprole, chlorfenapyr and pyriproxyfen exhibited maximum termite mortality, ranging from 31.18±5.67, 28.33±7.03 a...

Saman Fatima* and Shazia Iram 

...cing of DNA the pathogen species identified includes fungal Colletotrichum sp. These pathogens are involved in deterioration the skin of Citrus reticulate. They can either attack the healthy fruit leading to various infections or they can enter through various lesions caused by physical stress and worsen the condition. 

...
Aiguo Zhou1,3,4, Shaolin Xie1,4, Zhenlu Wang1, Lanfen Fan1, Yanfeng Chen2, QiaoYe1, Fang Zeng1 and Jixing Zou1,*

 

...to 0.248) with the inter-species genetic distances. The intra-species genetic distance ranged from 0.000 to 0.002. For the haplotypes of two color morphs of Channa argus, the mean pair-wise genetic distances were estimated as 0.002, which were within the intra-species genetic distance interval for Channa species, indicating that they belong...
Shagufta Nighat1, Muhammad Sajid Nadeem1,*, Syed Israr Shah1, Amber Khalid1, Tariq Mahmood2, Ayesha Aihetasham3 and Muhammad Asif4
...however within three bat species metal concentrations varied significantly. This study provides baseline data for future comparisons and management of bats and metal concentrations in environment.
...
Ajmal Khan* and Rehan Ullah
...ferent Plasmodium species in their blood smears. Male population accounts for higher prevalence rate (14.59%) than female (11.24%). The infection was more prevalent in November (21.4%), December (21.1%) and October (18%) and was lowest in the month of April (6.7%). The highest prevalence was recorded in autumn (36.8%) and summer (30.3%) and the lowest rate of infection was observed in spring (10.1%). Majority of the malarial cases were due to P. viva...
Faiz Muhammad1,2, Canfeng Dou1, Zhen-ming Lü1,*, Li Gong1, Xun Du1 and Muhammad Shafi3
...his study solely provide species specific information on its genetic structure and population variability in Chinese waters.
...
Jun Yan Bai1,*, Yong Gang Zhao2 and Yu Qin Wang1
...on. Polymorphism of goat species was tested by sequencing technology. Results demonstrated that there are two mutation sites (SNP loci) of the primer GHRL-2 in black goat and Yaoshan goat, which are G447C site and T498C site. At G447C site, gene frequencies of G and C in black goat and Yaoshan goat were detected 0.621/0.379 and 0.793/0.207, respectively. In black goat and Yaoshan goat, G is the dominant allele in G447C. At T498C site, gene frequencies of T and...
Qingling Hu1,2,3,* and Jinian Feng3
...div>In this paper, a new species Megalurothrips longus sp.n. from Hainan Island of China is described and illustrated. This new species is unique in this genus by the combinations of having 5 pairs of long setae on pronotum, the ultrashort chapped craspedum on posterior margin of abdominal tergites, and the shape and relative locations of setae on tergite IX.
...
Muhammad Ijaz1, Shahid Hussain Farooqi1, Rahmatullah2, Amjad Islam Aqib1, Sadaqat Ali3,*, Awais Ghaffar1, Ahmad Ali1 and Sehrish Saleem1
...n diarrheic foals of all species. The sodium, calcium, copper, iron and lithium concentrations significantly (p < 0.05) decreased while the potassium concentration significantly (p < 0.05) increased in diarrheic foals. Hence, this can be concluded that diarrhea in foals have significant correlation with PCV, serum electrolytes, and trace and ultra-trace elements.
...

Muhammad Salman Wazir and Mohammad Akmal 

...crop with other selected species. The study was conducted at Agronomy Research Farm, the University of Agriculture, Peshawar, during winter 2015-16. Treatments included cropping pattern viz. sole and intercrop of lines with 1:1 ratio i.e. one wheat row followed by one other crop species and 2:1 ratio i.e. two wheat rows followed by one other crops rows of Brassica (Brassica juncea), Fababean (Vicia faba) and Sunflower (Helia...
Abderraouf Chouaib Rebbah1, Mohcen Menaa2,*, Salah Telailia3,Menouar Saheb1 and Mohamed Cherif Maazi2
...oodlands). A total of 69 species were observed. One species was recorded only in mixed oak-pine forests, six were found exclusively in oak woodlands and 17 species were found only in pine woodlands. We noted 20 protected species, only one endangered species, and five endemic species ...
Xiao-Ying Ren1, Di Zhang2 and Wan-Long Zhu1,*
...ys were the inherent species in Hengduan Mountains region, which had special status in Microtus, Arvicolinae. In order to investigate the geometric morphometrics of the craniums and mandible in nine species of Eothenomys (E. fidelis, E. melanogaster, E. chinensis, E. proditor, E. custos, E. cachinus, E. eleusis, E. miletus and E.olitor), ANOVA a...
Radek Aulicky1,*, Vaclav Stejskal1 and George Opit2
...m 0 to 100% depending on species. The most sensitive species was O. surinamensis whereas the most tolerant was R. dominica. At 1- and 4-h exposure periods, there were significant differences in mortality between repressive and preventive regimes. However, no differences between regimes existed for 24-h exposure. Our data show that short term exposure to DDVP strips have suppression effect for O. surinamensis...
Gangchun Xu1,2, Fukuan Du2, Yuyu Wang2, Yan Li2, Zhijuan Nie2 and Pao Xu1,2,*
...ly-important aquaculture species. In this study, two prostaglandin E synthase 2 (PTGES2) orthologs were identified. The full length ortholog PTGES2a was 1,575 bp and contained a 1,167-bp Open Reading Frame that encoded a protein of 388 amino acids. The 5′ and 3′ untranslated regions were 269 bp and 139 bp, respectively. The full length ortholog PTGES2b was 1,457 bp and contained a 729-bp ORF that encoded a protein of 242 amino ...
Asim Faraz1,*, Muhammad Younas2, Abdul Waheed1, Muhammad Yaqoob2 and Kashif Ishaq3

 

...respectively). Available species for grazing/browsing were kikar, phulai, beri, siras, jand, khagal, dhaman, persain, khawi, bui, bhakra, kari, laana, phog, karir and khar laana. Regarding hair mineral status Ca, Mg, Cu, Zn, Fe and Mn concentrations were found to be significantly different (P<0.05) between calf groups being higher in IMS as (685.07±15.86, 595.67±15.86; 104.33±5.12, 101.17±5.12; 7.08±0.34, 6.73±0.34;...
Menderes Cenet
...enus level and 20 at the species level) belonging to 34 families were identified. Astragalus sp., Trifolium sp., Myrtus communis and Castanea sativa were the predominant taxa in the unifloral honey samples. Antimicrobial effects of eight honey samples proved the most effective inhibitors against Bacillus megaterium and Staphylococcus aureus. Honey samples (H07 and H08) showed significant antifungal effects on Candid...
Shamesa Maryam1, Ajaz Ahmad Sandhu1, Imran Bodlah2*, Muhammad Asif Aziz2, Ayesha Aihetasham3

 

...ince, Pakistan. Total 12 species namely; Aphis craccivora, Aphis fabae, Aphis gossypii, Aphis nerii, Rhopalosiphum padi, Lipaphis erysimi, Macrosiphum euphorbiae, Myzus persicae, Pentalonia nigronervosa, Sitobion avenae, Greenidea (Trichosiphumpsidii and Cinara (Cupressobium) tujafilina have been recorded for the first time from this area. General characters, measu...
Farheen Shaikh*, Saima Naz, Nadir Ali Birmani
... During the study, three species of chewing lice were reported from Common Quail. Their population density on host body was recorded in each month. The prevalence of chewing lice species of Coturnix coturnix was recorded as 44.47% Cuclotogaster cinereus (Nitzsh, 1866) belongs to family Philopteridae 32.64% Menacanthus abdominalis (Piaget, 1880) and 22.87% Menacanthus cornutus belongs to family Men...

Shamsher Ali1*, Muhammad Jamal Khan2, Zahir Shah2, Naveedullah3 and Abdul Jalal1 

...lerant crop genotypes of species on salt affected lands is an effective tool for getting desirable productivity. A two-factor experiment using complete randomized design with three replications in pots having silt loam soil was carried out on April 03, 2016 to examine three maize genotypes (Iqbal, Jalal, and Azam) under different salinity levels i.e. 0.4, 2.7, 5.2 and 7.6 dS m-1 at Amir Muhammad Khan Campus, Mardan, the University of Agriculture, Peshawar. The...
Rahat Afza, Muhammad Afzal, Muhammad Zeeshan Majeed and Muhammad Asam Riaz*
... both these coccinellids species. Imidacloprid is relatively safe for aphid control.
...
Pingping Cang1, Mingming Zhang1, Guo Qiao1,Qirui Sun1, Dehai Xu3, Qiang Li1, Xinghua Yuan4 and Wenbin Liu2,
...tive mudflat aquaculture species, was used to evaluate the effects of biofloc technology (BFT) on growth, nutrition and economic profitability in mudflat fish aquaculture. A 60-d experiment was conducted in zero-water exchange BFT system. The results demonstrated that weight gain (WG), specific growth (SG) and survival in BFT group were 133.94%, 1.20% day-1 and 90.0%, respectively. In control group with a 1/4-1/3 daily water exchange, WG, SG and sur...

Ejaz Ashraf1*, Hafiz Khurram Shurjeel2, Nosheen Fatima1, Raheel Babar3 and Ikramul Haq4  

...ively aware of regarding species diversity; however, they do not know the modern techniques to uphold crop and species diversity. Biodiversity concept of farmers is at very basic level and they know only limited conventional ways to maintain it. The statistical analysis showed weak significant association between factors responsible for biodiversity loss and two types of biodiversity since χ2 (3) = 11.338, p = ...
Hamidullah1,*, Arshad Javid2, Basit Rasheed1,Jehan Zeb3, Abidullah1 and Muhammad Iftikhar Khan1
...length of skull of these species was 11.75±0.35mm, 13.69±0.25mm, 12.48±0.34mm, 11.83±0.30mm and 15.00±0.15mm, respectively while their total bacular length was 1.58mm, 3.81±0.01mm, 3.82±0.47mm, 2.11±0.707mm and 5.83±2.15mm, respectively. The shape and size of the bacula were the characters that helped in clear cut identification of these bat species.
...
Tongliang Wang1, Lele Jia1, Xiaofei Zhai1, Jianguo Cui2 and Jichao Wang1,*
...ed evidence, and in some species, this match is imprecise. Here, we analyzed the acoustic characteristics of male calls and both male and female hearing sensitivity in an explosive-breeding toad Duttaphrynus melanostictus to test the matched filter hypothesis.Male toads emitted a series of multisyllabic calls that were composed of single notes with a dominant frequency of 1494 ± 80 Hz. The dominant frequency reflected body size and was static bet...
Zhiwen Zou, Jianfei Xi, Fen Chen, Rui Xu, Tianrong Xin and Bin Xia*
... more than 1,500 nominal species. However, the relationships of this subfamily was confused. In order to improve the classification system of Amblyseiinae, the mitochondrial CO1 gene sequence of seven Amblyseiinae species, collected from four provinces of China, were sequenced, and another seven Amblyseiinae species mt CO1 gene sequenced were download from GenBank. And the phylogenetic rel...
Jam Nazeer Ahmad1,2,*, Muhammad Jafir1, Muhammad Wajid Javed1, Sumaira Maqsood3 and Samina J.N. Ahmad1,2,*
...R fragments from all DCB species at 710 bp. The sequencing results and phylogenetic analysis with sequences submitted at NCBI database revealed that DCB have 99-100% similarity with Oxycarenus hyalinipennis OH1 (JQ342987.1), Oxycarenus hyalinipennis OH2 (JQ342988.1) reported from USA. This is the first report of molecular identification and DNA barcoding of Oxycarenus hyalinipennis infesting cotton from Pakistan. DCB is becoming alarming p...

Rafiullah1*, Abdur Rahman2, Khalid Khan1, Anwar Ali1, Arifullah Khan2, Abdul Sajid3 and Naimatullah Khan3 

...present study two animal species (cattle and buffalo) were selected. A total of 800 samples were collected from different areas of District Lakki Marwat and District Peshawar. All the samples were processed through different diagnostic techniques, including Microscopy, ELISA and Real-time PCR for diagnosis of Theileria parva at Veterinary Research Institute Peshawar. The overall prevalence for Theileriosis was 27.75% through Real-time PCR, followed by Indirect...
Liqin Liu, Maoting Wang, Zhenming Lü, Li Gong*, ChangWen Wu, Baoying Guo and Lihua Jiang
... in three closelyrelated species. Nineteen, fifteen, and thirteen loci were amplified in Sepia lycidas, Sepia esculenta and Sepiella japonica, respectively. 

 

...
Fariha Latif* and Muhammad Javed
...ure. Fish from different species has diverse ecological needs and respond differently to the environmental stress conditions. Thus, the sensitivity, bioaccumulation and antioxidant capacities of three major carps Catla catla, Labeo rohita and Cirrhina mrigala towards metals mixture (Cd+Cr+Cu+Pb) were determined during present research work. Sensitivity of the three fish species (120-day old) towards meta...
Muhammad Hidayat Rasool1,*, Muhammad Zaheer1, Muhammad Farooque Hassan2, Muhammad Shafique1 and Muhammad Usman Qamar1
...152 specimens, different species identified in order of their frequency were; Klebsiella pneumoniae (59; 38.8%), Pseudomonas aeruginosa (46; 30.3%), Escherichia coli (36; 23.7%), Klebsiella oxytoca (4; 2.6%), Serratia marcescens (3; 2%), Enterobacter agglomerans (2; 1.3%) and Enterobacter cloacae (2; 1.3%). Out of 103 carbapenem-resistant isolates, 58 (55.1%) were positive by DDDT and 49 (46.7%) by MHT. Most of ...
Rishen Liang*, Meng Zhou, Zhenxiang Lin, Guozhang Li, Yuan Chen, Xuan Lin and Zaohe Wu
...us vittatus were two species of colorful coral reef sweetlips which distribute in the areas of Indo-Western Pacific. The two species have long been considered as a synonym (oriental sweetlips) in morphology. In order to investigate the validity of two species at the molecular level, complete mitochondrial genomes of the two species were first determi...
Liyan Zhang1,2, Zhidong Zhou1,3, Haiping Li1,2, Yanlong Qiao4, 5 and Yueping Zhang1,3,*
...eographical range of the species. However, no phylogenetic structure corresponding to geographic location was observed from the neighbor-joining (NJ) tree and haplotype network analyses, and gene flow and exact P test results revealed that a wide range of gene flow occurred among the four S. japonicus populations. Analysis of molecular variance (AMOVA) and Fst analysis showed that genetic variation was mainly derived from within...
Saleh S. Alhewairini1,* and Mahmoud M. Al-Azzazy1,2
... disinfectant. Both tick species were susceptible to certain concentrations of Huwa-San TR50: 4,000, 8,000, 10,000, 12,000 and 14,000 ppm. A marked reduction in the movement of both tick species was observed 24h of applying Huwa-San TR50, at 10,000 ppm and above. This study recorded an increase in percentage mortality with increasing concentrations of Huwa-San TR50 and this resulted in mortalities of 66.5% for H. dromedar...
Tahira Moeen Khan* and Amat ul Mateen
...only known as dharaik) a species of family Meliaceae and Morus nigra (commonly known as Shahtoot) family Moraceae were used for bio reduction of copper ions to CuO nanoparticles in place of harmful and expensive chemical/physical methods. A cheaper, simple to perform method giving high yield without by products is employed here. The leaf extract act both as reducing and capping agent. The atomic absorption shows a linear curve between concentration...

John Ogunsola1*, Richard E. Antia2, Benjamin O. Emikpe2 and Olajumoke A. Morenikeji

...n or hatching of various species of captive animals were obtained. The animals included reptiles, amphibians, aves and mammals, with both sexes placed in the same enclosure with some degree of access to one another. Among mammals, survival rates of neonates ranged from 0% in Dorcas gazelles (Gazella dorcas; n=2) to 100% in Green monkeys (Chlorocebus sabaeus; n=2) and Patas monkeys (Erythrocebus patas; n=3), and crocodiles (Crocodylus niloticus; n=32). Muscovy ...

Syed Atif Hasan Naqvi1*, Sidra Mushtaq1, Muhammad Tariq Malik2, Ummad-ud-Din Umar1, Ateeq ur Rehman1, Shoaib Fareed3, Muhammad Asif Zulfiqar

...nt of the insect’s species has been recorded and authenticated by various scientists reporting that these acts as the carrier of the fungal spores and produce tunnels in the bark of the trees. Since, many extensive filed surveys of forests, avenues, road sides and canal banks has been made to calculate the total losses and mortality of the sheesham trees in Indian sub-continent. Up-till now billions of shisham trees have been destroyed because of decline...

 Syed Turab Raza1,*, Zhu Bo1,*, Zulfiqar Ali2 and Tang Jia Liang3

...stem using the earthworm species (Eisenia fetida) and treating it with cattle dung, pig manure and biochar with crop (wheat straw and rapeseed) waste was established in upland areas of China. It was monitored for two months. Four treatments (T1 to T4) were prepared using crop residues i.e. wheat straw, rapeseed and cow manure in different concentrations. Vermicomposting through biochar (Biochar 50%, rapeseed residues 20% and Biochar with earthwor...

Shafique Ahmed Memon1,6, Arif Ali1*, Mehar-un-Nisa Narejo2, Ghulam Khaliq3, Imran Ali Rajput4, Muhammad Adeel1, Khalil Ahmed Memon5, Dzolkhifli Omar6, Muhammad Rashid7 and Abdul Rasool

...itability of three aphid species on the pre-imaginal development of three species of green lacewings. Developmental stages of three different species of green lacewings, Chrysoperla nipponensis, Plesiochrysa ramburi and Apertochrysa sp. were provided with three different prey species, Aphis craccivora, Rhopalosiphum maidis and Corcyra cephalonica under t...

Khadim Hussain Wagan1*, Muhammad Ibrahim Khaskheli2, Jamal-U-Ddin Hajano1 and Abdul Ghani Lanjar2 

...s aligned with different species and observed that MPS16 belongs to M. phaseolina isolate. The sequence showed high identity with sequences with Macrophomina sp. from the NCBI database (100%); In contrast, alignments among the same genera and species demonstrated 91–98% identity. We then predicated that isolated encoded culture (MPS16) predetermine with Macrophomina sp. 

...

 Zhi Yijin and Shao Mingqin*

...ined for this endangered species. The Xiuhe, Fuhe and Raohe river systems exhibited large steady populations, with the maximum size ranging from 25 to 68 individuals for each river. Restoration and maintenance of suitable habitats for the scaly-sided merganser is imminent as the species is at risk of extinction due to its small population size. The total sex ratio of the merganser during the study period was 0.397 (n = 790) ...

 Xu Lijie, Obaid Ullah, Liu Haixing, Ihsan Ali, Zhongshu Li* and Nan-Zhu Fang*

...ation of reactive oxygen species (ROS) is one of the reasons for the slow growth of mammalian preimplantation embryos. Peroxisome proliferators-activated receptor gamma (PPARγ) functions in the nuclear regulatory factor 2 (Nrf2) antioxidant pathways by binding to the promoters of antioxidant genes and regulates the expression of genes that associate with NADPH oxidase. To understand the role of PPARγ in the development of early embryos and define t...

 Muhammad Arshad Hussain1 and Tariq Mukhtar2,*

...ty of root-knot nematode species associated with okra in the major vegetable growing districts of the Punjab province of Pakistan. The overall incidence of 39%, prevalence of 85% and severity of 4.1 in terms of the galling index was recorded throughout the province. Differences in the incidence of root-knot nematodes were recorded from all the districts ranging from 11% to 70%. The incidence was found to be the maximum (70%) in districts of Bahawalnagar and Ra...

Huma Khalil1*, Muhammad Afzal1, Muhammad Anjum Aqueel1, Abu Bakar Muhammad Raza1, Muhammad Sajjad Khalil1, Farghama Khalil2 and Hafiz Khurram Shurjeel1 

...iinae), 12 genera and 16 species were collected. Out of them, two genera and 12 species were recorded for the first time from this area. Aphidiinae contains 1,107 individuals which showed that it’s a dominant braconid subfamily while Opiinae (209) was the least dominant. The richness of braconid parasitoids in different localities of Sargodha was also investigated. Braconid parasitoid populations were higher in the mon...
Iram Maqsood1,2,3 and Ke Rong *1,2
...ly two crocodile’s species has been enjoying this universe, and one of them is Chinese alligator (Alligator sinensis) who is at the edge of extinction in nature. Approximately, 130-150 individuals left in wild. Habitat loss is considered as a major source of population decline of this precious species. Consequently, for the sake of A. sinensis conservation, China took steps with the top priority of habita...
Muhammad Zain Saleem1,*, Raheela Akhtar1, Asim Aslam1, Muhammad Imran Rashid2, Zafar Iqbal Chaudhry1, Muhammad Adeel Manzoor1, Bilal Ahmed Shah3, Rais Ahmed4 and Muhammad Yasin5
...of bovine) may cross the species barrier to infect the small ruminants which may complicate the control measures of brucellosis because most of the control programs rely on serological screening of brucellosis rather than molecular assay which could confirm the particular species circulating in ruminants. In this study 960 and 471 serum samples of goats and sheep were collected, respectively. After screening with Rose Bengal...
Guo-hai Wang1, Zai-xi Yang1, Pan Chen1, Wei-ning Tan2 and Chang-hu Lu1,*
...g behavior of local bird species to examine their role in dispersing seeds of Kmeria septentrionalis, an endangered tree species in a karst habitat in southwest China. Twenty-seven bird species were recorded feeding on its seeds, and fourteen bird species were confirmed as seeds dispersers. The chestnut bulbul (Hemixos castanonotus), striat...
Zhaochao Deng1, Jingchen Chen1, Na Song2, Yongzhen Li3 and Zhiqiang Han1,*
...d a stable model in this species in the South China Sea population. To reveal its population structure within the large-scale geography distribution, we added 169 sequences of the mitochondrial control region already genotyped from northern Australia. The South China Sea and northern Australia groups were successfully distinguished by the NJ tree with significant genealogical branches of haplotypes. These results indicated that there might have only one fisher...
SiRui Wang1,2, Fekede Regasa Joka1,2, XiaoLong Wang1,2,* and SuYing Bai2,*
...wild birds, 10 wild bird species, including Anas formosa, Anas crecca, Anas strepera, Mergus squamatus, Accipiter nisus, Buteo hemilasius, Buteo lagopus, Passer montanus, Psittacula roseata and Emberiza elegans, were selected.The sequences of the GTPase effector domain (GED) of the Mx gene were determined by PCR sequencing. The haplotypes were analysed by DNA SP software. The Datamonk...
Ashfaque Ahmed Nahiyoon1,*, Shahina Fayyaz2 and Nasira Kazi2
...dentification of one new species of soil nematode viz., Acrobeloides gossypii n. sp., along with three new record species viz., Tylenchorhynchus ewingi Hopper, 1959; T. crassicaudatus Williams, 1960 and Pratylenchus pseudofallax Café-Filho & Huang, 1989. Description, measurements and illustrations of these species are incorporated herein...
Tianlong Cai1, Falk Huettmann2, Kisup Lee3 and Yumin Guo1,*
...cha) is a vulnerable species. However, its stopover habitat receives little attention and is not well known or protected even. Here, we present the spatial distribution of the stopover habitats for hooded cranes in the East Asia. A machine learning modeling algorithm of maximum entropy (MaxEnt) weas applied and evaluated with Stochastic Gradient Boosting and Random Forests based on 115 every year used occurrence points (1990-2013) and 14 environmental laye...
Fukuan Du1,2, Yongkai Tang1, Juhua Yu1, Shengyan Su1, Fan Yu1, Jianlin Li1, Hongxia Li1, Meiyao Wang1 and Pao Xu1,2,*
...a commercially important species. However, eco-environment deterioration and overfishing have almost caused extinction of the species in the Yangtze River. Therefore, it is very urgent to perform genetic research on C. nasus to protect the wild population. In this study, we sequenced the brain transcriptome of C. nasus using Illumina Hiseq 4000 platform. We obtained 123,764 unigenes with an average length of 10...
Muhammad Khalil Nawaz, Sayyed Ghyour Abbas, Muhammad Akbar Khan, M. Adeeb Babar*, Muhammad Asim, Rabia Shahid and Muhammad Akhtar
...ledge about the recorded species.
...
Fakhra Soomro1,*, Riffat Sultana2 and Muhammad Saeed Wagan2
...iv>Nymphal stages of two species of genus Sphingonotus Fieber viz. S. savignyi Saussure and S. rubescens rubescens (Walker) were studied exclusively form Sindh during the 2014-2016. Both species passed through six instars larvae. Emergence of larval instars in both species was started from the month of July just after monsoon rainfall, whereas, S. savignyi

Abdul Kabir1, Laiba Uroog2*, Naushad Ahmad3, Fawad Ahmad3, Muhammad Saqib3, Noor Badshah4 and Taj Ali Khan3 

... environmental bacterial species. In Pakistan, it is the major disease of different dairy animals including bovines. However, only a little information is available about bacterial profile of the disease. A cross-sectional study was conducted to find the Etio-prevalence of bacterial species causing subclinical mastitis in a cohort of buffaloes at Khyber Pakhtunkhwa. 120 quarter samples were collected from suspected buffaloes...
Bushra Siddique1,*, Muhammad Tariq1, Muhammad Naeem1 and Muhammad Ali2
...ween prey and host plant species. Recent studies exhibited that the use of natural enemy is an ecofriendly measure to control pests. The Seven spotted ladybird beetle, Coccinella septempunctata play a prominent role in aphid management. It exploits several different cues released by plants to increase the efficiency of foraging. Aphid endoparasitoid, Diaeretiella rapae (McIntosh) (Hymenoptera: Braconidae) have an ability to locate itshosts by res...

Muhammad Rehan1, Asim Aslam1, Muti-ur-Rehman Khan1, Muhammad Abid2, Shakeel Hussain3, Javeria Umber4, Ahsan Anjum1 and Altaf Hussain2* 

...portant disease of avian species and continuously cause outbreaks in commercial poultry throughout the world. Despite intensive vaccination, ND is endemic in Pakistan and locally known as Ranikhet. Wild birds are considered natural reservoirs of Newcastle disease virus (NDV) and some common resident or migratory wild birds are associated with outbreaks of ND in commercial poultry in Pakistan. Continuous isolation of new genotypes in Pakistan shows the evolving...

Fraza Ijaz1*, Umair Riaz2, Shazia Iqbal3, Qamar uz Zaman4, Muhammad Furqan Ijaz5, Hina Javed1, Muhammad Amjad Qureshi1, Zuhra Mazhar3, Ahmad Hassan Khan6, Hassan Mehmood7 and Ijaz Ahmad8 

...application of Rhizobium species and Tryptamine performed better by improving growth and yield and quality parameters. It is concluded that precursor-inoculum combination is an effective approach and should be tested in different ecologies. 

...

Muhammad Sohail1*, Asad Sultan2, Said Sajjad Ali Shah3, Muhammad Sajid1 and Adnan Khan4

...igher than other poultry species particularly broilers.

...
Muhammad Ahmad, Zohaib Noor*, Karim Johar Khan, Waqar Younas and Ajmal Hussain
...ith three different fish species at the rate of 800/Acre in the semi intensive polyculture system by supplementing inorganic and organic fertilizers in the ponds. Fish were stocked at the ratio of 35:40:25 in both the ponds designated as group 1 and group 2. Group 1 pond was stocked with Catla catla (C. catla) a surface feeder, Labeo Rohita (L. rohita) a column feeder and Cirrhinus mrigala (C. mrigala) bottom feeder, respecti...
Faraz Akrim1,2, Tariq Mahmood1,*, Muhammad Sajid Nadeem3, Siddiqa Qasim1, Shaista Andleeb1 and Hira Fatima1
...breadth of two carnivore species; Indian grey mongoose (Herpestes edwardsii) and small Indian mongoose (Herpestes javanicus) occurring in the north-eastern Himalayan region (Azad Jammu and Kashmir) of Pakistan with a view to compute the niche overlap between the two species. The Indian grey mongoose was recorded at 15 different sampling sites within the elevation range 699-1559 m above mean sea level (AMSL). Th...

Hassan Naveed1,2, Kamran Sohail2 and Yalin Zhang2* 

...t-align: justify;">Three species in the leafhopper subfamily Deltocephalinae, Changwhania terauchii Matsumura (1915) n. rec., Linnavuoriella arcuata Hamilton (1980) n. rec. and Paralimnellus cingulatus Dlabola (1960) n. rec. are reported for the first time from Pakistan. All species are described and illustrated with habitus photographs. 

...
Bingbing Gao1, Na Song1, Zhonglu Li2, Tianxiang Gao3 and Liqin Liu3,*
...nservation. The ponyfish species Nuchequula mannusella is a dominant species along southern coast of China with important economic and ecological value, and little of its population genetic structure has been known. We use mitochondrial DNA markers to investigate the genetic structure of the species along southern coast of China. The complete sequences of Cytochrome b (Cyt...
Sagir Hussain, Erum Iqbal* and Shahina Fayyaz
...cius comprised of 17 species that based on the characters of the total body length, stylet, ratio of a, b, c, c’, V%, head annules, tail annules, lip region and tail terminus. The allometric and morphometric characters were derived from the original descriptions. An up to date list of valid species of Quinisulcius along with illustrations and diagnostic key is provided. Detailed surveys of cereals, fruits an...
Abdur Rauf Nizami*
...y a wide range of faunal species. The documented species are comprised of: foraminifers, gastropods, pelecypods, bryozoans, echinoids, sponges, brachiopods, and corals.
...
Jun Yan Bai*, Shuai Yang, You Zhi Pang, Xiao Hong Wu and Guang Lu Li
...er than those of ret two species (P<0.05). Based on comprehensive evaluation, the egg quality of Korea quail is better than those of other two species, egg production and laying rate of China yellow quail are significantly higher than those of Korea quail and Beijing white quail (P<0.05). The average egg weight of Korea quail is significantly higher than those of China yellow quail and Beijing white quail (P<0.05). ...
Songhao Zhang1, Yiwen Gong1, Jian Xu1, Mou Hu2, Peng Xu3 and Yanliang Jiang1,2,4,*
...ecular selection of fish species with consumer-favored skin color and body shape.
...
Zhengfei Wang*, Dan Tang, Xuejia Shi, Huayun Guo, Xiuping Chen, Daizheng Zhang and Boping Tang*
...most common and abundant species and predators at the top of food chain in the hydrothermal vent ecosystem. However, the genetic basis for the adaptation of hydrothermal vents crabs to the harsh environment remains poorly explored.The objectives of this study were to increase our understanding of the mechanisms of hypoxia adaptability in vent crabs and to confirm if there is a correlation between mitochondrial protein coding genes (PCGs) and adaptation to the ...
Xiaohui Yu, Shuai He, Liqiang Wang, Mengyang Kang, Yanjiao Zhu, Shuhui Wang and Xiuzhu Sun*
...zhong donkey, a precious species. The objective of this study was to reveal the effect of different antioxidants on the semen cryopreservation in Guangzhong donkey by testing indices of sperm motility, mitochondrial activity, membrane integrity and arosome integrity. The results illustrated that compared with controls, above-mentioned indices of sperm were significantly improved under concentrations of Vitamin C (400 mg/L) and Vitamin E (600 mg/L) (P < <...

Muhammad Yasin1, Romana Shahzadi1, Muhammad Riaz2, Mahideen Afridi2, Wajya Ajmal3, Obaid Ur Rehman2, Nazia Rehman3, Ghulam Muhammad Ali1,3, Muhammad Ramzan Khan1,2,3* 

...SHP2 homologs from other species conglomerated BnSHP1-like and BnSHP2-like into their respective clades. Semi-quantitative RT-PCR revealed overlapping expression of both the BnSHP1-like and BnSHP2-like transcripts in flower and siliques while no expression in the leaf tissues was observed. A strong expression for FUL gene was detectable in mature silique and silique from upper portion of plant as compared to other tissues of “Pakola” and “Pun...

Tahira Jatt1, Ghulam Sarwar Markhand1, Lane Rayburn2, Ray Ming3, Mushtaque Ahmed Jatoi1 and Ameer Ahmed Mirbahar1,4* 

...ocot and dioecious plant species having uncertain diploidy levels because of scarcity of cytogenetic knowledge. Khairpur district in Sindh is known as the biodiversity center of date palm. Investigations were carried on the chromosome number and karyotype one of the seven indigenous commercial date palm varieties and four wild type date palm of Sindh province, Pakistan by using the traditional Fuelgen squash method. Results indicated that all seven commercial ...

Amany Adel, Wesam Mady*, Zienab Mosad, Fatema Amer, Asmaa Shaaban, Dalia Said, Marwa Ali Abdel Maged, Abdel-Satar Arafa, Mohamed Kamal Morsi, Mohamed Khalifa Hassan 

...ned samples of different species and sectors in Egypt, with a prevalence rate 4.4% by the year 2015/2016. However, the LPAI H9N2 showed a wide range distribution with high geo-prevalence rate in 2015/2016 (96.3%) as positive cases were recorded in 26 governorates., the positive samples were distributed in 783 farms with the highest prevalence rate (76.5%), Also, the most of positive cases were detected in chicken as the highest prevalence (90%) among all the e...
Hafiz Abdul Ghafoor*, Muhammad Afzal, Muhammad Asam Riaz and Muhammad Zeeshan Majeed
...f eight indigenous plant species for their insecticidal potential against 2nd instar D. mangiferae individuals. Standard twig-dip method was used for toxicity bioassays according to Completely Randomized Design. Mortality of mealybug individuals varied with plant materials and increased along with the extract concentration and exposure time. Botanical extracts of Azadirachta indica (neem) and Gardenia jasminoides (gardenia) were...
Mohammed Anas Chowdhury1, Md. Abdul Karim1, Md. Tayfur Rahman1, Shoaibe Hossain Talukder Shefat1, Ashikur Rahman1, Mohammad Amzad Hossain2*
...e present status of fish species diversity of Surma River at Sylhet Sadar, Northeast Bangladesh. A total of 51 fish species belonging to 16 taxonomic families has been identified. The most abundant family was recorded as Cyprinidae covering 36%, while the least abundant family was Gobidae and Plotosidae comprising 1%. A Shannon-Weaver diversity index was fluctuated between 2 to 2.5 with mean value 2.30±0.14, which rev...

Amany Adel, Wesam Mady*, Zienab Mosaad, Fatma Amer, Asmaa Shaaban, Dalia Said, Marwa Ali, Abdel-Satar Arafa, Mohamed Kamal Morsi and Mohamed Khalifa Hassan  

...poultry sectors and bird species which are distributing all over the Egyptian governorates for examination of LPAI (H9N2) virus by real time RT-PCR. The results confirmed positive samples from 1026 for H9N2 with prevalence rate 4.4%. However, the LPAI H9N2 showed a wide range distribution with high geo-prevalence rate in 2015/2016 (96.3%) as positive samples were recorded from 26 governorates. Totally, the positive samples were distributed in 783 farms with th...
Fatima Tufail1, Sajid Abdullah1, Huma Naz2*, Khalid Abbas1, Laiba Shafique3
...ffects. Fresh water fish species such as Channa striata serve as important bio-indicators for aquatic contamination to access the changes caused by human activities effectively and reliable monitoring bio-system to recognize and predict hazardous effects of pollutants. Therefore, this study was done to evaluate the toxicity of endosulfan (END),deltamethrin (DM) mixture on hepatic catalase (CAT) activity of fish, Channa striata exposed to the...
Sehrish Ashraaf1, Hafiz Muhammad Tahir1, Muhammad Akram Qazi2, Shaukat Ali1*
...d as a marker to delimit species. Based on morphological identification and sequencing of CO1 gene, a total of 22 species of spiders belonging to five families were investigated and compared within each species and among families for nucleotide frequency distribution of all species collected. We had found non-significant difference in frequen...
Mohsen M. El-Sherbiny1,2,*, Reny P. Devassy1, Erinn M. Muller3, Abdulmohsin A. Al-Sofyani1 and Ali M. Al-Aidaroos1
...tal of 138 phytoplankton species (80 diatoms and 57 dinoflagellates) contributed to the phytoplankton diversity during the study. Zooplankton exhibited clear diel variation in distribution with higher abundance during night. Among the thirty-zooplankton taxa observed, Copepoda formed the dominant taxa. Of the total 70 copepod species observed during the study eight species are new records ...
Jie Zhang1,2,*, Baradi Waryani3,4 and Qihai Zhou2,*
...ahkeii is an endemic species in East Asia. It has a wide range of distribution in Chinese waters including coastal waters, inland lakes, and outflowing rivers south of the Yangtze River and its delta. In order to maintain stable high production of salangids, fertilized eggs from native or introduced populations of icefish were frequently introduced to various types of water throughout China mainland except for Tibet Plantae. The genetic diversity and ...
Jing Hu1,2, Yan Liu2,3, Gang Yu1,2, Changping Yang2,3, Binbin Shan2,3, Shengnan Liu2,4 and Dianrong Sun2,3,*
...i and other relative species.
...
Jingchen Chen, Zhaochao Deng and Zhiqiang Han*
...to other Perciformes species. Our results clearly demonstrate that the high-throughput sequencing method is the methodology of choice for generating complete mtDNA genome sequences.
...
Lusha Liu1,*, Lei Cheng2, Xingqi Zhang3, Yulong Li1 and Jianping Jiang1,*
...tly very limited in this species and the genus Microhyla. A total of 17,339 potential microsatellites were identified in 15,385 unigenes which were generated by Illumina paired-end sequencing in M. fissipes. Within all microsatellites, AG/CT, AAG/CTT, and AAAG/CTTT are most prevalent motif in each repeat class. We randomly selected 61 unigenes with the microsatellite to design primers and do genetic analysis in the Sichuan basin population of ...

Yasir Ali1,2*, Bashir Ahmad1, Naqeebullah Jogezai3 and Adil Hussain

.... which makes it a novel species. Both of the strains were non-pathogenic and potentially industrial strains for the production of thermolabile protease and alkaliphilic lipase 

...

Usman Zubair1*, Anjum Shehzad2, Muhammad Ishaque Mastoi3 and Khalid Mahmood1 

...on records presented for species of fruit flies from Poonch Division of Azad Jammu and Kashmir. Taxonomic issues with specimen are discussed. The specimens were collected from seven localities including Rawalakot, Banbake, Jandali, Pakhar, Kakuta, Mandhol and Bagh (Harighel) using McPhail traps during the years 2016-2017. Specimens were identified up-to species level using taxonomic key by Mahmood and Hassan (2005) and picto...
Wen-Feng Li1, Rong-Yue Zhang1, Chun-Hua Pu2, Jiong Yin1, Zhi-Ming Luo1, Xiao-Yan Wang1, Xiao-Yan Cang1, Hong-Li Shan1 and Ying-Kun Huang1,*
... predators. The dominant species include Apanteles flavipes (Cameron), Sturmiopsis inferens Townsend and Trichogramma sp., which parasitize the sugarcane borer; Synonycha grandis (Thunberg), Lemnia biplagiata (Swartz), Cheilomenes sexmaculata (Fabricius) and Thiallela sp., which prey on Ceratovacuna lanigera Zehntner; and Euborellia pallipes Shiraki, Orius (Heterorius) minutus ...
Nazia Qamar* and Sher Khan Panhwar
...Sagitta otoliths of five species Scomberoides commersonnianus (414), S. lysan (15), S. tala (8), S. tol (344) and Megalaspis cordyla (277) were collected from the commercial catches from July 2013 to March 2015. Fish length and otolith length for five species recorded as S. commersonnianus TLcm = 16.3−88.4, OLcm = 0.3−0.9; S. lysan TL=23.2&min...
Naheed Ikram and Nafisa Shoaib*
...ave isolated 5 different species of fungi Aspergillus niger, Aspergillus flavus, Rhizopus stolonifer, Penicillium sp. and Fusarium sp. from 14 different genera of commercially important marine fishes Acanthopagrus sp. Parastromateus niger, Nemipterus sp., Pampus argenteusIlisha sp., Alepes djedabaEpinephelus sp., Teraponjarbua, Terapon puta, Scomberomorus koreanus<...
Aly Khan1,*, Khalil A. Khanzada1 and S. Shahid Shaukat2
...ne locality. Most common species in maize fields was found to be Pratylenchus zeae that occurred in 5 out of eight localities, one-way of variance was performed for those nematodes that occurred in two or more localities. With one exception, the density differed significantly among the localities.
...
Hui Wang1, Lin Wang1, Xuanlu Li1, Shanshan Li1, Yongqiang Zhao2, Shicheng Lv2, Xinrong Xu1, Guang Yang1 and Bingyao Chen1,*
...s a result, 34 protected species among the 4975 individuals were sighted, including 127 red-crowned cranes (Grus japonensis) and 868 common cranes (Grus grus). The overall density of protected species, winter migratory species, and resident birds was 1244.60 individuals/km2, 396.88 individuals/km2 and 758.94 individuals/km2 respectively. The w...
Raja Imran Hussain* and Iqra Yousaf
...i> was the most abundant species. High adjusted trapping success in cropland and low in human dwellings were observed during the spring season. Trapping influenced by 4.63% decrease in wheat damage. Non-agricultural land and human dwellings provide good shelter and food resources for rodent dispersal. Controlling one habitat of the landscape, either human dwellings or cropland, might not allow effective results because rodents still have alternative habitat fo...

Asad Ali Khaskheli1*, Gulfam Ali Mughal1, Gul Bahar Khaskheli2, Allah Jurio Khaskheli3, Arshad Ali Khaskheli4, Abdul Samad Magsi5, Ghulam Shabir Barham2, Arab Khan Lund5 and Maqbool Ahmed Jamali4 

Nida Zia1, *, Ayesha Maqbool2, Muhammad Safdar3, Umm-I-Habiba1, Altaf Mehmood4, Muhammad Usman5, Zahid Iqbal6, Javed Iqbal6, Shahid Mehmood6, Amanullah Khan7 and Sajid Umar8
... belonged to the FAdV- C species and serotyped as FAdV-4 and showed close proximity at the nucleotide level. The other cluster containing three strains belonged to the FAdV-D species and serotyped as FAdV-11. Furthermore, the sequencing analysis of detected field strains revealed the high similarity and close clustering with FAdV-4 and FAdV-11 strains isolated from neighboring countries, suggesting geographic and temporal re...
Emre Barlas1 and Elif Yamaç2,*
...of the cave-dwelling bat species are under threat, because of destruction of caves such as filling or converting for other uses, human disturbance and loss of foraging habitats. In this study, cave-dwelling bat species and habitat preferences were investigated in Northwest of Central Anatolia in spring, summer and winter. Investigations were performed in 26 caves hosting (15) and not hosting (11) bats. Temperature, humidity,...

Muhammad Usman Ghazanfar, Muhammad Imran Hamid, Mubashar Raza, Waqas Raza*, Misbah Iqbal Qamar 

... type of soils and their species promote growth of the plants and commercially used as bio-fungicide against soil borne plant pathogens. The present study was conducted with the aim to determine the efficacy of Trichoderma species using dual culture and pot assays against Phytophthora infestans (late blight) and Fusarium oxysporum (wilt) of tomato on different compost including carbon rich compost, nitrogen rich compost and ...
Qiuxia Lei1, 2, Haixia Han1, 2, Jinbo Gao1, 2, Yan Zhou1, 2, Wei Liu1, 2, Chunlei Wang3, Jie Liu1, 2, Dingguo Cao1, 2, Huimin Li1 , Baohua Huang1,* and Fuwei Li1, 2, *  
...teria comprising several species; and the third kept as the control without adding any bacteria. The results showed that decomposition started earlier in the treated batches than in the control group. During the fermentation period, there was no influence between the internal temperature of the plies and the addition of bacteria. After adding strains, the time to reach the fermentation temperature was advanced by 1 to 2 days. The content of ammonia and hydroge...

Muhammad Amin1,2*, Khalid Mahmood2 and Imran Bodlah3 

...kistan, yielded 24 aphid species in 14 genera, representing subfamilies, Aphidinae, Lachninae, Calaphidinae, Hormaphidinae and Chaitophorinae, infesting 28 tree species in 22 genera, 17 families and 12 orders. Genera Aphis, Cinara and Myzus had 7, 3 and 2 species, respectively. Hoplochaitophorus quercicola (Monell, 1879) and Pterocomma beulahense (Cockerell, 1904) are new records for Paki...
Hafiza Mehwish Iqbal1, Shahid Yousaf1, Salman Khurshid1*, Qurrat Ul Ain Akbar1, Saqib Arif1, Nasreen Fatima2 and Ali Murad Rahoo3
...achi. Some of the fungal species viz. Aspergillus niger, Aspergillus flavus, Fusarium oxysporum, Rhizopus stolonifer and Alternaria alternata have been identified in citrus samples. However, major incidence was recorded for Aspergillus niger (41.6%) followed by Fusarium oxysporum (27.7%). Infected samples (5.9) had high pH as compared to the healthy samples (3.1). Total soluble solids were decreased from 14 to 8.5% due to fungal inf...
Tahir Iqbal1, Umer Rashid1*, Naveed Shahzad2, Amber Afroz1Muhammad Faheem Malik3 and Muhammad Idrees4

 

...hohepevirus B species. However, Pak aHEV strains were highly divergent from other known members within Orthohepevirus B suggesting as novel aHEV strains circulating in the population of layer chickens in the country. Detection of HEV in layer chickens may pose public health risk in context of zoonosis and food borne transmission if aHEV emerges as zoonotic HEV. 
...
Maliha Ayub1, Muhammad Javed1, Fariha Latif 1*, Faiza Ambreen2, Komal Sabir1
...inst the reactive oxygen species (ROS) and their harmful effects. This study was aimed to evaluate the effects of sub-lethal concentrations of manganese on antioxidant activity in the fish, Labeo rohita. Fish were acclimatized for two weeks in the cemented tanks prior to the start of experiment. Four groups (n=10) of one year old fingerlings of Labeo rohita were exposed to 96-hr LC50 and sub-lethal concentrations (2/3rd,1/4<...

Muhammad Ishaque Mastoi1*, Ibtasam Riaz2, Syed Muneeb Haider2, Arfan Ahmed Gilal3, Anjum Shehzad4, Ahmed Zia4 and Abdul Rauf Bhatti4
 

...ults confirmed that both species of coccinellid showed feeding potential against eggs and nymphs of P. minor. Comparatively, M. sexmaculata showed higher feeding than C. septempunctata on various immature stages of M. minor. Moreover, both the species showed relatively more preference on eggs of P. minor than nymphs. Therefore, both the species can be exploited in field conditions against ...
Fiza Asif1,*, Muhammad Siddique Awan1, Nasra Ashraf1, Nuzhat Shafi1, Abdul Rauf1, Khizra Bano1, Muhammad Razzaq2 and Naeem Iftikhar Dar2
...que. A total of 23 plant species were observed during summer and 15 plant species during winter season. During both the seasons Indian or Himalayan Chestnut Aesculus indica was found as the dominant plant species in the diet having relative importance value (RIV) 8.36 and 10.92 in summer and winter, respectively. Diet breadth of all the plant species<...

Muhammad Zeeshan Manzoor1*, Ghulam Sarwar1, Mukkram Ali Tahir1, Noor-Us-Sabah1, Ayesha Zafar1 and Sher Muhammad2 

... root medium, while each species has a critical threshold value where it was started showing negative response. Leaching fractions may help keeping salt concentration low in the root zone when irrigation water is saline. In this experiment three types of water (canal, EC = 2 and 3 dS m-1) were used as such and with leaching fraction of 10 and 20 %. This experiment was conducted in the field and RCBD design was used to make its layout. All the treatments were r...
Huaisheng Zhang1, Pengfei Li2, Huajun Wen2, Guangming Tian1, Hui Chen1, Lu Zhang1 and Jianqiang Zhu1,*
...nus). It is a unique species in China, which has been extinct in China for nearly 200 years. In 1980, the Milu was reintroduced into China and has now become a first-class protected animal in the country. Moreover, research on the Milu has begun. After 30 years of breeding and development, the Milu population has formed stable captive or wild populations in Beijing, Dafeng, Shishou and Dongting Lake. It has become a typical example of the successful reintr...
Mumtaz Ali Khan1,*, Sher Bahadar Khan2, Shakoor Ahmad2, Irshad Ahmad3, Ikramul Haq4, Kashif Prince1, Asad Ullah5, Muhammad Shoaib2, Shahid Zaman6, Amjad Islam Aqib7, Ghazunfar Rashid1, Mahboob Ali1, Imdad Ullah Khan4,Imad Khan5, Naimat Ullah4 and Muhammad Shahid8
... rabbits and goats. Each species was divided randomly into three equal (n=6) groups. Group A was supplemented vitamin E and group B was without vitamin E supplementation in both species. Animals of both groups were vaccinated with enterotoxaemia vaccine. Group C was kept as negative control in both rabbits and goats. The immune titer against C. perfringens type D was evaluated on 0, 7, 14, 28th and 60t...
Yacheng Hu1,2, Xueqing Liu1,2, Jing Yang1,2, Kan Xiao1,2, Binzhong Wang1,2 and Hejun Du1,2,*
...we report 17 novel cross-species microsatellite markers for Dabry’s sturgeon via next-generation sequencing from Chinese sturgeon (Acipenser sinensis). The 17 microsatellites were polymorphic with 3 to 6 alleles per locus and the total number of alleles is 80. The mean expected heterozygosity (HE, 0.506 to 0.781), observed heterozygosity (HO, 0.542 to 1), Hardy-Weinberg departure value (d, -0.042 to 0.427...
Uzma Rafi*, Asmat, Muqaddes Niaz, Syeda Shazia Bokhari and Aisha Waheed Qurashi*
...div>Many  bacterial species are harbored by cockroaches on the external and internal surfaces. These harbored species have great public health concern. There is a variable tendency of these microbes to adhere to various abiotic and biotic surfaces showing chances of infection. Present study aims to check biofilm formation and auto aggregation potential of the bacteria associated with cockroaches. For this purpose, cockr...
Irfan Irshad1, Asim Aslam1,*, Muhammad Yasin Tipu1, Kamran Ashraf2, Beenish Zahid3 and Abdul Wajid4
...ry and non-poultry avian species. In this study, five AAvV-1s have been pathotyped and genetically characterized from vaccinated birds collected between 2013-14. A phylogenetic analysis revealed that all the isolates belonged to sub-genotype VIIi with high similarity of 97.9 to 99.8% with similar viruses in this clade. Analysis of the hemagglutinin (HA) gene sequences of the two AIV was performed and phylogenetic analysis reveals genetically closely-related to...
Min Li1,2, Jingjing Wang3, Suxian Hu3, Philip Stott4, Baoqing Lin5, Lianshan Li5, Hui Liu1, Heng Bao1, Duoying Cui6 and Guangshun Jiang1,* 
...ked cover types to avian species richness, evenness, and Shannon’s diversity using a stepwise linear regression model and regressions of proportions of cover types at different spatial scales. We recorded 109,026 sightings comprising 94 species, and found that avian diversity indices were positively influenced by the presence of open water, farmland, and alkaline marsh, and negatively by human settlement; and in additi...
Shanshan Cai1, Tianxiang Gao2, Binlun Yan3, Aiyi Zhu1 and Xiumei Zhang1,2,*
...a commercially important species in Chinese fishery industry. However the natural resources of swimming crabs are declining and enhancement programs are being conducted for resources restoration for decades. In this study, 524 female broodstock from 10 hatcheries and 547 recaptured crabs from 6 investigations were used to assess the proportion of released individuals and evaluate the effect of the program in Shandong Province in 2014. Parentage determination b...
Muhammad Waseem1, Ahmed Raza1, Hamera Aisha1, Muhammad Naeem Awan1, Tariq Ahmad2, Rabia Nazir2 and Tariq Mahmood2,*
...the rampant trade of the species, and has been listed as endangered since 2014 and also included in Appendix-I of CITES. The IUCN estimates indicate a decrease of ≥ 50% in the global Indian pangolin population over the next 21 years, highlighting the need for protecting the species against illegal trade. In the current study, we investigated the scale of its poaching and illegal trade in the country. Results revealed that...
Sabbah M. Allam, T.M. El-Bedawy, M.H. Bakr and A.E.M. Mahmoud*
...i> and Salmonella species, and on antioxidant biomarkers.
...
Rais Ahmed1,2,*, Muhammad Khalid Mansoor1,2, Iftikhar Hussain1, Muhammad Saqib3, Muhammad Hammad Hussain4, Amjad Islam Aqib5, Haleema Sadia6, Javed Muhammad7, Asma Irshad8, Kashif Prince5, Muhammad Zain Saleem9 and Abdul Whab Manzoor10
...r finding association of species, gender, body weight, age and body condition score (BCS) with prevalence of antibodies against MAP. Seropositivity against MAP was significantly (P<0.05) detected. Male and female animals were equally susceptible to the disease (OR: 0.908, 95% CI= 0.6111-1.350). Age groups were not found associated with chances of being seropositive. Seropositivity was significantly (P<0.05) higher in animals under 300kg body weight. Chan...
Muhammad Raza Khan1, Tariq Mahmood1,*, Hira Fatima1, Faraz Akrim2, Shaista Andleeb1 and Abdul Hamid1
...n, is one of the largest species of Canid family; it occurs in various parts of the country including upper Swat area. Reportedly, species population is declining in its range, however, data on its ecological aspects are scanty in the country. In the current study, we investigated distribution and diet of grey wolf and the level of its human conflict in Mahoodand valley of Swat District. Results revealed the occurrence of gr...
Mubasshir Sohail1,2,*, Raza Muhammad1 and Qadeer Ahmed Soomro1
...realella. Both aphid species were significantly good in performance when fed to C. carnea larvae with S. cerealella eggs than their solo effect. Results depicted that mortality factor and life parameters of C. carnea larvae are influenced by its prey type which they fed on. These results of the study could be used to improve the rearing and conservation strategies to increase C. carnea population and their predatory activities.<...

Faleye Temitope Oluwasegun Cephas1,2*, Adewumi Moses Olubusuyi1, Olayinka Olaitan Titilola3 and Adeniji Johnson Adekunle1,3 

Himanshu Mishra, Vikas Kumar and Ashish Kumar*
...o March 2018. Thirty two species of birds were observed during the field investigation. The line transect method was employed for population estimates. During the field survey, we recorded a significantly higher number of migratory birds at the end of early winter (December) and at the commencement of middle winter (January). Red crested pochard (Netta rufina), Common coot (Fulica atra) and Gadwall (Mareca strepera) were the most populated...
Muhammad Khaled Siddiq1, Fatima Yousuf Dar1,M. Akbar Khan1, Muhammad Adeeb Babar1,*, Sayyed Ghyour Abbas1, Asra Ghaus1, Musdassir Iqbal1 and Muhammad Akhtar2
...igraphic position of the species. Sivatragus bohlini, previouslyrecovered from the Upper Siwaliks, and difficult to date. Moreover, antelopes are documented for the first time from this locality. 
...
Tasleem Akhtar1,2,Ghazanfar Ali1,*, Nuzhat Shafi2 and Abdul Rauf2
...oracinae containing four species distributed in the north and north-east Himalayas was investigated based on the complete mitochondrial 16S rRNA gene sequences. The average nucleotide length of 16S rRNA in 45 samples ranged from 1527 to 1552 bps. Five haplotypes (h) were observed, with haplotype diversity (Hd) 0.5323±0.080. Among 5 haplotypes, 2, 2 and 1 haplotype were detected in S. plagiostomus, S. niger and S. esocinus, respectively. Ha...
Zahra Eftekhar1, Morteza Naderi2,*, Mohammad Kaboli3, Hamid R. Rezaei4 and Nematollah Khorasani3
... of patterns of arboreal species adaptation to the glacial oscillations. Ancient Hyrcanian forests, as one of the old-growth relicts of the temperate deciduous forests, have been recently documented as an important refugium during the last glacial maximum (LGM). More investigations based on skull and mandible morphological assessments revealed considerable intraspecific evolutionary divergence among the local populations settled in the Hyrcanian forests of nor...

Ahmed Zia1*, Iqtidar Hussain2, Sardar Azhar Mehmood2, Shabir Ahmad2, Muzaffar Shah3 and Abdul Rauf Bhatti1 

... richness, abundance and species complex of Odonata. It revealed four families, fifteen genera and twenty-six species. Among recorded fauna, family Libellulidae appeared to be a dominant group representing 19 species, followed by family Coenagrionidae with 5 species and family Calopterygoidae and Aeshnidae representing single spe...
Sajida Sabahat1, Asif Nadeem1,*, Maryam Javed1, Muhammad Yasir Zahoor1, Abu Saeed Hashmi1, Ghulam Yasein2 and Ghulam Abbas1 
...conserved region amongst species. IGF-1 have not been studied before in camel. The DNA samples of Marecha camel were collected from the Camel Breeding and Research Station at Rakhmani Bhakkar, Pakistan. Four polymorphic sites were detected in the IGF-1 gene. A significant finding was the occurrence of a T→C polymorphism in exon 5 that causes a substitution of an amino acid from Cysteine to Arginine.That Cys/Arg polymorphism may serve as authoritati...

Muneer Abbas1*, Muhammad Ramzan1, Niaz Hussain1, Abdul Ghaffar1, Khalid Hussain1, Sohail Abbas2 and Ali Raza3 

... made with >26 insect species including 4 species of bio control agents. Helicoverpa armigera, Spodoptera litura, Agrotis Sp., Bemesia tabaci and Microtermes Spp. were major pests of gram and mungbean attracted in light traps. May, June and July were hottest months of the year with highest population captures of 2892, 2789 and 2475, respectively. Temperature had significant impact of 80.7 % on per unit population attracti...

Mazhar Habib1, Aamir Saleem1, Arshad Mahmood Malik2*, Sarfraz Ahmed3 and Sameera Arshad4 

... advanced plant maturity species, its herbage yield increased (P<0.05). However, phonologically, proportion of its plants with vegetative stage declined. This decline of plants with vegetative stage can cause distraction to livestock depending on the species for grazing purposes. It is suggested that two month clipping stage should be applied on Blue panic grass to get sustained grass vigor and optimum herbage yield. ...

Ahmed Zia* 

..., potentially threatened species whose habitat and ecology was never known. To date, there is no information available for its male and immature stages. It is second species for the genus to be recorded from Pakistan. Distributional details along with important taxonomic characters and habitat information is discussed in detail to facilitate readers of this document. A key to the known species...
Hanif Ullah1, Muhammad Inayat Ullah Khan2, Suleman3, Sawar Khan1,Salma Javed4, Abdul Qadeer1, Mohsin Nawaz1, Sardar Azhar Mehmood4
...alciparum are common species. The current study was designed to investigate the prevalence of malaria infection in District Lower Dir Pakistan. A total of 1750 blood samples were collected from seven tehsils of District Lower Dir (January to December 2013). The data were analysed tehsils wise, month wise, gender wise, age wise and species wise. Thick and thin smear were prepared and examined under microscope. The data wa...

Khaled Kaboudi* 

...t was isolated from many species of domestic and wild birds. Infection in commercial poultry flocks causes important economic losses, related to high mortality, decrease in animal performance and aggravation of infection by other pathogens. Although H9N2 is endemic in many regions of the world, such as Middle East and North Africa, where the first outbreaks were described since the end of 1990s, many features about epidemiology and genetic characteristics are ...

Shwe Yee Win1, Lat Lat Htun1, Myint Myint Hmoon1, Hla Myet Chel1, Yu Nandi Thaw1, Nyein Chan Soe1, Htet Lin Oo3 and Saw Bawm2* 

...was 60.5% (121/200). Six species of gastrointestinal parasites were observed as Capillaria spp. (30.0%, 60/200), Ascaridia galli (24%, 48/200), Eimeria spp. (20.5%, 41/200), Raillietina spp. (17%, 34/200), Strongyloides spp. (2.5%, 5/200) and Subulura brumpti (2.0%, 4/200). Mixed infection rate was 54.5% while single infection rate was observed as 45.5%. The highest occurrence of gastrointestinal parasites (66.0%) was observed in Nyaung U Township followed by ...
Hafiz Muhammad Arsalan1, Maria Altaf1, Zeemal Seemab Amin1, Muhammad Khalil Ahmad Khan2, Anum Shahzadi1, Hina Mudasser1, Iqra Maqsood1, Nazia Gulshan1, Saira Naseem3
...ation of reactive oxygen species can disturb the body’s defense mechanism which cause potential oxidative injury to tissues and lead to cartilage degradation in RA patients.
...
Nadia Saeed1, Mian Sayed Khan2, Habib Ahmad3, Muzafar Shah4*
...us avenae, Tylenchus species, Pratylenchus species, Psilenchus species, Meloidogyne species and Trichodorus species. Carbofuran (inorganic) and poultry manure (organic) in recommended amounts were used for management and results showed that both were effective against phytonematodes. Val...
Abu ul Hassan Faiz1,*, Fakhar-i-Abbas2, Mehboob ul Hassan3 and Lariab Zahra Faiz1
...ermine abundance of each species. The study, documented 10 species of mammalian pests, 13 species of pest birds of maize crop and their population density differed significantly (P≤ 0.05) at study sites. The habitat analysis of study sites and correlation of species with habitat were done through Principal Component Analysis (PCA) by using software (X...
Muhammad Shoaib1,3*, Arif Ismiyev2,Khudaverdi Ganbarov3, Aygun Israyilova3 and Sajid Umar4
...rmined against bacterial species by using resazurin microplate assay. All the tested compounds exhibited variable antimicrobial properties against various test cultures. All the compounds showed stronger antimicrobial activity against Gram-negative bacteria as compared to Gram-positive bacteria and fungi. Compound III was found to be the most effective compound. These results demonstrate the potential antimicrobial properties of mono and spiro cyclohexa...
Shahid Sherzada1,2,4,*, Muhammad Naeem Khan4, Masroor Ellahi Babar2, Muhammad Idrees3, Abdul Wajid2, Muhammad Nauman Sharif3, Muhammad Shahzad Iqbal3, Iram Amin3 and Muhammad Shahid3
...amily, Indian major carp species (Labeo rohita, Cirrhinus mrigala, Catla catla)are very suitable fish species for culture in Pakistan. However, the identification and phylogeny of these fish species are of much interest today. DNA barcoding is used as a bio-identification tool for the organism globally. The current study was also conducted for the fast and accurate identification of...
Peng Chen1,2, Zuhao Huang3,Chaoying Zhu1, Yuqing Han1, Zhifeng Xu1
Guanglong Sun1, Zhen Zhang1, Dongqin Zhao4, Gang Ge1 and Luzhang Ruan1*
...t; C > T > G in 73 species complete mitochondrial sequences in Gruiformes and Charadriiformes. The total AT content in the 73 species was larger than that of GC. The start codons in protein-coding genes (PCGs) included ATG, GTG, ATT, ATC and ATA, while its stop codons included TAA, TAG, AGG, AGA and the incomplete cipher T. In PCGs, the highest frequency of codon was CTA (Leu). The highest frequency of amino acids was ...
Javeria Zafar1, Asif Nadeem1*, Maryam Javed1, Fehmeeda Fatima1, Wasim Shehzad1, Ghulam Abbas1, Rajput Zahid Iqbal2 and Muhammad Muddassir Ali1
...ionship with other capra species. Blood samples were collected from Kirthar National Park, Sindh, Pakistan. PCR product was sequenced bi-directionally using dideoxy chain termination method after mitochondrial ATPase8/6 genes amplification. Polymorphism, Genetic diversity and Phylogenetic analysis were carried out by the MUSCLE, DnaSP and MEGA6 tools. Total of 20 variations at different positions were found in aligned sequence results. Sequence conserva...
Rana Manzoor Ahmad1,2, Abdul Majid Khan2*, Ayesha Iqbal2, Amtur Rafeh2, Muhammad Tahir Waseem2 and Muhammad Ameen2
...extinct Siwalik tragulid species including; Dorcabune anthracotherioides, Dorcatherium majus and Dorcatherium minus. To assess habitat stability for the Neogene tragulids, dental remains from the middle Miocene-early Pliocene, ca. 13.5-4.0 Ma outcrops of the Siwalik of Pakistan were analyzed for the occurrence of linear enamel hypoplasia. According to our results there was a lower occurrence of enamel hypoplasia (13%) in the tragulid fossi...
Qamar Zeb1*, Silvia I. Rondon2, Hayat Badshah,1 and Arsalan Khan1
...re the predominant aphid species (Homoptera: Aphididae). Two species of parasitoids Aphidius ervi L. and Aphidius colemani Viereck were recorded. Coccinella septempunctata L. (Coleoptera: Coccinellidae), Chryoperla carnea Stephens (Neuroptera: Chrysomelidae), and several species of Hover flies (Diptera: Syrphidae) were the most common predators. In general, aphi...
Zübeyde Kumbıçak1,* and Hatice Poyraz2
...The two Drassodes species had karyotypes comprising 10 pairs of autosomes plus sex chromosomes which were X1X20 (♂) type. All chromosomes including sex chromosomes were telocentric and relative lengths of autosomal pairs were decreased gradually in size. All male meiosis was chiasmate and during the first meiotic division stages, 10 autosomal bivalents and generally one chiasma per bivalent (rarely two chiasmata) were obtained, t...

Hafiz Abdullah Shakir1*, Javed Iqbal Qazi2, Abdul Shakoor Chaudhry2, Muhammad Irfan3, Muhammad Khan1, Shaukat Ali4 and Saima Shahzad Mirza5 

...ens, comprised of 3 fish species (Catla catla (thaila), Labeo rohita (rohu) and Cirrhinus mrigala (mori)) from river Ravi during two flow seasons at four sampling locations including upstream Lahore Siphon = A, Shahdera = B, Sunder=C and downstream Balloki headworks = D. All the metal contents in fish scales were highly significantly different (P<0.001) among sampling locations and flow seasons. Location-wise metal accumulation pattern was C > D > B &...
Asima Rani1,*, Syed Kashif Nawaz2 and Muhammad Arshad3
...on the Plasmodium species responsible for the infection. Allele specific PCR was employed for the amplification of rs8177400 polymorphism. Results of genotyping were confirmed via PCR-RFLP strategy. Presence of GG genotype decreases the susceptibility of malaria (OR: 0.544, CI: 0.331 to 0.894, p=0.053), mild malaria (OR: 0.472, CI: 0.274 to 0.815, p=0.024) and P. vivax infection (OR: 0.362, CI: 0.211 to 0.622, p=0.000). AG heterozygosity increase...
Hazrat Ali1,2,*, Ezzat Khan1,* and Muhammad Jamal Nasir3
...ments and different fish species of River Shah Alam, a tributary of River Kabul in Khyber Pakhtunkhwa, Pakistan. The different environmental samples were collected from the river, downstream the city of Peshawar, and analyzed for the selected heavy metals by atomic absorption spectrophotometry. Heavy metal accumulation was studied in muscles of six fish species collected from the river. Heavy metal accumulation was also stud...
Ammara Blouch1, Ata ul Mohsin2, Muhammad Naeem2 and Rashid Mahmood1*
...Dipel with Bt sub speciess kurstaki and Turex with Bt sub speciess kurstaki and aizawai were tested against three early larval instars of S. litura under laboratory conditions using leaf dip method. Mortality was recorded after three and seven days of exposure. The results indicated that larval mortality increased with time and Turex (Bt sub spe...
Chiping Kong1,2, Yongheng Wu1,2, Shangling Lou1, Benping Chen3, Simon D. Dowell4 and Yiqiang Fu1*
...search of this secretive species.
...
Huanxin Zhang1,2, Hongshuo Tang3, Jun Chen1, Yu Zang1,2, Xuexi Tang1,2,* and Ying Wang1,2,*
...on the evolution in many species, but the evolutionary characteristics of African hunting dog TLR genes are scared. The available genome sequence of African hunting dog offers us the way to examine the innate immunity of this endangered carnivore. 10 TLR genes (TLR1-10) were initially identified from the African hunting dog and lesser panda. The results showed that most of the TLR genes were very conservative in the African hunting dog. We found 6 of ten TLR g...
Erum Iqbal*, Nasir Mehmood, Nasira Kazi and Shahina Fayyaz
...plant parasitic nematode species viz., Paratylenchus manilkarii n. sp., P. sindhicus n. sp.,and Pratylenchus kralli Ryss, 1982 as a new record species. P. manilkarii n. sp., is characterized by the lateral field with four incisures; stylet 28-29 µm long; vulval lips protruding with vulval flap; lip region rounded or truncated without submedian lobes, tail ventrally curved with pointed or acu...
Romaan Hayat Khattak1,3, Hussain Ali1, Ejaz Ur Rehman1 and 
Muhammad Ali Nawaz1, 2*
...
Blue sheep is a key species and found in Tibetan Plateau and the bordering massif through Central Asia. In Pakistan the distribution range of species is restricted to higher altitude areas of Northern Areas including Khunjerab and Shimshal. The present study was conducted from 25 September 2014 to 23 October 2014, to estimate the population size of blue sheep in Shimshal and Socterabad Community Controlled Hunting Areas...
Hafrijal Syandri1*, Ainul Mardiah2, Azrita3 and Netti Aryani4

 

...estication in 2018. This species is freshwater fish native in Indonesia and has a high price in the markets. This study investigated the effect of stocking density on growth performance, body carcass composition and biometric indices of juvenile gurami sago in the synthetic sheet pond. Fish were stocked at densities of 10, 15 and 20 fish/m3 in synthetic sheet pond with three replicate. Fish were fed with commercial feed containing 29% crude protein...
Nurlybay Kazhgaliyev1*, Talgat Kulmagambetov2, Dulat Ibrayev1, Saule Bostanova1 and Zhanat Titanov1
...s among different animal species.We describe here the rationale and economics of adaptation of Aberdeen Angus and Hereford beef-producing animals brought from Canada and the Netherlands to Northern Kazakhstan. In order to investigate common zootechnic methods, daughters of imported Aberdeen Angus and Hereford cows were grouped at the age of 18-19 months with a live weight of no less than 350 kg. Groups were constituted using the analogue-pairs method and consi...
Abdul Samad1, Raheela Asmat2, Muhammad Naeem1, Hamida Ali3, Mohammad Zahid Mustafa1, Ferhat Abbas1, Jannat Raza1,3 and Muhammad Tauseef Asmat1*

 

...o identify the prevalent species and genes associated with virulence. Only 10 (1.25%) samples were found contaminated with Listeria monocytogenes. Milk samples were the most contaminated as 4 samples collected from retail shops or dairy farm were found positive for Listeria. While 2 samples of each beef, chicken meat and salad were contaminated with Listeria. The virulent genes inlA, inlB, prfA, hlyA, ...
Jun Zhang, Kui Zhang, Zuozhi Chen*, Yane Jiang, Yancong Cai, Yuyan Gong and Wenming Yu
...dominant coral reef fish species in the South China Sea. The specimes were collected by hand-line in the lagoons of five representative coral reefs during June 2013 to September 2018. According to FishBase, this study provides first report on LWR of six studied species and practically available parameters on LWR for three species. The estimated b values ranged between 2.218 (Para...
Haroon1,2, Yu-Feng Meng1, Zahid Khan1, Farzana Perveen2, Muhammad Ather Rafi3, Sayed Waqar Shah4, Xiao-Hong Su1 and Lianxi Xing1,*
...F 31 and D3 0.2) of each species. The Shannon diversity (H’) is high in union council (UC) Koaz Bahram Dheri (H’= 6.05) followed by UC Dhaki (H’= 4.38), while Simpson diversity (1/D) is more significant in UC Koaz Bahram Dheri (1/D= 0.1), and Ghandheri (1/D= 0.14). While the minimum Simpson diversity (1/D) recorded from UC Tangi (1/D= 0.41) and UC Hisara Nehri (1/D= 0.31). The maximum individuals were collected from UC Koaz Bahram Dheri (n=14...
Tong Feng, Zilu Zhang, Minghao Qu, Chan Luo, Laiba Shafique, Qingyou Liu and Kuiqing Cui*
...ved type among different species. The goat MC1R protein has a molecular mass of 34.65 ku, an isoelectric point of 8.70, which is weakly alkaline, and contains seven transmembrane domains typical of cell membrane receptor proteins. Sequencing analysis of the black, brown and white different color MC1R genes of Nubian goats revealed that there are three SNPs in the gene sequence, which are 219, 712 and 1160, respectively. The C/T mutation did not cause amino aci...

Anwar Ali1*, Muhammad Irfan Ashraf2, Saeed Gulzar2 and Muhammad Akmal2

...roxberghii) an important species of subtropical pine ecosystems in the Himalayas. Data was collected through destructive sampling of 32 sample trees growing in subtropical pine forests of Hazara Forest Region, Khyber Pakhtunkhwa (KP), Pakistan. Diameter at Breast Height (DBH) of the selected sample trees ranged from (12-93 cm) and height (H) varied between 9.50-40.10 m. Allometric equation was developed through testing different allometric models. The best fit...

Hamoudi Naoual1, Alloui Nadir2*, Barberis Abdelhak2 and Boudaoud Amine2 

...nd areas, migratory bird species, known to carry the AIV. The Anatidae population peaked in January 2017 with a total of 8064 birds. The 6 frequent species observed are: Mallard (Anas platyrhynchos), Eurasian teal (Anas crecca), Gadwall (Anas strepera), Eurasian wigeon (Anas penelope) and Common shelduck (Tadorna tadorna). Our observations confirm the diversity of migratory bird species, p...
Muhammad Asif Gondal, Qazal Waheed, Sana Tariq, Waseem Haider, Aisha Khan, Qudsia Rasib and Haroon Ahmed*
...tributes like diversity, species richness and equitability of freshwater gastropods are important due to various reasons like intermediate hosts for many trematodes and bio-indicator. Snails are cosmopolitan in distribution and diversity of habitat to perform ecological performance is abosolute. The freshwater malacological information is sparse within Pakistan specifically in the foothills of Margalla hills. Therefore, the present study was designed to evalua...
Erum Yawar Iqbal1*, Ashfaque Ahmed Nahiyoon1, Shahnaz Dawar2 and Shahina Fayyaz1
...e supernatant of new EPB species Xenorhabdus steinernematis n.sp. strain PAK. CB10 (KU097324) and the other X. indica PAK. S.B.56 (MF521953) resulted in both the highest mortality rate [(94.33±2.05, 100.00±0.00)%] @ 300µl/10ml at 30ºC and the lowest fecundity [(65.00±3.00) eggs/gravid female] in green house condition after 5 days of treatment. Crude cell extract of all bacterialfractions were found to be lea...
Bhandari Jyoti1,2, Yasen Shali3, Zhang Zehua4, Yao Xiaoho5, Deng Jiang3, Zhang Yaling5, Wang Cuiling5, Li Yang5, Lei Xueping5, Wang Wenfeng5, Mohammad Farooque Hassan6 and Li Can1,*
...ear understanding on the species traits is necessary. In this study, the population dynamics, life history and spatial distribution pattern of L. m. tibetensis Chen were explored on meadow and farmland of the Tibetan plateau during 2012. The first objective of this study was to investigate the population dynamic and life history of this pest on their outbreak sites. The second objective was to analyze the spatial distribution pattern of L. m. tibeten...
Ramazan İlgün1*, Nilgün Kuru2, Ferhan Bölükbaş3 and Fatih Mehmet Gür4
... tongue of other poultry species were investigated.
...
Nihat Yeşilayer*
... conducted on three fish species to investigate the relationship between total carotenoid concentration (TCC) and flesh colour, determined by visual and colorimetric methods, of three fish species. Linear relationships were observed between CIELAB colour measurements (lightness-L*, redness-a*, yellowness-b*, hue-H°ab and chroma-Cab), DSM SalmoFan card scores and TCCs. The redness (a*) was mostly correlated with TC...
Nadeem Munawar1,2*, Tariq Mahmood2, Paula Rivadeneira1, Ali Akhter2 and Saqib Mehmood2
...e of habitats for rodent species in agricultural landscapes
...
Ju Zhang1,2, Dong-Sheng Jia3, Shi-Hao Zhao1,2, Xiao-Liang Xie3, Hong Chen4 and Hai-Feng Li4,*

 

...ermining reactive oxygen species (ROS) level, paraquat-stress survival rate, malondialdehyde (MDA) content as well as superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPx) activities.We observed that HGQ exerted little effect on the growth of wild-type N2 nematodes at concentration < 0.6 mg/ml, and 0.05 mg/ml of the HGQ significantly prolonged the lifespan and reduced the lipofuscin level in N2 nematodes. However, the HGQ failed to inf...
Abdurakhim Kuchboev1, Mehmonjon Egamberdiev2, Rokhatoy Karimova1, Oybek Amirov1 and Mitsuhiko Asakawa3,*
... it was confirmed that 2 species of terrestrial snail, X. candacharica and A. gereliana, act as the first intermediate hosts of D. dendriticum, and P. sogdiana snail play a role of intermediate host of Brachylaima sp. in the Fergana Valley, Uzbekistan.
...
Mounir R. Abi-Said1, Mohammad Al Zein2, Mohammad A. Abu Baker3 and Zuhair S. Amr3,4*
...g at least eleven rodent species, unidentified bird(s), at least one scorpion, and other unidentified insects. Prey items were dominated by rodents (91%) which were found in 96.4% of the pellets. Birds, scorpions, and other insects constituted 2.46, 5.91, and 2.96% of the diet, respectively. Rodents contributed the most in terms of biomass, with the black rat, Rattus rattus, and desert jirds dominating the remains. The results suggested that the Desert ...
Muhammad Younis Laghari1,2, Zixia Zhao1, Yiwen Gong3, Punhal Lashari1,2, Shangqi Li1, Jian Xu1 , Ateeque Rahman Khooharo4, Jiongtang Li1,* and Yan Zhang1*
...st important aquaculture species in the world. In China, due to the geographical isolation of Hainan island from the mainland, the genetic diversity in Hainan island is different to that in the mainland. One of fifty sequences isolated from SINE element was polymorphic, including six haplotypes with an average sequence divergence of 11.03% (SE = 0.78%). Four haplotypes (MF177501-MF177504) were shared in these four population. However, two specific haploty...
Amna Shoaib*, Zoia Arshad Awan and Naureen Akhtar
... morphologically similar species that belong to the Aspergillus section Flavi. A. minisclerotigenes and A. flavus were isolated from soybean and okra seeds, respectively. The isolated species were first identified morphologically. ITS1–5.8S–ITS4 primers sequence and amplification of ISSR nucleotide sequences using three primers [P01 (AGAG)4 G, P02 (GTG)5, and P03 ...
Fatima Hashim Abbas1,2* and Alaa Tareq Shakir Al-Hassnawi1
...TAC) and reactive oxygen species (ROS) were measured in the serum of all studied groups. MDA levels were significantly higher (p≤0.05) in aborted women with T. gondii compared to negative control. MDA levels were also significantly higher (p≤0.05) among aborted women with Cytomegalo virus compared to negative and positive control groups. All aborted women had significantly higher levels of TAC levels (p≤0.05) compared to the control groups. How...
Nazia Qamar1,2*, Sher Khan Panhwar2 and Wang Ping1
...cs of high valued shrimp species Exopalaemon styliferus (112), Metapenaeus monoceros (265), Parapenaeopsis stylifera (688) collected from September 2017 to April 2018 by Estuarine Set Bagnet are discussed. High linearity (>0.8) among parameters was estimated by fitting a liner model and a negative allometric growth pattern in E. styliferus, P. stylifera and slight positive growth was calculated for M. monoceros. A m...

Reda Mohamed1, 2 

...irectly according to the species. The right ruminal artery originated either from the splenic, left gastric or celiac arteries. The epiploic branch detached either from the splenic, celiac or right ruminal arteries. The left ruminal artery arose either from the celiac, splenic or left gastric arteries. The reticular artery originated either from the left ruminal, splenic, celiac or left gastric arteries. The left gastric artery originated either from the celia...
Riffat Sultana1, Nuzhat Soomro1,*, Santosh Kumar2, Ahmed Ali Samejo1 and Samiullah Soomro1
...all;">The egg-pods of 04 species viz: Oxya hyla hyla Serville, 1831, O. velox (Fabricius, 1787), O. fuscovittata (Marschall, 1836) of genus Oxya and Oxyina bidentata (Willemse, 1925) of Oxyina were examined under laboratory conditions. Significant differences were found in the sizes and shapes of the pods. Beside this, number of eggs in each egg pod, distribution pattern and weight, length and width of eggs in the pods...
Anila Naz Soomro1*, Hiroshi Suzuki2, Sadaf Tabassum Qureshi3 and Wazir Ali Baloch1
... and its co-existing species C. typus. Entire continuum of stream was divided into five stations (St.1, St. 2, St. 3, St. 4 and St. 5). Monthly sampling was carried out using a scoop net (1 × 1 mm) via the sweep method, sweeping efforts were counted. The results revealed that C. sakishiemnsis was restricted atSt. 1 only, a few juveniles of C. sakishiemnsis were recorded at St. 3, St. 4. The length frequency histograms showed the ...
Daniel Cocan1, Vioara Mireşan1, Florentina Popescu1, Radu Constantinescu1, Aurelia Coroian1, Călin Laţiu1, Romulus Valeriu Flaviu Turcu3, Alexandru Ştefan Fărcăşanu3 and Cristian Martonos2,*
...efence mechanism of this species. The presence, topography and structure of venomous glands made brown bullhead one of the top invasive species spreading its habitat worldwide. The specimens were collected from Stejeriş Lake, Cluj County. MRI investigations were conducted within the National Center for Magnetic Resonance (NCMR), Babeş-Bolyai University, Faculty of Physics. For anatomical investigations, RARE (Rapid Acquisi...
Zhi Yi Jin and Shao Ming Qin*
...oraging habitats of this species include woodlands and farmlands. The largest proportion of woodland in the habitats was 88.70%. Proportion of shoals in foraging habitats at 500-m, 1000-m, 1500-m and 5000-m scales were larger than that in control plots, indicating that the presence of shoals is an important factor determining habitat selection of this bird. At micro-habitat scale, water flow speed (P=0.044), and distance to road (P=0.018) and vil...
Syed Basit Rasheed*, Ahmad Yar, Farrah Zaidi and Qaisar Jamal
...ck method. A total of 19 species representing 11 genera and three subfamilies namely Formicinae, Myrmicinae and Dolichoderinae were identified during the present study. Myrmicinae was the most diverse subfamily with five genera (Crematogaster, Meranoplus, Messor, Monomorium and Pheidole) and 11 species (Crematogaster subnuda, Meranoplus bicolor, Messor instabilis, Monomorium aberrans, Mo. dichroum, Mo. indic...
Jiantong Feng, Xueping Wen, Yahong Guo, Yingying Ye*, Jiji Li and Baoying Guo
...d economically important species in the coastal regions of China. In order to characterize the genetic diversity and population structure of M. lamarckii, a 750 bp region of mitochondrial COIII gene and an 822 bp region of 12S rRNA gene were sequenced and analyzed for 118 and 105 individuals from five populations (ZS, WZ, ZP, ST and ZJ) in the Southeast coastal areas of China, respectively. Results revealed that 33 haplotypes were defined in COIII gene,...
Gulnaz Afzal1, Ghulam Mustafa2*, Shakila Mushtaq3 and Amer Jamil4
...y, we distinguished five species of spiders using their CO1 gene sequences and compared them with 40 earlier published sequences, retrieved from GenBank on the bases of maximum similarity index. The sequences of gene encoding CO1 of all five spider species were deposited in GenBank. Out of five spiders in this study, three species i.e. Leucauge decorata, Oxyopes jav...
Muhammad Waseem, Tariq Mahmood*, Abid Hussain, Abdul Hamid, Faraz Akrim, Shaista Andleeb and Hira Fatima
...p;m above sea level. The species, in many areas of its range, is in conflict with humans, however, data on its population and economic losses are scanty in the country. We investigated its occurrence, population and human conflict in Mansehra District during 2016-2017. A total of 66 indirect signs of Asiatic black bear were recorded with an altitudinal variation of habitat ranging from 1511m to 2570m elevation including 17 dens and 44 scats of the bear from 10...
Yunfang Tian, Zeqin Fu, Jiantong Feng, Yahong Guo, Yingying Ye*, Jiji Li and Baoying Guo
...an important aquaculture species in the coastal regions of China. However, the previous studies of genetic information about M. meretrix were vague. None integrated research to reveal the population genetic and structure of M. meretrix in China from north to south. In this study, we investigated the genetic variation of seven location samples distributing the China coastline from north to south by mitochondrial DNA (COI and Cytb gen...

Amit Sharma1* and Pankaj Sood2 

...vation compared to other species which is mainly attributed to the compositional variation of the sperm plasma membrane. Different factors affect affects the semen cryopreservation viz. species, breed, semen collection technique, collection season, extender composition, type of cryoprotectant used, cooling rate, equilibration time, freezing and thawing rate. All these factors should be given due credit for achieving better ...
Lei Gao1, Gong-xue Jia2, Zheng-yuan Huang1, Ming-xing Yue3, Chao Zhang1, Shi-en Zhu1 and Xiang-wei Fu1,*
...cellular reactive oxygen species (ROS) and glutathione (GSH). DNA DSBs were examined by immunostaining of pi-H2AX, the marker of DNA DSBs. The results showed that the GVBD rates were similar in oocytes of young and aged mice. Polar body extrusion was significantly delayed in aged mice (P < 0.05), however the rate of polar body extrusion was similar to that of young mice at 16 h of IVM. Moreover, PN formation of parthenogenetic embryo was significantly delay...

Hamza Rehman*, Nida Ahmad Khan, Asad Ali, Warda Batool and Kanwal Razzaq 

...categorized as notorious species, an extended standing species around the world and at the same time it is perceived among the world’s 100 most essential intrusive species. Thiamethoxam and imidacloprid are Neonicotinoids with a minute toxicity and they have no teratogenic effects on grains, therefore both are used as cereals protectant against stored grain pests world widely. The re...
Muhammad Rizwan Ashraf1, Asif Nadeem1,2, Eric Nelson Smith3, Maryam Javed1, Utpal Smart3, Tahir Yaqub4, Abu Saeed Hashmi1 and Panupong Thammachoti3
...ous animals with over 40 species of venomous snakes found in Pakistan. One such group of snakes belongs to genus Echis is saw scaled viper (Ehcis carinatus). Molecular techniques have made it easy to elucidate phylogenetic relationships and evolutionary histories of different groups of organisms. This study is the first attempt to find the phylogenetic relationship and diversity through mitochondrial genes in saw-scaled viper from Pakistan. Tail tip bio...
Peimin Yang*, Zongyun Hu, Yixin Liu, Guanghai Jin and Lei Wang
...is a remarkable invasive species in Euroasia, is natively distributed in Northeast Asia and has been recognized as a candidate for aquaculture in northeast China. To investigate the genetic variability and population structure of this species in its native range, we analysed variation in the mitochondrial cytochrome b (Cyt b) for 94 specimens collected from five locations. Sequence analysis showed that there were 50 p...

Hina Maryam1, Muhammad Ather Rafi2, Ahmed Zia1, Ghulam Rasul3, Muhammad Kamal Sheikh3*, Muhammad Qasim4 and Gulnaz Parveen

...gar and Skardu. Total 18 species of 14 genera under seven families of orders Diptera, Hymenoptera and Lepidoptera were identified. Order Diptera was represented by family Syrphidae with four species under three genera. Order Hymenoptera represented four families i.e. Apidae with six species under four genera; Halictidae with two species under two genera;...

Shilong Chen1,2, Shifeng Xiao1,2, Shao Wang1,2, Fengqiang Lin1,2, Xiaoxia Cheng1,2, Xiaoli Zhu1,2, Dandan Jiang1,2, Shaoying Chen1,2* and Fusong Yu3* 

...esis mechanisms of cross-species transmission, retardation and beak atrophy are still needed to be elucidated. 

...
Gong Ga1,2 and SuoLang Sizhu2,*
...bsp;farming of different species of domestic animals are consumed traditionally. In this study, 173 serum samples of Tibetan swine were tested for anti-HEV IgM and IgG antibodies by the ELISA. HEV RNA were measured in feces (n=173), serum (n=173) and tissue ((including liver, spleen, kidney and intestine, n=21) by nested RT-PCR and qRT-PCR. HEV antigens were detected in tissues by immunohistochemistry analysis. Overall, we found that that eight serum samp...
Xuhui Zhang1, Zhiyuan Sun2, Jinfeng Cai1, Guibin Wang1, Zunling Zhu1, Linguo Zhao3 and Fuliang Cao1,*
... hepatic reactive oxygen species (ROS) in FR groups were significantly decreased compared with the control or NF group at 42 d of age. Furthermore, serum total superoxide dismutase (T-SOD) activity of birds from group FR3 was significantly increased (42d) compared with NF group. Additionally, the expression of antioxidant enzyme genes including nuclear factor erythroid 2-related factor 2 (Nrf2), heme oxygenase 1 (HO-1), SOD, and glutathione peroxidase (GP...
Celalettin Gözüaçik1,*, Mustafa Güllü2, Ayda Konuksal3, Reşat Değirmenci3 and Ercan Akerzurumlu3
... Tobias (Braconidae) species from Hymenoptera order were obtained. Bracon stabilis (93.4%) was determined as widespread and in higher level. A. gracilenta was identified for the first time as larval parasitoid of S. temperatella and also for Northern Cyprus and Cyprus Island. The average parasitism rate in cereal fields was 34.8-18.1% in Güzelyurt, 31.8-12.2% in İskele, 21.0-8.4% in Girne, 16.2-5.4% in Lefkoşa and, 9.5-1.8% in G...
Dongping Liu1, Guogang Zhang1, Chao Wang2, Baoping Qing2 and Jun Lu1,*
... considered a monogamous species, and breeding pair is solitary and territorial. However, 3.4% of breeding females exhibited polyandry and 43.1% of nests were observed colonial in single tree in the reintroduced population, probably due to male-biased sex ratio and better nesting conditions. First nest failure in reintroduced population occurred much earlier than that in wild, which resulted in significantly higher probability of re-nesting. The phenotypic pla...

Pushpa1, Nighat Seema Soomro1, Shahla Karim Baloch2, Mehmooda Buriro1, Aijaz Ahmed Soomro1, Muhammad Tahir Khan3, Qamar Uddin Jogi1*, Muhammad Nawaz Kandhro1 and Farheen Deeba Soomro1 

...elopathic effect of weed species on germination and seedling traits of wheat (Triticum aestivum L.). Wheat varieties Amber and TJ83 were subjected to powder of Chenopodium album, Convolvulus arvensis and Avena fatua under three different treatments i.e. 25, 50 and 75g. The effect of these weed powders on seed germination (%), shoot length (cm), root length (cm), shoot fresh weight (g), root fresh weight (g), shoot dry weight (g), root dry weight (g), and seed ...
Mohammad Ejaz1, Salma Javed2, Muhammad Hamza1, Sadia Tabassum2, Muhammad Abubakar3, Irfan Ullah4*
...ferent fungal endophytic species produce various other types of anticancer compounds like camptothecin, podophyllotoxin, torreyanic acid, vincristine, and vinblastine. This review is organized to describe the general study of natural bioactive molecules or secondary metabolites secreted by fungal endophytes as novel sources of anticancer drugs. The main purpose of this review is to organize the effective compound of the fungal endophytes for cancer treatments....

Adewumi Olubusuyi Moses1,2*, Faleye Temitope Oluwasegun Cephas,1,3, Ope-Ewe Oludayo Oluwaseyi1, Ibitoye Ibipeju Henrietta1, Arowosaye Abiola Opeyemi1, Adelowo Oluwatosin Deji1 and Adeniji Johnson Adekunle1,2,4 

Waqas Ahmad Shams1*, Gauhar Rehman1, Khurshaid Khan1, Ibrar Ahmad1, Saima Bibi1, Saif Ul Islam2, Dawood Safi1, Saba Gul Ayaz1
...that there were two crab species yawi and Smalley. These species belong to Allacanthos. They have gonopod with a distal portion of mesio laterally flattened. They have a cephalic sub distal portion which is concave. There is a narrow marginal process with an almost straight distal end and a sharp tip lateral part with an apex. Periodic and corporal aspects inclined the abundance of Allacanthos. The dominant
Mubashar Hussain1*, Misbah Younas1,Muhammad Faheem Malik1, Muhammad Umar1, Maimoona Kanwal1, Moazama Batool2
...d pitfall traps. Sixteen species representing three guilds i.e. Paracoprid (10 species), Endocoprid (4 species) and Telecoprid (02 species) were recorded. Onitis excavatus (27.68 %)and Onitis crassus (9.59 %)showed maximum relative abundance whereas Helocopris bucephalus (0.15 %) and Onthophagus bonasus (0.15 %)were the least ...
Maria Khalid1, Tanveer Hussain1*, Zahid Farooq2, Kamran Abbas1 and Masroor Ellahi Babar1  
...other different reported species as well. The study gave us useful genomic information about genetic diversity in A. chukar and its phylogenetic relationships with related taxa, emphasizing on need of execution of conservation strategies to protect this unique genetic resource of Pakistan.
...
Samia Afzal*,Sadia Zahid, Iram Amin, Muhammad Shahid and Muhammad Idrees
...most prevalent bacterial species in mosquitoe’s midgut. This observation may lead  towards the confusion that the outbreak is either of Dengue or Chikunguna virus. In conclusion, confirmatory molecular characterization of the viral genome remains controversial and further studies are needed in this respect.
...

Asad Ullah1*, Umar Sadique2, Sultan Ayaz1, Muhammad Subhan Qureshi2 and Farhan Anwar Khan

 Muhammad Rafay1,*, Ghafoor Ahmad1, Tahira Ruby2, Muhammad Abdullah3, Fahad Rasheed4, Muhammad Abid1, Sohail Akhtar5, Zulfiqar Ahmad6 and Riaz Hussain7

...bbler on Albizzia species having an average clutch size of 4 eggs. Average peripheral and core diameter, depth of nest was 13, 9 and 7 cm, respectively. Breeding completed in 36 days including incubation, nestling, post nestling and fledgling stages of 13, 5, 4, and 14 days, respectively. Overall predation during these stages was 57%. Adults consumed grains, insects, termites and flies during morning and evening frequently while providing insects, flies...
Saeed Fatima1, Khalid Javed Iqbal1, Usman Atique2,3*, Arshad Javid4, Noor Khan2, Sonia Iqbal2, Hamid Majeed5, Hamda Azmat2, Bakhat Yawar Ali Khan6, Irfan7, Muhammad Tausif Shahid1, Gulnaz Afzal1
...e investigated five fish species are Ctenopharyngodon idella, Oreochromis niloticus, Eutropiichthys vacha, Rita rita and Sperata sarwari. The results divulged the pattern of metals concentration in fish in the order of Cd > As > Hg. However, R. rita, O. niloticus and C. idella showed higher accumulation of the metals that clearly alluded to species-linked metal bi...
Ahmad Osman Mal1 and Mohamed Hosny Gabr1,2,*
...er-exploitation for both species. The current fishing mortality is recommended to be decreased to the target reference point F0.1 = 0.453 year-1 for H. harid and F0.1 = 0.466 year-1 for S. ferrugineus after increasing the age at first capture to be 3 years for both species.
...
Salahud Din1,*, Saima Masood1, Hafsa Zaneb1, Habib ur Rehman2, Saima Ashraf1, Imad Khan3, Muqader Shah4 and Syed Abdul Hadi1
... it possible to identify species specific skull and use clinical measurements during practical application.
...

Muhammad Safdar Hussain1*, Muhammad Farrakh Nawaz2, Muhammad Ayyoub Tanvir2 and Noor-E-Hira

...n in root length of both species was 19% and 9% respectively at 50 % drought. High drought stress (50%) resulted in a reduction of 49% and 38% dry matter in E. camaldulensis and T. aphylla respectively. The relative water contents (RWC) were more (71.5%) in E. Camaldulensis at the control level but significantly reduced (40%) at 50% stress while in T. aphylla less difference (52%-44%) was found in RWC. There was no significant difference found in diameter in b...
Ali Uzun* and Bilgenur Yasa
...grouping behavior of the species (p>0.05). Temperature and security are the primary effective factors for these subjects (p<0.01). Behaviors related to security developed simultaneously and became normal in a short time after threats disappeared. However, persistent temperature, although it varied from time to time, played an important role during the study (p<0.05).
...
Muhammad Asim1, Zaheer Ahmad2, M. Akbar Khan1, M. Adeeb Babar1, Sayyed Ghyour Abbas1,*, Muhammad Khalil Nawaz1, Kiran Aftab3 and Muhammad Akhtar4
...salmontanus. This species is well represented in the Middle Siwaliks but has not been previously reported from the Middle Miocene Chinji Formation of the Lower Siwalik Subgroup. The present evidence of T. cf. salmontanus in the Middle Miocene Chinji Formation of Pakistan extends the time range for the species from the Middle Miocene to the Late Miocene of Pakistan.
...

Riffat Sultana*, Nuzhat Soomro and Muhammad Saeed Wagan

...font-size: small;">A new species Oxya kashmorensis (Oxyinae: Acrididae: Orthoptera) from Kashmore, Sindh, Pakistan is described and illustrated. We provide a comparison of Oxya kashmorensis sp.nov. and O. nitidula which is recorded from Pakistan for the first time. Comparative information on the female genitalia of both species is provided. Further, a note on the ecology and distribution of bot...
Mahvish Rajput1, Abdullah G. Arijo1, Muhammad Bachal Bhutto1Rehana Shahnawaz Buriro2, Javaid Ali Gadahi1, Muhammad Naeem3 and Zubair Ahmed Laghari1*
...orphologically identical species indicating the only species infecting rumen. Further, it was found that the infection was prevalent in all months sampled but the highest infection rate was observed in November (56%) followed by October (38%), September (34%) and was observed lowest in August (22%). While, the infection rate in both sexes varies but the statistically non-significant difference in the prevalence among females...
Murtala Muhammad, Ting Zhang, Siyu Gong, Jing Bai, Jiansong Ju, Baohua Zhao* and Dong Liu*
...fection of cultured fish species is in an alarming trend, due to the possible emergence of antibiotic resistant strains. The bacteria was responsible for the disease outbreak that caused massive mortality of Chinese sturgeon (Acipenser sinensis) in 2016. We isolated the pathogenic bacteria (HNM-1) from the infected A. sinensis and identified its identity by conventional physiological, biochemical, and molecular techniques. Virulence and pathogene...
Omer Draz1, Xijun Ni2, Khizar Samiullah1,*, Riffat Yasin1, Rana Mehroz Fazal1, Sakeela Naz1, Saleem Akhtar1, Mahpara Gillani1 and Muzammil Ejaz1
...imens belonging to seven species of order artiodactyla which are Selenoportax vexillarius, Pachyportax latidens, Dorcatherium minus, Dorcatherium majus, Gazella lydekkeri, Hippopotamodon sivalense and Propotamochoerus hysudricus. The bovids are more prominent here as compared to all other artiodactyls. The suggested age of recovered species is Late Miocene to early Pliocene (7-5 Ma). The discovered specimens co...

Hasnain Alam1*, Jabar Zaman Khan Khattak1 and Taoufik Saleh Ksiksi

...towards using indigenous species for sustainable landscaping. In this study, we evaluated the germination response under osmotic stresses for four native species i.e. Atriplex leucoclada, Senna italica, Tetraena mandavillei and Tephrosia apollinea. Two osmotic agents (OA) i.e. NaCl and PEG 6000 and four osmotic levels (OL) i.e. 0, -0.2, -0.4 and -0.6 MPa were tested for each species. Data ...

Abdur Rehman1*, Sajjad Ahmad1, Ahmed Zia2, Asad Ali3, Kiran Shahjeer4, Abdul Latif1 and Taimur Khan

...6. The study revealed 23 species from 15 genera under 3 families. The abundant family was recorded as Libellulidae that was comprised of 19 species belonging to 11 genera, family Gomphidae included 3 species belonging to 3 genera and family Aeshnidae included one species belonged to one genus. Detailed description of each species...
Muhammad Tariq Rasheed1, Imran Bodlah1*, Ammara Gull e Fareen1,2, Muhammad Shakeel Khokhar1
...twood (1840) is a species rich genus in subfamily Myrmicinae. Many species of this genus are reported from various parts of the world including neighbouring countries of Pakistan. Members of this genus are considered as generalized foragers and cryptic in nature. Collected material was verified using most recent and available literature provided by Bharti and Akbar (2014). H...
Dil Afroza Khanom1, Amirun Nesa1, Muhammad Abu Sayed Jewel1, Muhammad Ayenuddin Haque1, Alok Kumar Paul1, Sonia Iqbal2, Usman Atique2,3*, Lubna Alam4
...mmercially valuable fish species viz. Gudusia chapra and Eutropiichthys vacha, for the muscular tissue bioaccumulation of selected heavy metals (Pb, Cd, Cr, Zn, Cu, and Mn) and their human health risks. A total of 50 fish species (25 individuals each) were examined from the Padma River, Bangladesh, and subjected to heavy metals presence and loads by detection after wet digestion of samples. ...

Abid Khan*, Mukhtar Alam and Yousaf Jamal 

...ent in this culture were species of photosynthetic bacteria (Rhodopseudomonas palustris, Rhodobacter spaeroides), lactic acid bacteria (Lactobacillus plantarum, Lactobacillus casei, Streptococcus lactis), yeasts (Saccharomyces cerevisae, Candida utilis), actinomycetes (Streptomyces albus, Streptomyces griesus) and fermenting fungi (Aspergillus oryzae, Mucor heimalis). Farm yard manure (FYM) and poultry manure (PM) were used as organic sources of nitrogen. Bio-...

Muhammad Medrar Hussain*, Asad Jan* and Sayyar Khan Kazi 

...essed in Oryza sativa subspecies indica variety Swat-1. Through Agrobacterium mediated transformation, OsTZF8 gene (pBIG-Ubi-OsTZF8) was successfully transferred to rice calli. From these rice calli transgenic plants were regenerated and established in greenhouse. For the evaluation of OsTZF8 gene role in drought stress tolerance, two weeks old rice seedling were subjected to drought stress. OsTZF8-OX transgenic indica line A and B displayed 69% and 64% surviv...

Bilal Saeed Khan1*, Muhammad Afzal2, Muhammad Asif Qayyoum1, Imran Ali3 and Abdul Ghaffar

...unknown) of the new mite species Pseudostigmaeus sorghumus sp. nov was collected from city Dera Ghazi Khan on Sorghum bicolor (L.) and described. Fifteen paratypes were also collected from same collection data and seven were from Muzaffargarh. 

...
Fehmina Ashraf1*, Muhammad Irfan2, Hafiz Abdullah Shakir1, Shaukat Ali3, Muhammad Khan1
...been depicted in various species of bacteria, plants and in different genera of fungi. Laccases have been purified by various methods. It involves in di-oxygen to water reduction and 1e- oxidation of phenolic and its allied parts. Laccases are mostly used in different industries like food, paper and pulp, pharmaceutical and textile etc. Both laccases and mediators have been used in different process like delignification of pulp. Laccases from bacterial
Ayesha Iqbal1, Ghulam Sarwar1, Abdul Majid Khan1*, Muhammad Tahir Waseem1, Ayesha Iqbal1, Rana Manzoor Ahmad1,2, Muhammad Ameen1
...te between the different species of wild and domesticated suids. The studied material comprises of the three skulls. The straighter snouts and slenderer crania manifests that specimens under study were wild while the sex of species was determined by the permanent canine teeth morphology, as in females the upper canines extend in ventrolateral directions and continue to grow in lateral direction while in males the upper canin...

Korkmaz Bellitürk1, Zubair Aslam2, Ali Ahmad2* and Sami ur Rehman2

...senia fetida (an epigeic species), were used as the test species. The samples were collected from prepared vermicompost and raw material for chemical and physical examination. For these samples, the pH, EC, organic matter, C:N ratio, phosphorus, potassium, calcium, magnesium, iron, nitrogen, sulfur and heavy metals i.e. tin, cadmium, nickel, lead, mercury and chromium parameters were evaluated. The experimental design was Co...

Nasrullah1*, Ahmad Nawaz Khoso1, Jamila Soomro2, Ilahi Bakhash Marghazani1, Masood-ul-Haq Kakar1, Abdul Hameed Baloch1, Sarfaraz Ahmed Brohi1 and Muhammad Asif Arain1* 

...ment. All groups of both species were fed maize, millet and sorghum randomly. Results indicated that goat spent more time to eat than sheep while sheep rumination time were noted significantly (P<0.05) higher in sheep compare to the goat. Meanwhile, drinking time was noted higher in sheep than goat. Moreover, goat exhibited higher resting, playing and other activities compared to sheep. Findings of dry matter intake (DMI), crude protein (CP) natural deterge...

Abdul Raqeeb1,3, Syed Moazzam Nizami2,4*, Aamir Saleem3, Lubna Ansari3, Saeed Gulzar3, Basit Ali3, Masooma Saleem5
 

...rical data of particular species for a specific forest ecosystem is of utmost importance. In the present study volume and biomass allometric of naturally growing Cedrus deodara tree in dry temperate regions of Himalaya has been developed from the empirical data collected from four different locations with three sites each as representative of its naturally growing area. Destructive sampling including excavation of roots was carried for overall 60 trees. The re...

I. Erum, K. Nasira, H. Sagir, S. Raza and Firoza, K.

Description of Discolaimus miniodontii n.sp. and Laevides hunderansis n. sp. with notes on Discolaimoides spatilabium (Nematoda: Dorylaimida) from District Ghizer, Gilgit-Baltistan, Pakistan
...new and a known nematode species of the order Dorylaimida viz., Discolaimus miniodontii n. sp. and Laevides manilkarii n. sp.; and a new report of a known species Discolaimoides spatilabium from District Ghizer, Gilgit-Baltistan, Pakistan. Discolaimus miniodontii n. sp., is characterized by having smallest odontostyle (9-10µm); relatively smaller and slender body (L=1.0-1.14mm; a= 38.5-45.8); sclerotized odontostyle, i...

A.N. Ashfaque1, F. Shahina1 and S. Dawar2

 

Diversity of nematode fauna associated with cotton fields of high temperature areas of Sindh, Pakistan
...der to estimate nematode species diversity, richness and evenness, the data has been submitted for calculating the diversity parameters such as Dominance (D), Simpson’s diversity index (1-D), Shannon diversity index (H’), Evenness (e), Brillouin Diversity Index (HB), Menhinik Diversity , Margalef's richness index, Equitability (J) and Fisher's alpha. All estimated parameters of diversity has interrelation among all nematode genera in particular but...

H. Soofi†1 , N. A. Birmani1 , A. M. Dharejo1 , A. R. Abbasi2 , G. S. Ghachal1

Description of new nematode species Rhabdochona (Rhabdochona) sindhicus of genus Rhabdochona (Railliet, 1916) from Indus River Pakistan
...ify;"> New nematode species of genus Rhabdochona collected form host catfishes Rita rita of Indus River, Jamshoro, Sindh, Pakistan. Collected nematodes were processes with standard method for feature research. New species Rhabdochona (Rhabdochona) sindhicus differs from other species of genus with body shape and size, buccal capsule shape, prostomal teeth arrangement, nerve ring posit...

Parsa Riaz and Muhammad Naeem*

Digestive Enzymes Activity with Gut Morphometric Parameter of Carnivorous Fish Wallago attu (Siluridae, Siluriformes)
...terature behalf of their species feeding habits. Gut morphometric parameters included first time in relation to Wallago attu morphology as Relative gut mass, length and Zihler’s Index are basically explored as potential indices to identify habits.

...

Mumtaz Shah*, Hashim Nisar Hashmi* Naeem Ejaz* Abdul Razzaq Ghumman*

PERFORMANCE EVALUATION OF AQUATIC MACROPHYTES FOR MUNICIPAL WASTEWATER TREATMENT
... aquatic macrophyte species used for the performance comparison were Water Hyacinth, Duckweed and Water Lettuce. Forperformance comparison four parameters including BOD5, COD, Nitrogen and Phosphorus were selected. These parameters were monitored for both the influent and effluent sewage samples. During the entire study, the average reduction of 51% for BOD5, 47% for COD, 19% for phosphorus, and 41% for nitrogen were found with water h...
Sitara Nawaz1, Shamaila Irum1, Haroon Ahmed2, Shazia Shamas1, Sadia Roshan1, Muhammad Ather Rafi4, Irfan Ullah5*, Gulnaz Parveen3*
...asis and the most common species in Pakistan.
...
Sumaira, Ali Mujtaba Shah*, Ghulam Asghar Solangi, Ifra Anwar, Qudratullah Kalwar 
... obtained from different species including sheep, ass, horse, yak, goat, bison and camel while the 80 % milk is produced by cows. Milk of camel plays an essential part in the diet of human. Additionally, camel milk comprises numerous fatty acids and enzymes. Hence camel milk has many beneficial effects, such as antiviral, antibacterial, anti-diabetic, anti-carcinogenic and anti-ageing. Besides, camel milk contains abundant proteins which are conductive to impr...
Zarish Yaqoob1, Saleema Bashir Shams2, Gaitee Joshua2 and Bibi Nazia Murtaza2,3*
... Overall, seventeen fish species were recorded in the study areas indicating a decrease in the number of species in Ravi. The results have shown that the water of Ravi is unsafe for aquatic life and irrigation. Metal concentration in the fish meat is higher than the recommended dietary allowance (RDA) parameters indicating a serious health threat to both, the fish and human population.
...

Muhammad Riaz1*, Naureen Akhtar1, Salik Nawaz Khan1, Muhammad Shakeel1,2 and Ateeq Tahir1

Neocosmospora rubicola: An Unrecorded Pathogen from Pakistan Causing Potato Stem Rot
...tic relationship of this species with other reported species of this genus. Pathogenic potential of the isolate was verified by artificially inoculating the spores of pathogen in healthy plants. Appearance of same symptoms and re-isolation of N. rubicola from infected tissue confirmed Koch’s pathogenicity postulates. Association of N. rubicola causing stem rot in potato is never reported before in Pakistan.

...
Muhammad Khalid1,2, Samrah Masud2, Zara Naeem2, Muhammad Munir Shahid3, Ammar Danyal Naeem2, Abir Ishtiaq2 and Muhammad Naeem2*
 
Length-weight and Length-length Relationships of Farmed Catla catla during Winter Season from Muzaffargarh, Pakistan
... TL for the studied fish species. Mean condition factor value was found 1.49±0.04 in the present work. Results of this work will be useful for fishery biologists and fisheries management. 

...
Roni Koneri1*, Meis Nangoy2 and Pience V. Maabuat1
...research, 7 families, 20 species and 1,750 individuals belonging to 2 suborders, Anisoptera and Zygoptera, were identified. Libellulidae was the family with the most number of species and individuals being found. Th especies with the highest abundance was Orthetrum pruinosum, followed by Libellago xanthocyana. The highest dragonfly species ...
Faruk Çolak1 and Ferhat Matur2,3,*
...head drumming, to convey species-specific information. The lesser blind mole rats (Nannospalax sp.) are obligate subterranean rodents known for their remarkable chromosomal variation. In the present study, we investigated whether the structure of seismic signalling is different between the two species found in Turkey, Nannospalax leucodon and the N. xanthodon and whether it is associated with ecological,...
Magbolah Salem Helal Alzahrani
...There are many different species of chamomile, the two most common being German chamomile (Marticaria chamomilla) and Roman chamomile (Chamaemelum nobile). The use of chamomile has been associated with calming and anti-inflammatory properties. The plant’s healing properties come from its flowers, which contain volatile oils including bisabolol, bisabolol oxides A and B, and matricin as well as flavonoids. This study aims to elucidate the po...
Cheng Zhao1,2, Jianghong Ran2*, Bin Wang2,3, Qin Shi4 and Marwan M.A. Rashed1
...ammals in the world. The species has experienced declines in its habitat and population due to human disturbance. To protect this species, we investigated the relationship between giant panda habitat use intensity and human disturbance density in the Daxiangling Mountains. The results indicated that, among multiple kinds of disturbances, roads affected the giant panda habitat use significantly. In addition, roads caused the ...
Waqar Majeed1, Naureen Rana1, Elmo Borges de Azevedo Koch2* and Shahla Nargis1
...corded pertaining to 152 species. Among the arthropods collected from two fields, number of the order Diptera was most diverse followed by those of Coleoptera, Hymenoptera, Hemiptera, Orthoptera, Lepidoptera, Araneae and Neuroptera. The number of arthropod species differed between localities and between the studied seasons. The arthropod composition varied significantly according to the sampled sites and according to the sea...
Hamed A. Ghramh,1, 2, 3,Zubair Ahmad 1, 2, 4, Khalid Ali Khan1, 2, 3*and Farhat Khan4
... Characters of these new species and their affinities with related species are discussed.
...
Mah Jabeen and Amjad Farooq*
..."font-size: small;">Four species of Brassica viz,. B. napus, B. juncea. B. compestris and B. rapa were studied for their relative resistance/susceptibility against aphids, under field conditions for three consecutive crop seasons i.e., 2009-2010, 2010-2011 and 2011-2012. The data on the incidence of aphids were recorded at weekly interval. Host plant susceptibility indices were also calculated. B. napus was found to be...
Zubair Ahmad1, 2,5, Hamed A. Ghramh1, 2, 3,Khalid Ali Khan1, 2, 3*, Kavita Pandey4 and Farhat Khan5
...nt-size: small;">Two new species viz., Chelonus (Areselonus) caeruleus sp. nov. and Chelonus (Areselonus) lithocolletiscus, sp. nov., are described as new to science from the northern part of India. These two species were reared from Acrocercops caerulea (Meyrick) and Lithocolletis virgulata (Lepidoptera: Gracillariidae). Materials about other s...

Ali Hazrat1*, Mohammad Nisar1, Khan Sher2, Jehandar Shah2, Tour Jan1 and Abid Ullah1

Taxonomic and Medicinal Study of Papilionaceae of District Upper Dir, Khyber Pakhtunkhwa, Pakistan
...ify;">Twenty seven plant species of the Papilionaceae were collected from Dir Upper, with elevation ranges from 1200-4000 meters during 2015-2017. They were taxonomically determined with the help of key characters, the uses of these native plants were recorded such type of study was concluded for the first time in the selected area of Dir (Upper). In view of the fact that these plant species are scarcely distributed, hence s...
Muhammad Rizwan1*, Bilal Atta1, Ana Maria Marino de Remes Lenicov2, Roxana Mariani2, Arshed Makhdoom Sabir1, Muhammad Tahir3, Misbah Rizwan4, Muhammad Sabar1, Ch. Muhammad Rafique1, Muhammad Afzal5
...rs with the most harmful species. Delphacids are primarily vector of the viruses, whereas Cixiids are vectors of phytoplasmas, mycoplasmas and prokaryotes-like associated to the class Mollicutes. Specimens of planthoppers were collected from the rice fields and surrounding weeds. A list of Fulgoromorpha is provided, with distributional and biological records as well. Records are extracted primarily from field data and specialized reference sources. Seven
Jam Nazeer Ahmad1,*, Samina J.N. Ahmad1,2,*, Mubashir Ahmad Malik1, Abid Ali1, Muhammad Ali3, Ejaz Ahmad1, Muhammad Tahir2 and Muhammad Ashraf2
...re are various important species of large swarms forming of desert locusts found in different regions of the world. In early 2020, in Pakistan, huge swarm of desert locust infestation was observed in different provinces of Pakistan. Precise and correct identification of any pest is very important to start a proper control strategy against it. The current study was conducted to identify and characterize locust species and to ...
Zhi Yijin, Shao Mingqin* and Li Quanjiang
...ssed. A total of 38 bird species, including 4 class I and 3 class II Chinese nationally protected bird species were identified. Of six habitats, 64% (15,435 individuals) of the total number of wading birds counted occurred in water-covered areas. The common crane Grus grus has the widest habitat niche (0.727), utilizing grasslands and farmland after crops were harvested, where it ate vegetation (roots) or seeds. Shore...

Andrei V. Tanasevitch1 and Yuri M. Marusik2,3,4,*

...font-size: small;">A new species, Carniella nepalensis sp. n., is described from eastern Nepal. The male of new species is most similar to C. forficata (Gao and Li, 2014) and clearly differs by the shape of the embolus. The type locality of new species is northwesternmost for the genus in Asia.
...
Ashfaque Ahmed Nahiyoon1*, Nasira Kazi2 and Shahina Fayyaz2
...mall;">A new and a known species belonging to the family Belondiridae are described from Sindh, Pakistan. Amphibelondira sindhicus n. sp., is characterized by having reduced anterior genital branch, more slender body, smaller neck length and expanded part of pharynx, smaller spicule and clavate tail with distinct radial striae. Belondira paraclava Jairajpur, 1964 is reported for the first time from Pakistan during the present studies on cotton.
Aribah Naz1*, Uzma Badar1,Afsheen Arif2*, Zaid Qureshi1, Sondas Saeed1,Erum Shoeb1, Maqsood Ali Ansari1 and Obaid Yusuf Khan1
...ibrio harveyi species. The sequence obtained has been submitted to NCBI under GenBank Accession# KY653092. Characterization of luminescent bacteria facilitates understanding of the environmental differences that favors the stability, survival and proliferation of species in their respective habitat.
...
Safia Arbab1, Rehana Buriro1, Shams Uddin Bhugio1, Atta Hussain Shah2,  Jamila Soomro3,Qudratullah Kalwar4, Saqib Ali Fazilani1 and Waseem Ali Vistro5*
...have different bacterial species and 16 (32%) were recorded with pure contamination. At 30 µl of crude Aloe Vera isolated bacterial organisms did not show any susceptibility, whereas at 60 µl, organisms showed quit sensitive reactions. In contrast, ethanol extract of Aloe Vera showed better result as compared to crude Aloe Vera at both concentration i-e 30 µl and 60 µl. Among isolates, S. aureus showed high sensitivity (15-22 mm)...
Sumaira1, Syed Mohsin Bukhari1, Maqsood Iram2, Arshad Javid1Ali Hussain1, Waqas Ali1, Khalil Ur Rehman3, Shahla Andleeb3, Irfan Baboo4 and Nimra Khalid1
... while internal parasite species belong to genus Pseudomonas, Staphylococcus and Streptococcus were recorded from Python molurus. Higher temperature and humidity accelerated the ecdysis process.
...
Duo Jing Qiu1,2,3, Xin Yu1,2,3, Mao Jun Zhong1,2,3 and Long Jin1,2,3*
...titude population in the species. We also found that testis mass increased with body mass and somatic condition. Furthermore, the somatic condition exhibited a significantly positive correlation with testis mass, indicating the condition-dependent testis mass in D. melanostictus.
...
Zubair Ahmad1, 2, 4, Hamed A. Ghramh1, 2, 3,Khalid Ali Khan1, 2, 3*, Farhat Khan4 and Shujauddin5
...ecific mutualism between species that produces net benefits for the participants. In this paper, the interaction between aphid M. sacchari and their attending ants on sugarcane (Saccharum officinerum) was studied. The presence of ants, especially, Crematogaster subnuda Mayr. and Camponotus compressus adversely affects the parasitoid effectiveness of Lysiphlebia mirzai and Aphelinus desantesi. The aphids got 31% and 26....

Muhammad Jawad1*, Shahid Riaz Malik1, Rana Muhammad Atif2, Haris Ahmed2 and Muhammad Shahzad Afzal3

Species Identification of Gram Wilt Complex through ITS Region by PCR-RFLP Analysis
...diverse type of Fusarium species. Molecular approach is a useful technique for the identification of wilt complex pathogens. The study conducted to identify the polygenetic association of the pathogens of chickpea wilt complex. Universal Rice Primers based diversity analysis indicates high polymorphism within the collected wilt isolates. Primers ITS 1 and ITS 4 generated internal transcribed spacer fragments that were restricted four restriction enzymes (HhaeI...
Muhammad R. Khan1, Bushra A. Rakha1,* and Muhammad S. Ansari2
...no variation in all four species. A total of 28 specimens, including 6 species belonging to genera Schizothorax and Schizothoraicthys were investigated. The species found in river Swat were Schizothorax plagiostomus, Schizothoraicthys esocinus, Schizothoraicthys labiatus, Schizothorax richardsonii, Schizothorax sinuautus and Schizothoraicthys macropthalmus. Among these
Hari Prasad Sharma1*, Shova Adhikari1, Yogesh Rai1, Rajkumar Sijapati1, Sapana Chand1, Manisha Karki1, Rubina Thapa Magar1, Ashik Husain1Khadka Bahadur Khatri1, Melina Karki1, Samiksha Badu1, Sushila Bajracharya1, Somika Pathak1, Rachana Shah2 and Chiranjibi Prasad Pokheral2
...nce, geographically rare species, attractive species, trafficked animals seized by the authorities, and injured and orphaned animals. The presence of visitors and their activities affect the behavior of animals in the zoo due to the structural design and the attractiveness of animals. The more attractive bird, ostrich Struthio camelus in Central Zoo of Nepal is suffering from visitors’ activities. Both male and ...

Muhammad Shakeel1*, Mudussar Nawaz1, Zahid Naseer1, Muhammad Fiaz1, Asghar Khan1, Muhammad Imran Khan1, Awais Ur Rehman1, Ahmad Yar Qamar2 and Ali Raza3

Caprine and Ovine Serological Evidence of Brucellosis in Five Districts of Punjab, Pakistan
...t affects various animal species. Amongst different Brucella species, Brucella melitensis has the greater zoonotic aspect, hence, it is considered an occupational hazard for small ruminant handlers as well as Veterinarians. The present study reports the seroprevalence of brucellosis in different sheep and goat breeds in five districts of Punjab, Pakistan. A total of 1239 serum samples were collected from male (n=73) and fema...
Tabassum Yaseen1*, Shehzad Ahmad1, Khushnood Ur Rehman2, Fayaz Asad1, Abdul Waheed1, Rani Gul3, Hussain Gulab4 and Naveed Akhtar2
Arbuscular Mycorrhizal Fungal Spore Density and Root Colonization in Weeds of Carrot field at Charsadda, Pakistan
...spheric soil of 15 weeds species belonging to 12 families were collected from Carrot field of District Charsadda and was investigated for the sporulation and root infections types. From the recorded results the highest spore density was found in Melilotus indica having spore number 276 which is followed by Malva neglecta and Sonchus asper having spore number 244, 214 respectively. The lowest spore density was recorded in Pao annua having spore number 35. The m...

Mohammad Javad Golmohammadi1, Hamid Reza Mohammaddoust Chamanabad1*, Bijan Yaghoubi2 and Mostafa Oveisi3

GIS Applications in Surveying and Mapping of Rice Weeds in Guilan Province, Iran
...i was the more important species in 10 regions of Guilan province. The Langarud and Rudsar regions each with 47 species and Anzali and Shaft with 25 species (with 71.2 and 37.9 percent, respectively) had the highest and lowest species diversities, species diversity in 2015 was more than 2014 and 2016 years. The frequen...

Joseph Anejo-Okopi1*, Obinna Oragwa Arthur2, Ocheme Julius Okojokwu1, Sarah Joseph1, Geoffrey Chibueze1, Joshua Adetunji1, Joseph Ameh Okwori3, David Ochola Amanyi4, Otobo I. Ujah5 and Onyemocho Audu6

Seroprevalence of Rift Valley Fever Virus Infection among Slaughtered Ruminants in Jos, North-Central, Nigeria
...in information on animal species, sex, and localities of origin. The blood samples were screened for RVFV antibodies using competitive Enzyme Linked-immunosorbent Assays (C-ELISA) to detect anti-RVFV IgG/IgM. Eleven out of 100 samples tested positive for anti-RVFV antibodies (prevalence=11%). Seropositive cases were more among cattle (16.0%) than goats (6.0%) (P=0.001). Seropositivity was also higher among the animals from Yan-shanu market, with 90.9% of the s...

Ghulam Sarwar1*, Muhammad Rizwan1, Jehanzeb Farooq1, Muhammad Farooq1,2, Hafiz Ghazanfar Abbas1, Farrukh Ilahi1 and Muhammad Asif1

Fiber Quality Studies with Respect to Different Cotton Insect Pests using Multivariate Analysis
...nize the impact of pests species on fiber quality by controlling certain pests.

...

Moazam Ali1, Wajid Ali2, Ayhan Ceyhan2 and Zeeshan Ahmad Bhutta3*

Pigmentation Genome Influence in Animals and Human Interventions in its Course of Action
...genetic field as in many species (sheep, cattle, horses, camels, dogs, cats, pigs) new variants of coat pigmentation are achieved by generating mutation in MC1R and ASIP allele. A row of scientists is working on genome sequences and mutations for getting a better and healthier pigmentation besides animal welfare. This review article contains a complete elaboration about the worth of pigmentation in animals, natural pigmentation process and new mutation and dev...

Zulnorain Sajid1*, Muhammad Ramzan2 and Noreen Akhtar1

Foraging Behavior and Pollination Ecology of Bumble Bee and Honey Bee in Pakistan; A Review
... of agrochemical, exotic species and pathogens) involved in the declining of pollinators, a big loss for the economy of Pakistan. The aim of this review paper was to check the importance of honey bee and bumblebee as chief pollinator of agriculture crops. This review indicates how declining factors are alarming for the bumblebee and honeybee.

...

Md. Sahidur Rahman

Origin and Spillover of Coronaviruses: Prospects of One Health Action
...virus originate in avian species. Domestic animals also play a critical role in disease transmission as they are found seropositive against different coronaviruses. At least seven coronaviruses are known to have been spilled over from animal to human. SARS-CoV-2 is the recent one that showed pneumonia-like syndrome named COVID-19. It was assumed that SARS-CoV-2 was initially a spillover from bats due to its genomic similarity with Bat-CoV-RaTG13, where pangoli...

Zafar Ahmad Handoo1*, Mihail Radu Kantor1 and Ekramullah Khan2

Description of Seven New Species and One New Record of Plant-Parasitic Nematodes (Nematoda: Tylenchida) Associated with Economically Important Crops of Kashmir Valley, Jammu and Kashmir (Part-1 of the series)
...u and Kashmir, seven new species and one new record of following species were recovered: Helicotylenchus siddiqii sp. nov. from soil around roots of Glycine max L. Miller, from Kashmir University Campus, Hazratbal, Srinagar, Kashmir; H. fotedariensis sp. nov. from soil around roots of Brassica oleraceae var. botrytis L. from Zadibal, Srinagar, Kashmir; H. harwaniensis sp. nov. from soil around roots of Lycopersicum esculentu...
Yawar Iqbal Erum*, Hussain Sagir, Kazi Nasira and Fayyaz Shahina
Compendium of the Genus Psilenchus de Man, 1921 (Tylenchida: Psilenchidae)
...an, 1921 comprised of 19 species based on the characteristics of the total body length, ratio of a, b, c, c’, V%, stylet, MB, head shape, tail length, DGO, oesophagus, excretory pore, spicules and gubernaculum. The allometric and morphometric characteristics were derived from the original descriptions. An updated list of valid species of Psilenchus de Man, 1921 along with illustrations of the anterior and posterior reg...
Sher Bahadar Khan1, Mumtaz Ali Khan2,*, Hameed Ullah Khan3, Sher Ali Khan4, Shah Fahad5, Faheem Ahmad Khan6, Irshad Ahmad7, Nighat Nawaz8, Sidra Bibi9 and Muhammad Muneeb10
...e: small;">Campylobacter species are one of the most important food borne zoonotic pathogens. A total of 1260 poultry meat samples were collected from four different regions of Khyber Pakhtunkhwa province and processed for isolation of campylobacter species. A total of 182 (14%) Campylobacter jejuni were isolated using enrichment and plate media followed by confirmation through multiplex PCR. Isolates were tested for ...

Muhammad Tariq-Khan1*, Syed Zanib Ali Gardazi1, Abu Daud Ahmad Khan1, Muhammad Ilyas2 and Ishaq Ahmad3,4

Virulence and Distribution Trends of Root-Knot Nematode (RKN) Fauna on Summer Vegetables in District Bagh, Azad Jammu and Kashmir (Pakistan)
...dentified as predominant species of the study area. RKN tropical species was found on M. incognita 37%, M. javanica 38% and M. arenaria 28% sites parasitizing vegetable crops. Host preference of M. javanica and M. incognita was detected in mixed field conditions as M. javanica preferred okra as host while M. incognita reproduced maximum on tomato. Common beans were found most susceptible host providing survival opportunity t...
Ammara Gull-E-Fareen1, 3, Imran Bodlah1*, Muhammad Tariq Rasheed1, Yasir Niaz2, Muhammad Adnan Bodlah2, Muhammad Asif4 and Nasir M. Khokhar5
... this purpose, seven ant species were selected, identified as Camponotus compressus (Fabricius, 1787), Formica fusca Linnaeus, 1758, Formica clara Forel, 1886, Lepisiota frauenfeldi (Mayr, 1855), Myrmica aimonissabaudiae Menozzi, 1939, Tapinoma melanocephalum (Fabricius, 1793) and Tetraponera allaborans (Walker, 1859). A lot of surveys were conducted during 2015-17 for the collection of ants associated with aphi...
Wajahat Azeem1,*, Tariq Mukhtar1 and Tooba Hamid2
...mong the known root-knot species, Meloidogyne incognita is by far the most destructive, widely distributed and the most dominant and prevalent. In the present study, the efficacy of a biological control agent, Trichoderma harzianum and an antagonistic plant, Azadirachta indica was tested against M. incognita on tomato. The antagonistic fungus and plant caused significant hatching inhibition and larval mortality of M. incognita

Sehrish Ashraaf1, Hafiz Muhammad Tahir1* and Sajida Naseem2

...y helpful in identifying species where morphological identifications can be difficult e.g., delimitation of juvenile stages. Standard barcode region of CO1 gene of 64 samples was amplified. The sequences of 658 base pairs were recovered from 62 samples, representing 7 families, 20 genera and 27 species. Araneidae was the

Muhammad Ramzan1, Muneer Abbas1*, Sohail Abbas2, Niaz Hussain1, Muhammad Aslam1, Javed Anwar Shah1, Muhammad Irshad1 and Mudassar Khaliq1

Incidence of Different Aphid Species on Various High Yielding Wheat Varieties
...hrough most common aphid species, i.e., Rhopalosiphum padi, Schizaphis graminum, Sitobion avenae on different varieties. Results indicated that heading and dough stages (Standard Weeks 10 and 11) were most susceptible developmental periods with average 10.56 and 8.36, 21.98 and 18.65 aphids per tiller during 2018 and 2019, respectively. R. padi was most dominant from mid-January to mid-April with maximum population of 100, 84.33, 44.31 and 1.64 % in 2018 as we...
Sadaf Aslam1,2*, Abdul Majid Khan2 and Muhammad Akhtar2
...l remains of the extinct species Hyotherium pilgrimi described. The known stratigraphic range of Hyotherium is about 14 to 11 million years. This species is closer to its smaller European relative H. soemmeringi. The studied material includes isolated premolars and molars. This paper provides new insights of morphology of an extinct species of the suid, Hyotherium p...
Taqiur Rahman1, Tabassum Yaseen1*, Ali Mujtaba Shah2, Samiullah3, Ghulam Jelani3, Gul Nawaz1,Qudratullah Kalwar2
...here about seventy plant species belonging to different families of spermatophytes have been collected, among which forty-eight belonged to angiosperm families and 2 families were gymnosperms. This comprises 39 herb, 14 shrubs, and 16 trees, respectively. The study postulated on the certification of herbal knowledge on realistic bases though former interviews for the documentation of accurate indigenous knowledge. (R1andR2) All the plant ...
Samreen Khan, Tabassum Ara Khanum, Nasira Kazi, Salma Javed* and Shahina Fayyaz
Description of Aphelenchoides acacia n. sp. and Aphelenchoides naurangiensis n. sp. (Nematoda: Aphelenchoididae) with Observation on Aphelenchoides saprophilus Franklin, 1957 from District Lakki Marwat, Khyber Pakhtunkhwa, Pakistan
...align: justify;">Two new species belonging to genus Aphelenchoides viz Aphelenchoides acacia n. sp. retrieved from soil sample of kikar (Acacia nilotica L.), ber (Ziziphus muritiana L.) and paper flower (Bougainvillea spectabilis L.) and Aphelenchoides naurangiensis n. sp. recovered from soil samples of wheat (Triticum aestivum L.), thoroughly described and illustrated from District Lakki Marwat, Khyber Pakhtunkhwa, Pakistan. The new s...

 Majid Shahi Bajestani1, Esmat Mahdikhani Moghadam2*, Reza Aghnoum3 and Hamid Rohani2

Study of Plant Parasitic Nematodes and Description of New Record (Rotylenchus alius) Associated with Barley (Hordium vulgare L.) in Khorasan Razavi Province, Northeast Iran
...trical identification 18 species were recorded belonging to nine genera. Among these species, Rotylenchus alius was found as a new record from Iran and Basiria gracilis, Boleodorus thylactus, Ditylenchus apus and Meloidogyne arenaria were reported as new host record from barley fields of Iran. Meloidogyne arenaria, was selected for detailed investigation at molecular level. Molecular traits on Meloidogyne arenaria
Kui Zhang1,2, Ping Geng1, Sher Khan Panhwar3, Khadim Hussain Memon4 and Zuozhi Chen1,2,*
...e commercial marine fish species in Pakistani waters. Most commercial fish species lack assessments of maximum sustainable yield (MSY) and allowable catch, a situation that hinders effective fisheries management. A Catch–MSY model based on statistical catch data and prior information on population parameters was applied to assess the total allowable catch (TAC) and MSY values for 24 commercial marine fish groups, and t...
Fanrong Xiao, Jichao Wang and Haitao Shi*
...performance in these two species. The Keeled box turtle has a flatter shell, larger head, longer toes, better clinging ability, and better self-righting ability, whereas the Flowerback box turtle has a more domed shell, smaller head, shorter toes, decreased clinging ability, and decreased self-righting ability. Together, these results provide evidence that these two species are specialized to use different microhabitats. The...
Zhi Chen1, Toshifumi Minamoto2, Longshan Lin3 and Tianxiang Gao4,*
...undance study of aquatic species. DNA extracting was an indispensable process to employ this method. In eDNA extracting of macro-organisms, DNeasy Blood and Tissue Kit was commonly used, but its price was about 80 RMB/sample, which was too expensive. Cheaper eDNA extraction kit was a potential aspect for improvement to expand further application of eDNA analysis. In order to examine some cheaper kits’ effectiveness of extracting eDNA of macro-organisms a...
Gautam Patra1*, Ana Sahara2, Sonjoy Kumar Borthakur1, Parthasarathi Behera3, Subhamoy Ghosh1, Apurba Debbarma4 and Seikh Sahanawaz Alam5
...yt b gene in various species of wild birds (Upupa epops, Passer domesticus, Pycnonotus cafer, Bubulcus ibis). The birds were captured by netting system. After blood was collected from wing veins, birds were released from the cages. Blood samples were examined after staining with Giemsa stain. The positive samples were used for amplification of cyt b gene of Plasmodium relictum. Cloning and sequencing of the amplifi...

Tasleem Akhtar1, 2, Ghazanfar Ali1,* and Nuzhat Shafi2

... the present study, four species of Schizothorax had been found, in which three species were already reported (S. esocinus, S. plagiostomus and S. progastus) and one new species (S. niger) was found first time in AJK. One hundred and fifty-nine specimens of S. plagiostomus, 74 specimens of S. esocinus, 21 specimens of S. progastus and 8 specimens o...
Feng Xu1,2,3*, Weikang Yang1,2,3*, Ming Ma1,2,3 and David A. Blank4
...dator, season, traits of species and numbers of others factors were thought to have significant impacts on vigilance. Here, in this study we considered only three of them: group size, disturbance, and predation vulnerability and their impact on the vigilance of the Demoiselle crane (Antropoides virgo). Our results showed that group size, human disturbance, and predation vulnerability significantly affect Demoiselle crane’s vigilance. With increasi...
Muhammad Zeeshan Majeed1*, Muhammad Shahzad Akbar1, Muhammad Afzal1, Muhammad Mustaqeem2, Muhammad Luqman3, Ijaz Asghar4 and Muhammada Asam Riaz1
... of ten indigenous plant species were evaluated for their insecticidal and repellency potential against the subterranean termite Odontotermes obesus Ramb, a destructive insect pest of wooden infrastructures, agricultural crops, orchards and forest plantations. Standard filter paper disc method was used for both toxicity and repellency bioassays according to completely randomized design. The response of termite workers varied with plant
Muhammad Zeeshan Majeed1*, Muhammad Afzal1,Muhammad Asam Riaz1,Kanwer Shahzad Ahmed1, Muhammad Luqman2, Mehar Zubair Shehzad1, Muhammad Bilal Tayyab1, Mujahid Tanvir1 and Saadia Wahid1
...cts (10%) of forty plant species were evaluated against Asian citrus psyllid (Diaphorina citri), armyworm (Spodoptera litura), house mosquito (Culex quinquefasciatus) and subterranean termite (Odontotermes obesus) using twig-dip, leaf-dip, aqueous exposure and filter paper-dip bioassay methods, respectively. Results revealed that the extracts of Mentha longifolia, Sonchus asper and Nerium indicum were the most t...
Muhammad Ramzan, Unsar Naeem-Ullah*, Mudssar Ali and Hasan Riaz
... especially Ficus species that not only planted to increase the aesthetic value of country but also use as fruits and medicine. There is need to control this destructive pest of ornamental plants in Pakistan to minimize the losses. The biology and morphology informations are very important before adopted any strategy against this pest. For this purposes, the current study was conducted and this is first study on this pest in Pakistan.
...
Jianjun Fu1, Shili Liu2, 3, Wenbin Zhu1, Yongyi Jia2, 3, Lanmei Wang1, Yufen Yang4, Zhimin Gu2, 3*and Zaijie Dong1*
...lection breeding of this species
...

Zubia Rahim1, Gulnaz Parveen1*, Salma Gul2 and Khushnood-ur-Rehman3

Ameliorating Effects of Salt Stress (KCl, NaCl) on Growth and Germination Parameters of Pearl Millet (Pennisetum americanum)
...nity effects on the test species were analyzed by (LSD) Least Significant Differences method. 100mM concentrations of the said two salt and a mixture of two salts concentrations was less stress causing on all parameters studied. The degree of toxicity of the salts decreases as NaCl<KCl<NaCl+KCl.
...

Muhammad Yasir*, Mansoor ul Hasan, Muhammad Sagheer, Amer Rasul, Rameesha Amjad Ali and Habib ur Rehman

Evaluation of Spinosad Applied to Grain Commodities for the Control of Stored Product Insect Pests
...ortality of three insect species was recorded at tested concentrations in all the treated commodities after the exposure period of 3 and 7 days. Overall results of all bioassays show that residual efficacy of spinosad was reduced with the increase of post treatment period. At 1 mg Kg-1, at the exposure period of 7 days, the mortality was more than 97% at month 0 and it was > 47.7% at month 5 in all the tested insect species
Abdul Majid Khan1,*, Muhammad Tahir Waseem1, Rana Manzoor Ahmad2, Ayesha Iqbal1, Hafiza Imrana Naz1, Amtur Rafeh1 and Muhammad Ameen1
...tended the range of this species from Lower to the Middle Siwaliks of Pakistan.
...
Ye Ge1,2,3, Qiucheng Yao1, Hongliang Chai3, Yuping Hua3* and Guohua Deng2*
...ds, especially migratory species, play an indispensable role in the spread and reassortment of AIVs and provide unknown opportunities for mutation and emergence of novel influenza viruses. Additional studies of AIVs originating from wild birds will help to determine viral adaptation and maintenance in alternative hosts.
...
Inga Kowalewska-Łuczak1 and Ewa Czerniawska-Piątkowska2,*
... genotypes of individual species was carried out using the PCR-RFLP. The frequency of the most occurring alleles for the individual polymorphisms studied was the following g.18174 A>G NCF4 gene A-0.807; SAA2
Jin-Juan Wan, Mei-Fang Shen*, Hui Xue, Hong-Yan Liu, Mei-Qin Zhang, Xi-He Zhu and Chong-Hua Wang

 

...wth and immunity of this species at juvenile stage is 3 times/day.
...
Saima Siddique1* and Zarrien Ayub2
...g and management of this species in Northern Arabian Sea. 
...
Sukhpreet Kaur Sidhu*, Gurkirat Singh Sekhon, Randeep Kaur Aulakh and Tejdeep Kaur Kler
...ones. A total of 51 bird species belonging to 31 families and 15 orders were recorded from studied locations. A diverse range of vegetation distribution was observed with 12 weed species, 22 tree species and three crops near the ponds. Avian species richness index was found positively correlated high with the occurrence of bird s...
Chaojie Yang1,2,3, Haishan Wang1,2,3, Le Ye1,2,3 and Zhi Chen1,2,3,*
...;">The identification of species constitutes the basic step in phylogenetic studies, biodiversity monitoring and conservation. The morphological descriptions and DNA barcoding study about Muraenesocidae in the East China Sea were old, rough and deficient. Morphometric measurements and meristic counts were taken for all collected Muraenesocidae samples in our present study. Teeth characters that are conclusive for the species...
Mardan Aghabey Turghan1, Roller MaMing1*, Li Weidong2, Di Jie1 and Xu Guohua1
...pdated checklist of bird species that occur in the Arjin Mountain Nature Reserve and its adjacent areas, including parts of Kunlun Mountain, Qimantagh and Kumkul Basin, is provided as part of the basic data for a second nation-wide field survey of wildlife resources of China (2010-2020). The information provided is based on field observations made from 2010 to 2017. A total of 172 bird species belonging to 95 genera of 42 fa...
Muhammad Riaz1*, Zahida Tasawar1, Muhammad Zaka Ullah2 and Zawar Hussain3
Parasitological and Molecular Survey on Theileriosis of Sheep and Goats and the Related Risk Factors in Musa Pak Shaheed Town, Multan, Pakistan
...ctively. Among Theileria species, PCR identified the incidence of T. lestoquardi and T. ovis was 16.5% and 5% respectively while 6% blood samples revealed mixed infection of both species in overall small ruminants. The infection rate of T. lestoquardi was higher (9.5% and 7%) than T. ovis (3% and 2%) in sheep and goats respectively. Statistically significant correlation revealed between theileriosis and animal
Arnab Tanveer, Shabana Naz*, Azhar Rafique and Asma Ashraf
...HSD (post hoc test). Six species of endo-parasites were identified from Jallo Wildlife Park. Eimeria (7500) and Ascaris (1100) were the most abundant. Murree Wildlife park had only two species i.e. Eimeria (3850) and Strongyloides (350). In Bahawalanagar Wildlife Park, 4 species of endo-parasites were found (Eimeria = 1450, Strongyloides = 550, ...
Ehsan Kashani1, Hamid Reza Rezaei2*, Morteza Naderi3 and Nematolah Khorasani4

 

...versity of the mammalian species and their plasticity in ever-changing environments is emphasized by scientists and conservation biologists. Central deserts and steppes of Iran host a different kind of insectivores like hedgehogs; however, their ecology and genetic properties are rarely documented. For species of hedgehogs that are included in the subfamily Erinaceinae, at least four known species
Fangqing Liu1, Jared Atlas2, Chaohao Du1, Anoop Das3 and Longying Wen1*
...at the body size of this species, especially in males, is significantly larger at high latitudes. It is the common pheasant’s adaptability to considerable environmental change that has facilitated the vast distribution of this species.
...
Minghao Gong1*, Shiliang Pang2, Zhongyan Gao2, Wanyu Wen1, Ling Zhang3, Gang Liu1, Huixin Li1, Fawen Qian4 and Wenfeng Wang2
...culture methods and crop species that consume less water than rice should be adopted to mitigate the adverse climate changes that accompany global warming and will contribute to RCC habitat degradation.
...

Muhammad Shahbaz1,*, Nosheen Farooq1, Abu ul Hassan Faiz1, Arshad Javid2, Irfan Baboo3, Misbah Shoukat1 and Muhammad Aslam Khan4 

...ae and Culicinae. Eleven species were identified as Anopheles barianensis (sub-familyAnophilinae), Culex barraudi, Cx. epidesmus, Cx. fuscocephala, Cx. pipirms fatigans, Cx. pipiens pipiens, Cx. pseudovishnui, Cx. vishnui, Aedes aegypti, Ae. micropterus and Armigeres subalbatus (subfamily culicinae). The most abundant species was Armigeres subalbatus.
...
Pengfei Liu1*, Hongxia Liu2 and Jiajia Xiao1
... coloration in these two species in the hand. PL with dull plumage, the males had brighter head plumage than females, there was no significant difference in coloration of wing and breast plumage between two sexes. EL appeared relatively bright and polychrome plumages, and the males had extremely significantly higher carotenoid chroma than female in grayish-white tail end, however, there was no difference in orange wing patch and yellowish-brown hip plumage bet...
Maria Syafiqah Ghazali1, Azlan Che’ Amat2 and Nor Azlina Abdul Aziz1*
...ous threat to endangered species. The present study was conducted to observe the occurrence of gastrointestinal parasites in large felines in a Malaysian zoo. Ten faecal samples were collected from pumas (Puma concolor, n = 5), African lions (Panthera leo, n = 3), a spotted leopard (Panthera pardus, n = 1), and a black panther (Panthera onca, n = 1). All faecal samples were examined for parasite eggs, larvae, and oocysts by simple f...
Hannan Nasib Hamid1,*, Muhammad Rais1, Muhammad Arif2 and Rubina Noor2
...wenty three herpetofauna species (14 recorded through direct sightings) were recorded which included two species of amphibians and 21 of reptiles (eight snakes, 13 lizards). Species in the sub-tropical broadleaved evergreen forest were more diverse with Common Leopard Gecko, Persian Leaf-toed Gecko, Reticulate Plump-bodied Gecko as notable species while ...
Oluwatobi Emmanuel Olaniyi1,2*, Chukwudiemeka Onwuka Martins2, Mohamed Zakaria2
...ite occupancy of the two species
 
Sana Mehmood1, Hafiz Muhammad Tahir1*, Muhammad Summer1, Sher Muhammad Sherawat2, Shaukat Ali1*, Sajida Naseem3
.... We identified 38 morph-species, representing 22 genera and 8 families. Accuracy of morphological identification was confirmed by barcode analysis of tissue samples. A standard barcode sequence of COI (Cytochrome c Oxidase I) was recovered from 90 specimens of spiders. Percentage accuracy of morphological identification was 92.10%. Four morphologically misidentified spiders were allotted to correct taxon after molecular identification. To describe the

Inam Ullah1,2, WU Qing-Ming1*, Ruqia Bibi2 and Najam Un Nisa2

Comparison of Nesting Site Preferences and Breeding Ecology of Red-Vented Bulbul, Baya Weaver, and Grey Bush Chat in Sheikh Badin National Park Dera Ismail Khan, Pakistan
...between a bird and plant species is considered to be the central aspect of wildlife and biodiversity , which makes the nesting behavior a vital factor when investigating the life of birds. This study was conducted to know the trees used for nesting by avifauna species of Sheikh Badin National Park. The current study was conducted at Sheikh Badin National Park from October 2018 to September 2019   . Most birds&rsquo...

Sabina Noor1*, Fatimah Abang1 and Hamady Dieng2

Biology of an Exotic Butterfly Acraea terpsicore (Linnaeus, 1758) (Nymphalidae: Heliconiinae), in a Newly Invaded Region, Sarawak, Borneo
...imary host plant of this species. Fecundity in a single cohort varied from 30 to 85 eggs, whereas eggs were oriented on the underside marginal areas of host plant leaves. The developmental time of A. terpsicore to complete its life cycle took an average of 30 ± 3.01 days with a total of five larval instars. The ontogenesis of larvae was accomplished without any disruption of diapause. The female adults were ochreous orange in color with a wingspan of ab...

Shishir Sharma* and Laxmi Prasad Joshi

Current Insights on Stemphylium Blight of Lentil with its Management Strategies
...ition and delineation of species is inevitable as high complexity is seen due to environmental concerns and contrasting morphological characteristics among species. The frequency and intensity of this disease depends on environmental and climatic factors that are mainly favored by high humidity, temperature greater than 220c, and cloudiness. The pathogen mainly persists in crop debris and occasionally in seed during the offs...

Tofique Ahmed Bhutto1, Mahmooda Buriro1, Niaz Ahmed Wahocho2, Safdar Ali Wahocho2, Muhammad Iqbal Jakhro3*, Zulfiqar Ali Abbasi1, Reema Vistro1, Fehmeeda Abbasi1, Sanam Kumbhar1, Fateh Muhammad Shawani4 and Nadar Hussain Khokhar5

Evaluation of Wheat Cultivars for Growth and Yield Traits under Agro-Ecological Condition of Tandojam
...op cultivars of the same species for growth and yield-related attributes is well documented. The present investigation investigated the performance of wheat cultivars under Tando Jam conditions. For this study, two-year field experiments were performed during October 2015-2017 (both seasons) applying randomized complete design with three replications. Performance of various wheat varieties for their yield and yield-related characters, including TD-1, Moomal-20...
Keke Liu, Yuanhao Ying, Yuxin Xiao, Jing Yan, Mengzhen Zhang and Yonghong Xiao*
...font-size: small;">A new species, Otacilia dadongshanica Liu, sp. nov. (♂♀) is firstly described from Jiangxi Province, China. The new species is diagnosed and illustrated with photographs. A distribution map is also given.
...
Muhammad Umar1, Muhammad Arshad2, Mubashar Hussain1*, Moazama Batool3 and Muhammad Faheem Malik1
...milies, 28 genera and 37 species visited the wetland in 2010, whereas in 2011, 21,302 birds belonging to six orders, nine families, 20 genera, and 28 species. Twenty two bird species were observed to be common in both years. The most abundant species were the Black-headed gull and the great cormorant in both years. The density of population was higher in...
Abdul Rauf Bhatti1*, Ahmed Zia1, Falak Naz2, Amjad Usman3, Rukhshanda Saleem4, Ghulam Sarwar5 and Amad Ud Din6
 
 
... P. limbatus. The species were recorded from walnut (Juglans regia) trees and Khabbal Grass (Cyanodon dactylon), which highlight their importance. Keeping in view topographic gradients, ecological complex in Pothohar plateau and pest status of curculionid weevils, further surveys are suggested to unveil more important records from the area.
...
Javeria Afzal, Muhammad Abid, Faisal Hussain* and Alia Abbas
...10%) of these five plant species were made for the experiment. All selected plant species inhibited egg hatching and caused larval mortality. Maximum reduction (24.3%) in egg hatching was recorded in C. album stem extract at 2% concentration. The minimum reduction (0.33%) was observed in the leaf extract of A. viridis at 10% concentration after 48 hours of exposure time. In larval mortality test, maximum larval...
Qin Liu1,2, Bin Wang1,3, Yu Xu1,4, Xiuyue Zhang1, Tao Zeng1* and Jianghong Ran1*

 

...no chromatic Galliformes species, is an endangered bird endemic to western China. Previous studies suggested that it had the behavior of facultative cooperative breeding, which was rarely reported in Galliformes. In this study, we isolated 17 tetra-nucleotide microsatellite loci to test parentage and kinship for a wild population with 29 individuals from 10 different families (A-J). The 17 loci with the mean polymorphic information content (PIC) of 0.566 and t...
Muhammad Umar1, Mubashar Hussain1*, Muhammad Faheem Malik1, Muhammad Naeem Awan2 and David C. Lee3
...and Vatala. In total, 52 species were recorded, which included the globally threatened sociable lapwing. The most abundant species were asian green bee-eater, red-vented bulbul, house sparrow and common myna, and no species was unique to a single site in the DVNP. Highest abundance, richness and diversity was recorded in Deva, with lowest community measures recorded in Barmala.
Muhammad Hamayoon Khan*, Niaz Hussain Khuhro, Muhammad Awais, Muhammad Usman Asif and Raza Muhammad
 
 
... Pakistan, two fruit fly species, Bactrocera zonata (Saunders) and B. dorsalis (Hendel) cause severe qualitative and quantitative damages to various fruits. The present study was executed to record the population dynamics of these fruit fly species in guava and mango orchards with respect to meteorological factors using methyl eugenol-baited traps. The results revealed that population of both the
Malik Muhammad Yousaf1*, Muhammad Mohsin Raza1*, Mumtaz Hussain1, Jahangir Shah1, Rao Wali Muhammad1, Sami Ullah2,3, Hera Gul4, Ijaz Ahmad5 and Muhammad Zeshan6
 
 
...;">Among arid zone plant species, Jojoba (Simmondsia chinensis), being an evergreen, perennial, multi-stemmed, and multipurpose plant has attracted wide attention due to its economic value, potential by-products and ability to withstand vagaries of the desert environment. By realizing the economic importance of this high-value desert plant, a pioneer study on seed germination response to various agro-climatic factors was conducted at the Arid Zone Resea...
Ijaz Haider1*, Muhammad Akhtar1, Ali Noman2 and Muhammad Qasim3
...tion fluctuation of five species of rice pests namely white stem borer Scirpophaga innotata (Walker), yellow stem borer Scirpophaga incertulas (Walker), rice leaffolder, Cnaphalocrocis medinalis (Guenée) (Lepidoptera: Pyralidae), whitebacked planthopper Sogatella furcifera (Horvath) (Homoptera: Delphacidae), and pink stem borer Sesamia inferens (Walker) (Lepidoptera: Noctuidae) on light trap. The effect of some abiotic...
Muhammad Tahir Waseem1, Abdul Majid Khan1*, Abdul Ghaffar2, Ayesha Iqbal1 and Rana Manzoor Ahmad1,3
...ls of three hipparionine species from Dhok Pathan Formation (late Miocene) has been utilized in this study to reconstruct the palaeodiet and palaeoecology by using stable isotope analyses of carbon and oxygen of tooth enamel carbonate. A gradual increase in hypsodonty and complexity in plications indicate the drier environments with hard and tough food available during the late Miocene. The late Miocene hipparionines were expected to have inhabited a mosaic of...
Muhammad Bilal Anwar1, Mirza Azhar Beg1, Amjad Rashid Kayani1, Muhammad Sajid Nadeem1*, Syed Israr Shah1, Sajida Noureen2
Muhammad Mushtaq1 and Tariq Mahmood3
...in the diet of three owl species in an uncultivated area with rapid urbanization all around to better understand their ecological significance. Regurgitated pellets of three owl species (n = 434) were collected seasonally from the study area. The food of the spotted owlet and eurasian eagle owl was found significantly different (P< 0.05) across seasons whereas no seasonal differences were seen in collared ow...
Baochao Liao1,2, Xiujuan Shan2,3* and Yunlong Chen2,3
... a population-level on a species to be examined. The present study applied a DEB-ABM to the Japanese anchovy Engraulis japonicus. The DEB-ABM accurately captured energy acquisition and allocation throughout the anchovy lifecycle (egg, yolk sac larva, exogenous feeding larva, juvenile, and adult) and predicted how individual-level processes affect energy dynamics at higher levels of biological organization. We estimated primary model parameters (e.g., en...
Muhammad Qayash Khan1,2, Muhammad Zubair Anjum2, Muhammad Adnan3, Abbas Khan1, Hafsa Zahid1, Javed Nawab4, Sher Zaman Safi5Muhammad Ishaq Ali Shah6, Atif Kamil7 and Abid Ali1*
...ong closely related fish species the taxonomic ambiguities arose as a result of morphological similarities which not only conceal the genetic diversity but also pose problems in fisheries management and conservation practices. The purpose of the present study was a molecular characterization of fish species of economic importance belonging to the genus Schizothorax, Tor and Mystus collected from various rivers ...
Ammara Gull-e-Fareen1,2, Imran Bodlah1,*, Muhammad Adnan Bodlah3, Muhammad Tariq Rasheed1, Habib Ali4 and Muhammad Asif5
... a Holarctic genus; some species of Callaspidia attack the larvae of order Diptera and Coleoptera. Callaspidia notata (Boyer de Fonscolombe, 1832) (Hymenoptera: Figitidae: Aspicerinae) is reported with colour variations like scape, pedicel and basal part of antennal segment 3 slightly darker than remaining segments, scutellum and mesopleura mostly dark reddish with some darker areas, legs also reddish brown except tarsal segments lighter in colou...
Iftikhar Hussain1, Sardar Azhar Mehmood1, Muzafar Shah2*, Mohammad Salim3, Shabir Ahmed1, Sana Ullah1,Sidra Batool4, Nadia Saeed1 and Khalid Usman1
...in the present study for species level identification and phylogenetic relationships.
...
Riffat Sultana1*, Nuzhat Soomro2, Santosh Kumar3 and Ahmed Ali Samajo2
...the mating behavior of 4 species of Oxyinae: Oxya hyla hyla Serville, 1831, O. velox (Fabricius, 1787), O. fuscovittata (Marschall, 1836) and Oxyina bidentata Willemse. In trials carried out in laboratory we verified the following mating sequence: (1) sexual recognition by antennation; (2) courtship with male turning his abdomen towards the female performing mediolateral antennae vibration and jerking its body antero-posteriorly. We...
Tanveer Hussain, Masroor Ellahi Babar*, Akhtar Ali and Fiaz Hussain
...equences of other animal species available on NCBI including European bison, Indian bison, Tibetan antelope, wild yak, domestic goat, sheep, water buffalo and cattle for biological positioning of dromedary camel. The results reconfirmed the classical biological classification.
...
Saba Shabeer1, Riffat Tahira2 and Atif Jamal3*
 
... than 1.5 million fungal species exist in the world, amongst them pathogenic species can attack plants at different stages causing considerable damage amounting to millions of rupees. One of the plant pathogenic fungi is Fusarium spp. Fusarium species are very well-known soil-inhabiting fungi that cause many economically important diseases of crops.Many ...

Muhammad Ihtisham1, Noor Amjad2, Muhammad Nauman3, Asghar Ali3, Khawar Riaz3, Muhammad Sajid3, Muhammad Owais Shahid*3 

 

.... However, several plant species have water-impermeable hard seeds which take a long time to germinate. The hard seed coat can be scarified successfully through acid treatment. Sophora is a beautiful ornamental plant and its seeds have the same issue. In this experiment, seeds of Sophora secondiflora were treated with H2SO4 and then sown at different dates. Both H2SO4 scarification and sowing time had a significant effect on germination and seedling growth. Th...
Aylin Celile Oluk1*, Ugur Serbester2, Murat Reis Akkaya3 and Oya Berkay Karaca4
...>Various factors such as species, breeds, lactation stage and location affect milk composition. We evaluated the composition of Kilis goat milk in two different seasons on the basis of alcohols, ketones, aldehydes, esters, indoles, carboxylic acids, aromatic hydrocarbons and terpenes. Milk samples were collected at the early and late lactation periods from Hatay and Kilis, Turkey. During both periods, the goats consumed a diversity of plant
A.E.S. Patrick1,*, S. Kuganathan2 and U. Edirisinghe3
...pecimens belonging to 10 species, 9 genera and 5 families of local fish in Vavuniya reservoir, Sri Lanka during January, 2013 to August, 2014. The regression coefficient value ‘b’ from LWR and statistical comparison from the ideal value (b=3) were used to find the growth patterns. Most of the local species showed isometric growth except Amblypharyngodon melettinus, Puntius sarana and <...
BamideleAkinsanya1, Isaac O Ayanda2,*, Benson Onwusa1 and Joseph K Saliu1
...ethod. Only one parasite species, Teneuisentis niloticus, an acanthocephalan was recovered. There was 72% infection prevalence. The result also revealed that both BTEX and PAHs were accumulated in the body of the parasite. Two components of BTEX, (1,2-dichlorobenzene and 1,3-dichlorobenzene) and five PAH congeners-Acenaphthylene, Phenanthrene, benz(a)anthracene, benzo(a)pyrene and 7,12-dimethylbenz(a)anthracene were not detected in the parasite. Total B...

 Amjad Ali1*, Pirzada Jamal Ahmad Siddiqui1, Naveed Ahmad2,Shabir Ali Amir3, Rafaqat Masroor3,Seema Shafique1 and Zaib-un-Nisa Burhan1

...ined. A total of 58 fish species in 33 genera and 24 families were recorded at 10 different dive sites. High diversity occurred at Churna Island following Mubarak Village and Astola Island. Majority of the recorded fishes were planktivorous. Compare to Churna and Mubarak Village, physico-chemical parameters at Astola Island were found in limits as preferred by fish and coral communities for their proper growth. Fish accumulation appeared to be link with coral ...
Muhammad Moosa Abro1*, Nadir Ali Birmani2 and Muhammad Bachal Bhutto3
...nthic examination of two species of freshwater fishes, Mastacembelus armatus and Oreochromis niloticus collected from the Indus river of Sindh Pakistan, revealed presence of subgenus Spirocamallanus of genus Procamallanus. The subgenus was characterized by the presence of spiral thickening in buccal capsule. The prevalence of subgenus was higher in Mastacembelus armatus (33.33%) than Oreochromis niloticus (7.69%). Ther...
Titin Herawati1,*, Indra Adiwiguna1, Ayi Yustiati1, Iis Rostini1, Roy Hendroko Setyobudi2, Hafizan Juahir3 and Asep Sahidin1
 

...ve method by mapping the species and comparing the diversity of fish living in both ends of Jatigede Dam. The results indicate that six families of fish are identified, consisting of 14 species. The fish diversity of Cimanuk River upstream Jatigede Reservoir is of moderate one – 1.735≤H’≤1.909 – with low species dominance, while containing high equitability 0.61≤...
Muhammad Farooq1*, Allah Rakha2,Jawad Ul Hassan2, Iftikhar Ahmed Solangi1, A. Shakoor3, Muhammad Bakhtiar4, Muhammad Noman Khan5,Shoaib Khan5, Ibrar Ahmad6, Shabir Ahmed7 andWang Yunyang1*
 

...l;">At global level many species of eatable mushrooms have been used for diet and medication purposes. In addition to its dietetic value mushroom have many medicinal importance because mushroom is used against several viral, bacterial and cancer diseases. Mushroom powder also used to reduce blood pressure and increase resistance of person against many diseases. Keeping in perspective the position of dietary and medicinal values of mushroom in this research mus...

Ijaz Ahmad* and Bakhtiar Gul

...s not possible for other species to sustain, because several broadleaf weeds are highly competitive and make a high canopy over the crop to get more light for photosynthesis and the morphological mimicry of A. fatua with wheat crop during the vegetative growth stage. It cannot be easily distinguished from wheat seedlings. Results showed that wheat in weed-free conditions had maximum biomass, and leaf area index in both the growing season as compared to weeds (...

Salma Javed and Samreen Khan*

...e Agar (PDA). Two fungal species Fusarium oxysporum and Aspergillus niger were examined for their aptitude to assist the population rate of the said species. Nematodes were collected from soil around the rhizospheres of sponge gourd (Luffa cylindrical L.) field in the vicinity of National Nematological Research Centre, University of Karachi and further processed by Cobb’s sieving and Baermann’s funnel techniques....
Alamaary Mohaammed Saad1,3, Abd Wahid Haron1*, Mohamed Ali2
Mark Wen Han Hiew1 and Lawan Adamu1
...xcessive reactive oxygen species (ROS) and the capacity of the antioxidants could affect the OS level in the frozen semen. This study was to determine the addition of different concentrations of antioxidants to evaluate oxidative stress and fertility of frozen semen in horses. Seven stallion were used for semen collection in this study. A total of twenty ejaculates was collected from three healthy stallions twice a week for the experiments 1 and 2. All ejacula...
Ahmed Saud Alsaqufi1, Sheikh Mustafizur Rahman2,3*, Roshmon Thomas Mathew2, Yousef Ahmed Alkhamis1,2, Md. Moshiur Rahman3,4 and Muhammed Aslam Pathiri2
...ession in different fish species. The present study was, therefore, intended to explore whether these light and shelter could influence some phenotypic traits of African catfish larvae under laboratory condition. Newly hatched larvae were stocked in plastic aquaria (10L) at a rate of 5 individuals/L and reared for one month under four treatments such as 24h light (24L), 24 h dark (24D), 12h light and 12h dark with PVC (12DL_PVC), and 12h light and 12h dark wit...
Hesham Saeed1*, Manal Abdel-Fattah1, Ahmad Eldoksh1, Farid S. Ataya2 and Manal Shalaby3
...FNα genes of other species, including C. ferus, Vicugna pacos, and Homo sapiens. Expression of C. dromedarius IFNα cDNA in Escherichia coli revealed a fusion protein with a weight of 22.5 kDa after induction of expression with IPTG for 5 h. The recombinant IFNα was expressed in the form of inclusion bodies that were separated and solubilized in vitro and the protein was refolded using SDS and KCl. The...

Ali Ahmad1*, Zubair Aslam1, Korkmaz Bellitürk2, Naeem Iqbal3, Muhammad Idrees3, Muhammad Nawaz4, Muhammad Yasir Nawaz5, Muhammad Kashif Munir6, Ahmad Kamal1, Ehsan Ullah1, Muhammad Ahsan Jamil1, Yousuf Akram1, Tanveer Abbas1 and Muhammad Mohsin Aziz1

... production by different species are also included in review. The paper also reveals fitness or compatibility of different species of earthworms to ‘bioprocess’ variation in different forms of organic waste. The review also presents the basic idea of all those research studies about effect of vermicomposting on different parameters of plant growth. Such an explanatory review is remarkably few and far among studie...
Abdul Muhaimin Wahab1, Basit Zeshan2,*, Naveed Ahmed2, Muhammad Afzal2 and Muhammad Naveed2
...i is the most common species for majority of human enteritis cases. The present study was conducted to determine the prevalence of C. jejuni, risk factors associated with the occurrence, identification control and preventive measure to reduce the prevalence in broiler chicken farms in Kelantan state located at east coast region of peninsula Malaysia. Eighty cloacal swab samples were collected from 4 different broiler chicken farms in district Tumpat...

Hira Soofi, Abdul Rasool Abbasi and Arifa Bhutto

...t-align: justify;">A new species Contracaecum malhi collected from catfish Wallago attu Bloch and Schneider, 1801 of Indus river of Sindh, Pakistan. Totally, 41 specimens of host were collected. The host specimens were dissected longitudinally, viscera put into petri dishes for examination of nematodes and were process through standard method of temporary slide. A new species, Contracaecum malhi, were identifed in having dif...

Salma Javed, Samreen Khan*, Nasira Kazi and Tabassum Ara Khanum 

...n: justify;">Three known species belonging to order Rhabditida were recovered from sewage and stagnant water with sediments from different location of Karachi, Sindh, Pakistan. In this study, two genera, Rhabditidoides and Butlerius and three species identified as Rhabditidoides stigmatus, Butlerius micans and Demaniella basili were recorded for the first time in Pakistan. The percentage occurrence of these genera was found ...

Zafar Ahmad Handoo1*, Mihail Radu Kantor1 and Ekramullah Khan2

...mmu and Kashmir, ten new species including two new genera of following were recovered: Fotedaronema kashmiriensis gen. n. sp. nov., from soil around roots of Pyrus communis L. from Sonamarg, Parasicagutter chitwoodi gen. n. sp. nov., from soil around roots of Pyrus malus L. in Pattan, Kochinema pahalgamiensis sp. nov., from soil around roots of Brassica oleraceae from Pahalgam, Kochinema kanganiensis sp. nov., from soil around roots of Lycopersicum esculentum ...
Fuhua Zhang, Yishuang Yu and Shibao Wu*
...olins and other pangolin species.
...
Hamed A. Ghramh1,2,3, Zubair Ahmed1,2,4 and Khalid Ali Khan1,2,3*
...-spacing: -0.1px;">A new species viz., Stantonia hayati Ahmad, sp. nov., is described and illustrated from India, while S. hammersteini Enderlein, 1908is recorded from Saudi Arabia. Affinities of the new taxa with related species have also been discussed. The genus Stantonia is also recorded for the first time from Saudi Arabia.
...
Khurram Goraya1,*, Qais ALRawahi1, Sultan ALBalushi1, Hani ALSaadi1, Sami ALRahbi1, Zahir ALAlawi1, Muhammad Hammad Hussain2 and Madad Hussain1
...eases occurring in these species. This study aimed to evaluate the causes of mortalities at WWR. During July to October 2019, fifty mortalities were observed at WWR. These mortalities consisted of 10 Arabian oryx and 40 Sand gazelles. All carcasses were subjected to the detailed post-mortem (PM) examination to find out the potential cause of death. Fatal injuries caused by fighting were the major cause of deaths (n=17, 34%) followed by cyclone related deaths (...
Aiguo Zhou1,2, Di Sun1,2,Shulin Liu 1,2, Yongyong Feng1,2, Yue Zhang3
Yanfeng Chen4, Shaolin Xie1,2* and Jixing Zou1,2*

 

... identification for fish species, which has a fast evolutionary rate. And thus, in the present study, investigation of genetic comparison was performed based on the complete sequences of mtDNA control region for “Bicolor” and “White” types of northern snakehead (Channa argus) due to an uncertain classification of them. The results showed that the genetic distance for the inter-species ranged fr...

Muhammad Yousif Jakhrai1, Ahmed Nawaz Tunio2, Ali Mujtaba Shah1*, Tarique Ahmed Khokhar1, Muhammad Mohsen Rahimoon1

...sia in ovine and caprine species were 2% lidocaine and xylazine were included in this study. This study showed that administration of xylazine in high epidural anesthesia produce a significant analgesic and sedative effect for laparotomy (peritoneal) surgical interventions in ovine and caprine species as compared to lidocaine. 
 
Novelty Statement | This comprehe...

Muhammad Afzal1, Muhammad Irfan Ullah1*, Muhammad Hamid Bashir2, Shah Najaf Mukhtar1, Muhammad Arshad1, Nimra Altaf1

...hout the world, and some species are important pests of fruit crops, field crops, vegetables, and weeds. In the present study, extensive sampling was done to assess mites’ biodiversity in different citrus orchards of Kinnow, Musambi, and Feutrell’s early at tehsil Sahiwal Sargodha, Sillanwali, and Bhalwal of district Sargodha. Sampling was done at fifteen days interval to record the population dynamics and identification of citrus mites during 2018...

Aioub Sofizadeh1, Ehsan Allah Kalteh2, Shahin Saeedi3, Mulood Mohammadi Bavani4*

... on the scorpion’s species in Golestan Province, Northeast Iran. Scorpions were captured during day and night using rock rolling and ultra violet methods from May to September, 2019. Then, the specimens were put into a 75% alcohol-containing plastic bottle. Finally, the specimens were identified using a valid identification key. Distribution maps were prepared using ArcGIS (Ver 10.4.). A total of 111 scorpion samples were captured. All the samples belong...

Saima Naz1*, Ahmad Manan Mustafa Chatha2, Saba Saeed1

...entrations) for two fish species viz. Labeo rohita and Cirrhinus mrigala was determined in this study. During metal stress trials both species were kept at constant temperature (32°C), pH (7) and hardness (250 mg L-1) of water. Physico-chemical parameters of test medium were monitored regularly. The observed mean LC50 and lethal concentrations for Cirrhinus mrigala were 55.85 ± 2.84 and 128.44 ± 9.25 mg L-1...

Halil Erhan Eroglu

...osomal data of 36 female species and 32 male species of family Cervidae were detected, namely (i) karyotype formulae, (ii) symmetry/asymmetry index values (iii) karyotype types. According to the chromosomal data, two phylogenetic trees were formed. The phylogenetic trees were showed karyotypic relationships among the taxa.
 
Novelty Statement | This is the first repor...

Safia Bibi1, Saima Naz1*, Saba Saeed1, Ahmad Manan Mustafa Chatha2

...xicity in different fish species as it provides accurate data on effects of different contami-nants on fish. Hence, histopathology must be consider to monitor contaminated aquatic systems.
...
Tariq Mahmood1*, Luqman Ullah Khan1 and Muhammad Naeem2
...oximately more than 2060 species of birds. In Pakistan, there are more or less 660 bird species belonging to 23 orders and 74 families. The abundance and diversity of avian species in a specific habitat can serve as a useful measure of their ecological status. In response to land use changes, 20-25% of pre-agricultural birds have vanished. In the current study, we documented diversity and ...
Yawang Sun, Yongjiang Wu, Jingbo Chen, Zili Wang, Juncai Chen, You Yang and Guozhong Dong*
...ction of reactive oxygen species increased in a dose-depend manner. Cellular concentrations of oxidative damage markers were positively correlated with applied LPS concentrations. Total antioxidant capability and the activity of superoxide dismutase (SOD) increased with increasing LPS concentrations. Gene expression of antioxidants including SOD, NADPH-quinone oxidoreductase 1, and hemeoxygenase 1 were significantly increased at the LPS concentrations of 12.5 ...

Saba Aleem1*, Iram Sharif2, Mehvish Tahir3, Muhammad Najeebullah3, Ali Nawaz1, Muhammad Imran Khan1, Amina Batool1 and Waheed Arshad1 

... lead to reactive oxygen species scavenging to protect cell membranes.

...
Yahong Guo1,3, Zeqin Fu1,3, Jiantong Feng1,3, Chengrui Yan1,3, Yingying Ye1,3*, Kaida Xu2 and Baoying Guo1,3
...main aquaculture bivalve species in Southeast China Sea, and excellent growth characteristics. For mussel breeding, farmers use wild individuals to multiply the cultured populations. However, blind selection of wild parents has inevitably resulted in inbreeding and decreased genetic variation. In this study, four wild specimens groups (ZSW, WZW, NNW, and FZW) and four cultured specimens groups (ZSC, WZC, NDC, and FZC) of M. unguiculatus were used to ana...

Hajira Nur-ul-Islam1, Ahmed Zia2*, Khurshaid Khan1, Hirad Ali3 and Abdul Aziz3

...ntial characters for the species, previous global records, habitat description, measurements of body parts and ecological data for the positive localities are provided. With the addition of this taxon, Anisoptera fauna of Pakistan now counts 74 species. The area carries important ecology and is less explored for odonate fauna. Although in recent past, few faunistic studies were conducted in this area; yet these couldn’...

Muhammad Shakil Ahmad1*, Muhammad Afzal1, Sylvain Nafiba Ouedraogo2 and Muhammad Zeeshan Majeed1

...ral crops. This sporadic species is becoming an emerging threat to the potato crop in central Punjab and is being evidenced infesting potato crop in Sargodha, Faisalabad and Okara districts. This in-vitro study assessed the comparative feeding preference, food consumption and utilization rates and larval development of S. litura on different white and red skinned potato cultivars. Feeding bioassays revealed that all parameters including leaf weight loss, larva...
Sadaf Aslam1*, Abdul Majid Khan1 and Muhammad Akhtar2
...ing feeding habits. This species migrated to Potwar land when grasslands became established. It has typical suine characters with hypsodont dentition and complex infolding of enamel surfaces. The described material consists of isolated molars. This discovery will provide a new insight to understand the diversity and geographic distribution of Siwalik Suids.
...
Zhi Wang1*, Wenhua Liu2 and FadaoTai3
...ared with other squirrel species. Still, its circadian activity patterns and time budgets in different behaviors remain unclear. Using artificial population of the animal bred in a simulated natural environment, activity patterns and time budgets were investigated. The results showed that the species was clearly nocturnal but varied greatly in the number of daily activity bouts showing bimodal patterns in winter, trimodal pa...
Bin Liu1,2, Libo Wang2, Dandan Xue2, Peng Xu1, Yuting An2 and Changhu Lu1*
...quality habitat for this species, and birds pass this location quickly in search of other suitable habitats.
...

Kiran Shahjeer1*, Gauhar Rehman1, Khurshaid Khan1 and Toheed Iqbal2

...tudy revealed that three species belonging to genus Lepisiota as a major outcome of this taxonomic study. The species include L. frauenfeldi, L. simplex, L. opaca and its sub-species L. o. pulchella. Among them two species viz., L. simplex, L. opaca and a subspecies of L. opaca i.e. L. o. pulchella are reported as firs...
Assefa Tessema Tecklie1*, Abebe Getahun Gubale1, Seyoum Mengistou Yilma1, Tadesse Fetahi Hailu1 and Eshete Dejen Diresilign2
...on the Nile tilapia fish species in Lake Hayq. A total of 198 fishermen selected randomly from Kebeles bordering Lake Hayq were used as respondents for structured questionnaires. In addition to this, 30 fish traders and 8 fish hotel owners specialized in fish dish were used as key informants. The average age of fishermen was around 36 which were in active force age group (< 65 years). Most (97%) of the fishermen used gillnets imported from Egypt with mesh s...

Hassan Naveed1*, Kamran Sohail2, Gul Zamin Khan3 and Yalin Zhang2

...st with distribution for species of genus Parallygus Melichar is also provided.

...

Sagir Hussain*, Qamar Abbas, Abdur Razzaq and Sher Wali Khan

...stan, four cyst nematode species viz., Heterodera avenae Wollenweber, 1924; H. mani Mathews,1971; H. schachtii Schmidt, 1871 and H. zeae Koshy, Swarup and Sethi, 1971 were detected from all four districts.

...

Shaista Shafi* and Amjad Farooq

...e of aphids in different species of brassica at Agricultural College of Bahauddin Zakariya University Multan, Punjab (Pakistan) during 2014-2015 and 2015-2016. Four brassica species (B. carinata, B. rapa, B. napus and B. juncea) were seeded from October to November at different dates (Octo 20, Nov 05, Nov 20) in RCBD design (Randomized Complete Block Design) with standard cultivation procedures to detect the effect of sowing...

Hussan Ara Begum1, Muhammad Hamayun1, Noor Shad1, Waqar Khan3, Jawad Ahmad1, Muhammad Ezaz Hasan Khan2, David Aaron Jones2 and Kishwar Ali2*

...ation percentage in both species. The germination percentage in control was recorded as 19.35%, while it was 18.65% in 30min and 19.00% in 120min exposures. Root and shoot growth of the seedlings was markedly reduced by increasing UV radiation. The shoot length was 2.40mm in control, 2.75mm in 30min, 1.50mm in 60min and 1.60mm in 120min of exposure to the UV light. The root length in control was 1.38mm, 0.90mm in 30min, 1.00mm in 60min and 1.17mm in 120min exp...
Asif Sadam*, Rahmat Ullah Khan and Sajid Mahmood
... traits that enable bird species to become urban exploiters i.e. to colonize and become abundant in highly urbanized areas. Bird species were identified in point counts without distance estimation, in three habitats: urban area, residential area, and agricultural area. Twelve sampling sites were selected in well-defined habitats in Mardan district. Bird species traits were taken from field...
Ghulam Raza1*, Maqsood Anawar2, Muhammad Akbar1, Muhammad Ali1, Alamdar Hussain1, Azhar Hussain3 and Tanveer Hussain4
...ex sibirica) is a subspecies of Capra ibex, and is evenly distributed throughout the upper comparatively dry mountains of Gilgit-Baltistan, Pakistan. It is categorized as a Least Concern species globally as well as in Pakistan, however its presence in the Karakorum mountain plays a significant role in the economy of the region as dozens of trophy hunting of this specie takes place in the region every year a...
Muhammad Ramzan1*, Unsar Naeem-Ullah2, Muhammad Umair Sial2, Naeem Iqbal2 and Shafqat Saeed2
...for these precious plant species in various countries. The larvae of the pest can cause 80-100% defoliation. The various confirmed host of T. varians include Ficus benjamina, F. religiosa, F. benghalensis, F. caraica, F. infectoria, F. elastica, F. nitida, Artocarpus communis, A. heterpphyllus and A. kamansi. Fairly limited studies are documented for its chemical and biological management. For chemical control, deltamethrin was proved more toxic while among bi...

Ahmed A. Kheder

...nto ten herbaceous plant species, different types of symptoms have been observed associated to virus infection on indicator hosts; Mentha spicata, Chenopodium quinoa, Nicotiana tabacum cv. White Burley and Vicia faba after 15, 18, 20 and 22dpi respectively. Reverse transcription polymerase chain reaction (RT-PCR) was used to amplify ~497bp for coat protein gene in RNA 2, the amplified product was confirmed with direct sequences. Phylogenetic analysis results i...

Sehrish Khudadad1, Muhammad Ather Rafi2, Ahmed Zia3, Mian Sayed Khan4, Gulnaz Parveen5, Muhammad Kamal Sheikh6*, Falak Naz7, Muhammad Qasim8 and Syed Waqar Shah9

...trict Mansehra. Total 28 species were identified under 16 genera of three sub-families, namely Camponotinae, Myrmecinae and Ponerinae. Subfamily Myrmicinae represented 20 species under 10 genera, followed by subfamily Camponotinae with seven species under five genera, while a single species from subfamily Ponerinae has been identified. Among 28 identifie...

Ghulam Murtaza1*, Muhammad Ramzan2, Assad Ullah3, Abid Ali5, Ayesha Zafar3, Rukhsar Beanish3, Ahmad Ali4, Ghulam Mustafa4 and Mudassar Aslam4 

...dult emergence fruit fly species were identified based on diagnostic morphological features and placed in separate cages. Different fruits such as guava, apple, fig, banana and citrus were exposed to Bactrocera zonata for oviposition. Fruits were placed in cage to assess the host preference for oviposition fruits having equal weight (500g). Fifty pairs of 11-12 days old adult of B. zonata were released in cage for 24h to determine their oviposition. The study ...
Ala’audin Hakami,1AusamaA Yousif,2* Mohamed Zaki,3 Mahmoud Ismail,4,5 Ahmed Al-Ali,5 Abdu-Rahman Al-Ankari5 
...isolates indicating interspecies transmission.
...
Sallam A.A.A.1, Hoda M.A.Waziri2,E. K .F. Elbeshehy1, SamiaI.Massoud,1 and Abeer M. Abo El-Wafa2.
...hirty three tested plant species, and
cultivarsbelonging to six different families. It was transmitted mechanically and not
transmitted by seeds or aphids. The isolated virus was inactivated by 10 min exposure
to 95°C, but not at 97°C, at a dilution of 10ˉ3,and at3 weeks storage at room
temperature. The BBMV was tested serologically against antibodies of Broad bean
stain virus (BBSV) and (BBM...

Mokbel, Samah A.1,Ahmed K. El Attar1; Azza G.Farag2.

...is a valuable ornamental species widely planted in Egypt. The
Phytoplasma associated witches‟-Broom has been detected on symptomatic hibiscus
plants. Samples of hibiscusleaves were collected from El Giza, Alexandria, Qlubia,El-
Fayom, and El-Mansouragovernoratesand analyzed for phytoplasma infection.The
collected hibiscus plants showed characteristic symptoms for Phytoplasma associated
witches‟-Br...

Mai A. Kilany1; Hanaa H.A. Gomaa1; Yousry E. Abo El-magd2 and Nermin Raafat2.

...ction of reactive oxygen species (ROS) in hepatocytes leading to their proliferation and triggers HCC. Manganese superoxide dismutase (MnSOD) is a nuclear-encoded antioxidant enzyme that neutralizes free radicals. Val16Ala single nucleotide polymorphism (SNP) is one of the most widely investigated SNPs in the MnSOD gene, where C to T transition resulting in the con-version of valine to alanine at amino acid 16 within the mitochondrial signaling se-quence. This...

Fawzy Rania1, AboElkhair M.1, Bazid A.M.1, Sultan H.2, Hussien A.H.3

...ng IBV which called quasispecies. Serotypic and or genotypic classification of IBV is mainly based on the S1 subunit of Spike (S) gene. In the present study, thirty tracheal samples of broiler flocks suspected to be infected with IBV were collected from different Egyptian governorates during 2012. Isolation and genetic characterizations were carried out for only ten samples which were positive for IBVs. Multiple nucleotide and amino acids alignments revealed p...

Serag eldeen Sultana, M.W Abdel azeemb, Nahla Mohamed Eldamranyc

..., (16) families and (23) species. The serum samples were examined using IDEXX MultiS-screen AI Antibody ELISA kit coated with AIV nucleoprotein and hemagglutination inhibition (HI) test against H5 and H9 antigens. The overall results using both ELISA and HI tests revealed that the prevalence of AIV antibodies was 12.6% (18/143). The seropositive samples represented 5/143 and 15/108 for ELISA and HI, respectively. The detection of both H5 and H9 antibodies in (...
Amro A. Farrag1; Ahmed K. El-Attar1; Om-Hashem M. El-Banna2; Ibrahim A. I.2; H.
M. Mazyad1
...mon bean onto twenty two species and varieties
belonging to six different families i.e. Moraceae, Solanaeae, Cucurbitaceae,
Leguminoceae, Chenopodiaceae, and Malvaceae using viruliferous whitefly (Bemisia
tabaci). Results revealed that SLCV could be transmitted to 16 out of 22 species and
positively back inoculated to beans from these hosts. Nucleotide sequencing of the
...

Eman A. H. Kattab1,3, A. H. Ebrahem2 , Om-Hashem M. El-Banna2 and Hanan F. EL-Kammar³

...ted systemically with 12 species belonging to Fabaceae and locally with 2 species belonging to Chenopodiace. It was transmitted mechanically and by Sitona lineate. It was detected serologically by indirect ELISA using BBMV specific antiserum. Light microscopy of epidermal strips of faba bean infected-leaves revealed amorphous cytoplasmic inclusions (X-bodies). The UV absorption spectrum of the purified virus had a maximum at...

Amira A. Mazyad1; A. A. Kheder1; Ahmed K. El-Attar1; W. Amer.2; Mahasen, H. Ismail.2; Amal, A.F.1

...erry plants onto 16 host species belonging to seven families. Typical leaf curling, chlorosis, vein clearing and stunting were appeared on indicator host (cucumber) 3 weeks post inoculation. Stability experiments of SLRSV showed that the thermal inactivation point was 48-62°C; the dilution end point was 10-4 to 10-6 and the longevity in vitro 10 - 18 days at room temperature. The diagnosis of SLRSV in the infected tissues of strawberry plants was performed...

Magdy, Mariam1 ; Abou ElHassan D.G. 2 ; and Salem, S.A.H 3

...rotypes in governorate , species and percent of inhibition . Solid Phase
Competitive ELISA was applied for the negative 152 sera samples to measure the titer of
antibody against strains A,O, SAT-2 with high titer of antibody against serotype (A) was 87 ,
serotype (O) was 72 and serotype (SAT-2) was 53 . Matching between SNT and ELISA was
applied for negative sera samples.
...

Amany Adel1, Abdelsatar Arafa1, Hussein A. Hussein2 and Ahmed El-Sanousi 2

... between different avian species. PL motif ESEV was found in 6 isolates from chicken and ducks circulating in such population whereas 17 viruses have ESKV similar to those reported in human in 2006. Based on NS1 sequence analysis of the H5N1 Egyptian viruses, neither geographic nor species signature were reported. This study indicates independent evolution of NS1 gene in Egyptian viruses that is not related to HA gene groupi...

Ramy A. Qabel1; Tarek F. El-Arabi2; Adel A. Shoukry1; Hassan H. Elsebaay1; Abdel-Aziz F. El-Hamahmy1

...infect many of Rhizobium species and strains. The other group of phages was less virulent and showed turbid plaques implied as group L. This was also determined by one-step growth experiment. It was found that rhizobiophage (V) group had the attachment and latent period after 30 min and burst size of 28. On the other hand, rhizobiophages (L) group had the attachment and latent period after 20 min and burst size of 9. The Group L even though they had low adsorp...

Shahida Sabir1, Anwar Ali Shad1, Tariq Masood1*, Zafar Ali Shah1, Nasiruddin2, Yaseen Ahmad1 and Syed Sartaj Alam3 

...nst all the three fungal species (Penicillium claviforme, Aspergillus flavus and Fusarium sp.). Methanolic extract of P. eryngii showed increasing % mortality against red flour beetle (Tribolium castaneum) in methanolic extract with increasing concentration after 24 and 48 h exposure time. Maximum mortality (100%) was noticed at 300 mg/L after 40 h exposure time. Hence, methanolic extract of P. eryngii can be used as a natural pesticide, especially in stored g...

Maha A. El-Abhar1, Moustafa A. Elkady1, Khaled M. Ghanem2, Hussieny A. Bosila3

...action of thirteen plant species and cultivars belonging to four families (Amaranthaceae,
Solanaceae, Fabaceae and Laminaceae) to AMV infection was demonstrated. The presence or
absence of the virus was verified by back inoculation onto healthy indicator host plant and/or ELISA
test. AMV was readily transmitted by mechanical means and by Myzus persicae with percentage of
60 %. In addition to visible symptoms, inf...
Maha M. Khedr1, Reem A. Suliman1, Marwa F. Mohamed1, Mounir D. El Safty1, Hussein A.
Hussein2
...orses, and numerous bird species. Maternal derived antibodies could interfere with the
efficacy of vaccination against avian influenza in early age in chicks.
Methods: Eight groups of one-day old commercial broiler chicks were kept in isolators along the whole
period of the study. Groups 1, 2 and 3 were vaccinated with the prepared vaccine; group 4, 5 and 6 were
vaccinated with one of the imported reassortant H5N...
Asma Kaouachi1, Mohcen Menaa1*, Abderraouf Chouaib Rebbah2 and Mohamed Cherif Maazi1
...ts. In the near past the species populations have increased significantly in Algeria. In order to better comprehend the ecology and vital needs of the wood pigeon and to help with our results in the process of conservation management of wood pigeon, a study of the diet of this pigeon was undertaken from October 2015 to April 2017 within the Souk Ahras region, in North-eastern Algeria. This work was carried out by using a combination of digestive-contents analy...
Abdullah Sheikh1,*, Faisal Almathen1,2 and Hairul Islam Mohamed Ibrahim3,4
...ented than the pigmented species. The results of our study showed that the mRNA from skin biopsies has low expression in white dromedary camels while higher expression in dark brown phenotypes followed by black and diluted ones through real time quantitative PCR. MicroRNAs (miRNAs) miR-129-5p and miR-145 were evaluated for their depigmentary role and observed reciprocal expression against the TYR gene expression. Hence the miR-129 and miR-145 expressed ...
Nehafta Bibi1,2, Faiq Jan3, Munawar Saleem Ahmad4 and Haitao Wang1,5,*
... great majority of avian species is diurnal and thus endures variation in light intensities, associated with daily, seasonal or lunar cycles. These diurnal birds search their food in light abundant environment and raise their broods in dark cavities. However their visual performance in dim light conditions is largely unknown. Here, we compared light intensity threshold of activity in two groups of passerines, i.e. secondary cavity and non-cavity nesting...
Zahid Mahmood Sarwar1*, Ayub Iqbal Malik1, Maryam Suhail2, Shafqat Saeed3, Muhammad Umair Sial3, Waqar Jaleel4, Muhammad Nadir Naqqashand Qamar Saeed1
...e taxonomic study of new species of the genus Spodoptera i.e. Spodoptera hirsutus is very similar to the Spodoptera litura but easily distinguish on the basis of different characters of genitalia. Specimens of this genus were identified on the base of their genitalia characters. This new species Spodoptera hirsutus was collected from Muzzafarghar with the help of light traps. The abdomen was disse...
Abeera Razzaq1, Sajid Abdullah1, Huma Naz2*, Khalid Abbas1, Laiba Shafique3 and Qingyou Liu3
...ction of reactive oxygen species (ROS). These ROS can interact with nucleic acids and cause oxidation of DNA. The potential of ROS to damage DNA has become a topic of significant interest for environmental toxicology studies. Thepresent research was conducted to assess the genotoxic potential of cobalt (Co) and chromium (Cr) mixture to fish Labeo rohita by using micronuclei assay. Fish were exposed to the four sub-lethal doses (26.61, 13.30, 19.98 and 7...
Allam A. Megahed, Badawi A. Othman, Samar S. El Masry, Abeer A. Faiesal and Mohamed A. Nasr Eldin
...a set of different plant species.
Electron Microscopy was used to examine the virus morphology. The cytopathic effect of the virus on
tissue ultrathin section was examined by transmission electron microscope (TEM). Finally, the PVM
isolate was detected using reverse transcription-polymerase chain reaction (RT-PCR) in the sprouts
after dormancy breaking for the harvested potato tubers.
Results: The obt...

Mohamed F. ElKersh1, Fatma M. Abdalla2, Gamilat K. Farg2, Soad A. Nasef3, Ahmed A. Ali2

...gypt and seven different species of poultry produced and traded in Egypt. These samples were isolated on SPF eggs, detected for AIV infection Via HA, RT-PCR and gene sequencing. We analyzed the sequence on gene bank to compare it with the other AIV strains
Results: We found 35 and 55 samples showed positive result for H5 and H9 respectively. After sequencing and comparing with the other AIV strains we found that the isolated strains showed close si...
Huda S. Darwish 1, Om-hashem M. El-Banna2, Mohamed S. Abbas3, Hoda M. Waziri 1, Maisa A. Awad1
...us, ornamental and woody species including tomato,
tobacco, grape, apple, peach, cherry, apricot and raspberry. Both of sodium azide (NaN3) and ethyl
methanesulfonate (EMS) are known as chemical mutagens.
Objective: Study the effect of chemical mutagens (NaN3and EMS) on the resistance of (ToRSV) on
two different tomato cultivars and characterization induction mutagens by ISSR molecular method.
Methods...
Hadeer M. Mossa, Ausama A. Yousif, Emad A. Aboelsoud, Mahmoud El Gamal, Ahmed El-
Sanousi
...as then classified to subspecies and strain level in a
quantitative manner in approximately 48min and 23 second.
Conclusion: This method allows screening all the virus harvest content in non-selective, non- targeted
manner. The reasons to choose this technology in qualification of the TC propagated LSDV as a onestep
quality control for in process LSDV indicating all what in the sample as well as an indication for...
Ahmed A. ElWakil1, Ausama A. Yousif2 , Adel A. Fayed3, Ibrahim M. elsabagh2, Mahmoud
El Gamal2, Omnia H. Refaei3
... flies and, African tick species play a role in
LSDV maintenance and transmission. Mechanical transmission of LSDV is well documented;
however, evidence of transovarian and transstadial transmission is a tick warrants an investigation into
the replication capacity of the virus in ticks. Transstadial occurs when virus remains with vector from
one life stage to the next and transovarian is transmission of virus fro...

Samah A. Mokbel, Eman A. Ahmed, Hanan F. El-Kammar, Ahmed A. Kheder

...esion host. Eleven plant species belonging to four families
were used to confirm the presence of CMV in the inoculum. Detection of the coat protein gene of
CMV in infected leaves has been done by reverse transcriptase-polymerase chain reaction (RT-PCR),
and the appearance of 678 bp bands confirmed the expected size of such gene. Light and transmission
electron microscopy were used to study the cytological and his...

Moazama Batool1*, Sajid Abdullah2, Huma Naz3, Mubashar Hussain4, Sadia Maalik1, Sajida Mushtaq1, Tanveer Ahmed5 and Laiba Shafique6

... In control, FCR of both species was better significantly than fish reared in Cr and Cd exposed test mediums. In control, SGR of C. marulius and W. attu was noted as 20.50±0.52 and 21.78±0.44, respectively that was significantly better than Cr (13.62±0.09 and 14.02±0.04) and Cd (13.55±0.05 and 13.82±0.04). The comparison between species showed that C. marulius amassed higher concentr...

Gulnaz Ismaylova

...istered in 11 more plant species. The article provides information on the distribution, phenology and plants affected by the pest. Both nymphs and adults of O.japonica cause serious damage to plants. When the females lay their eggs, it files the sprouts by the ovipositor and let them dry. Wintering is carried out in the egg phase. Nymphs begin to hatch from overwintered eggs in early May. The eggs of O. japonica were also photographed under a JCM-6000 electron...

Aliya Munir1, Sajid Abdullah1*, Huma Naz2*, Khalid Abbas1, Tanveer Ahmed3 and Zahid Farooq2

...umber of reactive oxygen species. Oxidative stress biomarkers like antioxidants enzymes have been successfully used in ecotoxicology field for evaluating the stress response of organisms exposed to pollutants. Therefore, this work was designed to evaluate the peroxidase (POx) level in kiney, gills and liver of fish Channa striata exposed to LC50 concentration (1.374µgL-1) of deltamethrin+endosulfan (DM+ES) mixture for 4-day. Sampling was performed after ...

Ayesha Manzoor1, Muhammad Saqib Naveed1, Sayed Rashad Ali1, Danish Ibrar2, Sairah Syed1, Sharmin Ashraf1 and Rafiq Ahmed1*

...a foundation of any crop species. Root to seed method is widely used in Pakistan for radish seed production but still low and inferior quality seed is being produced that cause a significant loss in yield due to lack of standardization of seed production technology.Therefore, to improve seed yield and quality, present research was conducted toevaluate the effect of steckling size on plant growth and seed yield of radish.Steckling of different lengths (5cm, 10c...

 Yongmin Li1,2, Huabin Zhang1, Xiaoyou Wu1, Dongwei Li 2, Peng Yan1 and Xiaobing Wu1*

...enced and other reported species to assess phylogenetic relationships of Ranoidea. Phylogenetic analyses using maximum likelihood (ML) and Bayesian inference (BI) methods supported the sister-group relationship between ((Rhacophoridae + Mantellidae) + Ranidae) and Dicroglossidae. Within Rhacophoridae, two species of the genus Rhacophorus (R. schlegelii and R. dennysi) were clustered together with the rep...
Donglai Li1,Mei Han1,Huw Lloyd2, Linyu Jin1, Lei Zhang1, Jiangxia Yin1 and Dongmei Wan1*
...socially monogamous bird species may be faced with providing costly care for unrelated offspring when nests have extra-pair young (EPY). Theoretical models predict that cuckolded males should lower their parental investment as the likelihood of paternity decreases. However, empirical data are not always in support of this prediction.Here, we explore parental behaviours within the context of extra-pair patenity (EPP) in a population of the varied tit Parus v...
Houqiang Luo1*, Yanfang Lan2, Ping Gan3, Wenjun Zhou4, Meng Wang1
Bing Hu5, Zhuning Zhang5, Yu Bai1* and Kun Li6*
...sed to identify the tick species and CME by amplification of the cytochrome oxidase subunit I and disulfide oxidoreductase gene, respectively. The results indicated that 1.29% of the serum samples were positive for E. canis, and 5.50% of dogs were infested with ticks. The Wenzhou samples of R. sanguineus exhibited a high homology (99.7%–99.8%) and these parasites showed a 99.1%–100% homology to previously reported isolates. The E. ...
Song Jiang1,2,3, Ming-ge Zhuang1,2,3, Fa-lin Zhou1,2, Qi-bin Yang1, Jian-hua Huang1, Li-shi Yang1 and Shi-gui Jiang1*
...sely related terrestrial species of N. succinea, had the best effect on maturation of parent shrimps. The highest gonad weight increase rate of 1845.28% and the largest consecutive spawning rate with average value of 70.66% were both in groups fed on P. tschiliensis, with no significant difference from the groups fed on N. succinea combination bait. The dynamics of VTG mRNA level were observed in hepatopancreas and ovary of P. monodon
Muhammad Khaled Siddiq1, Muhammad Adeeb Babar1,2*, Muhammad Akbar Khan1, Muhammad Umar Ijaz3,Sayyed Ghyour Abbas1, Muhammad Asim1Asif Mahmood Qureshi4, Mahboob Iqbal4 and Muhammad Akhtar4
...atomical elements of the species, found in Pakistan for the first time, and add substantial knowledge on the anatomical features of Bu. platyceros. Bubalus jarikasensis erected by Akhtar in 2002 is reviewed in this paper and synonymized to Bu. platyceros.
...
Nianhong Huang, Yan Wu, Yuanyuan Li* and Jinhong Zhao*
...lished Hepatozoon species showed that there is no significant difference in the geographical distribution and limited host specificity. This is the first time to report the infection of Hepatozoon sp. in Naja atra for the endemic species in Chinaand increases the number of known host species. Morphological and molecular analysis of Hepatozoon sp. establis...
Pengfei Liu*, Xuexue Qin and Fei Shang
... of ecologically similar species is widespread in nature and has fascinated the evolutionary biologists for a long time. In order to avoid direct competition, closely related bird species that breed alongside each other are expected to use different habitats characteristics for nesting. We looked for possible differences in breeding ecology of two bird species, the plain laughingthrush ...

Sajid Abdullah1*, Huma Naz2*, Zunera Abbas1, Uzma Nazir1, Mehrunisa Basharat1, Tanveer Ahmed3, Adnan Ahmad Qazi2

...enetic damage in exposed species like fish. Therefore, this study focused on the genotoxic effects of lead (Pb), chromium (Cr) and cadmium (Cd) on nuclear abnormalities in peripheral erythrocytes of Wallago attu were assessed by micronucleus assay. Fish were exposed to different concentrations (1/3rd, 1/4th, 1/5thand 1/7th of LC50) of Pb, Cr and Cd, separately, for three weeks. Blood sample of fish was collected to see the micronuclei (MN) and deshape nuclei (...
Ahmet Arpacık
...d hairs from three canid species that included red fox (Vulpes vulpes), golden jackal (Canis aureus), and gray wolf (Canis lupus) found in Turkey were characterized using light microscopy to study hair features, including cuticle and medullary patterns, medullary index, and hair length and root. The morphological features of the medulla and cuticle structures were quite similar for the three species, but...
Zunaira Noreen* and Khawar Sultan
...e wild profile of native species. This study aims to establish the baseline situation of avian diversity and abundance on various land uses including the landfill at Gujranwala in northeastern Punjab, Pakistan, and understanding the impact of urban solid waste in changing bird behavior. Field observations in a variety of land uses (agriculture, forest, lake, urban and landfill) in summer 2018 using the point count method for bird census determined the baseline...
Hui-Ming Li1, Bi-Ze Yang1, Xue-Jun Jin1,2, Lin-Miao Li1, Hai-Ying Jiang1
Xiu-Juan Zhang1 and Jin-Ping Chen1*
... is an endangered mammal species exhibiting scales characteristics. The conservation and management of this species could benefit from a better understanding of its genetic diversity and structure. In this study, 24 novel SSRs were isolated from full-length transcriptome and they were used for assessing of parent-offspring relationship for M. javanica. All SSR markers were highly polymorphic with a mean of 6 alleles p...
Aftab Raza Khan1, Azhar Abbas Khan2*, Javed Iqbal3, Arif Muhammad Khan4, Zeshan Hassan2, Hafiz Muhammad Aatif2 and Umbreen Shahzad2
...dispersion index of this species. Future studies are also warranted to evaluate the impact of injudicious use of pesticides on predatory performance of these birds against a wide range of arthropods including grasshoppers, crickets and locusts.
...
Hui Wang1,2, Yuchen Zhao1 and Xinpu Wang1,*
...September 2017. Eighteen species from nine genera were collected in all regimes. The largest size of species and individuals occurred in mid-August, and species diversity and abundance were significantly greater in the typical enclosure area and the enclosed mowing area compared to the grazed area. The dominant species were Carabus vladimirskyi an...
Chaochao Hu1,2, Xue Xu1, Wenjia Yao1, Wei Liu3, Deyun Tai1, Wan Chen4 and Qing Chang1*
...tionship by comparing 31 species in Charadriiformes.The complete mitochondrial genome of H. ostralegus is a circular molecule of 16,798 bp in length and the overall nucleotide composition of H-strand was A: 31.45%, T: 23.46%, C: 31.30%, G: 13.79%. In Charadriiformes mitogenomes, AT skews values were positive, while the values of GC skew were negative. We found a significant negative correlation between CBI and ENC, and a significant positive correlation...
Huijuan Sheng1, Xiang Xu1, Haiqiang Yin1*and Muhammad Irfan1,2
...font-size: small;">A new species of pholcid spider, Khorata danxia Sheng and Xu, sp. nov. (♂♀), is described from Danxiashan National Nature Reserve in Guangdong, China. The new species is diagnosed, described and illustrated with photographs.
...
Shuli Zhu, Yaqiu Liu, Weitao Chen, Xinhui Li and Yuefei Li*
... estimated for four fish species [Spinibarbus hollandi (Oshima, 1919), Distoechodon tumirostris (Peters, 1881), Bangana decora (Peters, 1881), Ptychidio longibarbus (Fang, 1981)] from Liujiang River, China. Fishes were collected from local fish markets that using various fishing gears such as gillnets, castnets and shrimp cages in July and December 2018. The LWRs parameters a and b values for the four
Zhi-Ming Luo*, Xiao-Yan Wang, Jiong Yin, Ying-Kun Huang, Wen-Feng Li, Rong-Yue Zhang, Hong-Li Shan, Xiao-Yan Cang and Jie Li
... to damage caused by two species of borer in seedlings of 12 new sugarcane varieties. The results showed that there were differences in resistance among the varieties, where varieties YT60, GT31, GT29, LC05-136, and YT55 were classified as showing moderate resistance, YZ06-407, YZ05-51, ROC22, YZ05-49, YZ03-194, and FN38 were found to be susceptible, and FN39 and DZ03-83 were shown to be highly susceptible. This study established a method to assess sugarcane s...
Romaan Hayat Khattak, Zhensheng Liu* and Liwei Teng*
...e, several wild ungulate species are raised in captivity. However, there is a lack of detailed information about the ex-situ conservation status of these species. The present study gives a piece of benchmark information on wild ungulate species, breeding practices and the challenges that exist in captive breeding in Khyber Pakhtunkhwa Province of Pakistan.
...
Aqsa Shahid1, Saima Muzammil1, Farhan Rasheed2,Bilal Aslam1, Muhammad Akhtar Ali3, Syed Zohaib Haider4, Masroor Ellahi Babar4, Muhammad Saeed1, Umair Waqas1 and Mohsin Khurshid1,*
...erformed using genus and species-specific primers. The susceptibility to various antimicrobial agents including the aminoglycosides was determined by the Kirby-Bauer method and minimum inhibitory concentration (MIC) to aminoglycosides was evaluated by the broth microdilution method. Moreover, the armA genes were studied by PCR followed by Sanger sequencing. The isolates showed a high rate of resistance to cephalosporins, carbapenems, aminoglycosides, an...

 Yanqiang Zhou1, Lixin Wang1, Chunxiao Hao1, Xiuyun Li2, Shakeel Hussain1, Dongdong Shen1, Zhiwei Peng1, Qi`an Zhai1 and Zhijun Hou1,*

...sp. and one Strongy-type species in goats; Trichuris sp., Nematodirus sp., Moniezia sp., E. macusaniensis, another Eimeria sp. and another Strongy-type (different with goats) in alpacas. It was discovered that the infection rate was 45.74%, 38.97%, and 12.09% in blue wildebeest, alpacas and goats, respectively. The hosts have different dominant parasite and diverse prevalence in different season, temperature, and humidity gro...
Waqar Ali1,3*, Muhammad Yaqoob2, Abida Arshad1, Guifu Dai3,Safir Ullah Khan1, Muhammad Arshad Malik4, Imran Ullah1 and Ihsan Ullah1
....1%) other streptococcus species, Pseudomonas aeruginosa (15.2%), Salmonella (13.5%) and Klebsiella pneumonia (8.4%). Staphylococcus aureus was found most prevalent pathogen that causes mastitis in goats. The overall prevalence of goat mastitis was recorded (11.67%). Risk factor like age, lactation stage, parity number and unhygienic condition showed statistically significant association with the prevalence of mastitis in beetal goa...

Muhammad Aftab1*, Aneela Riaz2, Ghulam Sarwar3, Muhammad Arif1, Qudsia Nazir1, Ifra Saleem1, Sarfraz Hussain1, Abid Ali4, Abid Niaz1, Fakhar Mujeeb4, Khalid Mahmood5 and Sarfraz Nawaz6

...n of the reactive oxygen species (ROS) including hydroxyl radicals (OH-), hydrogen peroxide (H2O2) and superoxide (O2-). However, on their side, efficient antioxidant defense system developed in plants, which having lower molecular weight of antioxidants. It also reduces (ROS) enzymatic activities including catalase (CAT), peroxidase (POD) and superoxide dismutase (SOD). Under combined stress conditions agronomic, bio-chemical, quality and over all yield reduc...
Muhammad Bilal Tayyab1, Muhammad Zeeshan Majeed1*, Muhammad Asam Riaz1, Muhammad Anjum Aqueel2, Sylvain Nafiba Ouedraogo3, Muhammad Luqman4, Kanwer Shahzad Ahmed1 and Mujahid Tanvir1
...s of 40 indigenous plant species of Soon valley and surrounding salt range (Punjab, Pakistan) against D. citri and A. gossypii using standard twig-dip and leaf-dip bioassay methods, respectively. Results of initial screening bioassay showed the highest mortality of D. citri by 10% extracts of Mentha longifolia (L.) Huds. (93%), Melilotus officinalis (L.) Pall. (91%), Nerium indicum Mill. (89%), Datura alba L. (88%) and Salvia officinalis L. (81%). Second bioas...

Najam-un-Nisa1, Ruqia Bibi1, Balqees Riaz1, Bushra Khalil1, Iqra Maheen1, Saima1, Uzma Islam Khan1 and Inam Ullah1,2*

...etailed research on bird species in Dhapchapak lake and the forest area.The study was conducted to estimate the diversity and abundance of avifauna species found in dhapchapak wetland and forest during winter (2017-18 and 2018-19). As birds are the best indicator for environmental changes hence the migratory birds fauna was observed during September to March of the year 2017-1019. Point transect method was used to explore th...

Hafiz Muhammad Tahir*, Iram Liaqat*, Junaid Nadeem, Hammad Aamir and Shaukat Ali

...type specific as well as species specific. Use of spider silk for coating of medical devices such as stents and catheters can decrease transmission of pathogenic bacteria forming biofilms as well as aid in wound healing.

...

Huda Bilal1, Hasnain Raza2*, Kaynat Ahmed2, Iqra Tariq2, Qurat-ul-Ain2, Sana Sarfaraz1, Sanaullah1, Maryam Maqsood3 and Ali Raza3

...he habitat, genetic, and species levels in a synergistic way. Land and aquatic biodiversity greatly influenced, some species are exhibiting different responses to these changing climatic factors like behavioral, morphological, phenological, reproductive, and genetic changes. After all these responses there are many species that are endangered and extinct. This review illustrates that clima...
Rizwana Sultan1, Asim Aslam1, Muhammad Yasin Tipu1, Habib ur Rehman2, Saba Usman1, Ahsan Anjum1,*, Muhammad Saeed Imran1, Muhammad Usman3 and Muhammad Zahid Iqbal3
... of avian Eimeria species strongly support that E. necatrix and E. tenella were closely associated and placed in the same sister clade with high bootstrap support (98%). Our two isolates RSI and RSII showed a homology index of 99.82% (nucleotide level) and 99.47% (amino acid level) with each other. The maximum similarity percentage indicated that RSI and RSII isolates were closely related to strains reported from India and China. This stud...
Nagarathinam Arunkumar*, Jainullabudeen Gulsar Banu, Nagarajan Gopalakrishnan and Arkalgud Hiriyannaiah Prakash

 

...lated from four mealybug species infesting cotton were screened for lipase production. On the basis of the 16S rRNA gene sequences, lipase-positive strains were classified into six genera, namely, Pseudoxanthomonas, Acinetobacter, Klebsiella, Providencia, Enterobacter, and Serratia. Acinetobacter lwoffii PSAD2 and A. beijerinckii PSAD7isolatesshowed the maximum lipase production of 2.3 U/mL and 1.7 U/mL, ...
Amal E. Abdel-Hady*, Sara M. El-Amir, Noura S. Al-Muttri and Heba M. El-Hariri
...menation of the examined species exhibited different pattern in the same microhabitat. Variety was observed in the two related species, having a common family, Lacertidae. Whereas, Agamaidae sp. showed different pattern of microstructures. So, we conclude that there are other factors, which influence scale surface structures not only with microhabitat.
...
Jialiang Han1, Guohou Liu1*, Wenke Bai2,3, Qixian Zou4, Ye Cao5, Caiquan Zhou2,3*, and Guy Michael Williams6
...g the persistence of the species should involve controlling the expansion of road construction to minimize the impacts of human disturbances on the langurs.
...

Usman Asghar1*, Muhammad Faheem Malik1, Umer Rashid2, Naeem Mahmood Ashraf2, Sumera Afsheen1 and Muhammad Hashim1

...ction conditions for all species. RFLP analysis produced species specific restriction profiles. Comparing these profiles, we have identified the species origin of meat unambiguously. 

...
Dia Mamadou1,2*, Meissa Beyah1, Sow Amadou Harouna1, Ba Samba Alassane1, Bouzouma Moustapha1, Braham Cheikh Baye1 and Beibou Ely1
...ered a highly vulnerable species. Furthermore, its high market value is such has led to a rush to exploit it to such an extent that some coastal cephalopods fishing vessels are being transformed into lobster vessels and European chartered vessels are arriving in Mauritanian waters. Therefore, in order to make the exploitation of this species biologically, economically and socially sustainable, a monitoring of landings of thi...

Ilker Kepenekci1, F. Dolunay Erdoğuş2 and Adnan Tülek3*

...PN) exists detailing the species found in strawberry growing areas of Kyrgyzstan. This research aimed to provide a faunistic and taxonomic record of PPNs from soil and plant samples collected from strawberry orchards in 10 different locations in Tokmok area of northern Kyrgyzstan during the summer of 2016. PPNs were identified according to morphological and morphometric characters. Eight species belonging to the orders Tylen...
Ömer Ertürk and Beyhan Taş*
...vatum is an invasive species. Rapidly spreading to Europe from Southeast Asia. It is distributed throughout Europe today. There are also records from transoceanic America continent. For anthropophilic S. curvatum species, the first record was made from Turkey, in 2015. In this study, a new locality record was made for this species from the province of Ordu, which is in Central B...
Qazi Muhammad Noman1, Farhan Mahmood Shah1, Khalid Mahmood2 and Muhammad Razaq1*
...s (Diptera: Tephritidae) species pose a significant threat to mango and citrus production worldwide including Pakistan. In the present study we identified and monitored the population dynamics of fruit flies species using male attractants Attrex® (methyl eugenol 98%, evyol group) and static Spinosad® (spinosad 2% and methyl eugenol 51%, target group) in mango and citrus orchards at different loc...
Congfen Zhang1,Yingxiao Liu2, Linfeng He2, Fengjun Shi2, Weitang Yao2 and Xuegang Luo2,*
...ssion of reactive oxygen species (ROS) enzymes can be used as a biomarker for detection of heavy metal contamination.
...
Seung-Yun Baek1 and Seong-Min Lee2*
... most prevalent wildlife species in WVCs on Jeju Island, South Korea. This study analyzed individual temporal patterns and spatial hotspots (clusters) based on roe deer–vehicle collisions (RDVC) on Jeju Island from 2014 to 2017. RDVCs occur frequently from July to October, and RDVCs are higher in male deer than with females in all seasons, except in winter. The clusters in the high-risk periods were more regionally distributed compared to the clusters in...

Mst. Deloara Begum1, Md. Muniruzzaman1, Md. Salauddin2* and Md. Mostafizer Rahman1

...is study seven different species and 168 isolates were identified from dried fish and these were Escherichia coli 21.43% (36), Vibrio spp. 18.45% (31), Staphylococcus spp.17.86% (30), Pseudomonas spp.17.86% (30), Salmonella spp.12.5% (21), Shigella spp. 8.93% (15) and Klebsiella spp. 2.97% (5). In cooked fish 9 isolates were identified and species were Escherichia coli 66.66% (6) and Shigella spp. 33.34% (3). Total viable co...
Luis Daniel Jiménez Martínez1, Vicente Morales Garcia2Carlos Alfonso Frias Quintana3, Alejandra del Carmen Castillo Collado1, Gloria Gertrudys Asencio Alcudia4, Carina Shianya Alvarez Villagomez4, Emyr Saul Peña Marín4,5, Bartolo Concha Frias1 and 
Carlos Alfonso Alvarez-Gonzalez4
...cestral subtropical fish species in southeastern Mexico, which has great potential as a model species for physiological, biomedical and genomic studies. The quantification of gene expression through RT-qPCR is one of the most commonly used techniques, due to its precision, sensitivity and high performance, particularly in gene expression to compare between cells, tissues and organs; as well as different populations, stages o...
Manar M. Farouk1*, Amal El-Molla1, Fayez A. Salib1 and Yousef A. Soliman2
Roheela Yasmeen1*, Laiba Asif1 and Samia Djeffal2
...">Worldwide there are 23 species of vultures. The vultures are known as one of nature’s most successful scavengers. However, since the 1990’s vulture numbers in South East Asia have been in decline, especially the oriental white-rumped vulture (Gyps bengalensis), thelong-billed vulture (Gyps indicus), and the slender-billed vulture (Gyps tenuirostris). The use of the non-steroidal anti-inflammatory drug (NSAID) di...
Sohail Anjum1, Awais Ahmad1, Farzana Bibi1 and Hazrat Ali2*
...lendens) is a native species of the Indian subcontinent. It shows greater tractability as it can easily adapt to new environment where food supply and garbage are found in abundance. Their intelligence is also acknowledged duly. They are also obligate to human presence. We can assume that “where there is human, there is house crow essentially”. The present article documents the ecology of this bird in Dir Lower, Khyber Pakhtunkhwa, Pakistan. Th...

Ruqia Bibi1, Najam-un-Nisa1, Sania Komal1, Hafiza Nimra Ghani Qureshi1, Maryam Safdar1, Hafiza Hina Jameel1, Saman Gul1, Sania Saeed1 and Inam Ullah1,2*

...cted to estimate various species of Avifauna found at Chashma Lake during winters (2017-2018 and 2018-2019). As the birds are the best indicators for environmental changes, the migratory bird’s fauna was observed from September to March 2017-2019. The line-transect method was used to explore the avifauna diversity at the study site. 16371 individuals were observed belonging to 11 families belonging to approximately 38 species

Bibek Aryal, Naresh Pandey and Laxman Khanal*

... of urbanization on bird species richness and diversity in Butwal Sub-Metropolitan City, one of the rapidly expanding cities in the central lowland Nepal. Bird surveys were conducted during the winter and post-monsoon seasons of 2020 along eight transects each of 2 km length by positioning the point count stations at every 200 m interval. The associations of bird richness and abundance with NDVI as the proxy of productivity and human footprint data as the prox...

Muhammad Usman Hanif, Abu Bakar Muhammad Raza, Muhammad Zeeshan Majeed*, Muhammad Arshad, Muhammad Irfan Ullah

...cts of three local plant species (i.e. Eucalyptus camaldulensis Dehn., Citrus limon L. and Azadirachta indica A. Juss) against the grubs and adults of E. vigintioctopunctata. Three concentrations of each synthetic insecticide (i.e. 2.5, 2 and 1.5%) and botanical extract (i.e. 10, 7.5 and 5%) were bioassayed using standard leaf-dip method. Results revealed that spinosad and 10% A. indica aqueous extract exhibited maximum mean cumulative mortality of hadda beetl...
Monif AlRashidi1*, Sami Saeed M. Hassan2 and Mohammed Shobrak3
...endance behavior of this species over 24 h. The results showed that the egg was incubated more than 80% in each two-hour period except for the periods (00:00 - 01:59 h; 02:00 - 03:59 h and 20:00 - 21:59 h) when it was incubated 56.67 %, 29.17 % and 45.00 % respectively. The incubating parent spent more time sitting on the egg rather than standing on the nest in each two-hour period except for the periods (02:00 - 03:59 h and 20:00 - 21:59 h) when the parent ne...
Misbah Sarwar1*, Abdul Hamid2 and Iftikhar Hussain2
...ent to conserve the bird species in the study area.
...
Zahid Beg Mirza1,*, Naveed Ali Soomro2 and Farwah Shariff1
...he identification of the species. During the surveys, information on the use of non-steroid anti-inflammatory drugs, that is diclofenac and other drugs known to be harmful to vultures, were gathered through interviews. This paper suggests that the vultures and other raptors in the mountainous eco-region of Sindh are in relatively larger populations compared to the Eastern side of Sindh due to the abundance of wild ungulates in protected areas such as the Khirt...
He Yujiao1,2, Xie Huichun1, Lin Gonghua2,3, ZhangTongzuo2,3, Su Jianping2,3 and Du Yurong1*
...ferentiation within this species could be related to quaternary glaciation. We also compared the clustering analysis results generated using mtDNA versus microsatellite markers. The most obvious difference between the two markers was reflected in the fact that the populations Yelashan (YLS) and Bangda (BD) represented a separate cluster based on the microsatellite data. Additionally, our studies involving the comparison of the two markers also reveal that a fe...
Zekeriya Özüdoğru1, Hülya Kara2*, Adem Kara3, Derviş Özdemir3 and Hülya Balkaya2
...vide further evidence of species-specific differences.
...

Phong Huy Pham1,2

...rwintering habits of the species are included. 
 
Novelty Statement | The study is novel to suggest containing of overwintering habits of common wasp, Polistes olivaceus. Suggestions include severe weather conditions or/and added nutrition source deficiency.
...
Funda Turan1*, Ihsan Akyurt2 and Sehriban Cek-Yalniz1
...n demand in many finfish species with sexual dimorphism, e.g., better growth performance, higher economic value. Synthetic steroids are commonly used to induce monosex population in fish but because of the potential hazards of such steroids; the use of new phytochemicals is a potential alternative to be explored. We evaluated hypothesis that red clover extract to sexually undifferentiated fry of African catfish (Clarias gariepinus) would affect their se...

Adel M. Abdelrahman1, Sahar R. Mohamed1, Soliman M. Soliman2, Sherif Marouf3* 

Eman H. Mahrous1, Mohamed. W. Abd Al -Azeem2, Faisal A. Wasel1, Waleed Younis2* 

...ed as P. multocida using species-specific primers by conventional PCR with an incidence of 6.7%, besides belonging to serogroup A by multiplex PCR. Serologically only eight isolates belong to somatic serotypes 1, 3, and 12 with a percentage of 20%, 10%, and 10% respectively, while other isolates were untypable. All the recovered isolates were further subjected to multiplex PCR screening of some common virulence genes and revealed the presence of pfhA, hgbB, t...

Hailemariam Assefa1*, Tesfahun Dagnaw2 

...used as tested bacterial species whereas Yeast, Mold and Dandruff were selected as tested fungi. The effect was seen high on Staphylococcus aureus, while the Klebsiella pneumoniae was less affected by any of the used extracts. Methanolic extract was more active than petroleum ether and ethyl acetate extract on all three tested fungal species. The oil was obtained by soxhlet extraction method. The maximum oil yield using petr...
Amr N. El-Shahat1, Refaat G. Hamza1,*, Ashraf M. Mounir1 and Madeha N. Al-Seeni2
...ction of reactive oxygen species (ROS) associated with increase in lipid peroxidation. Graviola fruits have been reported to possess antioxidant and anti-inflammatory activities. The present study was designed to determine the possible protective effects of graviola fruit juice (GFJ) against radiation induced oxidative stress and biochemical alterations in the liver and kidney of male albino rats.In the present study, gamma- irradiation (2 Gy every 3 days up t...
Syed Sikandar Habib1*, Saira Naz2, Sadia Nawaz1, Iqra Ameer1, Ameer Khatoon1, Hameed Ur Rehman3, Sahibzada Muhammad Jawad4 and Haider Ali5
...nab (wild) selected fish species including (Labeo rohita, Cirrhinus mrigala, Cyprinus carpio, Hypophthalmichthys molitrix, Ctenopharyngodon idella). Fish species selected for the current study is generally widely cultured in Pakistan and worldwide. Fish sampling was done by using different nets (river and farm) and blood sampling was immediately drawn from caudal peduncle by syringe and added in EDTA containing vial a...
Hongbin Li1,2, Lei Fang1, 3 and Lei Cao1,2*
...pothesis have focused on species feeding intensively on above-ground primary production. To test whether a facultative grazer strictly follows the green wave, we used 16 complete tracks in time and space of spring migrating tundra bean geese (Anser serrirostris)fitted with telemetry devices from two flyways between Yangtze River Floodplain winter areas and Anadyr (Russia)/Central Arctic breeding grounds. We combined these with high spatial resolution MO...

M. Hanafy1, Rehab Elhelw2, Soliman M. Soliman3, Sherif Marouf2* 

...f members of Pasteurella species isolated from camel from different governorates in Egypt. Camels with respiratory manifestation as nasal discharge, fever, off food, with ocular discharge and air gasping, paralysis of lips and salivation were subjected to clinical examination and a total of 141 samples were collected as follow; 111 nasopharyngeal swabs, 15 tracheal swabs and 15 lung specimens collected from camels from different governorates (New valley, Giza,...

Noha M. El-Shabrawy1, Atef M. Kamel2, Aza S. Goda1, Gehad R. Donia1, Ahmed M. Salah-Eldein2* 

...belonging to 4 different species; Egyptian barn swallow (Hirundo rustica), house sparrow (Passer domestics), great white egret (Ardea alba) and striated heron (Butorides striata) were hunted by a net trap to determine the concentration of lead (Pb), cadmium (Cd), copper (Cu), zinc (Zn) and manganese (Mn) in their muscle, liver, kidney and feather. Also, 16 water samples were collected to assess the level of heavy metals pollution in the study area. The result ...
Aiguo Zhou1,2,4, Shaolin Xie1,2, Zhuolin Sun1,2, Yongyong Feng1,2, Shulin Liu1,2, Di Sun1,2, Yanfeng Chen3 and Jixing Zou1,2*
...among five Channa species. The principal component analysis showed that the cumulative contribution rate of five principal components reached 78.928%, and tail shank (TS) and head length (HL) were the main contributors to the first principal component (35.435% contribution rate). The scatter diagram of the principal component analysis showed that white type and Channa argus hadcommon overlap, while the other three Channa

Nedžad Hadžiomerović1*, Ozan Gündemir2, Senad Kovačević1 

...pe variation between two species with ten landmarks. The study revealed that the mandible of the jackal was longer and of massive bone compared to fox mandibles. The most significant difference was the total length, the indentation between the condylar and the angular process, and the measurement from the aboral alveolus of the canine tooth to the condylar process. The molar teeth parameters show similar values, especially the carnassial teeth. PC1 and PC2, wh...
Romaan Hayat Khattak1, Zhensheng Liu1*, Liwei Teng1* and Ejaz ur Rehman2
...ce of several endangered species in many areas remains unveiled due to the lack of faunal inventories. In such situations, it is imperative to make proper records of the existing fauna on local scales to strengthen the conservation practices. Twenty-one species representing 18 genera, 12 families and six orders of mammals were recorded in Nowshera district, Khyber Pakhtunkhwa province (KP), Pakistan from an inventory conduct...

Asif Sadam1*, Rahmat Ullah Khan1, Sajid Mahmood1 and Juma Gul2

...s the majority of native species. The pattern of rainfall is changing and frequency of extreme events increasing due to urbanization and rapidly increasing average global temperature. These changes are having observable impacts on biodiversity at species level and ecosystem level, in terms of distribution, composition and function. Mardan district of Khyber Pakhtunkhwa has different habitats; it represents a useful ecologica...

Li Wei, Wei-wei Shao and Zhi-hua Lin*

...the larvae of two anuran species, Fejervarya limnocharis and Microhyla fissipes. Our results showed that survival rates under most pesticide treatments (22/28) and growth under all pesticide treatments were lower than those under the control treatment. Mortality and growth reduction rates under treatment with pairwise combinations of pesticides were rarely higher than those under treatment with individual pesticides. At concentrations of 1 and 2 mg/L, the surv...
Imran Bodlah1*, Muhammad Tariq Rasheed1, Muhammad Farooq Nasir1, Tariq Mahmood2 and Muhammad Asif3
...arrison, 1961 has only 3 species records from the world. Immature stages of this species are 5 which have been described with the help of coloured micro-graphs. Male and female genitalia have been described using line drawings and coloured drawings. Main diagnostic characters, brief description, morphometrics, distribution and illustrations are provided. Biology, trophic associations with 4 ant’s ...

Keqiang Wei1*, Yue Wei2 and Changxia Song1

...ly important aquaculture species in China. Using polyclonal antibodies, the strong staining of these proteins in hepatopancreatic cells was observed. The synchronous expression of p38 and its phosphorylated form (p-p38) was mainly present in B- and R- cells, and their MOD values were 0.0055±0.0038 and 0.0046±0.0027, respectively. As its downstream transcription factors, both RelA (p65) and Nrf2 were widely distributed in the cytoplasm of B- and R...

Sadaf Shahid1, Abdul Razzaq2, Gul-Makai1, Asim Shamim3*, Hafiz Muhammad Rizwan4, Rana Hamid Ali Nisar5, Qaiser Akram6, Mohsin Nawaz3 

...istrict was 12.26%. Five species of ticks i.e. Ixodes (3.98%), Haemaphysalis (1.90%), Hyalomma (7.38%), Rhipicephalus (7.14%), and Boophilus (2.62%) were prevalent in the study area. A non-significant association (P > 0.05) of tick infestation with sheep and goat breeds was found in the present study. The highest prevalence of ticks was found in animals of 1-2 years of age (15.79%), followed in order by less than one year (11.44%), and 2-3 years (9.06%) of ...

Saeed Ahmed Essote1, Asim Iqbal1, Muhammad Kamran Taj2*, Asmatullah Kakar1, Imran Taj2, Shahab-ud-Din Kakar1 and Imran Ali 3,4*

...milies, 20 genera and 37 species were collected. The family wise representation among collected specimens has been Boidae (4.6%), Leptotyphlopidae (7.5%), Typhlopidae (10.3%), Elapidae (11.7%), Viperidae (13.4%) and Colubridae (52.5%). The percentage of family Boidae, Typhlopidae, Elapidae and Leptotyphlopidae were high in Sibi Division while family Viperidae and Colubridae were dominant in Quetta Division. The family Colubridae has been the most dominant in t...

Uzma Ishaq1, Shahnaz Dawar2, Nasira Kazi1, Erum Iqbal1* and Saboohi Raza3

...Sindh, Pakistan. The new species is characterized by having a combination of characters: body length of female 0.7-1.0 mm, vulva at 56-59 percent of body length, anterior part of buccal cavity 5-7 µm wide, pharynx 198-238 µm long, tail 30-33 µm long, post uterine sac 10-16 µm in length, apex of dorsal tooth 3-5 µm from anterior end. Morphometric and morphological data of O. paraobtusus Jairajpuri and Khan, 1982 and O. obtusus Cobb...

Esraa Yosry Abdel Halim1, Hamdy El-Essawy1, Abeer Abdel Nasser Awad1, Mona S. El-Kutry2, Lamiaa Ibrahim Ahmed1* 

...amples, while Salmonella species couldn’t be detected in any of the examined samples. Staphylococci were recovered from most of the examined milk powder (83.33%), cheddar cheese (93.33%), and nearly half of the examined labneh (46.67%) samples, with non-significant differences between that of milk powder and labneh (p=0.572), and cheddar cheese (p=0.345). the majority of cheddar cheese (83.33%) and labneh (63.33%) samples were contaminated with yeast and...

Aly M. Ghetas1*, Dalia M. Sedeek1, Hanaa S. Fedawy1, M.A. Bosila1, Hoda M. Mekky1, Kh. M. Elbayoumi1, 3, Mohamed M. Amer2 

... for isolation of fungal species on specific medium. A total of 19 purified fungal isolates have been identified morphologically. Aspergillus isolates were the most identified (42%), followed by Trichosporon (10.5%), Penicillium (10.5%), Fusarium (5%), Candida (1%) and non-identified isolates (26%). Furthermore, the obtained 8 Aspergillus isolates were further morphologically identified into A. fumigatus which was most frequent species...

Oce Astuti1, La Sara2*, Muzuni3 and Safilu4

...recorded, identified its species, sexed, counted its number, and analyzed its spatial and temporal CC and SR. The Chi-square test (α = 0.05) was used to test significant differences of expected 1: 1 SR. It was 12 DC species had been identified which BSCs were found at the entire stations and all years round. It had high CC at each station ranging 21.561–79.176% which was found the highest at station A, while CC i...

Lin Huang1, Ling Mai2, Keyan Zhong1 and Xinjun Chen3*

...equences showed that the species were identical and highly conserved at multiple AA sites. Specifically, SeFABP has the highest similarity with T. multiceps and M. vogae, close to 37%, but the lowest similarity with F. hepatica and F. gigatica, close to 22%. Plasmid double enzyme digestion and sequencing showed that the fully synthesized SeFABP fragment was accurately cloned and connected to the expression vector pET-30a(+)-SeFABP. After induction, the recombi...

Yao Zou, Shien Ren, Miao Xu, Nannan Liang, Xuxin Zhang, Chongxuan Han and Xiaoning Nan

.... To differentiate among species and to describe the sexual dimorphism within each species, we measured morphological variation using one-way analysis of variance and cluster analysis in four species of zokor including Eospalax cansus, Eospalax rothschildi, Eospalax baileyi, and Myospalax aspalax. We also used principal component analysis and dichotomy to explore key measurements which cou...

Najeeb Ullah1*, Adnan Ihsan1, Syed Fahad Shah1, Kamran Sohail1, Muhammad Sohail Khan1 and Said Hussain Shah2

Arif Mehmood*, Muhammad Naeem and Ata-ul-Mohsin

...nging to 5 genera and 28 species were collected. Culex spp. were found throughout year, Anopheles spp. through March-November. Armigeres spp. through January-November, Aedes spp. through April-November and Lutzia spp. were found in the months January-March and June-November. Seasonal distribution pattern is an asset in controlling any epidemic occurred due to mosquito vector. This pattern informs about the active period, favorable temperature and humidity rang...

Javed Khan1, Abdul Majid1, Mohammad Nisar2*, Ali Hazrat2, Nausheen Nazir3, Muhammad Zahoor3, Mohammad Ihsan2, Azhar Hussain Shah1, Muhamad Ajmal Khan4 and Muhammad Yahya1

...es among different plant species and its knowledge help the breeders and farmers to select the best variety. Alnus nitida is one of the native and most important plants in District Dir Lower, Khyber Pakhtunkhwa, Pakistan, mostly used for medicinal purposes. In the present study, total 50 genotypes of Alnus nitida were collected from Dir lower and evaluated for morphological traits (leaf, petiole, nut, and catkin size). A significant level of variations was obs...

Maid Zaman1*, Imtiaz Ali Khan1, Amjad Usman1 and Ahmad-Ur-Rahman Saljoqi2

...er excluding the only 3% species which are the leading pests causing damages to agriculture, forestry, and housing/structures. Diverse ecological conditions of Pakistan made it favorable for termites which are found across the country but its diversity, genera strength, percent host and habitat attacked for district Swabi, Buner and Haripur is unreported. After collection (either on spot or through NIFA-Termaps) and identification, all districts had equal
Anjum Ara1, Usman Ali1, Muhammad Furqan2*, Zulfiqar Ali2
Muhammad Mudassar Shahzad3, Khawaja Basharat Ahmed4
Riaz Aziz Minhas4, Waqar Ahmed2, Zakir Hussain2 and Mian Aman Ullah2
... Eight freshwater turtle species have been reported from Pakistan. The present study aimed to investigate the diversity, distribution, threats and conservation of freshwater turtles in Mirpur, Azad Jammu and Kashmir, Pakistan where no research work was done previously. Study area was divided in three study zones (Mirpur, Dadhyal and Chakswari) along the Jhelum river and further sub-divided into 18 localities. Line transect, hand capture, visual survey, trackin...

Mukhlisi Mukhlisi1,*, Tri Sayektiningsih2 and Ishak Yassir1

...15 min. We found 89 bird species: 67 bird species were identified in hill karst forest and 33 bird species were recorded in coastal karst forests. Eleven bird species were found in both study sites. The score of diversity, species richness, and evenness indices of hill karst forests was higher than that in coastal kars...

Sozan A.A. Ismaeil1*, Hassan Emam2 

...ed that the liver of two species of birds is located in a hepato-peritoneal cavity, and each is composed of two undivided lobes, a large right lobe and a small left one which have light brown to dark red in pigeon and dark red in ibis. The histological structure of the organ in both species was different, were consisted of several lobules that were not separated from each other by trabeculae and covered by connective tissue ...
Muhammad Faisal Riaz1, Abu Bakar Muhammad Raza1*, Muhammad Zeeshan Majeed1 and Talha Nazir2
...th about 5,000 described species worldwide. Many of the aphid species are destructive pests of a wide array of horticultural and agricultural plants. This study determined the prevailing diversity of aphids on different economically important plantations in district Sargodha. From November to April 2018-2019 and 2019-2020, about 51,000 apterous adult aphid specimens were collected from various plantations from all six tehsil...

Muhammad Tariq Mahmood1*, Muhammad Akhtar2, Kaiser Latif Cheema2, Abdul Ghaffar3, Imtiaz Ali4, Muhammad Jahanzaib Khalid2 and Zeshan Ali5

...genetic improvement of a species. Screening of available genetic stock for detection of most diverse and high yielding genotypes is a pre requisite for a successful crop breeding program. For this purpose, a research experiment comprising of sixty-eight elite chickpea germplasm genotypes along with two commercial varieties were sown under tri-replicate randomized complete block design during the winter season of 2020-21. D2 statistics, principle component anal...

Shoaib Hameed1, Shakeel Ahmad1, Jaffar Ud Din2 and Muhammad Ali Nawaz3*

...t study investigated the species’ current distribution in the Hindu Kush Range in Pakistan, gathering information on human-brown bear conflict along with other large carnivore species in the study area. Multiple survey techniques questionnaire surveys, sign surveys and camera trapping were used during the period 2008–2010 in five study blocks delineated on natural watersheds in Pakistan’s Chitral district. ...
Dalia Khatun1, Md. Yeamin Hossain1,2*, Md. Firose Hossain3, Zannatul Mawa1, Md. Ataur Rahman1, Md. Rabiul Hasan1, Md. Akhtarul Islam1, Md. Ashekur Rahman1, Habib Ul Hassan4 and Sadicun Nahar Sikha1
...g the well-being of this species in the Ganges River. The WR was not significantly different from 100 for males (P = 0.6137) and females (P = 0.6185), indicating that habitat was still in good condition. The a3.0 were 0.0067 and 0.0050 whereas Lm was 3.14 and 3.32 cm for males and females, respectively. Also, MW was 2.55 and 2.50 year-1, respectively in the Ganges River. In addition, this study estimates the a3.0, Lm and MW from other water-bodies using the av...

Bikash Puri1, Anil K. Tiwary2, Bharata Regmi3,4, Dinesh K. Singh1, Doj R. Khanal5 and Manoj K. Shah3*

...ro-climatic zones at the species level and to serotype the BTV prevalent in the study areas.

...

Hams M.A. Mohamed1, Mona A. El-Zamkan2* 

...resence of Streptococcus species. The preliminary identification was confirmed by using VITEK®2 system which revealed the presence of four isolates of S. thoraltensis. The antimicrobial susceptibility of the obtained isolates was detected phenotypically and genotypically, in addition to the ability of these isolates to produce biofilm and protease enzyme. All the isolates displayed resistance to penicillin and oxacillin, while, two isolates were resistant ...

Mohammed H. Galhoum1, Hamza M. Eed2, Essam S. Soliman1* 

...ns concerning Salmonella species. The current study aimed to investigate the prevalence of Salmonella contributing contamination in chicken samples that were collected from broiler farms and slaughterhouses using conventional culturing, biochemical, and serological identifications versus molecular detection. A prospective study was designed to last for six months from March 2021 to the end of August 2021. A total number of 126 chicken samples (100 samples from...

G. Basana Gowda*, N.B. Patil, M. Sahu, S.R. Prabhukarthikeyan, S. Raghu, G.P. Pandi, T. Adak, C.K. Swain, S. Pokhare, S.D. Mohapatra and P.C. Rath 

...stant populations. Other species belonged to Staphylococcus sp., Enterobacter sp., Lysinibacillus fusiformis, Klebsiella pneumonia (all four from resistant populations) and Achromobacter sp (from a susceptible population). Present study provides a basis for elucidating the role of the gut bacteria in the phosphine resistance and design novel strategies for the management of T. castaneum.

...

Mirza Lena1,2, Dinda Fathia Syahramadani2, Alfi Nurrachma Gustya2, Arif Darmawan2,3, Sumiati2, Wiwin Winarsih4, Minoru Maeda5, Komang Gede Wiryawan2*  

 Mian Abdul Hafeez1*, Adeel Sattar2, Faiza Aslam3, Muhammad Imran3, Kamran Ashraf1, Rashid Zia2 and M. Muntazir Mehdi1
...rulated oocysts of mixed species local isolates at 21st day of age. Groups A and B were medicated with Ibuprofen (100mg/kg body weight) orally and Ibuprofen (100mg/kg B.W) orally plus Clopidol (0.5g/kg) of feed respectively, post infection for five days. The group C was medicated with Clopidol (0.5g/kg) of feed. The group D served as infected unmedicated (negative) control and birds in group E were kept as noninfected and nonmedicated (positive) control. Thera...

Sana Khalid1,2*, Muhammad Zia-ur-Rehman2,3, Usman Hameed2,4, Shabnum Shaheen1, Muhammad Naveed Shahid5, Khajista Jabeen1, Farah Khan1, Muhammad Saleem Haider1

...us whiteflies (B cryptic species) were reared and used to acquire the viruses for 48-72 h from the agroinfiltered symptomatic tobacco (Nicotiana benthamiana Domin.) and tomato (Solanum lycopersicum L.) plants and these were liberated to healthy plants for transmission of viruses. It was evident from the results that the whiteflies were incapable to acquire and transmit chickpea chlorotic dwarf virus (CpCDV)-a mastrevirus and mastrebegomo chimeric virus (MCV) f...

Omer Eyuboglu

...tation of non-indigenous species (NIS) and their permanent habitation of secondary regions pose a critical threat that adversely affects the marine environment and marine based economic activities and applications. The transportation of NIS causes a decline in fish industries, spoilage of culture fishing stocks, rising production costs, adverse effects on human health and changes in biological diversity. The most prominent alien specie...

Imtiaz Ali Shah1*, Maleeha Anwar1, Rafiullah2, Inamullah Wazir1, Muhammad Hasnain Riaz1, Abdur Raziq1, Muhammad Ijaz Ali1, Faizul Hassan1, Khalid Khan3, Yasin Ahmad4, Irshad Ahmad5, Muhammad Ibrahim Rashid5, Muhammad Tariq Zeb1* 

... positive for Salmonella species. The antibiotic susceptibility testing revealed that Salmonella isolates were resistant to ampicillin, amoxicillin/clavulanic acid, cefotaxime, and kanamycin while isolates were susceptible to chloramphenicol, gentamicin, kanamycin and streptomycin. These positive samples were further investigated and confirmed through PCR by targeting serovars specific genes i.e rfbJ, fliC, fljB for S. Typhimurium and ST11, SPV, SefA for S. En...

Farheen Aslam*, Hira Lodhi, Rasheeda Bashir, Faiza Saleem and Shagufta Naz

...DM-1 gene. The bacterial species harboring blaNDM-1 gene were 25% Enterobacter cloacae, 18.75% Klebsiella sp., 12.5% Pseudomonas sp., 12.5% Citrobacter freundii, 12.5% Acinetobacter Baumanii, 12.5% E. coli and 6.25% shigella sp. Nucleotide sequencing of PCR product of Klebsella sp, Enterobacter cloacea and Citrobacter freudii showed 100% sequence homology. It is concluded that there is high prevalence of blaNDM-1 among carbapenem resistant enterobacteriaceae i...

Jocelín Selene Sánchez Cisneros1, Braulio Alejandro Fuantos Gámez1, Martin Herrik Ramón Kane1, Laura Miranda Contreras2, Camilo Romero Núñez2* 

...thy specimen of the same species and colour characteristics. The diagnosis was cutaneous collagen dysplasia suggestive of cutaneous asthenia. This is the first report of cutaneous asthenia in a baby albino Burmese python in Latin America.

Keywords | Burmese python, Histopathology, Ehlers-Danlos syndrome, Wounds, Cutaneous asthenia 

...

Ji Feng, Yuan Li, Puqing Song, Ran Zhang, Hai Li and Longshan Lin*

...ships (LWRs) of six fish species from the central and southern South China Sea are presented in this study. A total of 359 specimens were collected by light falling nets (20~36 mm mesh size) in 2012. The b values of the LWR equations varied between 2.670 and 3.265 for the studied species. As a supplement to LWR data, it is the first time that relevant data from this sea area have been provided to fish base.

...
Fei Kong1,2, Qingjun Zhu1, Fanrong Xiao1, Jacob Mueti Ngwawa1, Hongxing Zhang2 and Haitao Shi1*
...s result showed that the species diet was noted to be primarily omnivorous and comprised 23 prey taxa classified into nine groups: plant (4), fish (1), frog (1), earthworm (1), insect (9), mollusk (3), shrimp (2), and other miscellaneous items.

...

Houria Bouazzara1,2,*, Rachid Chaibi 1,2, Farouk Benaceur 1,2,3, Amira Nouioua4 and Laura Bruno 5

...Thirty-three zooplankton species belonging to four taxa have been described from the Wadi M’zi River; Copepoda, Rotifera, Cladocera and Nematoda. The following diversity indexes were used to measure the diversity of zooplankton species in the lake; Shannon Index 3.14 to 3.8, Pielou Evenness Index 0.72 to 0.84 and Margalef Index 1.08 to 1.45. The zooplankton communities were observed to be abundant in spring and summer ...

Tarık Bugra Saruhan and Alptug Sarı*

...of information about the species, poaching, predator pressure, stray dogs, roads, agricultural drugs, and environmental pollution.

...

Leila Shirani Bidabadi1,2, Mulood Mohammadi Bavani3, Fatemeh Janjani4, Abedin Sghafipour5*

...sisting of almost 48,000 species around the world, but about 200 species have medically importance and sometimes can be fatal. The Iranian spider species belongs to 51 families and comprising 763 species. Of these families, Theridiidae and Sicariidae are the most medically important. The genus Latrodectus (Theridiidae) is the most dangerous spiders in Ir...

Muhammad Rizwan, Abu Bakar Muhammad Raza, Muhammad Zeeshan Majeed*, Muhammad Arshad

...lign: justify;">Mealybug species Drosicha mangiferae (Green) (Hemiptera: Pseudococcidae) has become a serious pest of many horticultural crops including citrus. Population studies are important to understand the abundance, life history and estimating extinction probability. The present study was conducted in three localities (tehsils) of district Sargodha during 2017 to determine the population dynamics of D. mangiferae nymphs and adults on citrus plants. Resu...

Nora Faten Afifah Mohamad1, Hassan Haji Mohd Daud1, Ruhil Hayati Hamdan2, Sharifah Raina Manaf3, Ain Auzureen Mat Zin2, Nik Nur Fazlina Nik Mohd Fauzi2

...mmercial importance fish species. The fish species include the African catfish (Clarias gariepinus), Asian catfish (Clarias macrocephalus) and hybrid C. macrocephalus X C. gariepinus (CMxCG). The fatty acid profiles of fishes were performed using a liquid gas chromatographic examination of methyl esters. The overall mean of saturated fatty acid (SFA) composition was significantly higher (p<0.05) in C. macrocephalus (48.21...

Fan Da1,3, Zheng-Yong Wen1,2*, Xiao-Dong Wang4 and Yu Luo5

...ucp2 was consistent with species evolution, and the pvucp2 shared a close relationship with electric eel ucp2. Quantitative PCRs showed that pvucp2 was extensively expressed in all detected tissues, with the highest expression in liver. Two-week fasting significantly decreased while refeeding dramatically increased the hepatic pvucp2 transcriptions. These findings suggested that fish UCP2 proteins are highly conserved and they might play important roles in mai...

Evrim Sönmez

...g economically important species in our country since it reduces the germination value and nutritional value of seeds. As a result of understanding the effects of entomopathogenic fungi on pests in recent years, researchers have also focused on fungi in fighting pests. These fungi, which are sold as bioinsecticides in the market, are generally preferred by producers who want to engage in organic or environmentally sensitive agriculture. Although there are a la...

Magdy M. Fahmy1, Nisreen E. Mahmoud 1*, Mohamed R. Mousa2, Manal M. Zaki3, Elshaimaa Ismael3, Mai Abuowarda1 

...0 different ectoparasite species (4 Crustaceans, 4Monogeneans and2 Protozoans) of which the crustaceans recorded the highest prevalence (63.67%). In the present study, Manzala Lake and its corresponding fish farms considered new localities for the detected crustacean and monogenean species. Significant positive correlations between the prevalence of parasitic infestation and water quality parameters were reported. Pathologic...

Mohammad Mahmudi1,2*, Muhammad Musa1,2, Sulastri Arsad1,2, Evellin Dewi Lusiana1,2, Alamanda Bunga1, Nur Azlina Wati1 

...of phytoplankton but low species diversity. Meanwhile, the water inlet and outlet of the shrimp farming which served at mangrove area had higher phytoplankton diversity. The composition of phytoplankton in this work was ideal for shrimp farming because it was dominated by the Chlorophyta and Chrysophyta divisions, which favour shrimp growth. On the other hand, water quality parameters across studied sites were quite similar, except for temperature and dissolve...

Mudssar Ali1*, Muhammad Awais Ahmad1, Asif Sajjad2 and Shafqat Saeed1

...syrphid fly and four bee species were found visiting the carrot flowers that comprised of 65% and 35% of total abundance respectively. Among Syrphidae, Eristalinus aeneus was the most abundant followed by E. laetus while E. arvorum was the least. In Apidae, Apis dorsata was the most abundant followed by Lasioglossum sp (Halictidae) while Xylocopa sp. was the least abundant bee species. The foraging behavior in terms of visit...

Asli Salcioglu

...ee Mediterranean Spicara species was investigated by using the 16S rRNA gene for confirmation of the taxonomic status and also identify incorrectly classified sequences on the GenBank database. The results of the haplotype network and phylogenetic trees show three distinct Spicara haplotypes/haplogroups, corresponding to three different species. Additionally, the number of mutations and high values of sequence divergences we...

Hyun-Ju Cho1, Eun-Jae Lee2 and Shin-Jae Rhim3*

...o 1934.1 ha in size. Six species of small rodents were captured during this study. The number of small rodent species and the total number of captured individuals were correlated with patch size. We focused on the patch size and preferred habitat variables of two dominant small rodents, Apodemus agrarius and A. peninsulae, and found that the numbers of captured individuals of both species ...

Mariam Arain1, Asghar Ali Kamboh1* and Muhammad Javed Arshed2

...rol group. The bacterial species produced weak positive biofilm formation (p<0.05) in Se supplemented goats as compared to control group. The hematological indicators revealed that the values of hemoglobin, hematocrit, erythrocytes, mean cell hemoglobin, mean corpuscular volume, mean corpuscular hemoglobin concentration, leukocytes, neutrophils, lymphocytes and monocytes count were significantly higher (p<0.05) in the Se treated group compared to control...

Tiyyabah Khan1, Hafiz Azhar Ali Khan1*, Muhammad Rizwan Khan1, Muhammad Umer1, Adnan Akhter1 and Waseem Akram2

...nhibition of both fungal species on wheat grains. Mortality of C. ferrugineus had only a highly significant and positive correlation with the infection inhibition of A. parasiticus (p<0.01). In conclusion, the tested insecticides proved effective in controlling C. ferrugineus and T. castaneum with indirect effect on fungal infection inhibition.

...

Rabia Bibi1, R. Muhammad Tariq2, Samir A.M. Abdelgaleil3 and Munawwer Rasheed1, 4*

... pests infestation. Four species of red seaweeds Asparagopsis taxiformis, Laurencia karachiana, Gracilaria foliifera, and Jania rubens found abundantly along the Karachi coast, Pakistan were collected in the year 2015-18. Samples were extracted using a Soxhlet extraction method with solvents of varying polarity (hexane, dichloromethane, and methanol). Five different concentrations of the extracts were subjected to the toxic assessment against two

Zunaira Noreen* and Khawar Sultan

...orests containing exotic species. The canal bank forest is one of such artificial forests present in Gujranwala, Pakistan. This study is designed to investigate role of canal bank forest as habitat for the native species of birds, their adaptability to exotic trees, and to understand role of mixed tree population in establishing the population of birds. Field data of the forest (N=1533 trees, 15 spec...

Huapu Chen1, Zhiyuan Li1, Yaorong Wang1, Wei Yang2,*, Hongjuan Shi1, Shuisheng Li1,3, Chunhua Zhu1 and Guangli Li1,*

...ally important farm fish species found in Southeast China. Production of all-female spotted scat population with superior growth traits can significantly increase farmer’s benefits due to its sexual dimorphism in growth. Herein, the sex ratio and differences in morphometric traits were observed between females and males in a full-sib population of S. argus. Then the correlation between these traits and their effects on body weight (BW) was analyzed. The ...
Muhammad Tariq Khan1, Muhammad Ather Rafi2, Riffat Sultana3*, Anjum Munir1 and Sajjad Ahmad4
...des annotated list of 10 species and subspecies of subfamily Eumeninaein in Sindh province under 5 genera i.e. Delta, Knemodynerus, Antepipona, Allorhynchium, Antodynerus. Besides this, their bio-geographical affiliations have also been discussed. Of these species and subspecies 6 are part of the Oriental fauna, one is part of the Afrotropical and Palear...

Uzma Jabeen1, Asmat Salim2*, Irfan Khan2, Nadia Naeem3 and Rubina Mushtaq4

...drug. As reactive oxygen species are significant regulators of transcription factors and gene expression, this study was aimed at analyzing the expression levels of genes that are induced in response to oxidative stress following DOX administration to rats. DOX was administered to rats intraperitoneally at 3 mg/kg at alternate days for two weeks. Kidney tissues were harvested and the mRNA levels of glutathione peroxidase-1(Gpx1), NAD(P)H quinone dehydrogenase ...

Hua Liu, Wei Hou, Li Peng, Changjun Peng, Yansen Cai and Jing Li*

...stigations in endangered species. Based on the whole genome sequences of Macaca thibetana, we successfully developed 26 SNP loci that were sensitive to non-invasive samples, then based on which, genetic diversity and population structure of three populations of M. thibetana were estimated. Our results showed the novel SNP loci were polymorphic and bi-allelic. The observed and expected heterozygosity across 38 individuals varied from 0.184-0.605 and 0.405-0.506...

Abdul Malik Ahmed, Bhargav Bhushan Nath, Ayub Ali, Jiten Sarma, Bipul Phukan, Imtiaz Ahmed* and Jyotirmoyee Das

...allometric growth of the species. The overall sex ratio (M:F) was 1:1.84 (Chi-square 40.38, P <0.01), indicating the predominance of females over males. Monthly analysis data of Gonado Somatic Index (GSI) showed two peaks with one in April and another in August suggesting Gudusia chapra breeds twice a year. The species was recorded to be highly fecund with fecundity ranging from 7,095-48,238. The relationship between fecu...

Muhammad Altaf1* Arshad Mahmood Abbasi2, Muhammad Shoaib Amjad3, Sadia Naseer1 and Muhammad Umair4

...may have jumped to avian species and evolved as Deltacoronavirus group. The avian coronaviruses jumped among other avian species, giving rise to Gammacoronavirus from Deltacoronavirus, while Betacoronavirus may have given rise to Alphacoronavirus. It is known that SARS-CoV-2 belongs to Betacoronavirus. This most similar virus is verified in bat and Malayan Pangolin. Analysis showed that SARS-CoV-2 most probably originated by...

Riffat Sultana1*, Samiullah Soomro1 and Chuan Ma2

...past many of its sibling species were misidentified on morphological examination. However, DNA-based species assignments has now made it possible to overcome this barrier. In this study we present CO1 gene data set on the 6 species of Chrotogonus i.e. Chrotogonus (Chrotogonus) homalodemus homalodemus (Blanchard, 1836) with two forms: long winged form and short winged form, C. (Chrotogonus)...

Luan Arthur Queiros Lima, Talita Monielly Alves de Oliveira, Thiara Guimarães Maia, Ayko Shimabukuro, Itainara Taili, Raul dos Santos and Cecilia Calabuig*

... feeding behavior of the species, being the first to record the predation and activity of the crab-eating-fox over a boa under the daylight.

...

Santosh Kumar1*, Riffat Sultana2* and Martin Husemann3

...August 2019. We found 25 species of grasshoppers, crickets and tree crickets. Caelifera were more diverse than Ensifera with 16 and 9 species, respectively. This work is provided an extended list of Orthopterans registered from Cholistan desert for the first time. 

...

Huahua Fang, Daquan Zhou and Xiaoyu Dong*

...hips (LWR) of three fish species (Lepidotrigla microptera, Liparis tanakae and Trachidermus fasciatus) from the Yellow Sea along coastal waters of Shandong province, China were estimated. Ninety-one samples were collected from March to June 2019 through trawl nets in the Yellow sea area (36°27′02″N 121°08′68″E). The length-weight relationships of Lepidotrigla microptera, Liparis tanakae and Trachidermus fasciatus can be expresse...
Nadeem Raza1, Aneela Zameer Durrani1, Muhammad Hassan Saleem1, Ali Ahmed Sheikh2, Muhammad Usman1*, Quratulain Mujahid3, Muhammad Zahid Iqbal1 and Muhammad Rizwan4
...standing of other animal species as well as humans in Pakistan.

...

Nahla Hamada Magd Khalil1*, Ihab Mahmoud Helal2, El-Desoky Hassan Ibrahim Dorrah1, Soad Ahmed Soliman Ismail3 

...ne) in the examined fish species at different concentrations. Mullet fish samples had significantly (P < 0.05) the highest concentrations of alderin, dieldrin and heptachlor epoxide with mean ± SE concentration of 89±0.85, 36.7±0.66, and 38.9 ±0.49 ppb, respectively. Tilapia fish had the highest concentrations of DDD, DDE and γ-chlordane with a mean ± SE concentration of 80.5±8.61, 46.6±9.77, and 79.5&p...
Adnan Ihsan*, Najeeb Ullah, Muhammad Usman, Syed Fahad Shah, Misbahullah, Riaz Hussain and Jawad Sarwar
...khtunkhwa, Pakistan, the species Enicospilus adustus and Enicospilus ramidulus are newly recorded for the fauna of Pakistan. Morphological descriptions and digital images of the recorded species are provided.

...

Mona M. Osman1, Kamelia M. Osman2, Manal Abu Elmakarem Mohamed1, Mahmoud E. Hashad2, Jeeser Alves Almeida3, Alaa Saad4, Octavio Luiz Franco5,6, Heba N. Deif 2* 

... by PCR using Mycoplasma species-specific primers. MIC testing of the axenic isolates showed that 19 of them were 100% susceptible to tulathromycin, streptomycin, oxytetracycline and tylosin and highly resistant to danofloxacin, lincomycin and florfenicol. Some interactions demonstrated significance (p <0.05), such as hemolysis/ tulathromycin (-0.607), tylosin/streptomycin (0.519), lincomycin/ florfenicol (0.808), lincomycin/ oxytetracycline (0.47) and oxyt...

Waqar Khan1, Muhammad Atif Khan1, Waseem Abbas1, Muhammad Shakeel1, Hammad Uddin2 and Bismillah Shah1*

...aled the presence of two species, Exitianus nanus (Distant) and Exitianus indicus (Distant) in the region. Their morphological descriptions, an identification key, and photographs are given. Specimens of all examined materials are deposited at the department of Entomology, The University of Agriculture, Peshawar, KP, Pakistan.

...

Bridget Adah1*, Clara Kwanashie2, Haruna Kazeem2 and Samuel Mailafia1

...ed to isolate Leptospira species from pigs. The organisms were isolated using Ellinghausen-McCullough-Johnson-Harris (EMJH) enrichment and basal medium, and identified using dark field microscopy. A total of two hundred (200) blood samples and two hundred (200) urine samples each were collected from pigs in Kaduna state, Nigeria. A total of 9 (4.5%) of the cultured samples were positive for the Leptospira organisms and % isolation from blood sample was 7 (3.5%...

Judith Kiptoo1*, Daniel Mutisya2, Paul Ndegwa1, Ruth Amata3, Lucy Irungu4 and Rotich Godfrey5

...in Kenya. The identified species were Meloidogyne incognita, Tylenchulus semipenetrans, Helicotylenchus dihystera and, Pratylenchus brachyurus. The most abundant species in all the surveyed localities was T. semipenetrans. Factor regression analysis results showed that modest rainfall amounts favoured high density populations of PPNs on citrus roots where soil types of Rackers in Baringo and Luvisols, Ferralsols and Cambisol...

Weidong Huang1,2,3, Xinyue Liang1,2,3, Xiufeng Xie4, Xingmin Wang2, 3 and Xiaosheng Chen1,2,3*

... identification for this species

...

Dali Wang1,2, Yujing Zhu1,2, Wancai Xia1,2, Mei Zhao1,2,3, Chan Yang1,2 and Dayong Li1,2*

...ears. In total, 27 plant species were observed within the debris field, all classified as either shrubs or herbaceous plants. Gnaphalium hypoleucum had the highest importance value of the herbs (27.48%), while Leycesteria formosa had the highest importance value of the shrubs (17.33%). The Shannon-Wiener diversity index was significantly higher in the lower section and the Bray-Curtis distance was significantly lower, suggesting vegetation recovery has progres...

M.A. Salam1,*, Sarada Kanta Bhagabati1, Rajdeep Datta1, H. Ramananda Singh2 and Gunajit Oinam2

...ncludes diversity within species, between species, and of ecosystems. The fish diversity of lake Kharungpat comprised of 29 species under 20 genera, 11 families and 6 orders. The study revealed that, among the identified fish species Amblypharyngodon mola, Esomus dandricus, Puntius sophore and Channa orientalis was found to be highly abundant. The record...

Haroon1, Chen-Xu Ye1, Yu-Xin Li1, Hong-Xin Zhang1, Qing Liu1, Xiao-Hong Su1,2,3 and Lian-Xi Xing1,2,3,*

...chanism. This well-known species was reared in an artificial environment under darkness at Northwest University, Xian, China, from May 2018 to June 2019. After the inaugural colonies foundation, imagoes started egg-laying during 30-40 days. The hatching ratio increased gradually during the time. The femal+male (FM) worker reproductive (ergatoids) colonies were reported significantly (p<0.005) in egg-laying and chambers making than primary reproductives (ima...

Nkiru E. Ekechukwu, Felicia N. Ekeh, Chinenye M. Ohanu, Hope C. Ezinwa and Ifeanyi Oscar N. Aguzie*

...tion methods. Overall 12 species were recorded, Orba had the lowest species diversity with 7 species while Obollo-afor and Ikpa recorded 10 and 9 species respectively. Dipteran and Coleoptera were the most diverse and abundant order observed with Musca domestica (Diptera: Muscidae) being the most abundant species encou...

Tabassum Ara Khanum, Nasir Mehmood* and Shahina Fayyaz

...ree-living soil nematode species, Neorhabditis andrassyii n. sp., and Poikilolaimus oxycercus which represents a new record of this species from Pakistan. Neorhabditis andrassyii n. sp. is characterized by having male (1109-1222) µm long body, spicules 32-44 µm long, gubernaculum slightly curved, boat shaped with flat distal end eight pairs of bursal papillae were present. Tail (46-68) µm long conical with ...

Nour H. Abdel-Hamid1*, Walid Elmonir2, Eman I. M. Beleta1, Rania I. Ismail1, Momtaz Shahein1, Mahmoud E. R. Hamdy1 

...=29) from different host species and governorates. The isolates were identified by the bacteriological and molecular techniques (AMOS-PCR) as Brucella (B) melitensis biovar 3 (n=24) and B. abortus bv1 (n=5). The ERIC and RAPD primers (ERIC2 and Operon 18/ RAPD4) used in this study created polymorphic band patterns in all Brucella isolates and the reference strains. ERIC-PCR and RAPD-PCR Dendrograms clustered the B. melitensis isolates into two clusters and thr...

Abdul Majeed1, Zhenlin Liang2, Lixin Zhu2, Chunli Liu2, Muhsan Ali Kalhoro1,* and Faisal Saeed1

...mercially important fish species from northern Arabian Sea, Pakistani waters. Present study was conducted on stock status of shrimp scad A. djedaba fishery from Balochistan coast, Pakistan. The data was collected from March 2019 to February 2020, and a total of 1,027 pairs of length-weight and length-frequency data distribution were measured. Computer software FiSAT package was used to analyze the growth and mortality rate parameters. The length-weight relatio...

Jae-Kang Lee, Hyun-Su Hwang, Tae-Kyung Eom, Dong-Ho Lee and Shin-Jae Rhim*

...We focused on two rodent species for statistical analysis, the striped field mouse (Apodemus agrarius) and the Korean field mouse (A. peninsulae). A. agrarius preferred microhabitat with dense ground vegetation, whereas A. peninsulae preferred understory vegetation. Ground vegetation was reduced as slope gradient increased, but understory vegetation was not affected by slope gradient. The results highlight that the A. agrarius population was influenced indirec...

Mujahid Tanvir1, Muhammad Asam Riaz1*, Muhammad Zeeshan Majeed1, Mazhar Iqbal Zafar2, Muhammad Tariq3 and Muhammad Bilal Tayyab1

...s of 40 indigenous plant species collected from Soon Valley and surrounding salt range of Pakistan bioassayed against C. quinquefasciatus larvae, eighteen botanicals exhibited more than 50% larval mortality in 48 h exposure. The most effective botanical extracts were Maerua arenaria Forsk, Nerium indicum Mill., Withania coagulans Dunal, Suaeda fruticosa (L.) Delile, Olea ferruginea Wall., Adiantum capillus-veneris L. and Dicliptera bupleuroides Nees exhibiting...

Nausheen Irshad1, Maria Akhter1, Tariq Mahmood2*, Faraz Akrim3, Muhammad Rafique Khan1 and Muhammad Sajid Nadeem4

...d Kashmir, Pakistan. The species occurrence was confirmed by direct field sightings (live and kill), and indirect signs (pugmarks, burrows, fecal droppings, and reported sightings by local community). During one-year study period (September 2015-August 2016), a total of 28 individuals of the species were sighted in the field including 18 live and 10 dead specimens. In addition, 93 fecal samples of the <...

Samreen Khan*, Salma Javed and Nasira Kazi

...on was identified as new species and related with Group 2 of Aphelenchoides species, distinguished via length of female’s body 428-444 µm (0.42-0.44 mm), cephalic region rounded and offset. Lateral field found with three incisures. Cuticle finely annulated, about 1µm apart. Stylet 10 µm (10±0), delicate with minute basal knobs. Excretory pore located 2 µm anterior to the metacarpus and 44...

Muhammad Ismail1,*, Abu Bakar Muhammad Raza1, Muhammad Zeeshan Majeed1 and Umair Abbas1 and Riaz Hussain2

...ral crops. This invasive species causes substantial economic loss to citrus produce each year in Pakistan. Farmers rely on persistent synthetic insecticides for fruit fly control. Insecticidal phytoextracts are biorational alternates to hazardous synthetic insecticides. This study evaluated the efficacy of aqueous extracts of neem (Azadirachta indica A. Juss), garlic (Allium sativum L.), ginger (Zingiber officinale Roscoe) and lime citrus (Citrus aurantifolia ...

Tariq Mahmood1*, Shakeela Ismail1, Faraz Akrim2, Muhammad Farooq1, Nadeem Munawar1 and Muhammad Raza Khan1

...lign: justify;">Two wolf species reported from Pakistan include the grey wolf (Canis lupus pallipes) and the Tibetan wolf (Canis lupus chanco). Limited studies have focused on grey wolf ecology in the country, therefore, scientific data on the species’ ecological parameters and conservation are scanty. The species is also facing persecution threat in response to depredation on livest...

Weam Mohamed Baher1, Wageh Sobhy Darwish2*, Abdelazim Elsayed Elhelaly3,4 

... samples in the two fish species; while infested the muscles in 30% and 10% of herrings and sardine, respectively. The highest prevalence rates for the two species were recorded in the collected samples from Damietta, followed by Alexandria, Port Said, Ismailia, and Suez, respectively. The public health significance of Anisakis larvae was further discussed.

Keywords | Herrings; Sardine; Anisakis larvae; Egypt 

Abdelrahman A. Abdelrahman1, Salama A. S. Shany1, Kareem E. Hassan1, Mansy A. A. Dardeer2, Ali A.1*, Magdy F. El-Kady1* 

...asma spp., using PCR for species identification, MG, MS, and Untyped strains, with a high prevalence of MG (27.9%) and lowest for MS (8.8%). An rRT-PCR used for detection of AIV-H9N2 and IBV showed high prevalence for IBV (88.2%) and AIV-H9N2 (52.9%), the highest rates of co-infection were MG-H9N2-IBV, Mycoplasma other than MG/MS, and H9-IBV with rates of (17.6%), (14.7%), and (13.2%) respectively, While for single infection were IBV (14.7%) and H9N2 (7.4%)....

Samira Merabet1, Nora Khammes-El Homsi1,*, Lydia Aftisse1 and Stéphane Aulagnier2

...three small-sized murine species to the same physical and ecological conditions in a locality of Great Kabylia (Algeria). Apodemus sylvaticus, and Mus spretus synchronized their reproduction in winter and spring, Lemniscomys barbarus in spring and summer. Photoperiod and temperature cannot explain this reproduction shift that might be linked to the feeding ecology of the species.

...

Barirah Rehman Talpur1, Zaheer Ahmed Nizamani1*, Imdad Hussain Leghari2, Mansoor Tariq1, Aisha Rehman3, Shahnawaz Kumbhar1 

...treatment groups of both species as compared to control. In rabbits and broilers, necropsy findings included mild inflammation and discoloration of liver along with nephritis. While in broilers, toxic lesions were observed on mucus membranes of duodenum and proventriculus along with nephritis. Histological lesions observed in livers of both rabbits and broilers included dilation of central vein and sinusoids and fatty degeneration of hepatocytes. Kidney tissue...
Mohamed Lebdah1, Sahar Abd El Rahman2*, Ahmed Attia3, Reham Karam2, Naglaa Fathy Saeed Awad1, Mohamed Ibrahim El Bagoury1
... quails to other poultry species.
 
Keywords | Newcastle disease, Quails, RT-PCR, F gene, Pathological changes, Class II genotype VII.1.1
...

Tu Thi Minh Tran1*, Diep Hoang Tran1, Thuong Thi Nguyen2, Tomas J. Acosta3, Takeshi Tsuruta4, Naoki Nishino4, Hai Thanh Duong5

...A genes. The predominant species in the fecal microbiota was not as predominant in the milk microbiota, but occasionally appeared in the uterine microbiota. The microbiota from the airborne dust and water samples did not show a relation with either the milk or the uterine microbiota, whereas Moraxellaceae, the most abundant family in the airborne dust and water microbiota, was detected at low proportions in the milk microbiota. The farm-to-farm difference was ...

Aamir Ibrahim1, Bingyao Chen1, Hassan Ali2, Imran Ali3, Yang Cao1 and Guang Yang1*

... minor) is an endangered species found in the Indus River system of Pakistan including Beas River in India which is a part of Indus River system, enlisted in Appendix I of CITES Red List of threatened species. Currently, the whole population across the Indus River in Pakistan is divided into four subpopulations. Although photo-identification efforts on freshwater dolphins were successfully made on the Irrawady dolphin (Orcae...

Zahra Hussain, Zulfiqar Ali* and Rida Ahmad

... enhance conservation of species, while the prevalence of diseases and other pathological conditions is a very common issue in captive animals and birds. The present study investigated the prevalence of different diseases and health conditions among animal and bird species at 10 captive breeding facilities of Punjab, Pakistan. For this purpose, three-year data (2017-2019), regarding diseases and pathological conditions was c...

Noor Muhammad Khan1,2, Tariq Mahmood Khalil1,3*, Rashid Rehan2 and Iftikhar Zeb4

... locally available plant species Arundo donax (A.d) and Typha latifolia (T.l) for removing HM from the untreated wastewater of Hayatabad Peshawar used for irrigation downstream. The wastewater analysis showed that HM concentration exceeds the limits of thresholds values. For phytoremediation the T.l was tested in both on-site (in-situ) and laboratory conditions (ex-situ) while A.d was applied only in an ex-situ setup. For T.l, the average uptake of copper (Cu)...

Samina Malik1, Tahira Jabeen Ursani1, Naheed Mehmood Soomro1, Naeem Tarique Narejo2, Jawaid Ahmed Khokhar1* and Asif Soomro1

...ch were arranged into 25 species, 15 genera and ten spider families. After analyzing the data from growing to harvesting of sugarcane, two spider guilds were identified on the basis of feeding and circadian behavior. Assemblage of spiders in the sugarcane filed studied under the umbrella of guild study clearly indicate that spiders are voracious predators and excellent biological control agents. Circadian rhythm is necessary for the adaptation in the environme...

Nimra Altaf1, Muhammad Arshad1, Muhammad Zeeshan Majeed1, Muhammad Irfan Ullah1*, Hamza Latif1, Muhammad Zeeshan1, Gulfam Yousuf1 and Muhammad Afzal2

...ous economic crops. This species was first reported in Pakistan during 2019, and is now an emerging threat to Pakistan’s Agriculture. The main objective of the study was to evaluate the efficacy of a synthetic insecticide Chlorantraniliprole in comparison to different concentrations of single botanical, i.e., neem leaf extract @ (50 ppm and 100 ppm) against FAW larvae in maize. Our findings showed a significant effect (P < 0.001) of these chemicals on...

Yahia A. Amin1*, Alaa Eldin Z. Mahmoud2, Mohamed Sabry Aref3, Abd El-Latif Shaker Seddek4, Waleed Younis5 

...that different bacterial species were isolated (Staphylococcus, Streptococcus, Escherichia coli, and Klebsiella). The infection is either a single infection (Staphylococcus only), or a mixed infection, while the control group has no bacterial growth. Staphylococcus was the only microorganism responsible for the single infection. Infection with Staphylococcus and E. coli has a higher incidence of infections with two microorganisms, while infection with Streptoc...

Muhammad Luqman1*, Adeel Mustafa1, Sheer Abbas2, Muhammad Yaseen1, Muhammad Umer Mehomood1 and Raheel Saqib3

...ven the least productive species in the study area. There is an ignorable trend of spending on mechanized livestock management/handling, paid extension services, and loan repayments. Almost 81% of the livestock farmers said that they only keep the health record of their livestock head. Above 50% of the farmers said that are unable to afford the veterinary services available. In the case of LDDD, LED and DVS, farmers said that they have assisted us. But the far...

Alsi Dara Paryuni1, Soedarmanto Indarjulianto2, Tri Untari3 and Sitarina Widyarini4*

...sease caused by fungi of species dermatophyte. The case of dermatophytosis have increased not only in humans but also in animals, especially dogs and cats. The close interaction of cats and humans reported to play an important role in dissemination of zoonotic diseases. Therefore, this study aims to diagnose and to treat of dermatophytosis in cats. Twenty cats with the age of 6-12 months were used in this study. Determination of dermatophyte infection in cats ...
Aiman Al-Mufarji1, Abd El-Nasser Ahmed Mohammed1*, Haitham Al-Masruri2, Rashid Al-Zeidi3
...tion varies depending on species and nutrient availability for production. Genetic engineering might be used for production invaluable microalgae compounds. Microalgae consider a promising source of omega-3 fatty acids (n-3 FAs), which have beneficial effects for humans and animals. Knowledge for microalgae effects on productive, reproductive and therapeutic performances is more fragmentary. Therefore, the present standard review article is compiled and discus...

Amany R. Sultan1, 2, Gamal A. Morsi2, Hoda El-Fayoumi1, Abdel-Azeem S. Abdel-Baki1*

...est that these parasitic species could be used in biological control of T. absoluta.
 
Keywords | Solanum lycopersicum, Biological control, Parasite, Prevalence
...

Atta Ullah*, Nasrullah Khan, Ataur Rahman and Rafi Ullah 

...ndred and sixteen plants species belonging to 99 genera and 50 families were recorded and identified with the help of available literature. Of these, monocots were represented by 17 species under 15 genera and 5 families, while dicots were represented by 99 species belonging to 84 genera and 45 families. The results reflect that 24% of plants were used as fodder, 29% fuel, 20% medicinal, 1...

Limei Yuan1, Kong Yang1* and Dechun Jiang2*

...ue to their complex interspecies relationships, and the phylogenetic status of many species are still unclear, which hampered the taxonomy and protection of these species. In this study, we investigated the molecular phylogenetic status of R. laoshan and Z. yinggelingensis using mitochondrial DNA (12S rRNA, tRNAVal, 16S rRNA and Cyt b) fragments and nuclear DNA (RAG-1, RHOD, TYR) fragments...
Makhamadi Abramatov1*, Abdurakhim Kuchboev2, Bakhtiyor Ruziev3 and Khumoyun Sobirov2
...nematodes represented 28 species, including sheep - 25, goats - 21 and, cattle – 22 of these 27 species belonged to in are geohelminthes, and only 1 species was biohelminthes the main core of nematodes of the gastrointestinal tracts of domestic ruminants is 14 species, 11 - facultative and 3 - potential. The total infection was 76.7% in sheep, 61.7...

Harpreet Kaur* and S.S. Hundal

...ed in both the earthworm species in all the doses of imidacloprid, indicating neurotoxicity. There was an initial increase in the GST activity followed by its decrease with the duration of exposure to imidacloprid. Imidacloprid is highly toxic to earthworm inducing physiological which may cause catabolism of enzymes. Earthworm M. posthuma was observed to be more susceptible as compared to E. eugeniae. The current study signifies that the irrational use of such...

Jawaid A. Khokhar*, T. J. Ursani, Fareeda Memon, Samina Malik, Asif Soomro and Fareeda Shah

...ed into 06 genera and 08 species along with morphometrics of 40 oothecae which were sorted and a few healthy were allowed for hatching at the advanced research laboratory of Arachnology and Entomology. The collected samples were kept at an Average temperature and humidity between 28.2 ± 0.47 to 38.78 ± 0.47 0c, 57.6 ± 0.55 to 72.6%, respectively.

...

Veronica Ngozi Emenuga1, Clara Idara Eleazar2*, Seto Tunrayo Aladenika1  

...distributions of various species within the bedding was significantly different (P= 0.001). Trichophyton mentagrophytes had the highest rate in the beddings (22%) followed by T. verrucosum (16%), while T. verrucosum had highest occurrence rate (24.2%) in cattle samples followed by the T. mentagrophytes (21.2%). Candida albicans was the most prevalent specie in milk (46.3%), followed by F. solani (31.7%). The correlation coefficient(r) in the bedding ...

Syed Wajahat Husain Jaafry1* and Amber Fatima2

...of molecular evidence in species recognition studies have made this topic more curious and complex. Some plant species compete more vibrantly for below-ground resources when an encounter with neighboring unrelated conspecifics as compared to related conspecifics (kin recognition). Some species increase competition when interacting with related and unrelated conspecifics (niche partitioning...

Muhammad Furqan and Zulfiqar Ali

...t. We recovered 45 plant species in major, minor, and trace forms which consisted of seeds, leaves, flowers, fruits, rhizomes, and bulbs. Invertebrates including ants, insects, larvae, and grit were also recorded. According to respondents the highest sighting (62.4%) of kalij pheasant was recorded from the forest, followed by cultivated land (20.4%). Major threats to kalij pheasant include forest fire (41.6%), followed by hunting (27.2%), habitat destruction (...

Mudssar Ali1*, Muhammad Awais Ahmad1, Asif Sajjad2 and Shafqat Saeed1

...d of seven solitary bees species (Nomia oxybeloides, Amegilla sp., Lasioglossum sp., Megachile sp., Xylocopa sp.), two honeybee species (Apis dorsata, A. florea) and two syrphid fly species (Eristalinus aeneus, Ischiodon scutellaris). In both the years, honey bees were more abundant than the solitary bees while the syrphid flies were least abundant. However, visitation rate of solitary bee...

Asma Fatima*, Ghulam Abbas and Shahnaz Rashid

... determined. Overall, 61 species of plankton have been recorded from the studied ponds and categorized into 19 groups; of which 25 phytoplankton species belonged to four major groups, whereas, 36 zooplankton species belonged to 15 groups. Among them, Bacillariophyta (69.815%) and copepods (78.927%) were “most abundant” as compared to other groups of phytoplankton and zooplankto...
Muhammad Kashif Iqbal1*, Khalid Mehmood2,4, Shakeel Ahmed3, Fazul Nabi4, Muhammad Arif Rizwan1, Muhammad Kaleem1, Mushtaq Ahmed1, Abdul Waheed1 and Jiakui Li5
...of rapidly growing avian species characterized by enlarge avascular growth plate with lesions in proximal tibiotarsal bone. The aim of present study was to investigate the antioxidant capacity of FK228 and role of vascular endothelial growth factor (VEGF) and Flk-1 genes in thiram induced TD. One hundred and fifty broiler chicks were equally divided into 3 groups: control; thiram fed; and FK228 treatment group. Expressions of VEGF and Flk-1 genes were analyzed...

Murat Durmuş* and Nazan Koluman

...fference between the two species with regard to feed consumption and live weight gains during the 8-week fattening period were found to be significant (P<0.05). Considering slaughtering data, the difference between lambs and kids in terms of hot and cold carcass weights, head weights, feet weights and leather weights were found to be significant (P<0.05). Kid and lamb meat were found to be similar with regard to parameters such as color (Brightness, redn...

Muhammad Akram1*, Muhammad Imtiaz Shafiq2, Amber Malik3, Farmanullah Khan4, Munir Ahmad Bhinder5 and Muhammad Sajjad6

...tralizes reactive oxygen species to regulate physical homeostasis in the body. The target of this study was to evaluate the molecular role of GST genotypic polymorphism involved in the development of CVD. For this case-control study, a total of 504 participants including 261 CVD patients and 243 healthy individuals were enrolled after taking informed consent. The analysis of the three allelic variants GSTM1, GSTT1, and GSTP1 was carried out through PCR-based a...

Muhammad Hanif Chandio1,2*, Naeem Tariq Narejo2, Muhammad Farooq Hassan3, Faheem Sadar4, Nasiruddin Shaikh1, Bushra Ainy Dars5, Ghulam Abass6, Asma Fatima6 and Shahnaz Rashid6

...ring of native snakehead species.

...

Umar Farooq Gohar, Attia Majeed, Bushra Muneer* and Hamid Mukhtar

...an produced by few plant species and endophytic fungi is used as precursor for the chemical synthesis of the anticancer drugs. In the present study, for the isolation of podophyllotoxin producing endophytic fungi 30 plant (Podophyllum hexandrum) samples were collected from different localities of Pakistan. About 261 fungal strains isolated, among them 22 strains had the ability to produce podophyllotoxin. Maximum podophyllotoxin production (88.14µg/ml) w...

Zaidi Zona, Zulfiqar Ali*, Rida Ahmad and Irfan Zainab

...1) and zooplankton (n=3) species in study area. In total, 37 fish species were found in the study area, with species richness rising from zone one (n =10) to zone five (n =33). Altogether, the fish diversity represents 25 genera and 13 families. To analyze the data, principal component analysis (PCA) was done by using XLSTAT and excel 2019 to study the factors affecting the water quality. ...

Shahbaz Ahmed1, Mubeen Ahmad1, Muhammad Razaq1* and Farhan Mahmood Shah1,2*

... the most abundant aphid species and coccinellids, the most abundant predators. S. graminum was least on unstressed or tillering stressed wheatbut was the most on wheat stressed at booting, heading, and grain formation stages. Irrigation stress reduced chlorophyll contents (5-25%) and wheat yield (kg/ha) (6-31%) when compared with unstressed wheat. The irrigation stress changed coccinellid abundance and predator-prey ratio. Altered plant physiology and a weake...
Ejaz Ur Rehman1, Shakeel Ahmad2, Fathul Bari3*, Tanveer Khan2, Naveed Ullah Khan2, Abdullah Khan4 and Romaan Hayat Khattak2
... the energy needs of the species and the resting time peaked during mid-day, may be associated with temperature coping strategy. Difference observed in pre and post hatching activity patterns may be attributed to time needed for incubation and responsibility of providing food to the young ones. White-throated kingfisher makes need based time allocation for various activities to increase reproductive success. The current study documents important ecological and...
Faiza Ghazanfar1, Masood Rabbani1*, Aamir Ghafoor2 and Muhammad Hassan Mushtaq3
...members of Campylobacter species. The causative agent is Campylobacter that asymptomatically colonizes broilers during development and contaminates it during slaughter. Outbreaks mostly start from the ingestion of contaminated poultry products or infected water. Reducing colonization of Campylobacter jejuni in the gut can be useful in decreasing the contamination of the poultry. Different organic acids display potential as a substitute of antibiotics. These no...

Haitham Al Masruri1, Rashid Al Zeidi2, Aiman Al Mufarji3, Abd El-Nasser Ahmed Mohammed3, Ahmed Al-Madani4, Al-Hassan Mohammed5* 

...lability for production, species, and lifespan of trees. Extracts of leaves and seeds were used for the production of invaluable compounds. Knowledge of M. oleifera impacts on productive, reproductive, and therapeutic performances is more fragmentary and the present review is compiled and discussed owing to the importance of M. oleifera and its purified compounds.

Keywords | Moringa oleifera, Growth, Reproduction, Milk, Blood 

...

Muhammad Mansoor1, Shahid Hameed Khan Khalil2*, Zafar Islam2, Muhammad Asif2, Ghani Akbar2, Muhammad Ashraf Khan3 and Ibadullah Jan4

...ate palm is a thermopile species and can withstand large temperature fluctuations, yet recent climate changes especially prolonged monsoon patterns, starting earlier (end of June) and lasting till September with sporadic changes, has posed multiple threats for Dhakki dates causing spoilage of fruits at early ripening stage, hindering ripening and drying processes at the end. Growers are adapting some alternate options of making ‘Chuhara’ (dried dat...

Sohail Ahmed Talpur1, Imran Khatri1*, Maqsood Anwar Rustamani1 and Zubair Ahmed2

...Pakistan, in total three species of the genus are described; their habitus images and male genitalia is provided; Chaetocnema belli Jacoby, 1904, Chaetocnema concinnicollis Baly, 1874 and Chaetocnema pusaensis (Maulik, 1926). Distributioanl map for each species is also provided.

...

Amna Sulaman1, Qurat-ul-Ain Ijaz1, Muhammad Shafi2 and Faiz Muhammad1*

...inella pyrum is a marine species found only in the Indian Ocean. It is an economically important resource as well as a sacred animal. The meat of this animal is used in traditional medicine. T. pyrum is a less known species from Pakistani marine waters. This research validated its molecular identification as T. pyrum. The neighbor-joining results revealed that it clustered with the same species

Dong-Min Hou and Ding-Qi Rao*

...h the extinction of some species has increased awareness of the need for conservation, there are still many gaps in research on the effects of microplastics on amphibians and reptiles. More research on the effects of microplastics on amphibians and reptiles is needed to to learn more about the potential effects and direct ongoing future conservation efforts. Finally, some constructive countermeasures are proposed to promote microplastics research in amphibians...

Shou-Dong Zhang1,2,3, Dao-Xin Liu1,2, Dan Mou1, Tong-Zuo Zhang2, Jian-Ping Su2 and Jiu-Xiang Xie1*

...the composition of plant species present in overwinter caches and inside nearby quadrats of zokor burrow systems on the Qinghai-Tibet Plateau. Based on human volunteer taste-testing, or assignment using the Chinese Materia Medica Monographs, we divided the collected plant species into four different taste groups (sweet, bitter, other-taste, and tasteless) and then compared Ei values to determine whether plant taste can affec...

Jun Wang*, Xiaoming Jiang and Zhiwei Sun

...tionships (LWRs) of fish species from the mainstream of the Yellow River, which is the largest sediment-laden river in the world. A total of 1168 specimens belonging to 4 families and 18 species were analysed. The following fish species were covered: Leuciscus chuanchicus (Kessler, 1876); Ctenopharyngodon idella (Valenciennes, 1844); Squaliobarbus curriculus (Richardson, 1846); Parabramis ...

Indyah Aryani 1,3*, Suyadi Suyadi2, Hartutik Hartutik2, Kuswati Kuswati2 

...on methods. The specific species was identified by their morphology. A total 43 Madura cattles were infected by nematode worm as follows: Oesophagostomum sp., Cooperia sp., Capilaria sp., Ostertagia sp, and Moniezia sp) while, 14 Madura cattles infected by trematode worms (Fasciola sp and Paramphistomum sp). The prevalence of gastrointestinal endoparasite was found as follows: Cooperia sp. 31%, Fasciola sp. 12%, Oesophagostomum sp. 6%, Moniezia sp. 4%, Paramp...

Muhammad Rabiul Hasan1, Zannatul Mawa1, Muhammad Ashekur Rahman1, Selina Yeasmin2, Yahia Mahmud2 and Muhammad Yeamin Hossain1*

...tive allometric for both species. This study would be helpful for the fisheries researcher and biologist to conserve and sustainable management of these species.

...

Reem M. Ramadan1, Fady Sayed Youssef2, Gehad Genidy Mohamed3, Sameh Hamed Ismail4, M.M. El-Bahy1, Shimaa Abdel-Radi1* 

...sus five chicken Eimeria species oocysts. The immature oocysts were exposed to 5, 10, 20, and 40 ppm, each for 1, 3, 6, 9, 12, 24, and 36 h. Percentage of sporulation inhibition in oocysts and comet assay were used to investigate the C-Oo.Nc destructive effects. The infectivity of sporulated oocysts exposed to LC50 & LC90 were evaluated by In vivo inoculation of broiler chicks. The results demonstrated that the increase in the rate of sporulation inhibitio...

H. A. Aidaros1*, S. S. Khalafallah1, M. S. Diab2, Nehal K. Alm Eldin2, Halla E.K. El Bahgy1 

... The isolated Salmonella species showed high resistance (100%) against doxycycline, ampicillin, and amoxicillin, while E. coli species showed resistance (90%) against oxytetracycline, doxycycline, ampicillin, and amoxicillin. Both Salmonella and E. coli species were highly susceptible to gentamicin. Gene tetA and blaSHV were detected in Gene tetA and blaSHV we...

Mian Sabahatullah* and Maqsood Shah

...rst from Pakistan. A new species Opiognathus nitidus M. Sabahatullah & Shah sp.nov. is described and illustrated. Five species of the subfamily Opiinae are reported for the first time from Khyber Pakhtunkhwa province of Pakistan. The newly reported species are Areotetes carinuliferus, Indiopius fischeri, Phaedrotoma biharensis, Phaedrotoma angiclypeata and Xynobius maculipennis. New di...

Sadaf Ansari1, Shahid Hussain Abro1, Abdul Jabbar Tanweer2, Abdullah Sethar3, Ghulam Abbas4, Sabahat Ansari1, Asghar Ali Kamboh1* 

...r isolation of bacterial species. The isolated species were identified by different biochemical tests. The results showed that the contamination of bacterial organisms in both raw and cooked meat was highest in beef followed by mutton and fish respectively (p < 0.05). In raw meat, bacterial species recorded were Escherichia coli (45%, 30% and 25%), Salmonella enteritidis (20%, 17.5% and...

Bilal Dik1, Saima Naz2*, Muhammad Sohail Sajid3,4 

...id birds belonging to 14 species, and 9 genera were surveyed. For the collection of lice, feathers of birds were carefully examined; an insecticide was applied on birds into a breathable paper bags from where lice were transferred to collection tubes. Of the 182 birds, 151 (82.97%) were infested with 21 chewing lice species including 8 species of Colpocephalum: C. apivorus, C. zebra, C. tr...

Nurdan Urvaylioglu1*, Ogunc Meral1, Serkan Sayiner2, Ulvi Reha Fidanci1 and Arif Altintas1

... most dominant bacterial species seen in clinical and subclinical mastitis samples. Somatic cell counts (SCC) in cows with clinical mastitis were significantly higher than the milk of cows with subclinical mastitis and healthy cows. Milk serum haptoglobin (Hp) and amyloid A levels were not determined statistically different between groups (p> 0.05). No correlation was found between CMT scores, SCC values, Hp and milk amyloid A levels in milk serum. There we...
Zain-ul-Aabdin Abro1*, Naheed Baloch1, Raza Muhammad Memon2, Niaz Hussain Khuhro2 and Iram Shaikh1
... to eliminate Bactrocera species from different orchard agro-ecosystem of Sindh by using MAT in integration of other eco-friendly management techniques for fruit flies.

...

Zain-ul-Aabdin Abro1*, Naheed Baloch1, Raza Muhammad Memon2, Niaz Hussain Khuhro2 and Waseem Akbar Qazi2

...s pests of several plant species. Trybliographa daci (Weld.) and Diachasmimorpha longicaudata (Ashmead) are natural enemies of fruit flies widely used as bio-agents in biological control programs against Bactrocera species. In current investigations we inspected the infected guava and mango fruits from lower (Hyderabad) and upper (Larkana) Sindh regions for population surveillance of parasitoids during 2019. The results show...

Farheen Shaikh*, Saima Naz and Nadir Ali Birmani

...ed and classified into 4 species which belongs to 3 genera. The species and their prevalence are 19.23% for Menopon gallinae (Linnaeus, 1758), 23.84% for Menacanthus stramineus (Nitzsh, 1818), and 22. 30% for Menacanthus abdominalis (Piaget, 1880) which belongs to the family Menoponidae and 34.61% for Goniocotes gallinae (de Geer, 1776) which belongs to the family Philopteridae. All four species

Ishtiaq Ahmad1,2* and Muhammad Akbar Anjum1

... one of the domesticated species of pepper grown around the globe, is considered to be highly valued horticultural crop due to high productivity and intense aroma. The present study was carried out to evaluate genetic diversity among 78 selected genotypes of Capsicum frutescens through morphological attributes. The diversity assessment based on morphological attributes indicated maximum fruit weight was gained in genotype AZRI-Selection-10-B (2.82 ± 0.2...

Ghulam Ali Bajwa1*, Zahid Rızwan2 and Muhammad Atıf Majeed1

... and domesticated insect species that needs continuously new genetic combinations to avoid fractioning of genetic diversity and gene erosion. In this study ten bivoltine hybrids were screened by heterosis using 11 biological and silk yielding quantitative traits. Heterosis was measured using multiple evaluation index (MEI), mid-parent heterosis (MPH) and better-parent heterosis (BPH), and hybrids were ranked using MEI and cumulative sub-ordinate function (CSF)...

Muhammad Usman1*, Aneela Zameer Durrani1, Nasir Mehmood2, Muhammad Hassan Saleem1 and Mamoona Chaudhry3

... collected and then tick species were identified. DNA extraction was followed by detection of 16S rRNA signature gene using B. burgdorferi s.l. specific primers through conventional PCR. We found that 4.3% dogs and 8.9% tick pools were positive for B. burgdorferi s.l. Rhipicephalus sanguineus (86.5%) was the most abundant tick species. 57.1% I. gibbosus and 8.4% R. sanguineus pools tested positive for B. burgdorferi s.l. Phy...

Fawziah M. Albarakaty* 

...ckground: Numerous plant species have observable effectiveness against bacterial and fungal diseases. Finding a novel antimicrobial chemical with few side consequences is one of the most crucial phases in microbiological research because microbial resistance to chemical antimicrobial is the prevalent crisis in the therapeutic community. Objective: Therefore, this work aims to ascertain which phytochemical components can be recycled and added to the diet of an...

Syed Ishfaq Ali Shah1,3, Azaz Ahmad2 and Wanzhi Cai1,*

...cius, 1781), is a common species in Pakistan. Due to its variable color patterns, its taxonomic distinction from Acanthaspis flavipes Stål, 1855 has been confounded. The genitalia in Reduviidae are commonly used for species identification and in present studies, because of identical genitalia, A. flavipes Stål, 1855 stat. restit. is restored as a junior synonym of A. quinquespinosa. The authors surveyed different...

Muhammad Umar1*, Mubashar Hussain1 and David C. Lee2

... landscapes by wild bird species shows their adaptability to maximize their opportunities to benefit from landscape crop production. We assessed seasonal patterns in avian diversity and distribution of agroforestry, urban croplands and rural croplands of Gujrat, Pakistan from April 2017 to March 2019. We randomly positioned three one km transects > 500 m apart at each sampling point in all three study sites. We conducted both morning (0500-0800 hours) and a...

Lobna M.A. Salem, Nashwa O. Khalifa, Marwa O. Abd El-Halim* 

...ttle worldwide. Fasciola species parasitize a variety of mammals, caused by Fasciola hepatica, and Fasciola gigantica. Traditional morphological techniques to differentiate the two species can be inaccurate, especially when hybrid forms are present. The definitive identification of Fasciola species, including their hybrids, has been made possible by advanced molecular techniques. Our study...

Hamenya Mpemba1, Fan Yang1, Kirsty J. MacLeod2,3, Dusu Wen1, Yan Liu1,4 and Guangshun Jiang1,*

...ct the behaviour of prey species via lethal (direct kill) or non-lethal effects (i.e., through predation risk). For example, prey species may move from areas perceived as risky to safer spaces where predation risk is lower, which can have important consequences for investment in foraging, movement, and mating, and for the behaviour and habitat use of other species, such as mesopredators. T...

Syeda Batool Zehra1, Abdullah G. Arijo2, Aly Khan3, Nasira Khatoon1* and Samina Waheed1

...guishing closely related species. Statistical analysis is used to determine the intensity of infection in relation to age and gender. This study will focus on children who are suspected of being afflicted with pinworms. The presence of adult worms or ova in the feces is required to make proper diagnosis. The swabbing of the perianal region is utilized to determine the presence of eggs in feces.

...

Yasemin Yıldırım Meşepınar and İlker Kepenekci*

...atoda: Steinernematidae) species [Steinernema feltiae (Balıkesir isolates) and Heterorhabditis bacteriophora (Çanakkale isolates) (Nematoda: Heterorhabditidae)] detected in our country (Turkey) against the larvae and pupae of P. operculella in greenhouse-pot experiments. S. feltiae was the most effective killing 6.33±0.61 (63.30%) larvae, whereas H. bacteriophora only killed 3.67±0.56 (36.70%) dead larvae. 0.17±0.17 (1.70%) larvae ...
Muhammad Younis1, Sami Ullah1, Fathul Bari1, Muhammad Asif2, Muhammad Ilyas2, Mahvish Rauf2, Ejaz Ur Rehman3, Rubina Noor4, Muhammad Arif4 and Muhammad Ali Nawaz5*
... not available for those species except annual census counts for markhor Capra falconeri. Management and conservation efforts are assessed by using relative abundance estimates. The current study aimed to estimate relative abundance of mammalian fauna of CGNP. During the current study, 30 camera traps (motion triggered camera (Reconyx™) with infrared flash were deployed for a period of 47 days. The survey resulted in 1052 functional trap nights obtaining...

Jie Li, Gaofu Wang, Xiaoyan Sun, Lin Fu, Peng Zhou* and Hangxing Ren*

...ecule in other mammalian species. And the KITL gene was extensively expressed at 0-, 12-, and 24-month-old goat tissue. Moreover, the mRNA and protein of KITL were increasing at 0-, 12-, and 24-month-old goat skin, which were confirmed by real-time qPCR, western blotting and immunohistochemical analysis. This study provides a theoretical basis for further clarifying the biological function of the KITL gene in goat.

...

Saleh M. Albarrak1*, Fahad S. Aldahmashi1,2, Abdulrhman A. Alrubayan1,2, Abdel Kader A. Zaki1,3 

... infertility in multiple species but never been examined in male camels. We have developed and evaluated an ELISA assay to specifically detect and quantify ASAs in the serum and seminal plasma of 29 infertile dromedary male camels, which were of two different breeds (Waddah & Majaheem) and three different ages (> 3 to ≤5, ≥5 to ≤7, and >7 years). ASAs were detected in ≥ 80% of the examined animals with considerable individual variation wi...

Cheng Zhao1,2, Qin Shi1*, Gen Yang3, Youyuan Tan2, Songwen Tan2, Jiahong Li2 and Marwan M.A. Rashed2

...nicus is a threatened subspecies of sika deer. Winter is the critical season affecting the survival of Sichuan sika deer. To get strategic information about the relationship between Sichuan sika deer and the environment in the winter, we conducted our study on habitat use of Sichuan sika deer in the Tiebu Nature Reserve from January to February in 2019 and 2020. The results showed that Sichuan sika deer preferred shrub vegetation and southern slope. Compared t...

Ishtiaq Ahmad1*, Muhammad Nafees1, Maryam2, Irfan Ashraf3, Ambreen Maqsood4 and Muhammad Saqib5 

... Cu contents of both the species in spectrophotometer. Reduction in fruit weight, fruit area and moisture percentage were significantly higher in oven dry method, followed by sundry with minimum reduction in shade dry method. The depletion in Cu and Fe contents was statistically high in oven drying method, followed by shade dry and sun drying, respectively; however, Zn and Mn contents were not significantly affected by any of drying method. Cu contents were si...

Ty Nguyen, Giang Thi Huong Phung, Lan Le Thuy Hoang and Giang Van Tran*

...ly, is an important fish species in view of its immense contribution to the need of this country in terms of nutrition, economic growth and development. The results of morphometric and genetic analysis of M. cunnesius in this study contributed the documents for identification and the genetic diversity, which are the basis for further research about M. cunnesius in breeding, species conservation and management at the Tam Gian...
Yasir Hameed, Muhammad Rizwan, Muhammad Shahzaib, Muhammad Sarmad, Muhammad Farrukh Hamid, Syed Muhammad Zaka*, Khalid Abbas and Muhammad Zakria
...t predator of many aphid species such as Lipaphis erysimi and Diuraphis noxia. In biological control C. carnea is most effective predator in controlling of aphid species. The functional response of all larval stages of C. carnea is calculated over a time of 24h at different prey densities (10, 20, 30, 40, and 50). Functional response of three larval instars was calculated using a logistic regression model, where handling tim...
Yasir Hameed, Muhammad Rizwan, Muhammad Shahzaib, Muhammad Sarmad, Muhammad Farrukh Hamid, Syed Muhammad Zaka*, Khalid Abbas and Muhammad Zakria
...t predator of many aphid species such as Lipaphis erysimi and Diuraphis noxia. In biological control C. carnea is most effective predator in controlling of aphid species. The functional response of all larval stages of C. carnea is calculated over a time of 24h at different prey densities (10, 20, 30, 40, and 50). Functional response of three larval instars was calculated using a logistic regression model, where handling tim...
Yasir Hameed, Muhammad Rizwan, Muhammad Shahzaib, Muhammad Sarmad, Muhammad Farrukh Hamid, Syed Muhammad Zaka*, Khalid Abbas and Muhammad Zakria
...t predator of many aphid species such as Lipaphis erysimi and Diuraphis noxia. In biological control C. carnea is most effective predator in controlling of aphid species. The functional response of all larval stages of C. carnea is calculated over a time of 24h at different prey densities (10, 20, 30, 40, and 50). Functional response of three larval instars was calculated using a logistic regression model, where handling tim...

Iqra Qazi1, Sohail Raza1*, Masood Rabbani1 and Muhammad Avais2

...iables related to animal species, age, herd size, parity, breeding method and housing management was filled at sample collection time. The serum samples were processed by indirect ELISA to detect antibodies against BoHV-1. The overall sero-prevalence was 68.40%. Post pubertal animals (>3yrs) contributing more to disease occurrence. High sero-positivity was observed in buffalo (73.12%) as compared to cattle (60%) moreover, the sero-prevalence is higher in an...

Arif Mehmood1*, Muhammad Asam Riaz1, Abu Bakar Muhammad Raza1, Waqas Raza2, Muhammad Zeeshan Majeed1

...-16. A total of fourteen species belonging to four genera were collected from eight different habitats. The most abundant habitats were recreational parks, followed by residential areas and forests, while the least abundant habitats were graveyards. Maximum Simpson index (0.90) and Shanon Index (2.45) was observed in residential area, while maximum evenness (0.97) was recorded in streams. Quantitative habitat web structures were used for the first time to pres...

Khalid Hussain1, Muneer Abbas1*, Niaz Hussain1, Muhammad Irshad1, Mudassar Khaliq1, Zubeda Parveen1, Sohail Abbas2, Ali Raza3 and Abdul Ghaffar1

...ean aphid collection and species richness. Results indicated that population appeared in the standard week (SW) 52 of 1st year to SW 18 of 2nd year in both traps. Population peaks in the yellow moericke traps (YMT) and sticky trap (YST) were found during SW 08-14 and SW 10-14, respectively. The YMTs were 50 % more effective due to their higher attraction and killing rate of aphids as compared to the YSTs. The efficiency of attraction depends upon the size, sha...

Khalid Hussain1, Muneer Abbas1*, Niaz Hussain1, Muhammad Irshad1, Mudassar Khaliq1, Zubeda Parveen1, Sohail Abbas2, Ali Raza3 and Abdul Ghaffar1

...ean aphid collection and species richness. Results indicated that population appeared in the standard week (SW) 52 of 1st year to SW 18 of 2nd year in both traps. Population peaks in the yellow moericke traps (YMT) and sticky trap (YST) were found during SW 08-14 and SW 10-14, respectively. The YMTs were 50 % more effective due to their higher attraction and killing rate of aphids as compared to the YSTs. The efficiency of attraction depends upon the size, sha...

Hams M.A. Mohamed1*, Katreen K.G.2, M.W. Abd Al-Azeem1, Faysal A. Wasel2, Ahmed M. Abd-Eldayem3 

...the presence of Listeria species in raw milk. In total, 150 samples of raw milk from vendors and nearby dairy farms in Sohag, Egypt, were collected. The samples underwent a bacteriological investigation. The results showed that 22 out of 150 samples had Listeria spp. contamination. Polymerase chain reaction (PCR) using the Listeria iap gene identified 13 of the 22 isolates that were reported as biochemically positive Listeria spp. Eight isolates of Listeria mo...

Muhammad Khalid Bhatti, Khalil Ahmed*, Ghulam Shabir, Muhammad Irfan, Muhammad Ashfaq Anjum, Muhammad Sarfraz, Amar Iqbal Saqib, Abdul Wakeel, Hafeezullah Rafa, Nadeem Iqbal, Muhammad Qaisar Nawaz, Ghulam Qadir, Muhammad Rizwan and Muhammad Faisal Nawaz

...rsity exists within rice species for salinity tolerance. Therefore, a study was executed to identify salinity tolerance of seventeen advance rice lines based on of agronomic characters and Na and K contents. Advance lines of rice namely, SRI-22, SRI-23, SRI-24, SRI-25, SRI-26, SRI-27, SRI-28, SRI-29, SRI-30, SRI-31, SRI-32, SRI-33, SRI-34, SRI-35, SRI-36, SRI-37, and SRI-38 were transplanted in cemented block at electrical conductivity of soil extract (ECe) 6 ...

Arif Mehmood1*, Muhammad Naeem2, Abu Bakar Muhammad Raza1, Muhammad Asam Riaz1, Muhammad Zeeshan Majeed1, Nadra Khan3 and Waqas Raza4

Shahrokh Mojarradgandoukmolla* and Hasan Akan
...i> are three widely used species and folk medicine that grow well in the northern suburbs of Iraq. Therefore, the present study was designed to evaluate and identify the effective compounds of these species and to investigate their physiological and biochemical effects on biochemical, and hematological parameters in rats treated with ethanol. Phytochemical analysis of seeds and leaves of these taxa was performed by GC-MASs a...
Ahmad Zaman, Azhar Rafique*, Farhat Jabeen and Tayyaba Sultana
...grounds). We recorded 87 species of bird of 70 genera belonging to 39 families representing 16 orders. According to Bull and McCackle method, 3 species were very abundant i.e. house crow, common myna, house sparrow, 6 species i.e. green bee-eater, pied bushchat, cattle egret, black drongo, red wattled lapwing, red vented bulbul were abundant, 7 species i...

Cristina Stanca Moise1*, Cornelia Chimisliu2, Mihaela Arinton3, Tom Brereton4 and George Moise1

...s, 225 locations for the species were identified in 37 counties (each containing Natura 2000 sites) along with Bucharest City. Based on these data we have drawn a map of the distribution of this species in Romania’s nine regions, also considering the collecting period. Considering the gaps in studying the distribution of this protected species in Romania, our paper forms a new baseli...

Abdurakhim E. Kuchboev1*, Mehmonjon Kh. Egamberdiyev2 

...ts. In this study, eight species of land mollusсs from Uzbekistan were found to be positive larvae of protostrongylids. Based on the nucleotide sequence data, three species of nematode larvae Protostrongylus rufescens, Muellerius capillaris, and Cystocaulus ocreatus were identified. According to the morphological characteristics of the studied land mollusсs, the shell structure was identified as six different morphotypes. ...

Ilhama G. Kerimova1*, Viktor A.Krivokhatsky2, Merve N. Aydemir3 and Lala N. Mamedova4

...ces were obtained for 25 species of Neuroptera. It is difficult to recognize the immature antlions of Palpares libelluloides (Linnaeus, 1764) and P. turcicus with similar brown rings on the last abdominal segments. The specimen that could not be determined was marked as “Palpares sp. questionable”. The genetic method has finally solved this question; now Palpares sp. questionable (IGK15) is surely assigned to P. turcicus. Myrmecaelurus solaris (Kri...

Ghulam Akbar1*, Muhammad Anjum Zia1, Amer Jamil1 and Faiz Ahmad Joyia2

...d from various bacterial species especially beta hemolytic Streptococci. Among these beta hemolytic strains the Streptococcus equisimilis is being used for industrial streptokinase production. It has 414 amino acids globular chain with 47000 D molecular weight. The fibrinolytic drug is comparatively cheap as compared to all other fibrinolytic drugs. It is the drug of choice in all low income nations and developing countries. The mortality rate with cardiovascu...
Wasim Akram1, Azhar Hussain2*, Sartaj Ali2, Iqbal Hussain3 and Muhammad2
...poral variability of two species of fruit fly, Bactrocera zonata and Bactrocera dorsalis, in apricot fruit orchards. Results revealed that there was a significant difference between the species and month to month. B. zonata had a substantially larger population than B. dorsalis. To predict the spatial variability of fruit fly species, geostatistical analytic techniques were used. Using an ...

Quang Minh Dinh1*, Tran Thi Huyen Lam2,3, Y Thi Nha Nguyen4, Thanh Minh Nguyen1 and Tien Thi Kieu Nguyen5

...and research on invasive species. Butis koilomatodon is one of the potential candidates for aquaculture in the Mekong Delta because it can survive in a wide range of water temperature (26–36 °C) and salinity (3.8-37.25%), but data on this fish species’ food and feeding habit are still fragmented and deficient. Consequently, this research aims at supplying necessary data related to diet compositions and feedin...

Jin-Ming Zhao1,2, Yun Fang2 and Yue-Hua Sun2*

...ational protected animal species in China. Lower breeding performance has been suggested as a main factor influencing the population viability of Chinese grouse. Nest predation, which might be time-varied, is a main contributor to the nest failures of Chinese grouse. Therefore, it is urgent to estimate nest age of Chinese grouse accurately before taking appropriate conservation actions. In this study, we estimated the nest age of Chinese grouse using the weigh...

Nam Thanh Nguyen1,2,3, Linh Manh Ha4, Anh Thi Nguyen5, Nam Hoang Chu5, Hau Duc Tran5, Hung Phuc Nguyen5 and Thuy Thi Ta6*

...owth conditions for this species based on a year-round (2018‒2019) wild specimen collection in northern Vietnam. Four morphometric characteristics (standard length, pre-dorsal-fin length, body depth, body width) showed higher growth rates in males than in females, suggesting a morphometric sexual dimorphism. The growth pattern of males and females were similarly higher than the isometric value of three, showing positive allometric growth in favorable environ...

Mustafa Erkan Özgür1*, Selim Erdogan2, Songül Aydemir3 and Hatice Yumusakbas2

...(p<0.05) between both species. Especially, the levels of eicosapentaenoic (EPA) and docosahexaenoic (DHA) determined no significant different (p>0.05). Additionally, we found negative correlation between the straight line velocity (VSL) and pentadecanoic acid (r = -0.78, p<0.05), stearic acid (r = -0.76, p<0.05) and nervonic acid (r = -0.89, p<0.01) for rainbow trout, while there was negative correlation (r = -0.96, p<0.05) between angular pa...

Carla Meneguin Barbosa1*, Fabio Gregori2, Cairo Monteiro1, Thais Helena Martins Gamon1, Luciano Matsumiya Thomazelli1, Tânia de Freitas Raso2 and Edison Luiz Durigon1

...zilian native psittacine species, divided in two outbreaks, one year apart between 2016 and 2017, in a breeding farm in São Paulo State, Brazil. PSHv-1 was detected in 6 species (61 birds) through Nested-PCR, that tested negative for Influenza, Paramyxovirus, Flavivirus, and Adenovirus. Genetic sequencing and phylogenetic analysis support these results.

...

Barbosa Carla1*, Gregori Fabio2, Thomazelli Luciano1, Oliveira Amanda1, Araújo Jansen1, Ometto Tatiana1, Marcatti Roberta3, Nardi Marcelo3, Paludo Danielle4, Utecht Nathalia1 and Edison Durigon1

...glomeration of different species. One pathogen of greatest importance that may be dispersed by birds are the coronaviruses (CoVs). Despite its relevance and complexity, studies on the detection and genetic characterization of these viruses are scarce, especially in South American wild birds. Thus, this paper aims to detect and discuss the diversity of these agents in birds at migratory stopping and wintering sites, along Brazilian Segment of the Atlantic Flywa...

S. Samina and Y.I. Erum†

...s revealed a total of 26 species of plant parasitic nematodes belong to 17 genera, 13 families, 15 subfamilies and 3 orders while free-living soil nematodes revealed a total of 21 genera, 17 families and 8 orders. Overall percentage of plant parasitic and free-living nematodes was 40% and 60%, respectively. Irantylenchus clavidorus Kheiri, 1972 was encountered with highest occurrence (40%) followed by Aphelenchus avenae Bastian, 1865 (27.5%) and Ditylenchus my...

H. M. Hassan† and S. A. Ibrahim

...and Magic smart with two species of entomopathogenic nematodes, Steinernema carpocapsae and Heterorhabditis bacteriophora were tested against cotton leaf worm Spodoptera littoralis. All tested insecticides caused less mortality to the tested entomopathogenic nematodes. Magic smart significantly surpassed other insecticides causing the mortality of 11.6 and 13.8 % to the entomopathogenic nematodes S. carpocapsae and H. bacteriophora, respectively as compared to...

A. Beyan1, A. Seid†2 and H. Shifa1

...pot areas of Meloidogyne species and Fusarium species infested farmer’s field conditions.

...

A. Ghasemzadeh1, S. Jamali1†, M. Esfahani2 and H. Pedramfar1

...on of root-knot nematode species and race were determined, and after amplification of purified population on the tomato cultivar cv. Rutgers, inoculums were sufficiently obtained. In four-leaf stage of the plant growth, the nematode inoculum levels were introduced, and photosynthetic parameters were evaluated at different times. The results showed that by increasing levels of nematode inoculum, chlorophyll fluorescence parameters were highly affected. In gener...

R. Hadadfar1, E. Mahdikhani-Moghadam2†, S. Baghaee2 and M. S. Bajestani1

...">To identify Psilenchus species in pistachio gardens of Khorasan Razavi Province of Iran, 50 soil and plant samples from pistachio roots rhizosphere (Depth 30-50 cm) were collected during years 2016-2017. Samples were transferred on ice to laboratory and nematodes were extracted by centrifugal methods. Psilenchus species were identified on morphological and morphometrical characters based on recent valid keys. Seven

S. Miheret1, A. Seid2† and N. Hailu3

...(80%) of the Meloidogyne species from root samples were recorded from three farms of district Kewet and three farms of district Efratana Gidim. Meloidogyne incognita and M. javanica were found infecting 70% of the surveyed tomato farms in mixture. Meloidogyne incognita was more prevalent than M. javanica from the surveyed tomato farms across the six localities. In a glasshouse experiment the intercropping of tomato with the antagonistic marigold followed by to...

I. K. A. Ibrahim1, Z. A. Handoo 2†, A. M. Zid1 and M. R. Kantor2

...) to the tested nematode species. On the other hand, six flax cultivars were tested, among them Giza 1 and Giza 5 were susceptible (S) to all the tested nematode species; Giza 6 was susceptible to Ma and Mj, while Sakha 1 was susceptible to Ma only. Giza 6 was highly susceptible (HS) to Mj only whereas Sakha 1 was highly susceptible to Mi and Mj. The flax cultuvars Giza 7 and Giza 8 were susceptible to Ma and Mi while these ...

F. Shahina†, K. Nasira, K. Firoza and Y. I. Erum

...ntomopathogenic nematode species described and reported during last sixty nine years (1952-2019) from Pakistan. The information compiled in this paper came gradually from many and diverse sources. It is the product of the efforts of several authors who contributed to gather knowledge on the biological diversity through systematics and faunistic studies. Information published in different scientific journals, newsletters, reports, book chapters, books booklets ...

M. Israr1†, M. Habib1 and K. Nasira2

... the nematode genera and species were identified (Siddiqi, 2000). Tylenchorhynchus usmanensis is reported from the first time from Pakistan is briefly redescribed and illustrated.

...

Dzulhelmi Muhammad Nasir1,*, Suriyanti Su2, Van Lun Low3, Zulqarnain Mohamed1 and Norma-Rashid Yusoff1

...ionally used to identify species variants. However, in this study, a molecular approach was utilized to produce a more precise and accurate result in an effort to identify, delineate and verify the species. Mitochondria-encoded cytochrome oxidase I (COI) and nuclear-encoded 18S rRNA (18S) genes) were adopted to establish DNA bacodes for 17 species of tetragnathid spiders (Araneae, Tetragna...

Shafia Riaz1, Khalid Abbas1*, Tanveer Ahmed1,2*, Huma Naz3, Hina Amjad1 and Shahbaz Ahmad1

...formed by employing five species specific polymorphic microsatellite markers. Overall, the results of growth trial confirmed that FQB genotype performed maximum while QBD evinced lowest performance among all the genotypes based on wet weight (g) and total length (mm). Genetic analysis revealed significant differences based on allelic frequencies, heterozygosity, inbreeding and genetic distance among hatchery genotypes. Impact of G×E interaction is illust...

M. Israr1, F. Shahina2† and K. Nasira2

...t-align: justify;">A new species of the genus Aphelenchoides is described from soil around the roots of turnip (Brassica rapa L.) plants collected from Mianwali, Punjab, Pakistan. Aphelenchoides turnipi n. sp. belongs to the Group 2 of Aphelenchoides species sensu Shahina with one or sometimes two mucronate structures in female tail terminus and is characterized by small body size (0.29-0.38 mm); two lateral incisures in the...

E. Mahdikhani-Moghadam†, J. A. A. Bub, S. B. Chery and S. Alvani

... the identification of 5 species of mononchid
nematodes viz., Anatonchus kashmirensis, A. tridentatus, Clarkus papillatus, Mylonchulus brachyuris and M.
paitensis. Among them, A. kashmirensis is recorded for the first time in Iran.
...

S. Aatika, K. Nasira and F. Shahina†

...nematodes, the following species of nematodes were encountered from maize and
its adjoining crops from Punjab, Pakistan. New species Filenchus maqbooli n. sp., characterized by small body with
short stylet and tail long, filiform has been described. Five new record species of plant parasitic nematodes viz.,
Helicotylenchus ce...

S. A. Montasser1†, N. A. Mahmoud2, A. F. El-Mesalamy2 and M. A. A. Abdel-Mageed2

...The nematode
species succeeded in developing and multiplying on almost all the tested crops. According to rating scale
based on nematode reproduction, Lencoln and Victory cultivars of pea were considered as highly susceptible
hosts with (Rf) values 36.5 and 25.68 folds, respectively. While Maser-1 cultivar of broad bean and Bronco,
Exira, Giza-6, Polista and Savana cultivars of common bean were classified as mode...

J. Salma, K. Nasira, M. Saima and F. Shahina†

...d estuaries as a diverse species, universally rich and
often showing sensitive responses to ecological changes. During present study, surveys were conducted at four
locations of Sindh coast viz., Kaemari, Korangi Creek, Ibrahim Haidry, Mubarak Village and two of Balochistan
coast viz., Gadani and Sonmiani beach. As a result, four new species Oncholaimus paraoxyuris n. sp.,
Meto...

I. K.A. Ibrahim1, Z.A. Handoo2† and A. B. A. Basyony1

...ce of nine cyst nematode species associated with different crop plants: Heterodera avenae on wheat, H.
daverti and H. trifolii on Egyptian clover, H. leuceilyma on Bermuda grass, H. lespedezae on lentil, H. goldeni on
qasabagrass, H. schachtii on cabbage and sugar beet, H. zeae on corn and wheat and Globodera rostochiensis on
potato. The cyst nematodes H. leuceilyma and G. rostochiensis are new records of the country and H. ...

K. A. Tabassum,† J. Salma and H. Sagir

...positive for Steinernema species. One sample of Prunus avium had
Steinernema affine from Hunza, two samples had S. cholashanense from Juglans nigra and Malus pumila from
Gilgit, and three samples harboured S. feltiae from Prunus armeniaca, Prunus persica and Malus pumila from
Nager. This paper deals with re-description of S. affine based on comparative study of morphological and
molec...
M. Bajestani1†, E. Moghadam2 and K. Dolatabadi3
...ic nematodes
species were identified on morphological and morphometrical characters viz., Boleodorus thylactus, Filenchus
cylindricaudus, Geocenamus tenuidens, Irantylenchus clavidorus, Merlinius brevidens, M. communicus, M.
pistaciei, Neopsilenchus magnidens, Pratylenchus neglectus and Zygotylenchus guevarai. Among these species M.
communicus and M...
Istkhar† and A. K. Chaubey†
...
Steinernema species evident the less polymorphism and highly conserved nature of this region as compared to ITS1
and ITS2 and delimit the relationship of steinernematid nematodes.
...
K. Nasira, S. Shamim and F. Shahina†
...esence of forty nematode species
including three new species viz., Bathyeurystomina minima Nasira, Shahina & Shamim, 2014, Belbolla
longispiculata Nasira, Shahina & Shamim, 2014 and Metoncholaimus siddiqii Shahina, Nasira & Shamim, 2015
while six species were reported as new records of Pakistan. These nematode species...
E. Yavuzaslanoglu1†, U. Gozel2, C. Gozel2 and M. Aydogdu3
...tomopathogenic nematodes species isolated: Heterorhabditis bacteriophora Poinar, 1976 (Rhabditida:
Heterorhabditidae) (16.92%) and Steinernema feltiae (Filipjev, 1934) (Rhabditida: Steinernematidae) (2.3%).
Entomopathogenic nematodes distributed in low sand content and low-fertilized soils in Karaman province. The
efficacy of H. bacteriophora and S. feltiae on G. mellonella was 100% after 72 h with 50 infective juveniles at ...

I. K. A. Ibrahim1 and Z. A. Handoo2

... the identified nematode species in Egypt.
...

A. Sattar1, †, A. Khan2, N. Khatoon1 and A. Mujahid3

...s in catfish
species belonging to family Ariidae (Blecker, 1862). Four species of catfishes namely Arius arius (Hamilton, 1822),
Arius caelatus (Valenciennes, 1840), Arius dussumieri (Valenciennes, 1840) and Arius sona (Hamilton, 1822) off
the Karachi coast were screened for the occurrence of helminth parasites. Fish were examined after washing
contents of gastrointestinal trac...

K. Nasira† and S. Shamim

... of fresh water nematode species of
studied sites ranged between 0.7-10.4 % while absolute frequency and relative frequency ranged between 15-98%
and 0.86-8.8%, respectively. Analysis of overall occurrence percentage of feeding groups revealed that predators
dominated the entire nematode community (35%) followed by bacterivores (32.5%), herbivores (20%), algal feeders
and fungivores shared the same occurrence per...

M. S. Yasir†, A. K. Sajid, N. Javed and M. Ghani

... identification of major species
of root-knot nematodes. During the survey, a total of 160 root samples were collected from different localities and
cultivars of date-palm. The maximum prevalence was recorded from locality Nouroz Kalat (100%) and the
minimum prevalence recorded was (20%) from Totazai and Raskoh. The incidence, as well as severity varied in all
the cultivars. The maxim...

Uzma Ishaque1, Nasira Kazi1, Erum Iqbal1* and Shahnaz Dawar2

...tode of Pakistan two new species and eight new records of the following species were recovered. Mylonchulus musae n. sp., collected from the rhizophoric soil of Musa paradisiaca L. in Karachi Sindh, Discolaimus tabacum n. sp., from the roots of Nicotiana tabacum L. in Manshera, KP, Discolaimus conicus Siddiqi, 2005 from the roots of Saccharum officinarum L. in Mirpurkhas, Sindh, Discolaimus laksi Khan and Laha, 1982 from soi...

F. Shahina† and G. Mehreen

...solates of S. abbasi and species of bicornutum group. While one isolate PAK.S.S.15 (JN599140) was
analyzed using 12S mtDNA with other known species. In all four trees, isolate PAK.S.S.15 form monophyletic
group with S.  abbasi (AY944002). In laboratory experiment, biological life cycle of three isolates of S.  abbasi
PAK.P.S.9 (EF469773), PAK.S.S.15 (JN571086) and PAK.S.S.16 (JN5...

A.A. Tanimola† and B. Fawole1

...rried out for eight Aloe species: Aloe schweinfurthii (ASF), Aloe
succrotina (AST), Aloe vera (AVR), Aloe chinensis (ACS), Aloe arborescens (AAR), Aloe keayi (AKY), Aloe
macrocarpa (AMC) and Aloe schweinfurthii x Aloe vera (ASV) that showed nematicidal activity in in vitro on
Meloidogyne incognita. The phytochemical analyses revealed that the Aloe species had similar phytochemicals:
...
A.A. Tanimola and B. Fawole1
...h concentrations of Aloe species extracts inhibited egg-hatching and second-stage juveniles mortality
was observed significantly when compared with water control. The AE of AKY leaves at 50,000 mg/kg was the
most effective in egg-hatching inhibited (95.4±1.7%), followed by AVR (94 ± 0.8%) and AST (88 ± 1.4%). Water
extracts of leaves of AKY, AVR and AST inhibited egg-hatching by 85.5±1.2%, 77.8 &p...

I. Uzma, K. Nasira, K. Firoza and F. Shahina†

...separate Helicotylenchus species
viz., habitus, body length, ratios a, c, c´, vulva position, DGO from base of stylet knobs, stylet length, shape of stylet
knobs, shape of head, number of head annules, shape of tail, number of tail annules, position of phasmid in relation
to anus, presence of male and female posterior genital branch is presented. These allometric and morphometric
characters were derived fro...

A. Zia†, K. Zia*, S.A. Anwar** and M. Iqbal

...root-knot nematode (RKN) species with tomato crop and to assess their infestation. Hundred and
sixty-one samples from 23 locations scattered over the vegetable growing areas of four tehsils of Faisalabad district
including Faisalabad, Chak Jhumra, Jaranwala and Samundri. The results showed that 87% of the tomato fields
were infested. The incidence of RKN ranged from 0 to 100% with an average of 36%. The galling index (GI) wa...

I. Kepenekci

...l number of 240 nematode species of plant parasitic nematodes belonging to 56 genera of
Tylenchida detected in Turkey. These nematode species found associated with 66 plants from 48 different
localities of the country.
...

F. Shahina†, K.A. Tabassum and M.A. Habib*

...ity percentage. All four species of insects,
viz., Helicoverpa armigera, Earias insulana, E. vitella and Pectinophora gossypiella were found susceptible to
infective juveniles of the four EPN species; S. pakistanense was the most virulent EPN species. There is a dire need
to focus further research on these EPN isolates to explore and exploit their potent...

Z. Gill and K. Firoza†

...ree-living soil nematode species associated
with date palm plantations in district Khairpur, Sindh, Pakistan. Population density and frequency of all nematodes
varied considerably at all surveyed sites. Occurrence of plant parasitic nematodes was found high at Gambat
(33.3%) and low in Kingri (15.38%). In free-living soil nematodes Nara has found high (10%) and low in Kingri
(3.84%). The dendrogram indicted that ...

M.A. Haq†, K. Mahmood*, M. Shahid*, S.A. Khan and A. Tahir**

...most common and abundant species of rootknot
nematode M. incognita (Kofoid & White, 1919) Chitwood, 1949 was identified on the basis of
perineal patterns (Eisenback et al., 1981). These new host records of M. incognita have not been
hitherto reported in Pakistan (Zarina & Maqbool, 1991; Maqbool & Shahina, 2001; Khanzada &
Khan, 2003; Zarina, 2004; Khan et al., 2005; Erum et al., 2005; Shahid et al...

M. Shahi-Bajestani† and E. Mahdikhani-Moghadam

...an provinces resulted 16 species of
nematodes viz., Psilenchus curcumerus, Ditylenchus apus, D. medians, Basiria gracilis, B. graminophila,
Aphelenchus isomerus, A. avenae, Boleodorus thylactus, Zygotylenchus guevarai, Pratylenchus thornei, P.
neglectus, Irantylenchus clavidorus, Neopsilenchus magnidens, Neopsilenchus paragracilis, Nothotylenchus
ferepolitor, Filenchus pratensis. Among these

A. Khan†, Saifullah, M. Iqbal* and S. Hussain

...div>culture of Pleurotus species at four different concentrations and three time intervals were tested against the
nematodes. Nematodes killed by the application of crude extracts of Pleurotus species never recovered to life after
placing in simple water. P. citronopileatus was found more effective than other species and it killed 100%
nematodes after 24...

F. Toumi†*,**, L. Waeyenberge*, R. Yousef***, H. Khalil****, K. Al-Assas*** and M. Moens*,**

...avanica was the dominant species (91%) and M.
incognita found only once (9%). In Tartus province, M. incognita was the most prevalent species particularly in the
southern parts (76%) and M. javanica occurred in several locations (24%) in northern Tartus. The majority of the
sampled tomato cultivars were infected with two Meloidogyne species; once both

A. Khan†, S.S. Shaukat*, N. Khatoon**, J. Akhtar and A.G. Rizwana**

...v>
Pakistan. Seven species of nematodes were found associated with the seedlings/rootstock including Aphelenchus avenae,
Helicotylenchus indicus, Hoplolaimus indicus, Meloidogyne javanica, M. incognita, Xiphinema americanum and X. index.
A matrix of similarity between six vineyard-nurseries was computed using Bray-Curtis index.
...

Aiman Amur1*, Nasreen Memon1, Khalida Unar2 and Roshan Jamali3

...justify;">The Bactrocera species which belong family Tephritidae commonly called as fruit flies, according to inhabitants they live in tropical and subtropical areas of the world. The fruit flies are the pest of several economical important fruits of world. The Bactrocera dorsalis (handle) complex fruit fly according to morphology, physiology and genetically. It is very serious pest of many fruits in the overall world; such as guava, apricots, Sapodillas etc. ...

Belema Robert1, Favour Welenya1, Deborah Achi1, Cynthia Onyeagwara1, Soala Obie Minimah2, Ebele Anulika Obichi2, Chidinma Charity Amuzie1* 

...xamined the geo-helminth species associated with selected edible vegetables from markets and farms in Port Harcourt metropolis, Nigeria. Methodology: Vegetables (fluted pumpkin leaves, waterleaves, bitter leaves and scent leaves) were purchased and harvested from selected markets (Creek Road, Mile 1, Mile 3, Timber, Rumuokoro, and Rumuokuta Markets) and farms (Rivers State University Agricultural Demonstration Farm, a farm at Nkpolu-Oroworukwo and another at R...

Jax Vincent Gamulo, Maye Pearl Bolina, Jessica Serena Brion, Via Crishiela Nicole Dela Rosa, Roxanne Francesca Maglaya, Carl Lexter Tan, Aimee Caye Chang* 

...sitic disease, involving species Fasciola hepatica and Fasciola gigantica. This systematic review with meta-analysis (SR-MA) explored the potential of phytotherapy against fascioliasis and as alternative to commercially available anthelmintic drugs. Eligibility criteria for inclusion and protocol was defined for systematic publication database searching. Final reference database consisted of eight (8) published journal articles with a total of 106 Fasciola flu...

Mohsin Shad1, Muhammad Usman2 and Qurratulann Afza Gardner1*

...or the identification of species. Mutations in the cyt b gene produce abnormal protein leading to deficiencies in the complex III (coenzyme Q), resulting in defective oxidative phosphorylation and consequently effects other metabolic pathways. In the present article, we comprehensively compare the biodiversity of cyt b in bc1 and b6f complexes using in silico structural analysis tools, emphasizing that despite vast knowledge available in this field, still ther...

Mutasim Billah1, Sardar Azhar Mehmood1, Abdul Rauf Bhatti2*, Ahmed Zia2, Shabir Ahmed1, Waqas Ahmad2, Kiran Shahjeer3, and Muhammad Ishaque Mastoi4

...tal of 95 specimens five species (Myllocerus delicatulus, M. undatus, Lixus augustus, Ammocleonus aschabadensis, Rhynchophorous ferrugineus) under four genera (Myllocerus, Lixus, Ammocleonus, Rhynchophorous and 3 subfamilies (Lixinae, Entiminae and Dryophthorinae). For each recorded species details along with valid names, localities, ecological observation and abundance for all collected species

Majid Ali*, Hafiz Abdul Majid, Farman Ullah, Tahir waseem, Muhammad Rashid Khan 

...s studied in relation to species, seasons and different housing system or herds. Random blood samples were received and collected from the surrounding village of arid zone research institute kohat. A total of 726 blood sample were analyzed from both sheep and goat. Out of the total blood sample (62.39%) total prevalence were recorded for all type of hemoprotozoa. In which highest prevalence was recorded for theleriosis 46.13%, followed by anaplasmosis 29.13%, ...

Muhammad Furqan1*, Zulfiqar Ali1, Muhammad Mudassar Shahzad2, Rida Ahmad1, Haqnawaz Yousaf3 and Imad Ul Din Zangi4

...ant is habitat indicator species of ecosystem. The breeding biology of Kalij pheasant was studied in Northeastern Himalayan region, tehsil Nakyal, district Kotli, Azad Jammu and Kashmir, Pakistan from April 2020 to March 2021. Breeding activities of kalij pheasant were recorded from March to July. Breeding calls were recorded in March, April and nesting started in May and June. Incubation started in June, July and mostly hatching occurred in end of June and Ju...
Saleh Aljubran, Shaker Al-Suwaiegh, Yousef Alyousef, Sulaiman Alhajri, Mohammed Alghareeb, Abd El-Nasser Ahmed Mohammed*
...ce banking for mammalian species. Such biotechnologies allow more offspring to be obtained from selected parents to increase milk and meat productivity, reduce the interval between generations, therapy of diseases and conservation of endangered mammalian species. Practically, current reproductive biotechnologies are species-specific because of differences in estrous cycle, seasonality, str...

Seema Perveen Memon*, Nasreen Memon, Mansoor Ali Shah, Reshma Sahito and Aiman Amur

... and remain the dominant species in District Sanghar, Sindh, Pakistan as compared to Plasmodium falciparum. This study is very helpful for the awareness about malaria and its control.

...

Tariq Mahmood1*, Mamoona Wali Muhammad2, Sami Ullah1, Bilal Ahmad3, Zarmina Aslam4, Naveed Ahmad Khan5, Muhammad Shahzaib Tariq6, Muhammad Ali Raza6, Rana Usama Iqbal7 and Samia Zain8

... foraging preference, subspecies variations, monitoring approaches, and the need of preservation and conservation of these essential pollinators. To determine honey bee ecotypes and local species that are more resistant to pests, diseases, and pesticides, as well as to quantify the synergistic impacts of the probable causes of present colony loss, further research is required.

...

Muhammad Shakil Ahmad1, Muhammad Afzal1, Liu Yu Feng2, Muhammad Shahroaz Khan1 and Muhammad Zeeshan Majeed1*

...lign: justify;">Armyworm species Spodoptera litura Fabricius (Lepidoptera: Noctuidae) is one of the destructive polyphagous insect pests worldwide and has attained field-evolved resistance to most of the conventional synthetic insecticides. In this study, some previously selected most effective biorational synthetic, botanical and microbial insecticidal formulations were evaluated either alone or in binary combinations against 3rd instar larvae of S. litura un...

Aiman Amur*, Nasreen Memon, Reshma Sahito and Seema Memon

... fly or other Bactrocera species was recorded in all the three cultivars throughout their fruity mango season; it was considered as life-threatening for management host fruit. 
 
Novelty Statement | This study makes it abundantly evident how the host fruit (mango), which is alarmingly vulnerable to fruit flies due to its seasonality, is the next fruit variety. However, as mango season comes to a cl...

Nachaat Sakr

...hogenic variation of FHB species need to be identified. Although barley and wheat are crucial crops in the dried Mediterranean area, there is insufficient information about their resistance to head blight infection and aggressiveness of Fusarium species. A 3-year (2019 to 2021) experiment was conducted under arid Mediterranean conditions to measure disease reactions, i.e., FHB incidence (DI, Type I resistance), FHB severity ...

Vetlana Aleksandrovna Shemyakova1, Boris Kazievich Laipanov1, Ismail Anatolyevich Bittirov2, Kerim Khasanovich Bolatchiev1, Kamilla Gadzhimuradovna Alieva4, Anatoly Murashevich Bittirov2,3* 

...of from nematodes of the species Bunostomum trigonocephalum and Bunostomum phlebotomum, which indicates of a high level of contamination of biotopes of pasture with eggs. The current sanitary condition of the mountainous territories of Kabardino-Balkaria under the conditions of soil contamination with eggs of the nematodes genus Bunostomum necessitates urgent measures to organize deworming of the sheep stock 4 times a year (quarterly) with benzimidazole deriva...

Hasina Basharat1, Muhammad Ramzan Ali2*, Aziz Ahmed2, Rehana Kausar2 and Shamim Akhter1

...-align: justify;">A fish species (African catfish, Clarias gariepinus) with high growth and production potential was imported from Thailand and acclimatized in the local environment of Pakistan. For the successful culture of any fish species, the knowledge about the proper feeding regime especially the appropriate amount feed offered, is very important. To determine the optimum feeding level for African catfish culture, an e...

Anatoly Murashevich Bittirov1*, Sadrutdin Shamshitovich Kabardiev1, Ayub Yusupovich Aliev1, Boris Kazievich Laipanov2, Svetlana Aleksandrovna Shemyakova2, Ismail Anatolyevich Bittirov1  

...und squirrel, 12 cestode species: Raillietina sp., Rodentolepis straminea, Paranoplocephala transversaria, Rodentotaenia bondarevae, Mathevotaenia symmetrica, Paranoplocephala omphalodes, Skrjabinotaenia lobata, Paranoplocephala dentate, Strobilocercus fasciolaris, Cysticercus longycollis, Alveococcus multilocularis and Echinococcus granulosus larvae, which were recorded with different occurrence values, indexes. Of these, 2 species

Muhammad Afzal1,3*, Shafqat Saeed1, Hasan Riaz1, Muhammad Ishtiaq1, M. Habib ur Rahman2

...y Bemisia tabaci cryptic species comprised of genetic variants which could be differentiated by mitochondrial cytochrome oxidase I (mtCOI-3ʹ) gene. Most numerous cryptic species is Asia II-1recorded all over in Pakistan whereas North Africa-Middle East (NAFME) previously known to be found in the Sindh province but now also reported in the Punjab province. This study revealed that overall diversity of whitefly cryptic

J. Salma and F. Shahina

...5, 255);">Eight nematode species of the genera Steinernema and 

S. A. Khanzada, M. Naeemullah, A. Munir†, S. Iftikhar and S. Masood

...55, 255);">Thirteen mint species were evaluated for the presence of nematode fauna associated with their rhizospheres. Six plant parasitic and six saprophytic nematode genera were found associated with mint rhizosphere. Tylenchorhynchus

M. A. Haq, M. Shahid and K. Mahmood

...most common and abundant species of root-knot nematode M. incognita (Kofoid & White, 1919) Chitwood, 1949 was identified from the host. The perineal pattern of&nb...

W. Khan, N. U. Nisa, A. Khan and S. M. H. M. Naqvi

...infected with any single species of parasite, 81 cases were found infected with double species of parasites, 21 individuals were having triple and 4 individuals were found to be infected with four species of parasites. Nematodes were the most prevalent intestinal parasites than cestodes and protozoans. The prevalence rate was: 

Tae-Kyung Eom1, Jae-Kang Lee1, Dong-Ho Lee1, Ho-Kyoung Bae1, Hyeongyu Ko1, Kyu-Jung Kim1, Sung-Cheol Jung2, Jong-Hwan Lim2 and Shin-Jae Rhim1*

...ily activity patterns of species can contribute to gaining an understanding of community ecology. During the warm seasons of the years 2019 to 2021, we used camera traps to monitor the activity patterns of water deer Hydropotes inermis, roe deer Capreolus pygargus, and Amur goral Naemorhedus caudatus in the Seoraksan and Jirisan National Parks, South Korea. We compared activity patterns among pairs of sympatric species in ea...

Hidayat Ullah1, Sadia Tabassum1, Sultan Ayaz2, Shumaila Noreen1, Atta Ur Rehman1, Naveed Akhtar3, Muhsin Ali3, Zaib Ullah3* and Sajid Mahmood1,4

...nd identified into seven species on morphometrics basis, in which four species were recorded new to this area. Out of identified seven species, four tick species Rhipicephalus microplus, Hyalomma rufipes, Rhipicephalus haemaphysaloides, Haemaphysalis bispinosa were identified from goats and three species Hyalomma margi...

Mohamed S. Abbas1*, Adel E.M. Mahmoud2, Hemat S. Mohamed3, Adam Cieślak4 and Małgorzata Szumacher-Strabel4

Asmaa A. Darwish*, Mona A. Mahmoud, Adel M. El-Kattan 

...pectively. Both infected species showed a significant (P<0.05) macrocytic hypochromic anemia, hyperglobulinemia, hypoalbuminemia, decreased A/G ratio, increased hepatic function tests, hypertriglyceridemia, increased matrix metalloproteinases activity, T/HDL/LDL-hypocholesterolemia, and decreased minerals, electrolytes, and trace elements concentrations and these changes were more prominent in goat than in sheep. While, the diseased ewes suffered from highe...

Bilgenur Yasa1* and Ali Uzun2

...orts the presence of 119 species from 45 families belonging to 19 orders in the Kocaçay Delta, Turkey, within the borders of the Karacabey District of Bursa Province, in a study conducted over the course of one year (2017). The distribution of species in terms of orders is as follows: Falconiformes, 1 (0.8%); Phoenicopteriformes, 1 (0.8%); Bucerotiformes, 1 (0.8%); Galliformes, 1 (0.8%); Cuculiformes, 1 (0.8%); Caprim...

Hasnain Raza1,2, Qun Liu1*, Muhammad Tariq Hanif2 and Yanan Han1

...tan. The five major fish species of commercial importance exploited by heterogeneous fishing fleets in the Exclusive Economic Zones (EEZs) of Pakistan have been undertaken as a case study for the stock evaluation. Altogether, both the models estimated largely similar results. The stock status results indicate that Euthynnus affinis and Rachycentron canadum were healthy, while Scomberomorus commerson and Parastromateus niger were overfished and Lutjanus argenti...

Saleem Hussain1, Muhammad Tayyab1, Tauqir Anwar1, Talha Nazir2*, Muhammad Zeeshan Majeed3, Zohaib Asad2,4, Muhammad Adnan3 and Tajwar Alam5

...ial of seven local plant species (i.e. parthenium Parthenium hysterophorus L., eucalyptus Eucalyptus camaldulensis Dehnh., milkweed Calotropis gigantean (L.) Dryand., bakain Melia azedarach L., neem Azadirachta indica A. Juss., tobacco Nicotiana tabacum L. and thorn apple Datura stramonium L.) against wheat aphid (Schizaphis graminum Rondani) under laboratory and field conditions. Using foliar spray method, toxicity bioassay was conducted with three different ...

Nasratullah Baloch1*, Naeem Tariq Narejo2, Hamida Narejo3, Muhammad Farooq Hassan4, Muhammad Hanif Chandio5, Faheem Saddar6, Dharti Shahnawaz Thebo7, Ghulam Abbas8 and Shahnaz Rashid8

...aring of commercial fish species in it.

...

MARIUM ASLAM, MUHAMMAD JAVED, FAIZA AMBREEN* & FARIHA LATIF

... against reactive oxygen species (ROS) and other free radicals. When the rate of ROS exceeds the capacity of antioxidant enzymes, non-detoxified radicals begin to attack the bio-molecules. Therefore, present research work was planned to study the effect of zinc on the peroxidase activity in the liver and kidney of Catla catla. To check the concentration based effect, C. catla were exposed, separately, to 96-hr LC50 of zinc and its sub-lethal concentrations viz...

MUHAMMAD EJAZ*1, MUHAMMAD JAMIL YOUSAF5, ASMA MAQBOOL3, ALTAF HUSSAIN4 & ABDUL QAYYUM KHAN SULEHRIA2

...ound to the the dominant species with the highest mean population density (40±11.9 ind/ml) while Philodina roseola was a least dominant with lowest population density (3±1.2 ind/ml). ANOVA displayed a significant difference in population density of rotifers among months. Rotifers exhibited positive correlations with temperature, total hardness pH, TDS, electrical conductivity and turbidity however, DO and transparency indicated negative correlati...

MUHAMMAD ASHFAQ*1, QURAT-UL-AIN ASGHAR1, RAHILA HAFEEZ1, AMNA ALI1, MUHAMMAD SALEEM HAIDER1, MUHAMMAD ALI1, MUHAMMAD BILAL CHATTHA1 ABDUL RASHEED1 & MUHAMMAD SAJJAD2

...ngal and three bacterial species namely Fusarium sp., Alternaria alternata, Pyricularia sp., Dreschslera sp., Penicillium sp., Curvularia sp., Acetobacterium, Deniobacter and Micrococcus were isolated from different rice varieties.
 
Key Words: Rice, seed-borne micro-flora, blotter paper, diversity
...
SYED ZULFIQAR ALI ABIDI, HAFIZ ABDULLAH SHAKIR, SYED SHAHID ALI, & JAVED IQBAL QAZI*
...ing rid of unwanted fish species.
 
Key Words: Alcoholic extract, Aqueous extract, Phytochemicals, Metabolites, Plants
...
 
 SADAF SARFRAZ1*, SAFDAR AMEER1, REENA AMBREEN1, SHOMAILA SIKANDAR 2, SHAISTA NAWAZ3 AND YASIR SALEEM
...icroorganisms in various species of cinnamon. 
 
...
 
 ANSA KHALID, UZMA HAMEED* AND IKRAM-UL-HAQ 
...th of Leuconostoc species. The obtained isolates were screened by using the shake flask method. The isolate IIB-C9 was selected for the parametric optimization as it gave the maximum activity. Among the 10 different fermentation media screened for enzyme production, maximum dextransucrase activity (9.96 U/ml) was obtained by bacterial strain IIB-C9 in fermentation medium M6 comprising (yeast extract 15 g/L, sucrose 40 g/L, and Na
 
 ANSA KHALID, UZMA HAMEED* AND IKRAM-UL-HAQ 
...th of Leuconostoc species. The obtained isolates were screened by using the shake flask method. The isolate IIB-C9 was selected for the parametric optimization as it gave the maximum activity. Among the 10 different fermentation media screened for enzyme production, maximum dextransucrase activity (9.96 U/ml) was obtained by bacterial strain IIB-C9 in fermentation medium M6 comprising (yeast extract 15 g/L, sucrose 40 g/L, and Na

Muhammad Ramzan1*, Unsar Naeem-Ullah2, Shafia Saba2, Madiha Mobeen Khan3, Umair Faheem4, Asad-ur-Rehman3, Naeem Arshad Maan3 and Waseem Hassan5

..., it was found that this species had not been reported so far from Pakistan. Therefore, the detail description is being presented here for futuristic references.

...
Jian-Cheng Zhai1,2, Sheng-Nan Wang1,3, Qiang-Hui Wang1, Yan-Ling Xia1, Wei-Shi Liu1, Ya-Jie Yin4 and He-Ping Li1*
...eindeer is the only deer species in both sexes grow antlers. Many apparent differences exist in antlers of female and male reindeer and sika deer. Insulin like growth factor 1 (IGF1), Keratinocyte growth factor (KGF) and Nerve Growth Factor (NGF) are essential for antler growth. To investigate whether epigenetic regulation of the growth factors is important in growth of sika deer, female and male reindeer antlers, methylation status were evaluated using bisulf...

Amber Khalid1*, Amjad Rashid Kayani1, Muhammad Sajid Nadeem1, Muhammad Mushtaq1, Mirza Azhar Beg1 and Surrya Khanam2

...etter management of pest species. Previous studies conducted on the diet of Indian gerbil were only based on field observations. This study provides information on the diet analysis of Indian gerbil through stomach contents. Samples were collected from different localities of Pothwar during different seasons. Stomachs were separated during autopsy. Slides from stomach contents were prepared and were compared with reference slides. Relative frequency of every f...
Ayesha Ahsan1, Rabia Arif2*, Samina Nazir1, Muhammad Saleem2 and Memunna G. Shahid1
...ycosylation in different species of Sordaria as well as N. crassa was calculated on Serine (S), Tyrosine (Y) and Threonine (T) residues by NetPhos and YinOYang.

...

Irene S. Gamil1* and Dalia Fouad1,2

...parable from Ophiotaenia species found in African snakes as well as those from colubrid snakes based on many morphological characteristics. Analysis of a dataset based on 473 bp of its 18S rRNA gene regions was carried out to determine the phylogenetic position of the new species among other proteocephalideans. Ophiotaenia tessellata sp. n. shows a close relationship to O. lapata Rambeloson, Ranaivoson and de Chambrier, 2012...

Usman Ali1,2*, Basharat Ahmad1, Riaz Aziz Minhas1, Muhammad Kabir3, Muhammad Siddique Awan1, Liaqat Ali Khan1 and Muhammad Bashir Khan1

...on issues for threatened species. This study aimed to identify the current range and suitable habitat of black bear in Azad Jammu and Kashmir (AJ&K) using the maximum entropy model. Field surveys were conducted between 2015 and 2020 to collect data using direct and indirect evidence. Maximum entropy (Maxent) models revealed an average AUC of 0.84 (+0.03) designating a high accuracy. Main predictors of HSM of black bear were elevation (34%), temperature (23...

Siti Fairus Mohamed Yusoff1, Annie Christianus1*, Yuzine Esa1, Muhammad Fadhil Syukri Ismail1, Bashiru Garba2, Nik Siti Zaimah Safiin3, Nur Hamid Hidayahanum4

...on to its parents’ species in terms of proximate compositions, fatty acid, and amino acid profiles. The results revealed that the biochemical composition of hybrid PH×PN was comparable with either one of its parents’ species. The crude lipid and total saturated fatty acids (SFAs) were significantly higher in hybrid PH×PN and P. hypophthalmus. Also, crude protein and docosahexaenoic acid (22:6n-3, DHA)...
Lubna Anjum Minhas, Abdul Samad Mumtaz*, Muhammad Kaleem, Rooma Waqar and Jamila Annum 
... fresh water green algae species from ecologically diverse habitats of Tehsil Gujar Khan, District Rawalpindi. A microscopic image data was used to identify algal species. A total of 30 species were recorded that belonged to 4 orders, 11 families, and 14 genera. Clamydomonas reinardtii, Acutodesmus obliquus and Cosmarium isthmocondrum are new record from Pakistan. Among identified taxa, Sc...

Om-Hashem M. El Banaa l, A.A. Abou Zeid2, Fawzia I. Moursy3 and Azza, G. Farag

...Saglio et al is the type species of the genus spiroplasma. Spiralin gene is the gene responsible for spiralin which is the major protein of Spiroplasma citri (S. citri Saglio et al), the causal organism of citrus stubborn disease. RecA gene protein is the enzyme primarily responsible for the homologous recombination of chromosomal DNA in bacteria. The Immunocapture- Polymerase Chain Reaction (IC-PCR) technique was applied for detection of S. citri Saglio et al...

Sahar. A. Shoman1 and B. A. Othman2

...ises the availability of species-specific primers for the TMV-E that will be helpful for diagnosis in mixed infection. In addition, it will be helpful in further molecular characterization of this strain.

...

Shabana Mangi1*, Abdul Manan Shaikh1, Waheed Ali Panhwar1, Javeed Ali Ujjan1, Fakhra Somroo1, Shazia Praveen Solangi2, Sumbul Mureed Mastoi3 and Ranjeet Kumar1

...are recognized up to the species level through the support of keys available for the region in different publications. Photographs of the adult and genitalia were taken with cameras fitted on the microscope. This revealed the occurrence of 46 specimens and identified 05 species under the subfamily Asopinae. Z. caeruleas (Linnaeus 1758) predatory stink bug is premalinary described from the district Khairpur Sindh province of ...

Muhammad Akram¹,²*, Rashid Mahmood³, Fahim Arshad4 and Umer Farooq Gohar5

...ultiple endangered plant species.

...

Chun Shi, Juanjuan Guo, Meng Li, Qi Yang and Jingang Li*

... reduced abundance of 16 species of bacteria, including Acinetobacter, Aquabacterium, Acidovorax, Thermus, and Klebsiella (P<0.05) in the awakening period. This study provides guidance and reference for the exploration of animal hibernation mechanisms and research on intestinal ischemic re-enema injury.

...

Seharish Munawar and Nuzhat Afsar*

...several marine gastropod species world around. The Phenomenon of imposex is directly connected with toxicity of tributyl (TBT) contamination and the source of this contamination is shipping traffic due to the use of TBT-based paints on ship hulls and the leaching of content into the water column. So, during the present study specimens of Tibia curta (Sowerby II, 1842), collected and investigated for the planned study from Gadani ship breaking yards (25.0361&de...

Muhammad Asim Bhutta1,2*, Amna Bibi2, Nadia Hussain Ahmad2, Sadia Kanwal2, Zarmeena Amjad1, Hafeez ur Rehman3, Umar Farooq3, Muhammad Nouman Khalid4 and Syeda Fiza Nayab5

...dance of reactive oxygen species (ROS). Reactive oxygen species such as H2O2 and O2, that develops in photosystem II as a result of exposure to intense light, start to damage electron transfer system components and protein structure. Plants have adapted several protective mechanisms like production of antioxidants, enzymes and carotenoids to face reactive oxygen species and avoid photoinhi...

Muhammad Saad Waqas, Li Xia, Tian-Ci Yi*, Liang-Yu Sun, Rong Xiao and Dao-Chao Jin*

...hailand. Like many other species of the genus Stigmaeopsis, S. inthanonsis has characteristics of nest weaving behavior on the host plant surface. Waste management behaviour of many Stigmaeopsis species are well described by many scientists but waste management behaviour of S. inthanonsis is still unknown. Here, we studied nest relocation and waste management behaviour of S. inthanonsis. Results showed that fecal piles, dead...

Natalia Shchur1,2*, Olha Chechet1, Tetiana Mazur2, Oleksandr Martyniuk2, Olga Gorbatiuk1, Halyna Buchkovska1, Iryna Musiets1, Diana Ordynska1, Olena Finkova3, Larisa Moskalenko3, Tetiana Ponomaryova-Gerasimyuk3, Maksym Lusta3, Vitalii Nedosekov2 

...e intestinal infections, species of Campylobacter spp.  which are the main food pathogens. In Ukraine, the distribution of emergency campylobacter has not been researched. This article describes conditions for active monitoring of Campylobacter spp. antimicrobial resistance, selection and research of 2,120 samples of cecal contents from cattle, pigs, and poultry. The samples were analyzed by a microbiological method for the detection of Campylobacter acco...

Muhammad Awais Ahmad1, Mudssar Ali1*, Asif Sajjad2 and Shafqat Saeed1

...ptera and 02 Lepidoptera species. It was found that the total abundance of a solitary bee Pesudapis oxybeloides was higher followed by a honey bee, Apis mellifera and a syrphid fly, Eristalinus aeneus. Moreover, solitary bee P. oxybeloides was detected as the most efficient pollinator based on rate of visitation and pollinator efficiency in a single visit, followed by A. mellifera and A. dorsata. The seed set in open pollination (free insect visits) was 58 and...

Munawar Lal1*, Naeem Tariq Narejo2, Muhammad Hanif Chandio1, Faheem Saddar3, Hameeda Narejo4, Ghulam Dastagir5, Ghulam Abbas6 and Shahnaz Rashid6

...eight of five dominating species were taken at Nurri Lake in Badin, Sindh, Pakistan from July 2018 to June 2019. A total of 1101 specimens were examined. There were 255 Liza subviridis, with lengths and weights varying from 4.3 to 16.8 cm and 2.6 to 45.68g, respectively. Mugilcephalus was 205 and ranged in size from 7.4 to 27.46 cm and 8.7 to 213.29g. Aulopaereaocellata was 246 and varied in size from 5.5 to 319.2 g and 4.7 to 27.0 cm in length. Acanthopagrus ...

Ahamed Mohamed Korayem, Moawad Mohamed Mohamed* and Mohamed and Mostafa Mohamed Attia Hamman

...on of root-knot nematode species infecting soybean grown in six Egyptian governorates; Beni-Suef and Menia representing middle Egypt and Alexandria, El-Beheira, Kafr-Elsheikh and Dakahlia representing northern Egypt, was conducted during the growing season 2020. A total of 100 root samples were collected and processed for identification of root-knot nematode species. Data revealed the presence of three root-knot nematode

Md. Rashedul Islam1, Abul Farah Md. Hasanuzzaman1*, Md. Latiful Islam2, Ghausiatur Reza Banu1 

...nolyticus were the major species identified from the Vibrio genus. The average concentrations of Vibrio spp. in brood, brood’s tank water, eggs, larvae, larval tank water, and larval feed were log10 3.86±0.61 cfu g-1, log10 3.63±0.57 cfu mL-1, log10 2.73±0.13 cfu g-1, log10 2.86±0.21 cfu g-1, log10 2.93±0.25 cfu mL-1 and log10 3.23±0.37 cfu mL-1 respectively. The highest concentration of Aeromonas spp. (log10 3.6...

Rogia SA Gomez*, Said H Mbaga 

...75.76%) and other animal species such as cattle, goats, and rabbits (41.7%). The average mortality rate recorded in these farms was 11.7%. Biosecurity Index Score ranged from 44-66% (mean 53.83 ±4.23). There was low adoption of biosecurity between the farm’s boundary and the poultry houses. The study concludes that in the Pwani region biosecurity was moderately applied, which shows that farmers in this region are aware of the need to exercise bios...

Javeria Khourshid*, Ghulam Abbas, Shahnaz Rashid, Asma Fatima* and Abdul Malik

...mercially important fish species (Orechromis niloticus and Acanthopagrus berda) were used for this study and kept in two different treatment tanks with their replicates (n=10 each) designated as T1= OxyAqua and T2= simple aeration. Juveniles were fed on supplementary pelleted diet thrice daily at 2% of their total body weight. Results showed that WG and SGR were significantly higher in T1, in which we applied Oxy Aqua organic® product without aeration than...

Bahlouli Fayçal1*, Chourghal Nacira2, Salamani Amel3, Benaini Mohammed4, Maamri Khelifa2, Kachaou Cherifa5, Djaballah Melak5, Atek Younes6 and Aissat Fares6

... L), is a characteristic species of the Mediterranean landscape, which has many varieties with significant phenotypic diversity. In our work we studied 6 varieties: Azéradj, Frontoio, Neb Djmel, Limli, Sigoise and Chemlal, at the level of the area of El-Annasser, wilaya of Bordj-Bou-Arréridj, this study is based on phenological, physiological and agronomic characterizations established by COI (1997).The results obtained indicate that the large nu...

Aamir Ali, Hafiz Muhammad Tahir*, Azizullah, Shaukat Ali, Muhammad Summer, Ali Haidar Gormani, Saira Nawaz and Ayesha Muzamil

...es (mulberry tea) of two species i.e., Morus alba and Morus nigra. Mice were fed orally with mulberry leaves extract (200mg/kg, 100mg/kg and 50mg/kg) mixed in distilled water. Mice paw edema was induced by carrageenan injection while formalin was injected to mice paw for induction of pain. These extracts significantly decreased edema in mice paw. The level of TLC and RBCs was increased to normal. Platelets level was also increased in mice treated with mulberry...

Asmaa A. Darwish*, Adel M. El-Kattan, Mona A. Mahmoud, Mohamed T. Ragab, Amani A. Hafez 

... values in both infected species, but IL-1β, IL-6, and Fb had the highest likelihood ratios in infected sheep and IL-1β and IL-1α had the highest likelihood ratios in infected goat while Hp and IL-1β scored the highest percentages of increase among these markers. We concluded that bvfA, virB, and ure are the main virulence genes in B. melitensis isolates obtained from vaginal swabs of infected sheep and goat. B. melitensis infection elicit...

Peng Xu1, Yankuo Li2*, Shusong Zhang1 and Bin Liu3

...tudy investigated rodent species diversity in Jiangxi Wuyi Mountain National Nature Reserve of China in 2014-2015. Rodents were trapped at nine selected sampling sites varying in altitude for evaluating their diversity. Consequently, 16 rodent species belonging to eight families were recorded. Out of 376 individuals of rodent species trapped (capture rate = 4.7%), Apodemus agrarius, Eothen...

Fakhra Nazir1*, Sahar Fazal1 and Fakhar-i-Abbas2

... justify;">Corvidae is a species rich and morphologically diverse family of the order Passeriformes (Aves), generally well identified by barcodes globally. Species identification and phylogenetic analysis through DNA barcodes using mitochondrial COI gene (cytochrome c oxidase subunit I) was aimed for samples of birds collected from different regions of Pakistan. Mitochondrial DNA was successfully extracted from keel tissue a...

Munir Ahmad1, Abdul Ghaffar1, Riaz Hussain2* and Rifat Ullah Khan3*

...ating effects on various species, as well as public health, if they enter the food chain. Pymetrozine’s toxicity in freshwater fish was the main focus of the current study. For this reason, 80 fish were collected and placed separately in four groups of 20 fish each. Pymetrozine was given to fish in groups B, C, and D at doses of 500, 1000, and 1500 µg/L in water. For histopathological and hematological examinations, blood and other visceral tissues...

Imtiaz Kashani and Sher Khan Panhwar*

... it is assumed that this species has ability to adopt different ecosystem for survival despite acquiring adverse impact on phenotypic characteristics. 

...

Khalid Mahmood1*, Arslan Lodhi1, Muhammad Asim2, Muhammad Adeeb Babar3 and Muhammad Akbar Khan1 

...imens are assessed up to species level and identified as belonging to Gazella lydekkeri, Selenoportax lydekkeri, S. vexillarius, Tragoportax punjabicus, T. salmontanus, and Pachyportax latidens. The presence of these bovid species indicates moderate taxonomic diversity of bovid fauna in the Dhok Pathan region of the Siwaliks of Pakistan.

...

Ying Liu1,2, Ji-Yong Fang2, Na Zheng3 and Hai-Long Wu1*

...ugh microscopy. This new species was collected from the small intestine of the Chinese frog species Odorrana schmackeri Boettger, 1892, acquired from four regions of Anhui Province, southeastern China. To our knowledge, one species of the Seuratascaris genus, namely Seuratascaris numidica (Seurat, 1917) Sprent 1985, has so far been recorded. The morphology of S. schmackeri sp. nov. differs...

Fadzlin Afiqah A. Samad2, Amirul Faiz Mohd Azmi1, Muhamad Affan Ab Azid1, Hafizin Mu’izz Zalazilah1, Syakirah Zulkifli1, Izreen Edriana Mohd Jasmi1, Muhammad Baqir Irfani Rahimin Affandi1, Mohd Zamri Saad1, Md Zuki Abu Bakar1, Agung Irawan3,7, Adib Norma Respati4, Anuraga Jayanegara5,7, Sadarman Sadarman6,7, Hasliza Abu Hassim1,2,7*. 

...9 comparisons from multi-species of buffaloes were analyzed according to a linear mixed model methodology with explanatory variables declared as fixed effects and individual study as random effects. The results showed a negative curvilinear pattern of milk yield across buffaloes’ breeds in response to the increasing FC ratio (P<0.05; R2 = 0.828) and strong linear increased in response to the increasing DMI (P<0.01; R2 = 0.841). The interaction effe...

Saqib Mehmood1, Bushra Allah Rakha1*, Muhammad Sajjad Ansari2, Ali Akhter1, Nadeem Munawar1 and Tariq Mahmood1

...bout 2.5 ha. Four rodent species was investigated in following order of dominance: Bandicota bengalensis > Nesokia indica >Tatera indica > Golunda ellioti. Maximum (P<0.05) rodent density was found in reference sites (2.03 ± 0.04 ha-1) as compared to treated sites (1.18 ± 0.05 ha-1). However, at each study sites, maximum activity (P <0.05) of rodents was recorded inside of the crop field (1.75 ± 0.02 ha-1) in relation to the...

Luigi Liotta1, Vincenzo Lopreiato1, Fariborz Asroosh2 and Alireza Seidavi2*

...cant differences between species/breeds. The acidity, density and fat in Talesh sheep’s milk was higher than milk from other species/breeds (P<0.01). Also, the amount of protein in Talesh sheep’s milk was significantly higher (P<0.05) than all animals tested with the exception of Talesh buffalo milk. The pH of Saanen goat’s milk was higher than the pH of milk from all other sp...

Ying Guan1,2, Puqing Song2, Xing Miao2, Hai Li2, Rui Wang2, Liangming Wang3, Yuan Li2* and Longshan Lin2*

...stigated. A total of 114 species of fish were caught in surveys throughout the year. According to their feeding habits, the fish species in the surveyed area were classified into six functional groups, including planktivores (FG1), planktivores/benthivores (FG2), benthivores (FG3), benthivores/piscivores (FG4), piscivores (FG5), and omnivores (FG6). FG3 was the most diverse group, with 43 species

Asifa Hameed1*, Haider Karar2, Abdul Ghaffar1, Abid Hameed Khan1, Muhammad Mubashir1 and Ghulam Mustafa1

...pollinator but honey bee species A. dorsata, and A. melliferae visitation was almost negligible. The total value of insect pollination was estimated as 1299 million dollars. Overall, this is the first study describing the role of pollinators in successful fruit setting in southern Punjab Pakistan and describing the pollinating insects of mango orchards during peak flowering season.

...

Muhammad Salman Ikram1, Tahir Mehmood1,2*, Sehrish Firyal3, Huma Sattar4, Shagufta Saeed3, Fareeha Nadeem3 and Muhammad Imran Mahmood Khan5

...n DNA within and between species, importance of Y-STR in relation of its haplotype diversity and frequencies among different population, role of paternal lineages identification which helps to determine the mutation rate of Y-STR and its relationship with paternal lineages determination. When familial searching is coupled with genealogy inquiry, the review article will help us comprehend the combined use of Y-chromosome information and family information and u...

Abdullah*, Imtiaz Khan, Muhammad Ishfaq Khan, Muhammad Ibrahim and Muhammad Fawad

...importance value of weed species. The present findings revealed that Asphodelus tenuifolius Cav., Carthamus oxycantha M. Bieb., Medicago denticulata Willd., Anagallis arvensis, Lathyrus aphaca L. Euphorbia helioscopia L., Convolvulus arvensis L., Cyprus rotundus, Vicia sativa L. Ehrh., Cynodon dactylon L. Pers. and Fumaria indica Hausskn were all found in five locations around the district. The main species in the district e...

Abdur Rauf1*, Farooq Jan1, Muhammad Qayash2, Zia-ul-Islam3, Rizwanullah1, Ikramullah Khan1, Muhammad Shuaib4, Muhammad Khalid5 and Samrin Gul6

...nst bacterial and fungal species. The four pathogenic bacteria (Micrococcus luteus, E. coli, Staphylococcus aureus, Bacillus subtilis) and two fungi (Aspergillus flavus and Aspergillus niger) were examined. The above-mentioned various ethanolic crude extracts of H. eichwaldii revealed the highest potential (15.82±0.40), (18.12±0.56), and (17.41±0.51) against S. aureus, a moderate activity (13.31±0.64), (15.43±0.52), (14.35&pl...

Beenish Shahid1* and Muhammad Ijaz Khan2

...etent oocytes in buffalo species limits the commercialization of in vitro embryo production technology in field conditions. The present study aimed to improve the cytoplasmic and nuclear maturation of in vitro matured oocytes of Nili Ravi buffalo in the presence of hormones. The denuded oocytes (DOs) obtained by repeated pipetting were collected from 2-8mm follicles. A series of experiments were conducted to evaluate the effects of oestradiol (2 μg/ml), rec...

Komal Javed1, Sohaib Muhammad1*, Zarghaam Khan1, Sehar Fatima1, Hassan Nawaz1, Mahrukh1, Tahira Khalid1 and Shariat Ullah2

...t family representing 11 species, Asteracea occupies the second position with 9 species followed by Fabaceae with 5, Brassicaceae and Solanacea having 4 species each, Polygonaceae with 3 species, Chenopodiacea and Cyperaceae with 2 species each, Aizoaceae, Commenlinaceae, Convolvulaceae, Euphorbiaceae, Lamiaceae, Malva...

Atef M. El-Sagheer1*, Aline F. Barros2, El-Sayed M. Abd El-Aal3, Mohamed M. Gad4, Doaa S. Mahmoud4 and Amr M. El-Marzoky3

...the feeding sites of two species. In combination with two species, the effects of M. incognita were noted more than those of R. similis. Where showed R. similis was protruding out or was inside the feeding site of M. incognita. In addition, R. similis was deepened within the root more than usual, with a lower number of phenolic and lignified cells. The obtained results can form the basis for understanding of the nature of ne...

Ramzan Ali1, Erum Iqbal1*, Muhammad Ismail Bhatti2 and Saboohi Raza1

...ese identified nematodes species are new records from Pakistan.

...

Sumbul Zulfiqar and A.G. Rizwana*

...cially due to Philometra species is considered very much problematic in fish culture and aqua tilling. There are number of complications in fishes that arose due to presences of Philometra sp. Presence of these parasites directly affect fish reproduction and ultimately decline their populace. This research work was done to collect, observe and identify variety of nematodes (Philometrids) from female reproductive organs of marine edible fish Pomadasys maculatus...

Selvaraj Thanga Malathi¹, Venkatraman Anuradha1*, Mohamed Yacoob Syed Ali2, Muhameed Sajjad Sarwar3, Nagarajan Yogananth2

...also affects the aquatic species such as fish. Low or nil secretion of thyroid hormone will leads to metabolic stress that in turn breakdown the basic metabolic processes that eventually ends in disturbing the marine ecosystem. The current research work deals with observed alteration in the thyroid metabolism (causes hypothyroidism) and morphological (histology) changes occurred in fish species (selected organism– Chan...

Muhammad Ali1*, Rukhsana Perveen2, Khalil Ahmed3, Ghulam Raza1, Muhammad Akbar1, Maisoor Ahmed Nafees3 and Muhammad Ayub4

... the description of this species on the basis of important diagnostic characters including male and female genitalia. It is an important predator of scale insect pest, Icerya aegyptiaca (Douglas, 1890) which is dangerous insect pest upon different fruit trees including date palm, mango, mulberry and other important fruit trees in this region. This study also investigates the predatory role both adults and 4th instar larvae of this coccinellid predator in the b...

Qi Liu1,2, Weiyuan Li2,3, Qi Zhang2,3, Ziwei Wang2,3, Rui Gao1,2, Wenlei Liu1,2, Lei Zhang1,2, Ying Liu1,2, Tao Tian2,3 and Hongwei Yan2,3*

... is an important fishery species in China. Hatchery-reared seeds have been released into the wild for improvement of shrimp productivity. Jinzhou bay is the major natural habitat and we used this location to temporally monitor the genetic effects of release of hatchery stocks on local F. chinensis populations across five years. A set of 13 microsatellite markers were used to evaluate genetic patterns across 2015, 2016 and 2019. We observed a significant Hardy-...

Yakun Ge

... through reactive oxygen species (ROS). A2780 cell line was purchased from the American Type Culture Collection and cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum, 50μunits/mL penicillin and 50μg/mL streptomycin, maintained at 37°C and 5% CO2 in a humid incubator environment. Quantitative analysis of ROS was performed using flow cytometry and median fluorescence intensity detection. Cell proliferation was detected by MTT method...

Yingying Ye1, Chengrui Yan1, Kaida Xu2, Jiji Li1, Jing Miao1, Zhenming Lü1 and Baoying Guo1*

...ngdao. Heterozygosity at species level was high and Fst ranged between 0.105 and 0.271, overall, without signs of inbreeding except for Qingdao population, with Fst = 0.271. The studied populations did not show a clear genetic structure with an average differentiation estimated between populations of 0.014. Knowledge obtained from this study has important implications for the management of existing genetic resources for aquaculture, artificial releasing projec...

Alisher Safarov1*, Nasreen Nasreen4, Firuza Akramova5, Shukhrat Djabbarov1, Adolat Mirzaeva5, Javokhir Esonboev5, Djalaliddin Azimov5, Mourad Ben Said2,3 

...aimed to investigate the species composition and prevalence of ectoparasites in domestic (dogs and cats) and wild predatory mammals (jackals, wolves, foxes, and reed cats) in Uzbekistan through regular parasite collections. Materials and Methods: A comprehensive surveillance was conducted to calculate the prevalence of ectoparasites in carnivorous mammals. Data on ectoparasite prevalence, including area, host, breed, species...

Abdul Hadi, Muhammad Rais*, Ifrah Muddassir, Abdullah Tasib, Maria Zafar and Sumbul Gill

...12,295 individuals of 83 species (12 orders, 38 families) were recorded from the National Park. The hiking trails (74 species, 5219 individuals) were found to be more diverse followed by undisturbed forest (60 species, 3377 individuals) while urban areas (41 species, 3699 individuals) were least diverse. The bird abundance (number of individuals and enco...
Tariq Ahmad1*, Anum Razzaq2*, Li Bo1, Faiz ur Rehman3, Gul Saba2, Omama Saqib1, Saif Ullah2 and Muhammad Suliman1
...ediately, otherwise this species will become extinct.

...

Adnan Ihsan1*, Najeeb Ullah1, Riaz Hussain2, Jawad Sarwar1, Kamran Sohail1 and Waqar Khan1

...genus Leptophion and the species L. maculipennis are described for the first time from Pakistan. Morphological description and digital images of the identified species and genus are given.

...

Bushra Ainy Dars1*, Naeem Tariq Narejo1, Muhammad Hanif Chandio2, Hamida Narejo3, Majida Parveen Narejo4, Faheem Saddar5, Ghulam Dastagir6, Ghulam Abbas7 and Shahnaz Rashid7

...nds. The culture of this species may produce a significant role in generating revenue in the country.

...

Nadia Jabeen1, Abdul Mubeen Lodhi1*, Rehana Naz Syed1, Muhammad Ali Khanzada2 and Alia Gul3

...s added as a new science species in the genus Marasmiellus (Omphalotaceae ), collected from the lawn and grassy soil of Hazara University, Mansehra. The comparative studies revealed that Marasmiellus agrianum N. Jabeen and M. Lodhi was grown on lawn soil and is a  flattened convex whereas Marasmiellus scandens being pathogenic was found mostly on the trunk of trees and is a semicircle convex-shaped basidiocarp. The species<...

Sagir Hussain1, Erum Iqbal2*, Nasira Kazi2, Sher Wali Khan1, Qamar Abbas1 and Abdul Razaq1

...s yielded a new nematode species and two new reported species belonging to the order Tylenchida as new geographical records for Pakistan. Hemicycliophora pyri n. sp., is characterized by the broadly rounded lip region with two indistinct annuli, closely fitting sheath with 231-247 body annuli, stylet 95-100 µm long, non-raised and non-separated labial disc and gradually tapering long tail. Psilenchus vincigurrae Brzesk...

Uzma Ishaque1, Erum Iqbal1*, Shahnaz Dawar2 and Nasira Kazi1

... order Mononchida, a new species of the genus Mononchus Bastian, 1865 was collected from rice (Oryza sativa L.) field in Nawabshah, Sindh, Pakistan, which has been described and illustrated. Mononchus oryzae n.sp., is characterized by its body, 1.508-1.528 mm long, lip region 23-24 µm wide, buccal cavity 34-36 x 16-17 µm with tooth apex located at 20-22% of stoma length and 3.9-4.2 anal body diameter long tail. M.oryzae n.sp. comes close to M. nudu...

Yingying Wang, Jianyi Yu and Lichen Zhou*

...most endangered tiger subspecies endemic to China, remain only a little more than 200 today, was susceptibly infected with Toxoplasma gondii. In this study, we used polymerase chain reaction to detect DNA, and enzyme-linked immunosorbent assay to test for T. gondii antibodies. Antibodies (S/P>0.31) to T. gondii were found in 20 (26.32%) of the 76 tigers, while all blood samples tested through nested PCR were negative. This is the first investigation of T. g...

Mohamed Mahrous Amer1*, Hanaa Sayed Fedawy2, Hoda Mohamed Mekky2, Khaled Mohamed Elbayoumi2, Ahmed Ali El-Shemy3, Mohamed Abd El-Rahman Bosila2

...caused by many bacterial species, mainly Escherichia coli (E. coli) and/ or Staphylococcus aureus (S. aureus), causing severe economic losses in poultry. This study was done on 14-day old broiler Ross 308 chickens subcutaneous (s.c) injected with E. coli and/ or S. aureus to induce cellulitis. Clinical signs, mortality, pathological lesion, and growth performance were determined. Hematological parameters, liver and kidney functions were also recorded. Colistin...

Rida Ahmad1,2*, Zulfiqar Ali2*, Farkhanda Manzoor1, Usman Ahmad3, Safdar Sidra4, Irfan Zainab2, Muhammad Furqan2, Aliza Batool1,2 and Zaidi Zona2

...y of habitats to support species diversity and maintain viable population. Avian studies provide substantial information about these changes as birds are predictor of ecological disturbances. The current research explored the avian diversity, richness, abundance and their feeding habit in selected habitats of Khyber Pakhtunkhwa (KP) and Gilgit Baltistan (GB). Data were collected from May 2017 to October 2017 using point count technique. Thirty points were sele...

Lichun Jiang1,2*, Lan Zhu1, Meiqi Li1, Xinyue Bao1, Zhenkun Zhao2, Haifen Qin2 and Wei Chen3*

...cephalophus) is a unique species in the genus Elaphodus. Currently, very little is known about its nuclear and mitochondrial genomes and their phylogenetic position within the family Cervidae. In this study, we have determined the complete sequence of the mitochondrial genome of the tufted deer, by using a long polymerase chain reaction (PCR) technique. The entire mtDNA sequence is 16,196 bp in length, which compared with previous studies is the least, contain...
Iram Liaqat1*, Noor Muhammad1, Muhammad Mubin2, Najma Arshad3, Tehreema Iftikhar4, Sumera Sajjad5 and Farzana Rashid5
...s belong to Streptomyces species and were identified as S. monticola, S. septentrionalis, S. polaris, S. desertarenaee and S. lutosisoli. Primary screening of the five isolates using cross streak method showed excellent zone of inhibition (ZI 10-27 mm) against tested pathogens (Escherichia coli, Klebsiella pneumoniae, Bacillus licheniformis, Pseudomonas aeruginosa and Bacillus subtilis). Secondary screening using ethyl acetate extracts also showed significant ...

Hafiz Muhammad Arsalan1, Amina Arif1 and Muhammad Khalil Ahmad Khan2*

...ncreased reactive oxygen species (ROS) production in response to antioxidant (AOX) defense systems lead to oxidative stress (OS). Our study aimed at biochemical profiling of CML patients in response to imatinib or nilotinib therapeutic drugs. Fresh venous blood sample (10 mL) of 170 CML diagnosed patients and 10 healthy individuals was collected in heparin vial from oncology department, Mayo hospital and Jinnah hospital Lahore, Pakistan. Biochemical profiling ...

Gang Liu*, Na Xu, Zhizhong Gong and Jiahui Feng

...geese ate mainly Poaceae species, whereas the Caizi Lake geese ate mainly Carex spp., suggesting that different diets might induce varied gut fungal communities between the geese. More fungal genera were significantly correlated with bacterial genera (Sphingobacterium, Brevundimonas, Stenotrophomonas, Chryseobacterium, Acinetobacter, and Pseudomonas) in pairwise populations, and Ceratobasidium, Tomentella, Paurocotylis, Tuber, Podospora and Mortierella were th...

Deny Anjelus Iyai1*, Ambo Ako2, Sitti Nurani Siradjuddin2, Budiman Nohong2 

...er 4 districts, with 890 species of grass, legume and non-grass/non-legume plants. There were 11 families found in total in the observation plots in each district, namely Compositae, Poaceae, Fabaceae, Rubiaceae, Cyperaceae, Moraceae, Lamiaceae, Melastomataceae, Acantaceae, Peperomiaceae and Verbenaceae. Dominant plant species are in the range of 0.01-0.03, abundance is in the range of 1.65-3.87, evenness is in the range of ...

Ishtiaq Ahmed1*, Hamid Ullah2, Zubair Ali2, Muhammad Sohail2, Yasir Amin2 and Afrasyab1

...ent GIT helminths. Seven species of parasites including: Eimeria Spp, Ascaris spp., Strongyloid spp., Fasciola spp. Trichuris spp. Monezia spp. and Schistoma bovis. as well as mixed species were identified as per their intensity. It was noted that prevalence was highest in goat (80%) followed by buffalo (74%), cattle (71.27%) and sheep (68.08%). The Eimeria spp. was highest (35.27%) followed Buffallo (28.35%) and trichuris s...

Asif Sadam1*, Rahmat Ullah Khan2, Karim Gabol2*, Muhammad Awais3,4, Mohammad Ismail1, Sajid Mahmood1, Muhammad Aslam4 and Hamidullah5

...;">Many of the waterbird species are generally thought to be threatened mainly or at least partly by over hunting. This paper provides novel information on the causal factors that lead to hunting and illegal trade of waterhen Amaurornis phoenicurus in a remote villages of district Mardan, Khyber Pakhtunkhwa, Pakistan. Data were collected by adopting a mix scientific approach including Participants’ observations, interviews and structured questionnaire. O...

Nasratullah Baloch1, Naeem Tariq Narejo2, Hamida Narejo3, Muhammad Farooq Hassan4, Ghulam Abbas5, Shahnaz Rashid5, Muhammad Hanif Chandio6, Faheem Saddar7 and Majida Parveen Narejo8

...amilies, 68 genus and 91 species were recorded from this research work. Out of which, 4 species were reported as dominant species namely Liza subviridis (24.88%; TL 1.8-35.0±0.2 cm), Sardinella longicep (15.83%;2.8-20.4±0.3 cm), Sillago sihama (9.04%; TL 3.5-20.3±0.4 cm) and Acanthopagrus berda (7.99%; TL 1.47-28.5± 0.5 cm). The Simpson’s biodiversity inde...

Bushra Allah Rakha1*, Farah Qayyum1, Muhammad Sajjad Ansari2, Ali Akhter1, Komal Shakeel1, Javeria Batool1, Faryal Akhtar1 and Sehrish Hina1

...cm). The preferred plant species used by white-cheeked bulbul for nest construction was garanda (Carrisa opaca; 58.7%) followed by sanatha (Dodonaea viscosa; 26.25%), panch phuli (Lantana camera; 6.25%), beri (Zizyphus mauritiana; 3.75%), kronda (Carissa macrocarpa; 2.5%) and mallah (Zizyphus nummularia; 2.5%). Clutch size in white-cheeked bulbul ranged from 1 to 5 eggs with mean clutch size of 2.6 eggs. Maximum percentage of nests (30.2%) had clutch size of 2...

Jameel-ur-Rehman1, Asghar Ali Kamboh1*, Ahmad Ali Moryani1, Riaz Ahmed Leghari1, Abdullah Sethar2, Ali Raza Nizamani3, Abdul Ahad Soomro3, Kanwar Kumar Malhi1 

...comprising of three fish species i.e., Labeo rohita (LR; local name Rohu), Catla catla (CC; local name Thaila) and Cirrhinus mrigala (CM; local name Morakhi). The samples were processed for isolation of bacterial organisms using conventional culture method and isolates were tested for antimicrobial sensitivity according to CLSI method. According to results, the prevalence of bacterial organisms was high (p < 0.05) in CC than CM and LR. E.coli were the most ...

Peng Chen1, Jiaqi Li1, Hongbo Li2, Qin Lu3, Wei Liu1,4,5* and Jianliang Zhang1*

...as those of Anseriformes species. The mean base composition of the mitogenome of Anseriformes was T (22.31 ± 0.51%), C (32.63 ± 0.64%), A (29.36 ± 0.64%), and G (15.71 ± 0.52%), indicating a slight specific bias towards A and C. AT content ranged of the mitogenome was from 50.27% to 55.31%, with an average value of 51.67 ± 1.10%, higher than the GC content and similar to that of birds in general (50.5% to 57.7%). In addition,...
Misbah Ammanat1, Abdul Qadir1, Zulfiqar Ali2*, Rida Ahmad2,3, Usman Ahmad1, Irfan Zainab2 and Aliza Batool2,3
...presenting 215 different species. Tarbela Reservoir and the future Dasu dam site had the greatest abundance and diversity of avifauna. The number of individuals observed per survey peaked in November, at the height of fall migration; the secondary peak of back migration in March was much smaller. Most abundant species in the study area included Great Cormorant (Phalacrocorax carbo), Common Myna (Acridotheres tristis) and Car...
Md. Abdullah Al-Mamun1,2, Al-Mamun2,3, Sanjay Kumar Mohanta2,3, Md. Farhan Tazim2,3, Mohammed Rashed Parvej 2,3, Md. Sharif Uddin2,3, Suman Barua1,2 and Liu Qun1*
...on, and sex ratio of the species. Monthly variation in the gonadosomatic index (GSI) values and histological observations has revealed two spawning peaks, in spring (April-May) and fall (September). The maximum GSI has accounted to 4.70±1.45 and 5.01±1.75, which corresponded to warmer water temperature 29.68ºC±0.60 in April and 29.72ºC±0.28 in May, respectively, over the Bay of Bengal. At 50% sexual maturity (Lm), males ma...

Tasleem Akhtar1*, Muhammad Farooq Nasir2, Imran Bodlah2 and Muhammad Adnan Bodlah3

...female biased (60%). Two species of hyperparasitoids viz. Asaphes suspensus (68%) and Pachyneuron aphidis (54%) were involved. Examination for phenotypic polymorphism showed that field population of A. smithi contained both dark and light pigmentation pattern of abdominal segments while laboratory reared samples were only dark pigmented in both sexes. The findings of this study can help in defining strategies for the rearing to release this parasitoid in biolo...

Yang Pan1,2, Yang Huang3, Guo-hai Wang4* and Qi-hai Zhou3*

...hwest China. Eleven bird species were recorded feeding on its seeds, and eight bird species were confirmed to be seed dispersers. Oriental turtle-dove (Streptopelia orientalis), red-whiskered bulbul (Pycnonotus jocosus), and red-billed blue magpie (Urocissa erythrorhyncha) were the main seed dispersers. The number of seeds removed increased with bird foraging frequency, and seed dispersal distance increased with bird body an...
Yousef Ahmed Alkhamis1,2*, Basanti Mondal3, Roshmon Thomas Mathew2, Ganesan Nagarajan4,5,6, Sheikh Mustafizur Rahman3, Md. Mostafizur Rahman7, Adnan Alhajji1 and Md. Moshiur Rahman3,8*
... threat for fish as most species either do not grow well or eventually die in coastal regions where salinity changes happen regularly because of different natural calamities. This study was conducted to explore the effects of periodic changes of salinity on different phenotypic traits in Nile tilapia (Oreochromis niloticus) in order to find out any traits that can be expressed through compensatory growth. Equal sized juvenile Nile tilapias were randomly assign...

Nida Sadaqat1, Sheheyar Ahmed Khan1, Amna Bibi1, Sadaf Zahra1, Muhammad faisal Salamt1, Noreen Latief2 and Fatima Ali1*

...tive oxygen and nitrogen species (ROS, RNS), which are implicated in pathophysiological events in burn patients. Excessive productions of free radicals are harmful and implicated in tissue damage and multiple organ failure. Supplementation of antioxidants has proven beneficial in decreasing free radicals in burns. The aim of the present study was to investigate the effect of N-acetyl cysteine (NAC) on biochemical alterations during the post-burn stage in scald...

Meryem Betmezoğlu1*, Dilek Arsoy2 and Mahmut Çerkez Ergören3

...l importance in terms of species genetic diversity We believe that this breed will play a key role in the reduction of scrapie cases, based on its resistance genotype H154 ratio. Larger studies are needed to gain a complete understanding with regards to the impacts of the 146D, 146S, and 154H alleles in Damascus, Cyprus Native Hair Goat and Damascus-Saanen hybrids.

...

Mamona Jabeen1, Sumra Naz1, Hina Amjad1, Khalid Abbas1*, Sajid Abdullah1, Muhammad Anjum Zia2, Taqwa Safdar1 and Muhammad Sarfraz Ahmed1

...ation of freshwater fish species using molecular markers is important for their management regarding the evaluation of the potential genetic effects induced by anthropogenic interventions. The genetic variability among five natural populations of Channa marulius was studied by using five microsatellite loci in a total of 150 individuals. The C. marulius population exhibited a moderate level of heterozygosity. The mean value of observed heterozygosity ranged be...

Rahamdad Khan1, Saad Muhammad2, Muhammad Haroon3, Saad Jan1 and Syed Majid Rasheed1*

...duration (9 hours), both species grew faster and recorded their maximum biomass plant height, leaf area, and number of branches. Both weed species grown under reduced light duration could not reach maturity and complete their life cycles. P. hysterophorus has the potential to grow quickly and replace C. sativa under 9 hours of light duration, which is suitable for enhancing the medicinal value of C. sativa.

...

Saima Naz1, Ahmad Manan Mustafa Chatha2, Rifat Ullah Khan3*, Saba Iqbal1, Nimra Amjad1, Azka Kiran1, Ammara Javed1, Maria Lateef1 and Amna Nawaz1

...onal variations. Maximum species originated belongs to family Cyprinidae which were 12 in number. It is suggested that there is a need of comprehensive strategies to conserve the nearly extinct group of fish species.

...

Ayoola J. Shoyombo1, Ake A. Moses1, Comfort I. Ukim2, Mustapha A. Popoola2, Olayinka O. Alabi1, Noah C. Edozie1, Faith Ogbor1, Jacob Kuusu1, Ekemini M. Okon3* 

... 

...

Saime Betül Baygeldi1, Barıs Can Güzel1*, Ramazan Ilgün2 and Zait Ender Özkan1

...st geese with other bird species by scanning electron microscopy (SEM) analysis. In addition, by applying the silicone plastination technique to the tongue, it is aimed to compare the SEM images before and after plastination. German mast geese used as study material were obtained from goose breeders. After the micro-anatomical features of the German goose tongue were determined, SEM (FEI-Quanta; FEG 250, USA) analyzes were made and their general structures wer...

Razia Sultana1, Shinawar Waseem Ali1*, Ghulam Murtaza2 and Shahid Mahmood2

... of 4 detected bacterial species was less than 1%. Three species (Mycobacterium tuberculosis, Pantoea agglomerans, and Raoultella ornithinolytica) belonged to culturable bacteria and one species (Tepidimonas spp.) belonged to nonculturable bacteria. Our data demonstrate the presence of wide diversity of bacterial microbiota in locally processed back-slopped yogurt. 

...

Khalid Mahmood1*, Muhammad Akbar Khan1, Sayyed Ghyour Abbas1,2, Muhammad Adeeb Babar3 and Muhammad Asim4

... of this barbourofelines species from the Chinji Formation to the Nagri Formation.

...

Nabi Ullah, Abdul Samad Mumtaz*, Lubna Anjum Minhas, Muhammad Kaleem, Rooma Waqar, Amber Jabeen and Ayesha Hanif

...nkhwa. Total of 52 algal species belonging to 2 classes, 6 orders, 13 families, 22 genera, were reported from the four different sites (E1, E2, E3 and E4) of District Bajaur Khyber Pakhtunkhwa. Comprehensive investigation of four research stations revealed the phytoplankton diversity from Chlorophyceae to Cyanophyceae. All species were collected from the fresh water bodies during March spring to August rainy season in 2021. ...
Durairaja Ramulu1*, Jawahar Paulraj2, Jayakumar Natarajan1, Sudhan Chandran1 Sudhir Kumar Das3, Suresh Eswaran4, Santhakumar Rajagopal5 and Padmavathy Pandurangan6
...ratios (E) for the three species were 0.43, 0.36 and 0.51, respectively. The mean CPUE was 0.9136 kg / hr / craft. This study would suggest good inland capture fishery management plan in the potamon zone of the river Thamirabarani.

...
Guo-Hai Wang1, Ji-Feng Long2, Li-Juan Wei3, Zhi Qin2, Wei Yao4, Chuang-Bin-Tang1* and Qi-Hai Zhou4*
...ntiation among sympatric species and the coexistence of such species communities. However, there is no clarity on whether the activity patterns of the sympatric species red-bellied squirrels (Callosciurus erythraeus) and Northern tree shrews (Tupaia belangeri) overlap; knowledge on the coexistence mechanism of these animals in the karst habitat is also minimal. Herein, we used camera traps...

Wen Xiong1*, Shengao Chen2, Dong Xie3, Qiang Wang4, Yanxia Li5, Lei Pan6, Xiaolei Ren7*, Wei Tang8*, Kang Chen9 and Ross N. Cuthbert10

...ange, including invasive species and habitat loss. There is an urgent need to establish synthesized baseline information pertaining to current ecological communities to quantify future change and identify habitats to protect. The Qiantang River is the largest river in the Zhejiang Province, located in the southeast of China, with extensive fishery and aquaculture sectors. However, synthetic information on freshwater fish biodiversity and invasions in this regi...

Muhammad Altaf1*, Arshad Javid2, Abdul Majid Khan3, Sadia Nazer4, Irfan5, Khalid Javed Iqbal6, Muhammad Sultan Haider7 and Sana Ashraf7

...ion of various mammalian species of the study area were collected through linear count method viz., direct observation (personal count and record voices) and indirect observation (presences of carcasses, fecal pellets, pug marks and meeting with local communities). The habitat preferences of large, medium and small mammals varied significantly. A decrease in mammalian diversity was observed from forest habitat to urban landscapes. Indian wild boar, Asiatic jac...

Weidong Liu, Jiashen Tian, Zhen Wang, Zhongren Kong, Jiabo Han and Zhichuang Lu*

...ha) is the only pinniped species reproducing in the wild in China. Wild populations of this species have declined sharply in China due to anthropogenic impacts. Forty-six individuals died accidentally in Liaodong Gulf between 2018 to 2020 and were collected. The genetic diversity and population structure of this population were investigated using mitochondrial ND4L and D-loop sequences, and the results were compared with the...
MISBAH RAZZAQ, MUHAMMAD RAIS*, MUHAMMAD ARSLAN ASADI, SALEHA ABBASI &
ABDULLAH IBRAHIMv
...n diet of many reptilian species of Pakistan are
scarce. We aimed to document major dietary items of Black Rock Agama
(Laudakia melanura) in rocky habitat, croplands, areas around human
habitations and natural streams of Mori Said Ali Game Reserve (AJ&K)
using stomach-content flushing and fecal analysis. Of the recorded 17
dietary items, ten (59%) were of plant origin and seven (41%) were of
animal origin. Pyrus pa...

RUBAB ZAFAR KAHLON*& IBTISAM BUTT

...ct-wise data for 12 bird species was obtained from the
Zoological Survey of Pakistan, Islamabad and Arid Agriculture University,
Rawalpindi from 2007-2015. The collected data was arranged and
tabulated in Microsoft Excel 15 and SPSS 22 and were analyzed for
linear regression. The most common bird species found were House
Sparrow, Common Quail and House Crow. The dec...
IRAM MUJAHID IQBAL1*, ASAD SHABBIR1, 2, KANZA SHABBIR1, MAHAM NAVEED1, FAREIHA UROOJ1,
AQSA BUTT1, RAEES KHAN3, NIDHAN SINGH4 & FIRDAUS-E-BAREEN1
... documented all the tree species of the botanical garden and
both of the campuses through extensive surveys during 2014-15. A total
of 220 woody plant species belonging to 157 genera of 55 plant families
were being reported. The major plant families in terms of species
contribution were Fabaceae (34), Moraceae (19), Myrtaceae (14),
ZAHID FAROOQ1, RUQIA BIBI2, IRFAN BABOO3*, KAMRAN ABBAS4, MUHAMMAD SHAHBAZ5, KHALID
JAVED IQBAL6, DILAWAR HUSSAIN7, MUHAMMAD ABRAR8, ASMA CHAUDHRY9 & TANVEER
HUSSAIN10
...tal of seven
species of endoparasites, Capillaria 34%, Ascaridia 29%, Heterakis
13.4%, Eimeria 12.5%, Strongyloides 12.5%, Giardia 7.31%, and
Syngamous 4.55% were recorded, with mixed infection 34%. The
variations in prevalence in study birds and in study sites were because of
good and bad management strategies.
...

ZAHOOR AHMAD SAJID1* & SHEZA AYAZ KHILJI2

...zing the reactive oxygen species produced during salt stress episode. It is therefore, suggested from the results of this research work that biochemical characteristics were related to a transferring of plants from being salt sensitive to relatively more tolerant. Apparently lot of work on this salt bush regarding biochemical and physiological characteristics still remains elusive and needs further experimentation under greenhouse as well as field conditions t...

HIRA SOOFI1*, ARIFA BHUTTO2, ABDUL RASOOL ABBASI3 & GHULAM SARWAR GHACHAL1

...todes were resemble with species Aphanururoides lethrini in all diagnostic characteristics and identify as such. Present genus reported first time from Rita rita of Pakistan, hence this report is new locality and host record.

...

Nusrat Habiullah1*, Shah Nawaz Kumbar1, Fahmida Parveen Samo1, Shamusuddin Bughio2, Asghar Ali Kamboh3, Burirah Rehman Talpur1 

...effects of lead in avian species.  

...

Qasim Ali1, Mudssar Ali1*, Muhammad Awais Ahmad1, Asif Sajjad2 and Shafqat Saeed

...bserved consisted of two species of bees and eight species of flies. Among these, Episyrphis balteatus emerged as the most prevalent insect pollinator, closely followed by Apis florea and Calliphora sp. The highest visitation rate was recorded for Apis dorsata, followed by E. balteatus and Ischiodon scutellaris. Comparative analysis revealed that fruit dimensions, weight, pulp content, and seed count per fruit were notably i...
Ummul Firmani1,3, Rahmi Nurdiani2, Arning Wilujeng Ekawati2 and Happy Nursyam2*
...found that the bacterial species was B. paramycoides B2.1. These results suggested that Bacillus paramycoides B2.1, which is found in the digestive tract of milkfish, can be used as a probiotic candidate for fish feed indicated by several probiotic tests that have been carried out.

...

Romaan Hayat Khattak1, Liwei Teng1,2*, Naimat Ullah Khan3, Aamir Ali3, Abdul Hadi4 and Zhensheng Liu1,2*

...an. The presence of this species indicated that this ecosystem has rich biodiversity, providing plenty of resources for the survival of yellow-throated marten. However, keeping in view the diet ecology of yellow-throated marten we assume that it may have some negative impacts on the ongoing ungulates captive breeding programs with in the park. Therefore, detailed studies are needed to be carried out to investigate the population trend and habitat ranges of thi...

Sha Li1,2, Yacheng Hu1,2, Wenjing Li3, Wei Su1,2 and Wei Jiang1,2*

...ps (LLRs) for nine fish species belonging to three families inhabiting the Yichang reach of the middle Yangtze River, China. The samples were collected with gill nets (2×50 m, mesh size: 40 and 60 mm) between November 5th, 2019, and December 31st, 2019. A total of 1252 specimens were used to estimate the related parameters. The LWRs parameters of all nine species were found to be significant (P <0.05). The values o...

Al Salihi karima Akool1* , Almas. M. Al-Bayati2, Iman Mousa Khaleel3  

...age of lactation, breed, species and diseases of the udder . Moreover, she-camels also shows fluctuating in the lactation length from 9 to 18 months. This study intends to investigate the macro and microscopical features of local Arabian she-camel’s productive and nonproductive mammary glands (SCPMG & SCN-PMG). Sixteen mammary gland samples and its teats ( 8 SCPMG and 8 SCN-PMG) were collected from Al Muthanna abattoir. Gross examination, and full d...

Nur-E-Farjana Ilah1, Md. Joynal Abedin2, Esmout Jahan Alice1, Taiba Akter Laboni1, Mst. Shahinur Khatun1, Most. Shakila Sarmin1, Md. Ashekur Rahman1, Obaidur Rahman1, Md. Akhtarul Islam1, Muhammad Ali Fardoush Siddquy3 and Md. Yeamin Hossain1*

...k of information on this species in the region has made it crucial to carry out such research for better understanding about its growth and health in this particular habitat. A total 100 individuals were collected from fishers catch during November 2021 to October 2022 by using traditional fishing gears such as trawl and gill nets (mesh size: 2-3 cm). Data showed that  TL was found to be  between 15 and 21 cm and the BW remained as 46 and 136 g. All ...

Muhammad Mudassar Shahzad1*, Tehreem Shabbir1, Syed Makhdoom Hussain2, Fatima Yasin1, Humayoun Huma Maqbool1, Aasia Karim3

...ful in the diets of carp species
 
Novelty Statement | Barley meal was firstly used in fish feed specially for the common carp fingerlings. It was firstly tested for the mineral absorption and body composition. Use of the Barley was found very beneficial for these fish when was used at the level of 20-30% as replacement of fish meal.
...

Slamet Widodo1*, Mohammad Ikhsan Shiddieqy1, Teguh Wahyono2, Yeni Widiawati1, Zultinur Muttaqin1

...es between various plant species and even different cultivated varieties. This   study was conducted to evaluate the relationship between nutrient content, digestibility, and gas production of several forages in Indonesia that could help to develop prediction equations about feed digestibility and gas production to these forages. Parameters measured in this study were crude protein (CP), neutral detergent fiber (NDF), acid detergent fiber (ADF), lign...

Erkinjon B. Shakarboev1*, Abat S. Berdibaev2

...ic of Karakalpakstan. 53 species of helminths were identified during the research, representing 39 genera, 25 families, 13 orders, 4 classes and 3 phyla, with 17 species (32%) from the class Cestoda, 4 (8%) from Trematoda, 3 (6%) from Acanthocephala and 29 (55%) from Nematoda. The highest diversity of helminth species among the studied predators was recorded in the Fox – 40

Muhammad Raza Salik1, Muhammad Babar Shahzad Afzal1,2*, Ayesha Komal3, Muhammad Nawaz Khan1, Muhammad Ihsan Ullah4, Faheem Altaf5, Akbar Hayat1 and Hira Tariq1

...o is widely grown edible species in the world including Pakistan. It is enriched with vitamin C and many other phytochemicals that are beneficial for health. In Pakistan, Citrus reticulata occupies the dominant position and it is 85% of total citrus production. The study was carried out at Research farm of Citrus Research Institute, Sargodha, Punjab, Pakistan during 2012-13 and 2013-14 to see the impact of four different plant spacing (T1: 10` × 10`, T2:...

Michelle Anne Diano1,2, Loel Dalan1,2, Neil Pep Dave Sumaya3 and Nanette Hope Sumaya1,2*

...uthern Philippines. This species was identified by morphological characterization and analysis of the D2-D3 expansion segments of the 28S rDNA sequence. The D2-D3 rDNA sequence alignment of the four isolates, B2R1 (MT459236), B2R2 (MT459237), B2R3 (MT459238), and B3R1 (MT459239), do not exhibit any nucleotide differences with each other or with previously described populations of C. briggsae from China (MN519141), Germany (EF417140), and the USA (AY604481, JN6...

Khalid Hussain1*, Tanvir Hussain2 and Muhammad Inamullah Khan3

...otential of broad-leaved species, specifically Walnut (Juglans regia) in dry tem perate fore st zone, Swat, Pakistan. Juglansregia was selected to assess the resilience and adaptability potential of the species in the scenario of climate change, because no broad-leaved species have been studied so far in dry temperate forest in Swat region to establish climate-growth relationship. To that ...

Mahmoud M.A. Youssef1, Wafaa M.A. El-Nagdi1*, Hassan Abd- El-Khair2, Usama S. Elkelany1, Mahfouz M.M. Abd-Elgawad1 and Mona G. Dawood3

Retno Setyaningsih1, Sri Murtini2*, I Wayan Teguh Wibawan2, Surachmi Setiyaningsih2, Ekowati Handharyani3

...of Oryctolagus cuniculus species or European rabbits. There were no RHDV antigen can be found from asymptomatic seroconverted RHDV rabbits in this study using DAS ELISA while seroconversion was affected by age and sex while there was no significant difference of seroconversion among breeds of Oryctolagus cuniculus or European rabbits which spreading among asymptomatic rabbits in seven West Bandung Regency villages, Indonesia. 
 

Bakhtawar Soomro* and Shakeel Ahmed Memon

...ho-metrical changes this species; Diplotriaena murtazi treated as a new species. This species is dedicated to author’s father Advocate Ghulam Murtaza Soomro.

...

Tanvir Hussain1,2*, Kafeel Ahmad2, Muhammad Bilal Zia1, Hammad Uddin1, Khalid Hussain1, Muhammad Inamulla Khan3 and Said Akhtar Khan1

...and conservation of this species in the future. 

...

Ahmad Khan1, Muhammad Amjad Ali1, Muhammad Tahir1, Samreen Nazeer2*, Muhammad Zubair Akram3*, Muhammad Arslan Azmat1 and Sabina Asghar4

...east Asia. This nematode species is recognized as one of the foremost biotic constraints in the region, making it a prominent and recurring issue for agriculture and crop management. This study investigated the response of fourteen different wheat plant varieties to root knot nematode and their impact on plant growth parameters. Impact of morphological plant characters on galling population and egg mass index was assessed. Results revealed that Ujala-16 yielde...

Afsheen Khattak1, Shahida Naveed1*, Naila Khalid1, Inayat Ullah Khan2 and Tamana Bakht

...ntial against the tested species.

...

Waqas Ahmad*, Muhammad Naeem

...sity and conservation of species. Here we identified a commercially important fish Notopterus notopterus and analysed its genetic diversity. For the purpose of identification 15 specimens of N. notopterus were collected from Satluj, Ravi, Indus, Jehlum and Chenab rivers of Pakistan and barcoded with mitochondrial COI gene. BLAST analysis confirmed 100% identity of Notopterus notopterus with reference sequences belonging to NCBI GenBank database. Genetic divers...

Waheed Ali Panhwar1*, Mehtab Ali Mahar2 and Abdul Manan Shaikh3

...y Melolonthinae with two species i-e: Melolontha indica Hope, 1831 and Melolontha furcicauda Ancey, 1881. In addition to this, M. indica constructed as a new regional record for Pakistan while M. furcicauda is reported first time from Sindh Province of Pakistan. Beside this, description of the species and distribution of species along with digital images are provided for the first time. Ho...

Muhammad Nauman Arif1, Muhammad Mansha1* and Tanveer Hussain2

...rcinus) is a significant species in Pakistan due to its meat, skin and antlers, but there are insufficient molecular data, provoking us to explore its genetic variation and phylogenetic analysis using ATPase 6/8 genes of mitochondrial DNA. The blood samples from hog deer were collected and DNA was extracted by using in-house organic methods. PCR was used to amplify a total of 880 bp of overlapping genes, which were then sequenced. Bioedit software was used to ...
Hyun-Su Hwang1, Jae-Kang Lee2, Tae-Kyung Eom2, Seung-Hun Son3, Dong-Ho Lee2, Hyeongyu Ko2 and Shin-Jae Rhim2*
...Korea. The dominant tree species in this forest were Japanese red pine (Pinus densiflora), Mongolian oak (Quercus mongolica), Japanese emperor oak (Quercus dentate). At the study site, we selected 6 plots and set up 3 feeders in each plot. The feeders were located 1.5 m above the ground and spaced 1 m apart. We selected 3 types of food resources (kidney beans, brown soybeans, and peanuts) based on their energy per 100 g. We supplied 200 g of each food type at ...

Adeel Kazam1, Safdar Sidra2, Zulfiqar Ali1*, Rida Ahmad1,3, Ahmad Bilal1 and Aliza Batool1,3

...021. In total, 139 avian species of 27,450 individuals were recorded at study sites. Results revealed that the species richness was maximum at Uchalli (133), followed by Khabbaki (92), Jahlar (88), and Ahmedabad lake (79). The Shannon Weiner index and Simpson index values for Jahlar lake, Uchalli lake, Khabbaki lake, and Ahmedabad lake were (2.99, 0.90), (2.32, 0.82), (2.26, 0.66) and (1.72, 0.51) respectively. The omnivore ...
Hina Mumtaz, Muhammad Zeeshan Majeed*, Muhammad Afzal, Muhammad Arshad, Arif Mehmood and Muhammad Qasim
...e invasive fall armyworm species, Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae), was first time reported in Pakistan during March 2019 causing severe damage to maize crop. As a new pest, there is little information available on its susceptibility to insecticides in Pakistan. We evaluated selective synthetic insecticides with different modes of action to control S. frugiperda larvae in the laboratory as well as under semi-field and field condition...

Nazia Suleman* and Asia Riaz 

...ty and egg laying of two species of ladybirds on alternate natural dietary sources other than natural dietary sources i.e., live aphids. The longevity of seven spotted ladybird Coccinella septempunctata was significantly higher on control (live aphids, Mean= 171.5 days) than other treatments including frozen aphids, frozen eggs of Angoumois grain moth and soaked raisins. Among all treatments, longevity was minimum on frozen aphids (Mean= 66.4 days) for seven s...

Shamsher Ali* and Naheed Baloch

... of two indigenous plant species i.e., colocynth, Citrulus colocynthis, and Akk, Calotropis gigantea by using different 03 and 06ml/L concentrations of each plant seed oil against the lesser grain borer, Rhyzopertha dominica, and Khapra beetle, Trogoderma granarium infesting wheat grains. Observations were made on mortality, weight loss, and insect damaged grain. The results show the maximum mortality 62.0% of R. dominica and 34.3% of T. granarium at a 6ml/L c...

Muhammad Ali Raza1*, Aneela Zameer Durrani2, Muhammad Muddassir Ali3, Tariq Usman4, Bilques Bano5, Nazia Rubab6, Syed Tasadak Mehdi7, Muhammad Wasim Iqbal8, Kumayl Hassan Akhtar9, Hira Hameed10

...ally infected with mixed species of gastrointestinal nematodes. The study design also included infected but un-medicated and uninfected and un-medicated controls.  Faecal egg count reduction and larval counts from coprocultures were carried out pre and post treatments to analyze the anthelmintic activity. There was significant difference among the various treatment (p< 0.05) and on various days (p<0.05). The highest decrease in the egg per gram was ...

Shu-Zhi Qin, Wen-Pei Ling, Mei-Fang Yin, Chun-Yu Luo and Cheng-Guo Zhao*

...rate and reactive oxygen species (ROS) content were measured by flow cytometry; the expression of Bcl-2, Caspase-3, p38 MAPK, ERK1/2 and JNK proteins were determined by WB technique. The results showed that, compared with control group, LDH, AST content, ROS level, apoptosis rate, Caspase-3, p38 MAPK, ERK1/2, JNK protein expression in H/R group were significantly increased, while cell survival rate and Bcl-2 protein expression were significantly decreased (P &...

Yu Song1*, Yueping Wei2 and Peng Wang3

...ad the largest number of species and strongest metabolic function potentials. Overall, the findings in this study provide valuable information for maintaining soil ecosystem balance and provide theoretical guidance for the practical application of this co-culture system.

...
Subudao Eerdun1, Hai Si1, Rui-Lin Tian1,2*, Hua Mei1, Caicike Badumu1 and Ridunhu Hu1
... for identifying the two species.

...
Muhammad Furqan1*, Zulfiqar Ali1, Muhammad Mudassar Shahzad2, Rida Ahmad1, Faraz Akrim3, Imad-ul-Din Zangi4
...itiative to conserve the species.

...
Riffat Sultana1*, Mohan Lal1, Samiullah Soomro1, Santosh Kumar2 and Ahmed Ali Samejo1
...ut into 07 genera and 11 species. Morphological and morphometry account of each species with illustration ecology and global distribution was given. Taxonomic keys have been generated at generic and species level.

...

Mubashar Hussain*, Habiba Razaq, Muhammad Faheem Malik, Kiran Aftab, Jaweria Riaz and Somia Liaqat

...ted which belonged to 18 species, 11 genera, nine tribes, and five subfamilies. Data were analyzed with Similarities Percentage (SIMPER) analysis and diversity indices were compared among those three croplands. We found that Pheropsophus lissoderus was the most abundant and dominant species in all three study sites whereas Brachinus bilineatus and Galerita lecontei were recorded only in tehsil Phalia, Pheropsophus verticalis...
Amany M. Reyad1*, Aya Maher Rabie1, Reda Mohamed Taha1 and Khalid El-Dougdoug2
... hours for all bacterial species. The results obtained showed a significant reduction in the bacterial count of E. coli, Staph. aureus, and K. pneumoniae, indicating that the cocktail phage therapy has a potential application for ...
Rabiea Pervaiz, Shaista Bano*, Sarfraz Ali Tunio, Abdul Nabi Jatt and Aisha Amber Soomro
...lign: justify;">Bacillus species provide a natural source for the discovery of novel antibacterial substances. However, some of the Bacillus species still remained to be explored widely for their antagonism against harmful bacteria. One of them is Bacillus pseudomycoides which produces rhizoidal colonies on solid medium. The present study was aimed to explore antibacterial properties of B. pseudomycoides isolated from the rh...

Khalid Ali Khan1,2,3* and Hamed A. Ghramh1,2,4

...he country. Three native species of honey bees including Apis dorsata, A. florea, and A. cerana whereas one exotic species A. mellifera are present in Pakistan. Honey produced in Pakistan enjoys good repute in the Middle East due to its unique taste and quality. Pakistan exports around 4,000 tons of honey with a worth of about $ 23.00 million to Arab countries every year. It is believed that the Pakistani beekeeping industry...
Suneela, Sajida Mushtaq*, Sadia Maalik, Asma Waheed Qureshi and Moazama Batool
... estimation of number of species that are present in that ecosystem. In an interrelated ecosystem, different species of insects perform different functions; act as pollinators, recycle nutrients, water and energy in many ways. In this kind of mutually dependent systems, the loss of even single species can affect the entire system very severely. Therefore, diversity estimation of insects he...

Wang Teng1,2,3,4, Li Chunhou1,2,3,4, Liu Yong1,2,3,4* and Zhu Ren5*

...hication, and non-native species have seriously threaten the biodiversity of fish in the Beibu Gulf. However, the information about fish fauna in this region is very poorly which limiting the conservation of fish biodiversity and sustainability of the fishery. In this study, we calculated taxonomic features of fish in the Beibu Gulf based on the sampling and observational field data obtained from the competent authorities. Our results indicate that 1519
Sudhan Chandran1*, GB Sreekanth2, Geetanjali Deshmukhe1 and  Ashok Kumar Jaiswar1
...nd b values for two fish species to establish length-weight relationships with respective coefficient of correlation and the 95% confidence intervals. A new maximum total length was recorded for two creek associated mangrove fishes, viz., Escualosa thoracata (10.1 cm) and Bregmaceros mcclellandi (10.5 cm).

...
Annum Razzaq1*, Zia Ullah2, Arooj Naseer1 and Abdul Nasir Khalid1
... decaying Russula species. Previously, no species of Asterophora has been described so far from Pakistan. Descriptions and illustrations are made using morpho-anatomical details. Moreover, molecular techniques have been used to amplify its ITS region of nrDNA and sequenced for phylogenetic analyses. This genus is a new record for Pakistan.
...

Rahmat Elahi1, Gulnaz Parveen1*, Nazara1, Faryal Ali2, Nain Tara3 and Saba Iqbal1

...total of eight different species of fungi were isolated from five different maize varieties. In the blotter test method, only spores and mycelium of seed-borne fungi were detected, that was further confirmed by the agar plate method revealed the presence of eight different types of fungal colonies in maize varieties, each with varying percentages. Like Trichoderma harzianum colonies accounted for 3.33% of the treated seeds and 13.33% of the untreated seeds. Si...

Daniel Offiong Etim1*, Idorenyin Asukwo Udo2, Rosemary Anietie Bassey1, Victoria Barrong Ogar1 and Etim John Umana1

...evaluate the efficacy of species of Trichoderma in combination with poultry manure in the control of Meloidogyne incognita infecting okra. Trichoderma viride at 2.65 x 107, 2.40 x 107, 1.85 x 107 spores/ml and T. harzianum at 2.40 x107, 1.40 x 107, 1.10 x 107 and 9.0 x 106 spores/ml were applied singly, in combination with poultry manure at 10, 15 and 20 t/ha. The obtained results showed highly susceptibility of okra to M. incognita with Gall index (G.I = 5.00...

Ghusoon Hasan Jadaan1*, Khalisa K. Khudair2 

...nyl(PC), reactive oxygen species (ROS), and gamma-glutamyl transferase concentration(GGT). The results indicated that 200 mg/kg of SiO2 - NPs orally for 4 weeks contributed to a substantial drop in serum TAC-O, an increase in MDA, GGT, PC, and ROS concentration, and attenuation of silica’s oxidative stress status, CP NPs (T3) or SiO2 NPs (T2) administered orally to female rats for four weeks constitutes a case of oxidative stress. The study revealed the ...
Omaima Khamiss
...mes from different virus species generally exhibit a considerable degree of structural diversity. However, some sequenced baculovirus genomes from closely related viruses are structurally very similar and share overall nucleotide sequence identities in excess of 95%. This work focuses on the comparative essential basis studies to better know complex interactions between baculoviruses infecting the pest in question (Spodoptera littoralis) in relation to ...

Ibrahim l , Madiha Salah and Ikuta 2, Kazuyoshi

...specimens from different species and organs of sick and dead birds collected during 2007 and 2009 in Egypt were tested using virus culture in embryonating chicken eggs and RT-PCR as references. Influenza rapid tests efficiently detected H5N1 in clinical samples derived from different organs including lung, liver and brain tissues with high sensitivity and specificity. The sensitivity and specificity were 71% and 100% for Sysmex avian influenza kit and 86% and ...

Raof*, Amal M. A.; Haleem*, Iman Y.; Aly*, Nawal M.; * *Garhy, M.M. and Hosny***, Gehan A.

...cting wide range of host species with variable severity and decreased productivity. Non-structural protein (NSP) 3ABC antibody is considered to be the most reliable indicator of present or past infection with foot-and-mouth disease virus (FMDV) in vaccinated animals. An indirect ELISA was established, for detection of the antibody response to FMDV NSP 3ABC using commercial ELISA kit (Prio-check) for l065 serum samples were collected (735) from Sharkia and (330...

Elbeshehy, E. K.F. and Sallaml, A.A.A.

...ect different host plant species including squash, pumpkin, pepper, bean, Chenopodium amaranticolor and cowpea showing foliar symptoms of mosaic, deformations and necrotic and chlorotic ring spots, that resemble those induced by CMV. SDS-PAGE test showed various distinguishable sole novel protein bands in four cucumber cultivars infected with CMV but not in healthy one. RT-PCR, with the primer CMV 1 and CMV2 for CMV-CP. gene, yielded 422 base pair DNA fragment...

El-Dougdoug2, Kh.A; Ghalyl, M.F. and Tahal , M.A.

...ucing• Streptomyces species were isolated from soil rhizosphere in Zagazig province of Egypt. In order to identi$r the Streptomyces strains, morphological, physiological, biochemical and antagonism testes were performed. The Egyptian isolates of Streptomyces were found to be a species ofcalvus, canarius, vinaceusdrappus, nogalater and viridosporus. The Streptomyces spp were grown in glycerol asparagine broth medium and ...

Ahmed, AmalA.; Zein, Salwa N. and Khatab, Eman A. H.

... to infect only 20 plant species and varieties from 22 tested by mechanical inoculation. The virus was transmitted in a non-persistent manner using Myzus persicae Sulz. Infected plants were reacted positively only with the specific antiserum for the CeMV using double antibodies sandwich—enzyme linked immunosorbent assay (DAS-ELISA). It was successfully purified from infected N. tabacum L. var. White Burley leaves and virus particles had filamentous flexu...

Ahmed, Amal A. and Fath-Allah, Mervat M.

... to infect only 20 plant species and varieties out of 24 tested plants by either grafting or mechanical inoculation, and PPV was able to infect only 19 plant species and varieties. CMV and PPV can be transmitted by Aphis gossypii and Myzus persicae from cucumber to cucumber and woody plants. The best time for leaf sampling was to detect the viruses, in diseased apricot tree by sap inoculation or ELISA, in April, followed by ...
Arafa, A ; El-Kanawaty, Z; Hassan, M.K; Anwar, H.K  and  Mona M.Aly 
 
...5Nl virus from different species of the zoo birds and also studies the immune states of the vaccinated birds after application of H5Nl vaccine for the first time one month after the introduction of early outbreaks of 2006. Viral diagnosis was based on direct detection of viral RNA by real time PCR. Two positive cases from turkey and Grocer duck were processed for viral isolation and characterization. The level of antibodies was detected in vaccinated birds by ...

Arafa, A.; Kanawaty, Z.; Abdclwhab. E. M.; Hassan, M.K.; and Aly M.M.

...results for all examined species. Molecular examination of swab samples by RRT-PCR revealed negative results for Avian Influenza H7. The current paper documents absence of Al-H7 in backyard birds around El-Abassa Lake in Egypt during the surveillance in October, 2007. Also this study highlights the need for continuous active surveillance of poultry especially in areas with high risk of exposure to migratory birds and wetlands and to monitor the presence of avi...

El-Tarabili M. M., El-Shahidy M. S., Rifaat M. M., Kania S. A. and Abdelwahab Shahira A.

... disease in these animal species.

...

Abeer, E.Mansour and Hegazi, A.Z.

...ls. Five animals of each species were vaccinated using a dose of I ml for sheep and goats and 2 ml for cattle, buffaloes and camels inoculated subcutaneously. It was found that both of the immune parameters were generally increased gradually to reach the highest value of cellular immunity by the 2e day, while that of neutralizing antibodies was reached by the  week to the 10th week post vaccination. It was noticed that vaccination of cattle and sheep resu...

Abou zead, A.A., Ali, A.A.H.*and Abd El Hkeem M.M.

...ds that housed with this species or near to this breeding. 
...

* Amal Abou El-Ela, A.

... to infect only 12 plant species and varieties from 19 by grafting or mechanical inoculation, it has a limited range of experimental hosts. The dilution end-point of infectivity was 10-3, the thermal inactivation point was 540C, and longevity in vitro was of 10-14 h at 250C. PNRSV was detected by double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA). Immunocapture-reverse transcription-polymerase chain reaction (IC-RT-PCR) was used to amplify ...

Manal A. El-Shazly1, A. s. 2 Abdel Wahab and Salwa N. Zein3

... by two different thrips species, Thrips tabaci L (33.3%) and Frankliniella occidentallis Pergamde (60.9%) whereas the transmission of IYSV was obtained by Thrips tabaci L. only (45%).  Adults of T. tabaci and F. occidentallis Pergamde as vectors of TSWV and IYSV were discussed. Franklinella tritici L. and Gynaikothrips ficorum Marchal did not play a role as vectors of these plant viruses. Both TSWV and IYSV had a wide host range the differences in host r...

Mohga M. El-Tahlawey, A. Mandour and AE Aboulata

...of seven different aphid species on faba bean was arranged descendingly as follow: Aphis craccivora (270.9). Myzus persicae. (89.0). A fabae (52.5). Acyrthosiphon pisum (24.3), A. gossypii (4.7). A sesbaniea (1.8). and A. nerii (0.7). Population fluctuation of previous aphid species was also recorded on Faba bean during the same period at the same fields. Fluctuations of Infection rate for both virus-infection types (necroti...

A. E. Aboul-Ata, Mohga, M. El-Tahlawey, M. A. Amer and A.M. Mandour

... by five different aphid species i.e. A. craccivora (93.84), A Fabae (89 09), A. Pisum (77 50). A sesbaniea (56.25). and A. gossypii (38.46). The virus transmissibility by aphid is higher parallel to number of insects allowed to acquire the virus. FBNYV is transmitted by Nymphal Stage more than adult Stage (78.7% and 34.3% respectively). FBNYV is being able to be acquired by A. craccivora insects after 4-day post-inoculation period. The virus is not being able...

A-New-Whitefly-Transmitted-Geminivirus

...Based on diagnostic host species and back inoculation assay two different types of symptoms were found. The first consists of identical Tomato yellow leaf curl virus (TYLCV) symptoms such as severe leaf chlorosis and distortion on tomato plants. named TYLCV-Giza isolate, and the other one showed yellow mosaic symptoms on tomatoes, named Tomato yellow mosaic virus (TYMV)-Qalyubia isolate. The genetic diversity at the molecular level for the two isolates showed ...

Musaad A. Al-Dubaib

...ies for different animal species. Agar gel immunodiffusion was carried out using commercial diagnostic reagents. All samples of herds having positive cases with immunodiffusion were tested by ELISA. Positive cases were recorded among samples of the Holstein cattle with both serological tests. Prevalence rates differed from one farm to another and with both serological tests. With agar gel immunodiffusion, the prevalence rate in 3 farms were 43.13%, 21.79% and ...

Zhengfei Wang1*, Chenchen Shen1,2, Yiping Zhang1, Dan Tang1,3, Yaqi Luo1, Yaotong Zhai1, Yayun Guan1, Yue Wang1 and Xinyu Wang1

...an important aquaculture species. Thus, we conducted the antennules transcriptome of Procambarus clarkii and identified 26 olfactory-related genes, including nine ionotropic receptors, two ionotropic glutamate receptors, ten variant ionotropic glutamate receptors, four cytochrome P450s, and one carboxylesterase. Our study suggested that ionotropic receptors were the main odorant receptors in Procambarus clarkii. Additionally, the key genes that are responsible...
Yongke Zhu1,2, Yun Fang1, Songhua Tang1, Yuan Gu3, Jinming Zhao4, Wolfgang Scherzinger5 and Yue-Hua Sun1*
... the knowledge of the subspecies of boreal owl (A. f. beickianus) in the coniferous forests at high mountainous altitude of the Qinghai-Tibet Plateau is still limited. We spent 10 years studying the breeding biology of A. f. beickianus in Lian Hua Shan Nature Reserve (Gansu Province), where we could first confirm the occurrence of this small forest dwelling owl in 1995. During breeding seasons (2003-2009, 2017-2019), we checked nest boxes and recorded the basi...

Sukhpreet Kaur Sidhu1*, Gurkirat Singh Sekhon1, Sachin Kumar1, Tejdeep Kaur Kler1 and Anureet Kaur Chandi2

...s the diversity of avian species of insectivorous feeding guild and their foraging activities at ponds surrounded by wheat and rice crop fields. Three ponds were selected and surveyed during April 2020 to March 2021 in village Mukrabpur, district Rupnagar (pond I), village Gopalpur, district Ludhiana (pond II) and in Punjab Agricultural University (PAU) campus (pond III), district Ludhiana. Out of 67 bird species recorded 44...

Kouengoua Kouengoua Armelle Prudence1*, Yessinou Roland2, Nankam Chimi Roland1, Fotsac Dzousse Muller1, Kouam Alain1, Djuikwo Felicite1, Facho Balaam1, Awah Ndukum Julius3, Farougou Souaibou2 

...wn that several wildlife species are involved in the maintenance and transmission of bTB. Recent studies on the status of bTB at the wildlife-cattle interface have gained relevance in recent years. Awareness on the status of bTB in the African wildlife is a paramount step for ensuring control, surveillance in cattle. This review systematically addresses data available on bovine tuberculosis in Africa’s wildlife. This article has given an overview of the ...

Vladimir Vasilievich Shimalov  

...larus), to establish the species composition of helminths and their infection of these animals under conditions of increased anthropogenic pressure on the channels associated with periodic mowing of their banks and slopes. Common shrews were caught with mousetraps lined up along drainage channel bank in mixed forests, on arable lands, pastures, and along roads in Brest, Zhabinka and Malorita districts of Brest region during 2015–2019. 4,000 trap-days wer...

Faisal Alsaaq

...ons. A total of 117 fish species belonging to 31 families were identified during the survey, with an overall abundance of 20,810 individuals observed. The fish assemblages in the area exhibited a balanced representation by all functional groups across different trophic levels, indicating a healthy state. Of particular interest were the families Chaetodontidae (butterfly fishes) and Serranidae (Groupers), known as reliable indicators of reef health and effectiv...

Taleeha Roheen1, Shagufta Kamal1*, Shazia Anwer Bukhari1, Ghulam Mustafa1 and Saima Rehman2

...he presence of different species of novel methanogenic archaea and sMMO-producing methanotrophic bacteria in rice paddy soil samples. The evolutionary analysis indicated a phylogram with five monophyletic groups (MPG-I to MPG-V). Results revealed that three isolated species (Sphingomonas sp. MG-1, Sphingomonas sp. MG-2 and Sphingomonas sp. MT-2) were in a close evolutionary relationship while the fourth isolated

Skeikh Mustafizur Rahman1*, Mst. Shirin Sharmin Khan1, Yousef Ahmed Alkhamis2,3, Roshmon Thomas Mathew2, Md. Moshiur Rahman1, Mohammed Monirul Islam4, Md. Asadujjaman5 and Md. Golam Sarower1

...n-commercial marine fish species namely Johnius argentatus, Harpodon nehereus, Cynoglossus lingua, Johnius elongatus, Sillaginopsis panijus, Pomadasys hasta, Setipinna phasa, Megalaspis cordyla, Rita rita, Gonialosa manmina and Scatophagus argus obtained from the Bay of Bengal. The samples were collected from raw fish (as a whole), different body parts (head, middle and tail) and processed fish (boiled and dried). This study further compared the nutrition valu...
Nael Abutaha, Fahd A. AL-Mekhlafi*, Khalid Elfaki Ibrahim, 
Mohammed S. Al-Khalifa and Mohamed A. Wadaan
...inst different genus and species of mosquitoes.

...

Elena Balarezo1*, Jose Luis Flores1 and Brendan Cullen2 

...d. Using current pasture species and livestock, it first was modelled the effects of climate change in 2050 and 2080 on pasture growth, feed consumption, and milk production. Afterward, it was modelled better adapted pastures (deeply rooted, or “DR” and heat-tolerant, or “HR”), as well as livestock (with higher feed conversion efficiency, or “FCE”). The growth patterns of pastures will be impacted by climate change as the sp...

Ahokpossi AGAC1,2*, Salifou CFA2, Youssao Abdou Karim I2, Ameyapoh Y3 

...eat quality vary between species and within species vary by breed. The objective of the study was to compare the carcass and meat quality characteristics of Goliath chickens recently developed by farmers with those of local chickens and exotic chickens commonly found in Benin. Thus, data on carcass characteristics, and sensory meat quality were collected on 120 chickens divided into four groups: (1 and 2), each composed of ...

Ram Prasad Ghimire

...e an abundance of browse species which are the major sources of roughage feeds for grazing goats. A study was conducted in order to determine the fodder quality of some common pasture browse species among them. The study included the analysis of fodders in the laboratory for nutrient composition, the feeding experiment determining fodder intake and weight gain monitoring in the goats, and a subsequent in-vivo experiment dete...

Nasir Shah1,4, Muhammad Ibrahim1*, Zarnosh Habib2, Kalsoom3 and Zahir Shah4

...ct of three native plant species (Azadirachta indica, Zataria multiflora, Achillea santolina) and their various concentration (2, 1, and 0.5%) were used for the purpose. Firstly, the artificial diet of fruit flies was subjected to these treatments, while on the other hand chikoo fruits which were used for flies to settle on, were dipped in same concentrations of these plant extracts, and dried under shade and exposed to peach fruit flies for feeding for 15 day...
Rahmat Ullah Khan*1, Karim Gabol1, Abbas Khan1, Asif Sadam2, Waheed Ali Panhwar3, Hamid Ullah5, Muhsin Ali4, Gul Bacha Khan4 and Habib Ul Hassan1
...pes. A total of 112 bird species belonging to 15 orders, 40 families, and 71 genera occurring in the study area. Among the three habitat types, the more diverse and abundant habitat of birds was Creek (51%) followed by scrubland (27%) and Bhambore fort (21%) with Shannon diversity index (3.701). The more diverse and abundant bird species were the winter visitors followed by resident species
Pratap A. Divekar1,2*, Sampat K Patel2, Guru Pirasanna Pandi G3, Manimurugan C2,4, Vikas Singh2 and Jagdish Singh1
...densities of each insect species, immature and adult of natural enemies, crop damage ratings and marketable yield in insecticide treated versus untreated control plots. Spinetoram 45 and 60 g a.i. per ha recorded significantly higher larval population reduction (>80%) with least crop damage ratings (˂ 2) for both the insect pest population. Spinosad, emamectin benzoate, indoxacarb and chlorantraniliprole were also the found best treatments in controlling D...

Muhammad Yasin1, Azhar Abbas Khan2*, Sana Rubab2 and Sumaira Maqsood3

...ose rate for both insect species, while highest was recorded at low dose of B. bassiana.

...
Yongtao Xu1, Dandan Wang1, Xiaolong Hu1, Minling Li1, Ming Tang1, Wuhua Liu2, Jianwen Zhan2 and Weiwei Zhang1*
...animal and is an endemic species in the East Asian monsoon region. Although the species as a whole is thriving, it is endangered and locally extinct in many areas of China, and the South China sika deer (Cervus nippon kopschi) is one of three subspecies left in China. Diet analysis is one of the core contents in studying animal habitat requirements, and a study of their diet could provide ...

Pankaj Gargotra1, Judith Betsy C1*, Cheryl Antony2 and Stephen Sampath Kumar J3

... recognized for only few species especially of ornamental importance. Lepidocephalichthys thermalis is an important food species of loach fetching high market price but there is limited data related to its nutritional requirements and reproductive biology. Therefore, a detailed study was carried out to analyze the effect of vitamin enriched diets on the captive maturation and breeding performance of L. thermalis. Vitamins A,...

Jiaojiao Wang, Wei Liu, Qingqian Lin and Jianhua Hou*

...gust, 2019. In total, 36 species belonging to 11 orders and 22 families of birds were recorded. Disturbances such as noise from aircraft flights affected the number of species and the individual density and diversity of birds. However, different areas were affected to different extents, and three areas on the same side were the most affected. Additionally, we found that the numbers of 14 bird species...

Phoebe Lyndia Tolentino Llantada1,2*, Midori Umekawa2, Shuichi Karita2

... PCR amplification using species-specific primer sets for 16S rDNA fragments to detect major fibrolytic and non-fibrolytic bacteria. Results from the PCR-DGGE analysis showed differences in bacterial diversity, density, and banding patterns along the gut of buffaloes. Higher bacterial diversity, density, and banding patterns were observed in the foregut and hindgut as compared with the midgut. PCR-DGGE fingerprints further revealed that samples from the foregu...

Alif Rahman Rohim Puarada*, Safika, Agustin Indrawati

...bacteria among wild bird species in remote habitats, suggesting the potential for these avian populations to serve as reservoirs and sources for emergent AMR profiles. Recognizing the critical role of wildlife in AMR dynamics this study focuses on birds of paradise, indigenous to Indonesia. Their gastrointestinal microbiome, intricately shaped by a unique ecological milieu, presents a compelling avenue for exploring AMR genes’ reservoir and dissemination...

Babi Kyi Soe1*, Toe Win Naing2, Su Lai Yee Mon1, Nay Chi Nway3, Hiroshi Sato4

... problem since different species of cattle, e.g. indigenous, crossbred dairy, and crossbred beef, are raised together on most farms. Anaplasma spp. are obligate intracellular rickettsial vector-borne pathogens that impact on livestock farmers with major economic constraints and eventually threaten human health in cases of zoonotic species involvement. Therefore, our study aimed to identify Anaplasma spp. infection in a bovin...

Kenyum Lollen1, Judith Betsy C1*, Cheryl Antony2 and Stephen Sampath Kumar J3

...pio is a widely cultured species and exploitation of natural stock due to increased demand in production can be averted by hormonal inducements which further affects the quality of gametes. Cryopreservation can aid in the conservation of gene pool and bestow superior quality sperm. Freezing and thawing rate are the most critical factor in the cryopreservation of milt. In the present study, variability between spermatological parameters of induced and non-induc...

Perinçek Seçkinozan Seker

...gence events within this species; the following results may be inferred: (1) roe deer individuals with the same genotype as those in Europe can also be found in areas further east, such as Turkey; (2) these could be considered to be representatives, which may have contributed to the formation and shaping processes of the known admixed genetic structure of European roe deer populations in Europe; and finally, (3) the roe deer populations may have probably enter...
Aatif Masood Ahmad Khan1, Masood Rabbani1*, Arfan Ahmad1, Muhammad Wasim2 and Sohail Raza1
...chemical identification, species-specific PCR tests and classical serotyping were performed. Two types of swab samples were used, one for direct PCR detection and other for the conventional diagnosis procedure. All isolates were identified as Avibacterium paragallinarum and required nicotinamide adenine dinucleotide phosphate (NAD) for their growth. The isolates were typical for Av. paragallinarum as they were not able to ferment neither galactose nor trehalos...

Kunlayaphat Wuthijaree1, Pattaraporn Tatsapong1, Sukanya Yung-Rahang2, Prayad Thirawong2, Koonphol Pongmanee2*

...entified, three nematode species (Ascaridia galli, Heterakis gallinarum, Capillaria spp.), and cestodes and trematodes were found. Overall, the total prevalence of helminth infection was 79.9% (183/229), of which most were nematodes (72.1%), with a mean (± standard deviation) burden of 7.41 ± 12.81 (ranging from 0 to 78) worms per chicken. The most common helminth species identified in the examined Thai indigen...

Kalsoom Abdulrazaq1*, Bisma Arif1, Rimsha Mehboob2, Asma Mehboob3 

...among a minimum of three species: an infectious agent and two host organisms, which can either be humans or animals. They can spread directly through contact with diseased animals, such as rabies, and through bites, or indirectly through exposure to contaminated surroundings and contaminated food. Vectors, such as mosquitoes or ticks, play a role in the transmission of diseases like West Nile fever and Lyme disease, respectively. Several factors impact disease...

Moazama Batool1*, Saima Naz2*, Sheeza Bano1, Sadia Nazir3, Ghulam Abbas4, Ahmad Manan Mustafa Chatha5, Maria Lateef2 and Fatima Yasmin2

...d on two freshwater fish species, Catla catla and Labeo rohita, employing probit analysis. Over a period of 90 days, mortality served as the primary toxicity criterion. The experiments were conducted under consistent conditions of pH (7), temperature (28.00.00°C), and water hardness (198.00 mgL-1), with three replicates for each dosage in the tests. Significant variations were noted in the LC50 values and lethal responses for both fish

Oybek A.Abduganiev1, Erkinjon B.Shakarboev2*

...he conducted studies, 35 species of helminths from 32 genera, 22 families, 13 orders, 4 classes and 3 phyla were identified in predatory fish from bodies of water in the middle course of the Syrdarya River. By their life cycle, 24 of the species recorded in predatory fish are biohelminths and 11 geohelminths. The helminths were recorded in predatory fish in the following proportions: Trematoda – 31.4%, Cestoda – ...

ARIFA ZEREEN & ALMAS JAHAN

...nvasive and exotic plant species. Besides this many exotic species have been planted as ornamental plants at the green belts. With the passage of time the exotic plant species also called Invasive Alien Species (IAS) is going to be a serious threat to local ecosystems. This research work was planned to determine the harmful and significant effects of exo...

Wesam Jasim Hansh 

...to identify the Fasciola species causing Fascioliosis in cows and buffaloes in Thi-Qar province, Iraq based on morphological measurements and sequences analysis of 28S rRNA gene. Fasciola flukes were isolated from the livers of cows and buffaloes slaughtered in the municipality of AL-Nassiriyah abattoir during July to November 2022. Sixty Fasciola flukes including (30 from cows and 30 from buffaloes) were used in morphological study. Genomic DNA was extracted ...

NUSRAT MAJEED* & ABIDA BUTT

...h belong to twenty-eight species and twenty-one genera. This study added twenty-three first records of species from ten genera. The female of Phintella indica is in this study for the first time.

...

ATEEQUE RAHMAN KHOOHARO* & PIRZADA JAMALUDDIN A. SIDDIQUI

...o establish abundance of species. Overall, 49 species of invertebrates were recorded. Two of these species were annelids, 35 molluscs (Polyplacophora 1, gastropods 30, bivalves 4), 9 arthropods (cirripediae 2, malacostraca 7) & 3 echinoderms (stelleroids 3). The Highest diversity was found during the mid & high tidal zones. Diversity & distribution configurations were found to ...

MUSHTAQ HUSSAIN LASHARI1*, RABIA HAMEED1, UMER FAROOQ2, MUSADIQ IDRIS2 & ZIA UR REHMAN2

...ales and females of both species was analyzed through independent T-test. The mean ± SE values for Barr bodies was significantly higher (P ≤ 0.05) in human females (7.7 ± 0.63) as compared to their male counterparts (2.2 ± 0.38). However, statistically non-significant (P ≥ 0.05) result was noticed between female and male dogs being 1.8 ± 0.32 and 0.8 ± 0.24, respectively. In a nutshell, it is concluded that both the fem...

ZEESHAN REHMAN1, RANA ABRAR HUSSAIN1, SHAISTA JABEEN2, SAKHAWAT ALI2, ZAHAR NOREEN1 & IRUM MUKHTAR1*

...a oleracea. Var. Botyris species in Lahore (LHR), Narowal and Kasur districts of Punjab, Pakistan. The average concentration of elemental Zn in sewage-irrigated samples was the highest (153.4233mg kg−1), followed by Cd2+ (70.47333 mg kg−1) and Pb (65.79667mg kg−1). Results showed higher Pb2+ and Cd2+ level in B. oleracea than daily intake of metals (DIM) standard limits, cultivated on wastewater. Whereas health risk index (HRI) was found maxi...

ASADULLAH KHAN1, MUHAMMAD AYAZ KHAN1, ALIA NAZ1, ABDULLAH KHAN1 & NAUREEN AURANGZEB1

.... Dermatocarpon miniatum species samples were collected from control site, primary, secondary and tertiary roads and were investigated for Pb and Cd concentrations and reduction in chlorophyll contents. The data were analyzed using ANOVA, correlation and regression analysis. Significant (P<0.05) variation in Pb and Cd concentrations in lichens along different roads were found. It was concluded that traffic density was responsible for Pb and Cd accumulation ...

*ARIFA ZEREEN1, ALMAS JAHAN1,SHEIKH SAEED AHMAD2 & ZAHEER-UD-DIN KHAN3

... i.e., Two Way indicator species analysis (TWINSPAN) and Canonical Correspondence Analysis (CCA) were used. Vegetation data obtained from forty quadrats was compiled. Thirty eight plant species belonging to twenty one families were recorded. TWINSPAN bifurcated the flora of entire study zone into two main communities that had been again separated into smaller i.e., sub communities. Canonical correspondence analysis recognize...

FOZIA HUMAYUN1, ZARRIEN AYUB2, MUHAMMAD SAMEE HAIDER3 & SYED ABID ALI1*

...e predominant Siphonaria species (S. asghar, S. belcheri and S. kurracheensis) via PCR based amplification of the two mitochondrial housekeeping genes i.e. 16S rDNA, COI, and one nuclear H3 gene. The nutritional significance of the Siphonaria sp. is also highlighted via amino acid profiling. Sampling was conducted at Buleji, the major coastal site of Karachi which harbours a huge and varied number of gastropods. The body muscle was dissected out of the shell a...

MUSHTAQ HUSSAIN LASHARI1*, UMER FAROOQ2, AMMARA ARSHAD1, MUHAMMAD NAEEM TAHIR2, MUSADIQ IDRIS2, ANAM KHURSHID3 & ZIA UR REHMAN2

...ales and females of both species was analyzed through independent T-test. The mean ±SE values for Barr Bodies were significantly higher (P≤0.05) in female cattle (9.61±1.11) as compared to their male counterparts (0.92±0.28). Similar results were revealed for buffaloes being 6.23±1.15 and 0.92±0.28 for females and males, respectively. In a nutshell, it is concluded that female cattle and buffaloes have a higher occurrence ...

Uqba Mehmood

...lly produced by Bacillus species during sporulation and germination. The hydrolysis of spore proteins to free amino acids, is accomplished by proteases, in first 20 minutes of spore germination. The analysis of Spo mutants (strains which lack Sporulation (Spo) gene or have its inactive form) revealed that many of these strains did not produce extracellular proteases. Some evidence for the involvement of serine proteases in sporulation has been provided by inhi...

MARIAM AHMED, YESRA ARSHAD & HAMID MUKHTAR*

...e identified as Bacillus species on their morphological and biochemical basis. Crude enzyme revealed that Bacillus sp. IIB-B5 produced maximum keratinase (28.13 U/mL) at pH 7.0, at 40oC after 72 h incubation. While Bacillus sp. IIB-B9 showed maximum enzyme production (26.59 U/mL) at pH 8.0, after an incubation period of 96 h at 50oC. This study showed that these isolates have the potential to be used in keratin hydrolysis.

...

*AMNA SHOAIB, AROOJ SHEZAD, ARSHAD JAVAID, SUNDUS AKHTAR & ZOIA ARSHAD AWAN

...nus sativus L. and three species of Trichoderma (T. harzianum, T. viride and T. hamatum) were evaluated for their antifungal effect against Sclerotium rolfsii, the causal agent of collar rot disease in chickpea. In vitro, methanolic leaves extract of R. sativus significantly decreased pathogen biomass by 6-96% and three Trichoderma species also caused significant inhibition in pathogen growth variably between 30-100%. In pot...

Inayat ul Islam1, Rooh Ullah1, Ahmed Zia2, Abdul Rauf Bhatti2*, Maryum Ilyas2, Sohail Hayat1 and Khabab Hayat1

...ven genera and seventeen species and added new geographic range to Odonata fauna of the country. Among recorded fauna, family Libellulidae appeared to be the dominant group, representing 14 species, followed by family Aeshnidae, Calopterygidae and Coenagrionidae representing single species each. Being a flying insect group, seasonal surveys and temporal data for Odonata in this ecologicall...

Anisa Mushtaq1, Murtaz ul Hasan1*, Asim Shamim2, Muhammad Ali Abdullah Shah1, Muhmamad Arif Zafar3, Abdul Asim Farooq4, Aayesha Riaz1, Muhammad Kamran1 and Saif ur Rehman

...of Babesia and Theileria species was also investigated in ticks using 18S rRNA gene. Identification of ticks collected from 384 cattle and 384 buffaloes screened revealed three tick genera and six tick species: Rhipicephalus microplus, Rhipicephalus decoloratus, Rhipicephalus annulatus, Hyalomma anatolicum anatolicum, Hyalomma anatolicum excavatum and Haemaphysalis punctata. Of those four species

Teedzai Chitura*

...at attributes of poultry species fed diets supplemented with probiotics. The search process was conducted with the use of electronic databases such as Science Direct, Google scholar, JURN, Directory of Open Access Journals, and Research gate. The keywords were “antibiotics’, “growth performance”, “meat quality”, “poultry”, and “probiotics”.The objective of this review study was to provide a comprehens...

Naveed Ahmed* and Amjad Usman

...nce was conducted. Eight species were recorded, two species (Megachile albifrons, Smith 1853, Megachile pseudodisjuncta, Kumari 2018) are new record to Pakistan, whereas all the eight species are new record to Khyber Pakhtunkhwa Province. Brief description together with illustrations and distributional range of each of these Megachile species is also pro...

Mubashar Hussain*, Takhmina Nazir and Muhammad Faheem Malik

...rded that belonged to 13 species representing six genera, three tribes and three subfamilies. The results showed that maximum number of species belong to genus Epilachna (five species) and Coccinella (four species) which make them most diverse genera. Coccinella septempunctata (16.40%) was the most dominant species fol...
Kalaiselvi Natarajan1, Karal Marx Karuppiah1, Sheena K Baby1, Sakthivel Mohammed2, Shanmugam Seerappalli Aran1 and Suresh Eswaran1*
...valuable ornamental fish species, which has numerous strains. Even though culture of Koi carp is practiced at many tropical countries, there is a very little information on the seed production and embryonic development of the species especially in RAS. The present study was aimed to study the breeding, embryonic and larval development of Koi carp in RAS system. The matured brooders were administered with three synthetic horm...

Muhammad Wasif Gulzar*, Riffat Maqsood, Muhammad Zain, Muhammad Suleman, Tayyab Ur Rehman, Sana Asif, Abdul Wadood and Jawad Hussain

...affects all warm-blooded species and is widespread worldwide, except for islands like Australia and Antarctica. Rabies causes more than 60,000 deaths annually, although every year about 15 million people receive Rabies Post-Exposure Prophylaxis (PEP). Wildlife including raccoons, skunks, bats, and foxes are major rabies reservoirs. The disease is primarily spread by the bite of a rabid animal and the saliva of an infected host. The incubation period (average 2...

Iqtidar Hussain1*, Muhammad Inam Ullah Qaisrani1, Abdul Aziz Khakwani1, Zuhair Hasnian2, Umar Khitab Saddozai1, Muhammad Naeem4, Hadia Gul5 and Moneeza Abbass3

...rees and many other weed species. Growth promoting effects of parthenium extracts at low concentrations have also been reported in certain crops. A laboratory experiment was carried out to evaluate the germination and germination indices of maize with estimation of maize growth infested with parthenium allelopathy. This trial was conducted Completely Randomized Design with 3 replications. Parthenium dry powder (5, 10, 15, and 20 %) mixed with soil produced var...

Abeer Alahmari1,2*

...avenging reactive oxygen species (ROS) and relieving oxidative stress as a result of its rich chemical content of furano-sesquiterpenes, which possess powerful antioxidant activities.

...

Yousef Abdal Jalil Fadladdin1, Ateeq Ullah2*, Raheela Nawaz3, Yagoob Garedaghi4, Abbas M.A. Al-Azab5 and Mashael Abdullah Aldamigh6

...nd to be infected with 2 species of soil transmitted helminths including 27% (n=54) A. lumbricoides and 35.5% (n=71) A. duodenale. Regarding ages, 11-12 years were highly infected. Females were observed to be infected more than male students. Children of unemployed mother and father were more infected than employed parents. Children living in cemented house were more infected than non-cemented. Children defecating in latrine were highly infected than children ...

Xin Niu1, Xuelan Fang2, Sang Ba3, Yihao Fang1,4, Davide Fornacca1,7, Kun Tan1,4, Yanpeng Li1,4,5*, Zhipang Huang1,4,5* and Wen Xiao1,4,5,6,7

...n among sympatric animal species is a primary mechanism maintaining a long-term and stable coexistence. Information on the pattern of coexistence among sympatric species is vital to provide specific conservation measures and management. This study focuses on the spatial-temporal niche differentiation strategy adopted by black-and-white snub-nosed monkeys (Rhinopithecus bieti) and rhesus macaques (Macaca mulatta) to support t...

Mirwaise Khan1, Rubab Maqsood1, Hamad Bin Rashid2, Shakera Sadiq Gill1, Muhammad Noman1, Rafia Akram1, Muhammad Sajid Hasni1, Haroon Rashid3 and Mamoona Chaudhry1*

... poultry and other avian species there. Further studies are needed to identify the circulating virus genotypes, associated risk factors and required control measures.

...
Qun Lu1,4, Yang Zhou1, Hangyu Lin1,4, Zhong tang He1, Feifan Ma1, Yonghua Zheng1,2, Hongyu Tang1,2 and Tao He1,2,3*
... used to distinguish two species of fish belonging to different genera of the same family. This research could also provide data reference for the study of the migration route between Sc. grahami and Sp. sinensis.

...

Zhenkun Zhao1,2, Ziniu Alimo2, Xinyue Zhao2, Haifen Qin1, Buddhi Dayananda3, Lichun Jiang1,2* and Wei Chen4*

...rvative in Passeriformes species. The monophyly of Passeriformes is divided into four major clades: Musicicapoidea, Sylvioidea, Passeroidea, and Corvoidea. The phylogeny analyses of Passerida was conducted with the clear support of dividing the group into three superfamilies: the Muscicapoidea, the Sylvioidea, and the Passeroidea, and Passeroidea is a sister taxon for Muscicapoidea and Sylvioidea, which are closely related to each other. We suggest that the ge...

Iqra Munir*, Farrah Iftikhar, Hira Fatima, Sunbal Khalil Chaudhari and Roha Ramash

...ation of different plant species. Plant specimens underwent pressing, drying, and mounting onto herbarium sheets. The identification process was conducted for all gathered samples. In this research study, documentation was carried out for 50 plant species distributed across 27 families. These species arranged with scientific names, common names, family names, plant part used and ethnopharm...

Shahzad Aslam1*, Amjad Rashid Kayani2, Muhammad Irfan Ashraf3, Muhammad Azhar Jameel2 and Kiran Sahar4

...ence of 29 dietary plant species as compared to 30 plant species observed in the field. No animal derived food component was noticed in the diet. The results revealed that food composition consisted of 83% plants diet, 14% provisioned food items and 03% scavenging on garbage bins. To study food resource preference, the monkeys were classified into five age/sex classes: Adult males, adult females, sub adults, juveniles and in...
Abdel Satar Arafa
...ong birds varies by host species and virus strain. The respiratory and contact transmission are likely the primary routes of transmission and may partly arise initially as an adaptation to poultry which clearly has implication for zoonotic transmission. Inactivated vaccines are the most common vaccines used to control H9N2 viruses, however they have a wide antigenic variability in different lineages.
...
Julio Adolfo Corzo-Bacallao1*, Carlos Alfredo Salas-Macías1, Osvaldo Fonseca-Rodríguez2,3, Felipe R. Garcés-Fiallos1, Erika Isabel Alcívar-Muñoz1 and Henry Fabricio Baque-Loor1 
 
..., interspersed with tree species typical of the dry forest. The system involves manual weed control, without fertilization, irrigation, phytosanitary control, or shade regulation. In this scenario, and during an experimental period of 90 days (03/08/2022 - 26/10/2022), phenological variables of coffee trees maintained in a study area of 50 x 50 m at a high (S1: 51-70%) and low (S3: 1-30%) shade level was compared with those obtained at an intermediate shade le...
Yanis Cruz-Quintana1*, Ana María Santana-Piñeros1, Byron Manuel Reyes-Mero1, Leonela Griselda Muñoz-Chumo1 and Lenin Cáceres-Farías1,2 
... traditional aquaculture species such as Piaractus brachypomus has been little studied. The objective of the present investigation was to establish the presence of Trichodina heterodentata, its parameters of infection, and associated damages in three aquaculture farms of P. brachypomus located in Puyo, El Coca and in Joya de los Sachas, Ecuadorian Amazon. In each farm, 15 fish were collected randomly. The size and weight of fishes were rec...

Asmit Subba1*, Jash Hang Limbu2 and Laxman Khanal1*

... fin. In Nepal, only one species of Heteropnuestes, i.e., H. fossilis has been reported. Based on the morphometric and meristic characteristics, this study reports the first-ever record of another species (H. nani) under the genus from eight locations in Jhapa District, eastern lowland Nepal, along with H. fossilis records. The two species distinctly differ, with H. nani conspicuously smal...

Bilal Atta1*, Arshed Makhdoom Sabir1, Muhammad Dildar Gogi2, Muhammad Asif Farooq3, Muhammad Ijaz1, Tahir Hussain Awan1, Muhammad Ahsin Ayub4, Muhammad Usman Saleem1, Amara Nasiba1

...t pests, focusing on six species: Scirpophaga innotata, Sesamia inferens, Scirpophaga incertulas, Cnaphalocrocis medinalis, Sogatella furcifera and Nilaparvata lugens. Population data spanning four years (2019-2022) were collected through the use of light traps revealed distinct peak populations for each species at different times. Scirpophaga innotata exhibited a consistent peak population in September, with a significant i...

Naveed Akhtar, Hafiz Muhammad Tahir*, Azizullah, Aamir Ali

...vers of assemblages, and species richness, lack comprehensive understanding and remain poorly documented. We studied biodiversity, species richness, and seasonal dynamics of coccinellids in two major maize-growing districts of the Punjab province, i.e., Kasur and Lahore, in 2018-2019. The coccinellids were collected from February to June during both cropping seasons. Visual counting, handpicking, sweep nets, sticky traps, an...
Sanaullah Sattar1, Ali Hussain1,2*, Javed Iqbal Qazi2, Arshad Javid1 and Shahid Mehmood1
...onditions. The bacterial species for the experimental trials was isolated from buried corroded metallic installment and found motile, Gram-negative, non-spore former and identified by 16S rRNA gene sequencing as Desulfovibrio desulfuricans. The corrosive impact of SRB on steel coupons was performed in water as liquid medium and the processed clay as the solid medium without and with the provision of Postgate B medium. After 60 days of anaerobic incubation, cor...

Arif Mehmood1*, Muhammad Naeem2, Abu Bakkar Muhammad Raza1, Muhammad Zeeshan Majeed1, Muhammad Irfan Ullah1, Muhammad Asam Riaz1, Ikram ul Haq1 and Waqas Raza1

...ts of different mosquito species. In this study, a total of 580 specimens, comprising twelve mosquito species belonging to five genera were collected, which were deposited in the Biosystematics Laboratory of Pir Mehr Ali Shah, Arid Agriculture University Rawalpindi. Results show that Park, Forest area, and scrapyard were the most abundant habitats respectively, while the least abundant habitat was crop area. Parks were found...

Apurbo Kumar Mondal1, Md. Rabiul Auwul2, Md. Momotaj Hossen3, Md. Sodrul Islam1*, Narayan Paudyal4, Md. Shahidul Islam1 and Kazi Khalid Ibne Khalil1

...s was also performed for species, age, sex, study duration, and sample size for the assessment of the potential risk factors. The prevalence rate was found highest in sheep at 42.91%, female individuals at 32.32%, 500 or below sample size at 43.63%, in the period of 2000–2010 at 42.05% and aged animals at 41.23% non-significantly. This is the meta-analysis of PPR worldwide that offers a comprehensive picture of the prevalence of PPR in small ruminants wi...
Muhammad Usman1, Ghulam Murtaza2, Allah Ditta3, Tamana Bakht3 Muhammad Asif4,
Muhammad Nadir1and Sehar Nawaz5
...ribution pattern of weed species in wheat crop during 2016-
18 in district Khanewal, Punjab Pakistan. Thirty-six weed species distributed among fifteen
different families were collected from the study area. Family Poaceae was the predominant
with 10 species, while family Asteraceae was the second most dominant family with four
weed

Ali Hazrat1*, Qasir Ali2, Mohammad Nisar1, Khan Sher2, Tour Jan1 and Abid Ullah1

...occurrence of bryophytes species in the study
area. It is the first attempt to document the bryophytes species in the selected area. A
total of 27 moss species (20 genera, 14 families), 16 liverwort species comprising 13
genera and 8 families were recorded. Whereas, hornworts were represented by only two

Kamran Ishaq1, Amir Sultan2*,Nazar Khan3 and Rahim Shah4

...and central Mexico. This species has been observed in various localities in Zhob district of northern part of Baluchistan Province of Pakistan. These observations represent first record of this species from Baluchistan or Pakistan. Its description and illustrations are provided for easy identification.

...

Ali Hazrat1

...s to explore the type of species of the Rosaceae family in the target area. In total, 30 species were collected belonging to 15 genera from different localities of the selected area, in which the highest number of seven plant species belonged to genus Prunus, five to genus Rosa, three to genus Potentilla, two to each genus Cotoneaster, Rubus and Pyrus and one to each genus Crataegus, Eriob...

Adil Hussain1*, Muhammad Qasim Hayat22 and Syed Ali Imran Bokhari1

...amotte (Asteraceae) is a species of Artemisia described from Europe but native to East Asia. It is an alien and/or invasive species that has become naturalized in many European regions, Australia, South America, New Zealand, North and South Africa and Western Asia.In continuation of our work on Northeastern Pakistani Artemisia, we report the first local occurrence of Artemisia verlotorum Lamotte from Gilgit-Baltistan region ...

Farrukh Hussain1, Sajid Aziz1, Gul Hassan2, Khalid Aziz1 and Sapna Raisham1

...e study revealed 56 weed species distributed among 42 genera and 23 families in the area. Dryopteris fragrans was the only pterodophyte. There were 2 families, 6 genera and 9 species of monocots. Dicots had 35 genera, 46 species and 20 families. Based on the floristic and FIV data Poaceae, Asteraceae, Brassicaceae, Cyperaceae, Papilionaceae, Euphorbiaceae and Lamiaceae emerged as the impor...

Felix O. Takim*1, Gideon Z. Nayan2, Oluwafemi O. Osatuyi1and Israel O. Olayiwola1

...ts revealed that, 7 weed species were the most prevalent and there was inconsistent effect of planting date on weed flushes while weed smothering efficiency of intercropping was between 31 to 49 % and 48 to 73% for weed density and weed biomass, respectively. Intercropping resulted in land equivalent ratios (LER) of 1.29 to 1.74 while the competitive ability of maize was increased with an increase in sweet potato density. Planting in the month of June had sign...

Syed Awais Hussain Shah1*and Rizwan Ali2 2

...od, we reported 59 plant species which belongs 54 genera and29 families, among the reported families Lamiaceae and Fabaceae were dominant families having six species each, followed by Asteraceae with five species. These plants are utilized by habitants from centuries as Ethnomedicine against various diseases like cough, cold, malaria, fever, stomach disorders, mouth and throat sour etc. Th...

Arshad Javaid, Amna Ali, Iqra Haider Khan and Amna Shoaib

...thogen of over 500 plant species, causes collar rot
disease in chickpea plant and reduces its survival rate, growth and yield. This study was
undertaken to assess the benefits of soil amendment with a weed Chenopodium album L.,
on growth, yield and physiology of chickpea var. Bakhar-2011, against S. rolfsii. For this
purpose, soil was sterilized by fumigation with formaline and then inoculum of S. rolfsii was

Hussain Shah1, Hamida Bibi2, Ali Hazrat1and Khan Sher3

...nkhwa Pakistan. 76 plant species belong to 47 families of
herbs, shrubs, mushrooms, trees and vegetables were recorded for their medicinal use.
These include 74 plants (96%) of angiosperms, 1 (1%) of gymnosperms, 2 (2%) of fungi
and 1 (1%) of Pteridophytes. Asteraceae was a dominant family having 5 species follows by
Brassicaceae and Moraceae each one is represented by 4
Tabassum yaseen1*, Muzamil shah1, Khushnood Ur Rehman2 Ali Mujtaba Shah3, Gul
Nawaz1,Rani Gul4
...tative stage. The Glomus species is dominant in the rhizospheric
soil of weeds plants followed by Aculospora, and Sclerocystis. The lowest Glomus spore
density is present in Fumaria parviflora (10.67±15.89). The spore density of AMF had a
strong positive correlation with soil pH and a negative correlation with the Phosphors
content of the soil. The highest vesicles are investigated Euphorbia heliscopia (14...
Fawad Khan1, Zahir Muhammad1, Khushdil Khan2 , Shabir Ahmad2, Muhammad Jamil Khan3, Tamana Bakht4 And Asif Kamal2
...rgenic and invasive weed species belonging to 12 different
families collected from different areas of study. Among the studied plants, most of the
species belong to the Asteraceae family. For morphological studies of pollen through light
microscope (LM) and scanning electron microscope (SEM), the samples were prepared via
acetalization process. We done the fieldwork for the col...

Shabana Mangi1, Waheed Ali Panhwar1, Abdul Manan Shaikh1, G. Sarwar Solangi2, Khalid Hussain Rind3, Nazir Ahmed Abro4, Zaibun-nisa Memon1, Gul Hafeeza Lund1 and Paras Somroo1

...ing 2018-19. The instant species causes significant damage to crops, feeding on different weeds including; Gnaphalium, Convolvulus arvensis, Amaranthus and Cortaderia sellona, while the crops include; maize, potatoes, tomatoes, sugar cane. Its larva is known as wireworm that is yellowish to brown in color. The members of this genus badly affect the economy of the growers in the affected areas. Aptopus opata is a differ from the closely related

Haroon Khan1*, M. Mubassir Khan1, Bakhitar Gul1, M. Fawad1 and Imtiaz Khan1

...ons. A total of 39 weeds species from 16 families (14 dicots and 2 monocots) and 36 genera were identified. The major monocot family Poaceae contributed 10 species while among dicots, Asteraceae took the lead with 6 species. Among the weed species, 27 were annual and the rest 12 were perennial. Annuals were reported from all three sites, while perennials...

Maqsood Anwar1, Naveed Akhtar1*, Shah Khalid1 and Hassan Zeb2

...2018. A total of 28 weed species distributed in 15 families and 27 genera were reported from the selected maize fields of the study area. Out of 15 families, twevel (12) were dicots having (17 genera and 18 species) and three (3) were monocots having (10 genera and 10 species). Poaceae was dominant family with eight (8 species). Amaranthaceae has five (5...
Barkatullah1, Sumayya Noreen1.Khushnood Ur Rehman1, Zahid Ali Butt2, Tabassum
Yaseen3, Kamran Akbar3, and Salma Noreen3
...f three
test species was retarded. It was determined that the allelopathic effect of extracts is
directly related to the duration of soaking i.e. 48 h extracts were more effective than 24 h.
among all parts the highest activity was shown by leaves followed by fruit, bark, Rainwater,
and then mulching. From the above experiment, it is strongly suggested that the tested
portions of Z. mauritania have si...
Naeema Khatoon Khaskheli1 , Muzafar Hussain Sirohi11, 2,*, Ameer Ahmed
Mirbahar1, Abdul Razak Mahar1, Mumtaz Ali Saand1, Mirza Hussain3
... (60 quadrats/site). The species were identified and herbarium
samples were preserved in Herbarium, Shah Abdul Latif University, Khairpur, Sindh
Pakistan, for future reference. The species community composition, habit, and life span
were determined. The study confirmed 35 weed species belonging to 14 plant families. The
weed community was dom...
Kamran Ahmed Pathan1 , Waheed Ali Panhwar1,*, Abdul Manan Shaikh1, Safdar Ali
Ujan1, Javed Ahmed Ujan1, Khadim Hussain Memon1, Irfan Ahmed Pathan1 and
Shabana Mangi1
... was identified to seven species and six
genera. The species Batocera rubus (Linnaeus, 1758), Batocera rufomaculata (De Geer,
1775), Apriona cinerea (Chevrolat, 1852), Prionus corpulantus (Bates, 1878) and
Macrotoma crenata (Fabricius, 1801), were recorded as new record from Sindh Province.
While Archopalus exoticus (Sharp, 1905), Dorysthenes hugelii (Redtenbacher, 1848) were

Gulshan Riaz1, Zaheer-ud-din Khan1, Muhammad Umer Farooq Awan1, Andleeb Anwar Sardar1, Muhammad Tayyab1, Sarah Maryam Malik and Sohaib Muhammad1

...jab. Forty one (41) weed species were collected from the study area belonging to twenty one (21) different families. Twenty four weed species found in chickpea, twenty five in mustard and twenty nine in wheat crop fields. Sixteen weed species were common in three crops. Family Poaceae and Astraceae had maximum weed species i.e. 7 and 6

Khushdil Khan1, Mushtaq Ahmad1, Muhammad Zafar1, Khafsa Malik2, Shazia Sultana1, Shabir Ahmad1, Fawad Khan3, Asif kamal1, Kalim Ullah3

...ographical origin of bee species and adulterations found in honey.

...

Muhammad Nasir Mazhar1, Muhammad Arif*, Naeem Akhtar1 and Muhammad Shafiq1 and Muhammad Yousaf1

... resistance in some weed species against the herbicides. Therefore, a field experiment was planned to assess the effect of multi-approached weed suppression in wheat at Reclamation Research Station, 7/3-L Ahmad Pur Sial District Jhang during winter 2019-20. Experimental treatment was comprised of two wheat cultivars i.e. Ujala 2016 and Faisalabad 2008 and seven weeds control approaches i.e. hand weeding, organic mulching, eucalyptus extract, neem extract, clod...

Abdullah1, Syed Mukarram Shah2, Adnan Ali Shah1, Murad Muhammad1, Muhammad Abdussalam1, Khushnood Ur Rehman3 and Haroon Khan4*

... 2020. Overall, 95 plant species associated with 31 families have been recorded. Among them Poaceae (22 species), Asteraceae (10 species) followed by Amaranthaceae and Papilionaceae (6 species each), Brassicaceae and Polygonaceae (5 species each), Euphorbiaceae and Solanaceae (4 species<...
Reshma Sahito1, Nasreen Memon1, Aiman Amur1, Seema Memon1
Shabana Mangi2
... Sindh during 2015. This species causes remarkable damage to crop and maximum number of specimens were collected from Peas (37) and rice (31) crops while least number on weeds (16), and dwell in weeds near crops, redescriptions of the genus and species are provided, small-sized stink bugs belonging to order Heteroptera (Tribe Carpocorini). The Carpocoris Pudicus causes a remarkable loss to different crops and weed leaves and...
Hasina Baloch1, Rahmatullah Rind2, Dildar Hussain Kalhoro1*, Shahid Hussain Abro1, Hubdar Ali Kolachi3, Saqib Kakar1, Muhammad Ibrahim3, Fayaz Ahned1, Hasnain Ali1 and Muhammad Mahesar1
...s logged as the dominant species caused intensive gel formation in subclinical mastitis. However, 840 quarters were found with infection at diverse degree. Only 102 Most severe (4+) samples noted strong gel as with mean somatic cell count (SCC) of 8,1x105 while 60 more severe (3+) samples showed distinct gel with mean SCC of 2,7x105. Among the 102 strong positive samples, 57 (17.27%) contained pathogens. The correlation between SCCml-1 and colony forming unit ...

Wali Muhammad Mangrio1*, Faheem Ahmed Jatoi1, Hakim Ali Sahito1, Fahmeeda Imdad Sahito2, Bhugro Mal3 and Naseem Qureshi4

...otential key insect pest species, extremely harming fruit of Phoenix dactylifera L, inducing tremendous date fruit yield and economic lossess. The research study was carried out to evaluate the efficacy of bio-rational insecticides against Batrachedra amydraula (Meyrick) at Taluka Kingri, District Khairpur under field conditions during, 2020-21. The four different bio-rational insecticides viz., (T1) = Azadirachta indica oil, (T2) = Azadirachta indica leaves e...

Mthi S. 1,2, Ikusika O.O.1*, Washaya S.3, Mpendulo C.T.1, Nowers C.B.2 

...roundworms were the only species found in the collected faecal samples. Significant differences were observed in roundworms (P<0.05) among treatment groups, but DME did not affect coccidia parasites. Overall, diatomaceous earth improved growth performance and reduced parasitic infestation up to a 5% inclusion level. 

...

Tebogo Letsukulo Percy Thepa, Thobela Louis Tyasi*

...a multitude of livestock species. The aim of the study was to conduct a comprehensive literature evaluation of the association between ovine growth traits and the SNPs of the MSTN gene. Four databases (PubMed, Web of Science, ScienceDirect and Google Scholar) were systematically evaluated using the keywords sheep, MSTN, polymorphism, genetic variation, growth traits, gene polymorphism, skeletal muscle growth, GDF-8, without any year of publication restrictions...

Khalid Hussain*, Tanvir Hussain, Zahid Rauf and Nowsherwan Zarif

...row) one of the dominant species in the moist temperate forest of Ayubia National Park (ANP), Khyber Pakhtunkhwa. The study revealed that the species is climate and drought sensitive with dendrochronological potential. It was hypothesized that A. pindrow is sensitive to climate change and records the variations in climatic factors. The past studies revealed the reliable dendrochronological potential and climate vulnerability...

Ashar Farooq1*, Farrukh Waheed1 and Asad Abbas Khan2

...s designed to assess the species composition and carrying capacity in scrub rangeland of Kherimurat, Punjab. For field data collection, two homogeneous sites i.e., grazed and un-grazed were randomly selected in Compartment No.12 of Kherimurat, scrub rangeland. Reconnaissance of the study area was carried out to layout the transect lines and quadrat method was used to collect the vegetation parameters such as cover percent and forage production. Three transect ...
NAVEED AKHTAR,Haroon Khan,WISAL MUHAMMAD KHAN,MUHAMMAD SALEEM KHAN,KASHIF ALI,SAJJAD ALI
Inayat Ur Rahman,Iram Noreen,Zeeshan Ahmad,Shahab Ali,Hussan Ara,Ayesha Khan,Shujaul Mulk Khan
ATTIQ ULLAH,Mohammad Safdar Baloch,MUHAMMAD SADIQ,EJAZ AHMAD KHAN,MUHAMMAD AMJAD NADIM,KHALIQ NOOR
Zahid Hussain,SULTAN MEHMOOD,ASIM MUHAMMAD,REHMAN ULLAH KHAN,SAAD ULLAH KHAN
MUHAMMAD SALEEM KHAN,IQBAL MUNIR,SYED ZAHIR SHAH,NAVEED AKHTAR,Haroon Khan,WISAL MUHAMMAD KHAN
Shujaul Mulk Khan,SHER ASLAM KHAN,Muhammad Saeed,Shah Masaud Khan,Ijaz Hussain,Muhammad Liaqat,Sardar Ali,Muhammad Abbas Khan
Amna Ali,MUHAMMAD SALEEM HAIDER,UZMA BASHIR,NAUREEN AKHTER
Haseeba Bibi,Arshad Iqbal,FAZAL HADI,Abddul Razaq,Ghias Ali
Muhammad Saeed,Ghosia Lutfullah,Abid Ali Khan,Murad Ali,SAEED ULLAH KHATTAK,Nafees Bacha
Wirat Phuwiwat , Watcharin Wichittrakarn , Chamroon Laosinwattana , Montinee Teerarak
Sangita Shrestha , Glenn C. Graham , Donald S. Loch , Stephen W. Adkins
Zhijie Xu,Yongqiang Wei,G.J. Duns,Zuodong Qin,Lanfang Wu,Xuelian Wang,Jishuang Chen
Ihsan Ullah , Siraj Ud Din , Sultan Mehmood Wazir, Saad Ullah Khan, Alamgir Khan and Zulqarnain

Muhammad Umair Khan*, Zahid Rauf, Abdur Rehman, Tanvir Hussain and Mansoor Ali Khan

...;">Identification of new species for pulp and paper production is the need of the day. In this regard, a little work has been done in Pakistan instead of abundance of various hardwood species which would be regarded as fine sources of pulp and paper production. There is a dire need for pulp and paper industry of Pakistan to find out locally available potential sources of raw material for pulp and paper production. This would...

Muhammad Bilal Zia1*, Ashar Farooq1, Hammad Ud Din1, Barkat Ullah Khan1 and Samee Ud Din2

...war introduced Paulownia species in 1989 and six species were evaluated in multi-location trials. The studies for optimal planting stock and propagation methods for Paulownia indicated that the root stumps grew substantially taller, having straight stems and symmetrical crowns. Highest survival was observed for Paulownia fortunei, Paulownia tomentosa and Paulownia elongata. Paulownia fortunei and Populus deltoides; both had ...

Ali Nawaz, Qazi Bilal, Anwar Ali*, Nowsherwan Zarif, Faizan Ahmad, Asim Karim and Atif Majeed

...) is a fast-growing tree species that grows extensively on farmlands in order to fulfill socioeconomic needs as well as climate mitigation and adaptation. The current study reviewed the social, economic and environmental significance of Eastern Cottonwood based agroforestry system. The current economic review of Populus deltoides shows that average net return and average net present value are 11121USD ha-1, INR. 793,579 ha-1 with benefit cost ratio of 2.45. Th...

Manar Neamah Al-Shreefy*, Suhaib A.H. Al-Taai 

...acteristics, this animal species is valuable as a model in numerous scientific investigations. Therefore, this study sheds light on the histomorphological and histochemical properties of these organs, supporting further studies on vital digestive tract functions such as food processing and absorption. 

...

Muddasir Khan1, Siraj-Ud-Din1, Muhammad Farooq2* and Sanam Zarif2

...ass Hills a total of 113 species belonging to 54 families of Angiosperms, were recorded. Maximum genera and species were in case of Lamiaceae i.e 9 genera being (9.782%) and 11 species (9.734%) of the total genera and species followed by Asteraceae comprising 8 genera (8.695 %) and 10 species (8.849 % followed by Papil...

Viranga Kumudini Jayasundara¹*, Ali Khatibi², Jacqueline Tham²

...;">Dogs are a ubiquitous species, and their ecology is closely linked with human activities. Catch-neuter-vaccinate-release is the intervention employed to manage the free-roaming or stray dog population in the Sri Lankan context after imposing a “no kill” policy in 2006. However, sustainable and effective management is still not visible in urban areas and rural areas of the country as well. Therefore, this study aimed to investigate dog owners&rsq...

Chengrui Yan1, Jing Miao1, Jiantong Feng1, Liping Xia1, Yingying Ye1,2*, Jiji Li1 and Baoying Guo1,2

...ally important gastropod species in the coastal regions of China. Compared to other molluscs, T. clavigera has a long planktonic larval period (i.e., ~ two months). In order to identify the relevant factors affecting the genetic structure of T. clavigera, a total of 147 T. clavigera individuals distributed along the Chinese coast from 9 populations were analysed genetically on the bases of cytochrome oxidase I (COI) gene. Analysis of the COI genetics indicated...

Syed Basit Rasheed*, Farrah Zaidi, Samiullah and Tehmina Jan

...was designed to know the species composition, relative abundance and seasonal variation of leishmaniasis vector in an emerging endemic focus of Nowshera. Sand flies collected by flit method were identified into 4 species of genus Phlebotomus and 17 species of genus Sergentomyia. P. sergenti, the suspected vector of leishmaniasis was also collected in this survey. Sergentomyia baghdadis and...

Abdul Rahman Sesay1,2, Muhammad Saif-ur-Rehman1*, Faisal Ramzan1 and Faisal Saeed Awan3

...ics in many domesticated species, resulting in discernible genetic modifications at the individual genome level. The study aimed to discover and analyze potential indicators of recent selection in Sahiwal cattle, specifically identifying the genes and quantitative trait loci associated with these selection indicators. The study utilized a sample size of 98 Sahiwal bulls. The genotyping of all animals was conducted using the BovineHD140k BeadChip. After undergo...
Mubashar Hussain1,2*, Hifza Liaqat1, Muhammad Faheem Malik1
Kiran Aftab1, Moazama Batool3, Razia Iqbal1 and Somia Liaqat1
...20. We observed the same species richness in all three study sites, but a great difference was observed in species abundance. A total of 5565 individuals of 58 species belonging to 23 families and four orders were collected from DVNP. Barmala was reported as the highest abundant site (2815 individuals), followed by the Vatala (1832 individuals) and Deva (918 individuals). SIMPER analysis i...

Basheer Ahmad, Nowsherwan Zarif, Saif Ullah Khan, Salman Ahmad and Anwar Ali*

...ce, restrictions in tree species availability, challenges in market mechanisms, and issues with wood pricing. To effectively promote agroforestry, creating typical agro,forestry farms at the community level can be a valuable extension approach. However, effective extension programming needs partners to share an understanding of the challenges and an idea for positive results. Moreover, it necessitates the appropriate selection of messages, messengers, target a...

Arshama Sheraz1, Shabir Ahmed1*, Sardar Azhar Mehmood1, Wali Khan2, Waheed Ali Panhwar3, Fiza Sadiq Awan1

...ed twenty-four amphibian species, nine of which are endemic to the country. Amphibians in Pakistan are diverse, falling into four families: Dicroglossidae, Microhylidae, Bufonidae, and Megophryidae. The current study was carried out to investigate the amphibian fauna of several localities in District Abbottabad. From June 2019 to August 2020, a field survey was undertaken in District Abbottabad. Total dissolve solvent (TDS), Dissolve solvent (DO), Electrical C...
Manahil Wahab1 and Anwar Ali2
...ands. Poplar is the main species, followed by Eucalyptus, Bakain, Ailanthus and Kikar. Though farm forestry is practiced in the area since ancient times, the modern commercial farm forestry has been started in the last three decades. Driving forces for adoption of farm forestry include inspiration from other farmers, self-initiatives and quick economic return. Majority of the respondents (72%) have planted trees for commercial purpose. The average number of tr...
Fazli Amin1*, Naveed Ahmed2, Muhammad Salman3, Zia Ur Rahman4 and Mir Manzar Ud Din5
...owed that total 8 insect species were recorded visiting M. oleifera from three major orders such as hymenoptera, diptera and lepidoptera in this study. Among all, hymenopteran were the most abundant and species rich order as compared to the others. Five species viz. Apis mellifera, Apis dorsata, Apis florea, Apis cerana and Xylocopa fenestrata belongs to Hymenoptera, one
Tanvir Hussain1, Said Akhtar2, Khalid Hussain3* and Zahid Rauf4
...ability of some hardwood species growing in Lalkoo, Swat based on morphological characteristics of wood fiber. For this purpose, wood samples were collected from local depots and wood fibers from each species were separated adopting standard laboratory procedures. Results showed that Walnut (Juglans regia) fibers were comparatively longer in llength followed by Pohu (Parotia jacouemontiana), Mulberry (Morus alba), Black loc...
Ehtisham1, Rizwan ur Rehman1, Raja Wajahat1, Tabarak Ashraf1, Shabir Ahmad Jan1, Arz Muhammad1 and Ahmad Zamir2*
...us monkeys is one of the species of primates having the large geographic range extend from northern Africa to south and Southeast Asia, southern China and northeast to Japan. Their tendency to survive under diverse environmental conditions make their survival in numerous habitats. Association between primates and the tourism are commonly studied, but the differences occur among the goal of ecotourism and their damaging effects that has become a reason of conce...
Salman Ahmad1, Anwar Ali1, Basheer Ahmad1, Nowsherwan Zarif1* and Saif Ullah Khan1
...labourers. Poplar is the species most frequently used in agroforestry, accounting for 52% of all plantings, followed by Eucalyptus at 16%. 10% of the seedlings for planting came from the Forest Department, and 90% came from private nurseries. 30% of respondents plant for shelterbelt purposes, 10% for land stabilisation, and 60% of respondents plant primarily for economic gain.

Keywords: Agroforestry, Respondents, Households Fuelwood....
Muhammad Umair1, Nowsherwan Zarif1*, Zahid Rauf1, Anwar Ali1, Ghayyas Ahmed1, Basheer Ahmed1, Salman Ahmad1 and Saifullah1
...ng native and introduced species. In this study, we evaluate the potential of agroforestry in the district of Bhakkar to maximize a variety of socioeconomic benefits. According to the findings of the study farmers were generally supportive of intercropping and border cropping. Most farmers regarded agroforestry systems as most beneficial due to their ability to protect surrounding crops from dust storms. Age, education level, and distance from the farm to the...
Tanvir Hussain1, G. M. Nasir2, and Ayaz Marwat3
...d software program. Each species was properly given; Scientific name, possible local names, catalogue number, nature of wood (soft/hard), region, Identification features and its distribution. The developed software program proved to be robust and efficient for wood identification process....
Ashar Farooq1 and Shakeel Ahmad2
...%), relative density and species composition were determined. Secondary data regarding rehabilitation of degraded slopes were also collected. Results revealed that slope stabilization measures have significant positive effect on vegetation parameters. The statistics show that the cover percent at Asrait, Niam, Kullaly and Dabargai sites was 55.5%. 51.4%, 41.4%, and 24.3% respectively. At Asrait site, 62.53% were planted species<...
Ghayyas Ahmad1, Arifullah Awan2 and Muhammad Imran3
..., tools used in lopping, species preferred and the role of gender were investigated. It was found that the practice was quite prevailing in the area. Main purpose of lopping was to meet the domestic need for fuel wood. Local people were largely unaware of its legal status or lopping's adverse affect on the tree's health. Axe was the main tool used for lopping. The preferred species was Oak but since its availability was scar...
Muhammad Umar Atique1, Sanam Zarif Satti1, Muhammad Ilyas1*
...ed for three fodder tree species including Acacia nilotica, Bauhinia variegata, and Ceratonia siliqua. The leaf samples of the selected species were collected with replication of ten (10) from the Range Research Garden of Pakistan Forest Institute (PFI), Peshawar, and brought into the Forest Chemistry Laboratory of PFI in polypropylene woven bags for chemical analysis. Quality parameters including moisture content, ash, prot...
Afra Siab1, Saif Ullah Khan1, Anwar Ali1, Nowsherwan Zarif1, Basheer Ahmad1, Salman Ahmad1
...rmers have no idea which species to plant and how to plant, that can lead to more production. The study also recommends to solve the sale problems, that is wood based industries be established in the rural area to make the efficient use of wood grown on farmlands....
Muhammad Farooq1*, Lal Badshah2 and Sanam Zarif1
...iversity consisted of 93 species within 40 families. Based on number of species Asteraceae (10 spp.), Lamiaceae (8 spp.), Brassicaceae, Solanacea, Poaceae each with 6 species were the leading families. Mimosaceae (5 spp.) Caryophyllaceae (4 spp.) were the next dominant families. The other families had either 3 or less than 3 species. Biological spectrum ...
Zahid Mahmood1, Mohammad Salim2, Nowsherwan Zarif1, Zahid Rauf1, Muhammad Naqash1 and Ahmad Hussain3
...aluation of various wood species for their physico-mechanical properties and further recommendations for rationale utilization of studied wood species on the bases of strength (physico-mechanical) properties was accomplished in this research study. ASTM international standards of wood testing were followed for physico-mechanical tests, i.e. Density, MoR, MoE, cleavage, tensile, compression parallel to grains, compression per...
Ashar Farooq1*, Mohammad Salim2, Muhammad Tahir Khan3, Zahid Rauf1, Ahmed Hussain2 and Muhammad Bilal Zia1
...f three perennial forage species of Panicum grass subjected to different clipping stages at Range Research Garden, Pakistan Forest Institute, Peshawar. Randomized Complete Block Design with Factorial arrangement having four replications was used for layout of the experiment. Treatment combinations consisted of three species i.e. Panicum antidotale, Panicum coloratum and Panicum maximum and three clipping...
Tanvir Hussain, G. M. Nasir and Ayaz Khan
...ove the quality the wood species for better utilization. Permanent slides of cross, radial and tangential sections of each wood species were prepared, observed under the microscope and data were collected for the frequency and dimensional measurement of different wood elements/ structures in each wood species. On the basis of results, it was found that Morus alba wood may be compara...
Sanam Zarif Satti1, Tanvir Ahmad Quereshi2, Mehwish Zarif3 and Iftikhar Ahmad4
...that among all the plant species promising total phenolics total flavonoids and antioxidant activity was observed. Highest value of total phenolic content was observed for B.aristata (80.25 mg GAE g-1) while lowest values was recorded for C. oblique (10.25 mg GAE g-1), highest value of flavonoid content was recorded as (38.5 mg QE g-1) and comparatively highest value of antioxidant activity was recorded for B. ...
Ch. Muhammad Muslim1, Hassan Sher2, Junaid Khan2, Shahid Hussain2, Ashfaq Ali2 and Atif Majeed3
...d by maximum number of 6 species followed by Apiaceae and Solancaceae represented by 4 species each. Alliaceae was represented by 3 species while Amaranthaceae, Asterceae, Brassicaceae, Fabaceae and Pllygonaceae were represented by 2 species each. All other families were represented by 1 species each. Documented plants...
Khalid Hussain, G. M. Nasir and Tanvir Hussain
...perties of locally grown species Paulownia catalpifolia, Paulownia elongata, Paulownia fortune and Paulownia tomentosa was carried out in order to observe the extent of variations. Discs were cut off from the butt log of each species at breast height and data were collected for the growth rate and heartwood percentage. To observe variations in anatomical properties, the sample blocks were removed from the disc ...
Muhammad Yousaf Khan and Pervez Manan
...t widely propagated tree species throughout the world, because of its adoptability to site, types of management systems, multipurpose nature and fast growth the Eucalyptus was introduced in Sub-Continent in late 18th century for the first time. Need for conducting this study was felt to dig out the facts about Eucalyptus plantations in Malakand District after a protest of few participants organized and brought by NGOs based at Peshawar and Islamabad...
Ahmed Zamir, Muhammad Waqas Khan and Saeed Anwar Wazir
...lants. It has about 6000 species of wild plants, among them almost 4000-6000 are considered to carry or of medicinal importance. During the ethno botanical elaboration of Leepa valley 106 plant species of 55 families were recorded. Among them 93 are considered to carry great medicinal values. Residents of the area use these plants for different medicinal purposes by mixing them with other plants. Some of plants like wise ...
Muhammad Yousaf Khan and Raees Khan
...rowth of valuable forest species but contribute to the national cause by equitable resource production adding to financial, social, economical and even law and order aspects of the society. The scientific management of forests has been evaluated against the existing ban on forest management and it has been concluded that scientific management is the remedy to resolve the issues associated with the forest crops, products, produce, disputes and resources in Paki...
Asad Abbas Khan1, Amina Batool2, Muhammad Aslam1, Muhammad Ehtesham Asghar3, Abdul Ghafoor1 and Muhammad Arif1
...g the efficacy of forage species in rangelands by employing various rehabilitation techniques such as reseeding etc. The present study was designed to assess the growth performance and biomass production of reseeded grasses in scrub rangelands of Kherimurat scrub forest of Barani Livestock Production Research Institute, during summer 2010 to spring 2011. Five grass species included Bothriochloa pertusa (palwan), Pe...
Asad Abbas Khan1, Amina Batool2, Muhammad Aslam1, Muhammad Ehtesham Asghar3, Abdul Ghafoor1 and Muhammad Arif1
...g the efficacy of forage species in rangelands by employing various rehabilitation techniques such as reseeding etc. The present study was designed to assess the growth performance and biomass production of reseeded grasses in scrub rangelands of Kherimurat scrub forest of Barani Livestock Production Research Institute, during summer 2010 to spring 2011. Five grass species included Bothriochloa pertusa (palwan), Pe...
Zahid Rauf, Tanvir Ahmad Qureshi, Ghayyas Ahmad and Wahiba Iqbal
...mption and types of wood species utilized by the various wood based industries to help various stake holders and policy makers for sustainable forest management and subsequent provision of woody raw material on sustainable basis to the wood based industries by the respective Forest Departments.139 various wood based industries i.e. Furniture, Sports, Chipboard, Medium Density Fiber board (MDF), Plywood and Match-manufacturing were surveyed and data was collect...
G. M. Nasir
... of seven low value wood species grown in AJK, was studied for the assessment of their technological properties helpful to improve quality of wood before utilization. Permanent slides of cross, radial and tangential sections of each wood species were prepared and data were collected for the frequency and dimensional measurements of various wood elements/structures in each species. Results ...
M. M. Rahaman, K. Akhter and R. Akhter
...ade using veneer of this species bonded with liquid urea formaldehyde glue of 50% solid content extended with wheat flour and catalyzed with 2% hardener (ammonium chloride) under the three specific pressures, viz, 1.05 N/mm2, 1.40 N/mm2, 1.76 N/mm2 in three replications at 6 minute press time and 120oC press temperature. Dry and wet shear test were conducted on the plywood samples and their shear load at failure per ...
Tanvir Hussain, Zahid Rauf and G. M. Nasir
... three lesser known wood species before utilization grown in Kalam, Swat. Standard samples and wood sections were prepared from butt logs of each species to observe the structural features and determine physico-mechanical properties. Anatomical results revealed that Kasunder wood may be medium, Geiray better and Quercus wood may be good in strength. The wood of all the species may be less ...
Syed Fazal Baqi Kakakhel
...ror valley supports five species of Morels including Morchella hybrida, Morchella angusticeps, Morchella esculanta, Morchella delicosa, and Morchella conica'. Morels are collected, dried, packed and marketed for its economic incentives, medicinal value and use for food. The locals of the valley use their endogenous knowledge for collection, drying, packing and marketing. Questionnaire of standard questions was designed and data regarding five...
Anwar Ali1, Saz Muhammad2, Zakir Hussain3, Khadim Abbas4 and Kiramat Husain5
...l is the single dominant species (85.26%) in the forests. In co-dominant species, Fir consists of 5.85%, Juniper 3.9% and Spruce 2.09% of the total trees sampled during the inventory. Birch is the only broad-leaved species recorded during the inventory with 2.89% trees. Diameter class distribution shows that the forest is overwhelmingly young and consists of lower dia classes. Most of the ...
Ghulam Mustafa Nasir, Tanvir Hussain and Khalid Hussain Sulangi
...essels. ...
Ashar Farooq1; Farid Shah2; Saifullah Zahri2 and Samiullah Jaffar2
...ium is the dominated species of arid and semi-arid rangelands of Balochistan. Six (06) species of Seriphidium are found in this region. The dwellers of the area are dependent on livestock to earn their keeps and livestock is dependent on these rangelands. Being a high palatable species, Seriphidium is the main target of large mammals. The experimental work has been carrie...
Mazhar Iqbal, Ashar Farooq, Zulfiqar Ali Sheikh and Waseem Abbas
...the effects of different species composition on infiltration capacity of soil. The study area was divided into three zones, namely, Zone-I: Pure Chir (Pinus roxburghii) Zone, Zone-II: Chir and Robinia (Robinia pseuodocacia) Mix Zone, and Zone-III: Pure Robinia Zone. Twenty (20) sample plots were established randomly in each zone for determination of infiltration capacity. Double Ring Infiltrometer was used to collect the required information on e...
Anwar Ali1, Muhammad Ismail2 and Kiramat Husain3
...hat Kail is the dominant species followed by fir and spruce. Juniper and Chilghoza pine are also present in very small proportion. Birch is the only broad-leaved species recorded during the inventory. Stand structure is almost young as most of the trees fall in immature (38%) and sub-mature (44%) development stages. On the other hand, 14% of the trees are mature and 3.64% are over-mature which together constitute 18%. The c...
Mamoona Wali Muhammad1, Syed Ajmal Rahim2, Junaid Mumtaz3 and Syed Akmal Rahim4
...lantations of Eucalyptus species, Poplar and Acacia modesta, etc. were found on 10-12% of land. Majority 68% respondents use farm trees for mix of uses (timber, fuel wood, fodder) with preferred rotation age, expressed by 80% as 6-10 years. Out of total farm tree produce, 30% consumed for domestic fuel, 12% for roofing windows, poles etc. and 58% sold to get cash for family. 92% used standing sale procedure.

The nursery or trees have proved pr...

Mubashir Jamil Khan1, Asad Abbas Khan2, Amir Saleem1, Lateef M. A.1, Muhammad Aslam1, Muhammad Mushtaq2, Abdul Ghaffoor2 Amna Btool1 and Arsalan Ali Khan1
...onal value of five grass species found in Kherimurat scrub forest and rangelands. General observations of increasing percentage of all nutrients except for dry matter were observed from summer to winter season and then reverse from winter to spring in the major range grass species of Kherimurat....
Farah Samuel and Syed Kamran Hussain
... to a variety of aquatic species but also a source of irrigation for agricultural lands of Peshawar and Charsadda districts. Various plant species, native to the area, are found on the river banks. As far as its significance is concerned, conservation is the need of the hour for various threatened species such as fish fauna, freshwater turtles, migratory birds and otters. Illegal hunting a...
Syed Fazal Baqi Kakakhel
...ror valley supports five species of Morels including Morchella hybrida, Morchella angusticeps, Morchellu escuhmta, Morchella delicosa and Morchella conica. 10 sites plots 20mx20m quadrate size) were taken covering slopes, and altitudes, through transact walk with in the study area at approximately 200m (400 steps) distance. Soil samples were collected from the study area and thus investigated for climatic parameters. The results show that the cli...
Ghulam Ali Bajwa and Muhammad Waseem
...01 butterflies and moths species were collected, which belonged to 18 families. Among these, 42 species were new in the Park area. About 70% of the species migrated from lower elevation or from dry temperate forest to moist temperate forest. Margalef Species Distribution Index (3.25) showed greater richness of species ...
Mian Muhammad Shafiq and Muhammad Saqib
... in the world. Out of 49 species of pheasant found in the world five species i.e. Monal, (Lophoporus impejanus) koklass (Pucrasia macrolopha), Kalij (Lophura leucomelana), western horned Tragopan (Gragopan melanocephalus) and Cheer (Catreus wallichi) are found in Pakistan while four (4) species i.e. Monal, Koklass, Kalij and Western horned Tragopan are f...
Islam Ullah Shah, Anwar Ali, Ayaz Khan and Sultan Muhammad
...or collection of data on species composition, their DBH and heights. This data was used to estimate growing stock and carbon stock in the study area. Pinus gerardiana is present in all four stands as the leading dominant specie. Average Density of all stands was calculated as 342.88 trees/ha with basal area 55.34144 m2/ha. The average volume of all stands was calculated as 132.324m3/ha. The distribution of Pinus gerardiana i...
A. S. M. Helal Siddiqui1, Abul Khair2, M. Masudur Rahman3 and S.M. Mosfeka Hasnin4
...y rich. Among the floral species Passur (Xylocarpus mekongensis) is one of the important timber species in the Sundarbans. Passur belongs to the family Meliaceae. The canopy of Passur is dense, heavy and the stem is cleared bole. The tree attains a height of 15-20 m and the exploitable age 100 years. Now Passur is affected by heart rot problem. Actually heart rot is internal damaged condition locally known as "dho...
Tanvir Hussain
...bility of eight hardwood species against a white rot fungus Ganoderma lucidum. For this purpose wooden blocks (4.5x2.5x1.5cm) prepared from each species were infested with fungus for 120 days. The endurance was calculated based on the mean percentage of weight loss of the wooden blocks. Results revealed that Sapindus mukorossi was most subjected to decay with a maximum average weight loss whereas the maximum na...
Fazal Baqi Kakakhel
...S and field surveys. The species was observed in three of the available six habitat types including woody ravines, shrub land and agricultural fields. Chi-square tests showed the species displayed significant habitat selection in relation to the availability. The species showed highly significant habitat selection for woody ravines, preferred northerly aspects and foraged in the morning an...
Zahid Rauf and Syed Jawad Raza
...s, sawdust, etc., of the species could also be used as raw material for pulp and paper manufacture....
Fazal Baqi Kakakhel
...S and field surveys. The species was distributed in three of the available six habitat types: woody ravines, shrub land and agricultural fields. Chi-square tests was used and the species showed highly significant preference for woody ravines, preferred northerly aspects and foraged in the morning and evening. The findings conformed generally to other studies on the species....
Muhammad Bilal Zia and Muhammad Tahir Laeeq
...wing deciduous Paulownia species have caught greater attention in afforestation and agroforestry programmes. A trial comprising four Paulownia species was conducted at the Pakistan Forest Institute, Peshawar, to asses the genetic variability based on growth parameters. These parameters such as tree height, diameter at breast height (DBH) and survival were assessed after one and two years of plantation. The results showed hig...
Muhammad Tahir Laeeq and Muhammad Asif Aziz
...t is a multipurpose tree species, especially having medicinal and pesticidal value. Neem is propagated primarily through seed, but seeds are having viability for short period of time. To get healthy and good quality planting stock appropriate nursery techniques are imperative.

The study was initiated to assess the effect of various nursery techniques on the growth improvement of neem seedlings for obtaining healthy planting stock. The study comprised...

Fazal Baqi Kakakhel
...S and field surveys. The species occurred in five out of six available habitat types; agricultural fields, shrub lands, mountain slopes, grass lands and barren rocks. Chi-square tests showed the species displayed significant habitat selection in relation to the availability. The species showed highly significant habitat and preferred mountain slopes highly significantly. The
Ashar Farooq and Mubashir Hassan
...t to determine the plant species composition, forage production and carrying capacity of the area to evaluate the current condition of the rangeland. Systematic sampling with random start procedure was adopted to collect the data. The study revealed that species composition of Cenchrus ciliaris was maximum (42.08%) followed by Eleusine flagellifera (27.41%) and Elionurus hirsutus (16.22%) respectively on...
Mian Muhammad Shafiq and Muhammad Saqib
... in the world. Out of 49 species of pheasant found in the world five species i.e. Monal, (Lophoporus impejanus) koklass (Pucrasia macrolopha), Kalij (Lophura leucomelana) and western horned (Gragopan melanocephalus) are found in Pakistan while four (4) species i.e. Monal, Koklass, Kalij and Western horned Tragopan are found in the study areas of Kaghan valley.
N. R. Wani and S. Murtaza
...ological parameters like species richness, dominance and evenness index exhibited variations in both the strata in all the sites.

Key words: Floristic diversity, Manasbal Lake, Vegetational strata....

Naveed Ahmed
... days. Four bark beetles species viz. Pityogenes scitus B., Ips longifolia Stebb., Scolytus major Stebb. and Polygraphus major Stebb. were present in blue pine tree infected with die-back disease. However, it was observed that the bark beetle, Pityogenes scitus B was most frequently found in infected trees while Ips longifolia Stebb., Scolytus major Stebb. and Polygraphus major Stebb. were less in number...
Ch. Muhammad Muslim and Sohail Sikander
...ars depending upon plant species concerned. Disturbance in the regeneration pattern is also affected by heavy grazing and intensive felling of trees in particular area. Due to increase in population and simultaneously of animals the grazing pressure has increased tremendously and thus unpalatable or even poisonous plants though not eaten but are trampled so heavily that regeneration and survival of the plant become extremely difficult. Therefore, there is a ne...
Ghulam Mustafa Nasir
... structure of eight tree species grown in Balochistan was studied and basic anatomical data were compiled to evaluate their technological properties supportive to improve the quality of wood before utilization. Permanent slides of cross, radial and tangential sections of each wood species were prepared and observed under the microscope for various structural features. Results revealed that Babul and Phulai wood may be strong...
Muhammad Shabir Mughal and Muhammad Muslim
...>) with other associated species. The information gathered will provide guideline in preparing future forest management plan....
Muhammad Nawaz Rajpar, Mohamed Zakaria, Ebil Yusof and Kamziah Abd Kudus
...esearch was to determine species abundance and feeding guilds of waterbirds at Putrajaya artificial freshwater wetland, Selangor Peninsular Malaysia. A total of 3720 bird detections that belongs to 21 waterbird species of 7 families were recorded using distance sampling point count method from March to December, 2009. The Purple Heron; Ardea purpurea (1083 detections; 29.11%), Black-crowned Nightheron; Nycticorax n...
Muhammad Shabir Mughal and Muhammad Muslim
...status of indigenes tree species, medicinal, aromatic and economic plants growing in the area and evaluation of future prospects of endemic tree species including medicinal and economic plants that need in-situ conservation of sustainable utilization having market potential and income generation activities for rural communities. The area falls under scrub forests and subtropical Chir pine forests. Inhabitants are holding sma...
Tanveer Haider, Aurangzeb Ashraf, Ambar Masud
..., in total 79 vegetative species were found in the area, however 7 remained unidentified forage productivity remained 1160 kg/ha, animal units was almost .03. Pressures and threats to park and particular compartment are directly and indirectly increasing day by day. Major pressures are increasing human population, overgrazing by animals, environmental pollution, like water contamination and forest fires. A thing of concern was the identification of a fast depl...
Rahim Muhammad Akmal Syed1, Hasnain Shahida2, Mamoona Wali Muhammad3 and Jabeen Farkhanda4
...on of different suitable species of plants. The results of the soil analysis of various agro ecological zones and the consequent recommendation of the associated suitable species, aids the agrofarmers to pick out the best possible option.

Key words: Soil Analysis, Agro-ecological Zones, Farm Plantations, Soil Texture and Organic Matter, Nitrogen and Phosphorous.

...
Ghulam Mustafa Nasir
...s/structures in the wood species. Results showed that in Acacia ampliceps wood, the fibers are medium in length and reasonably thick-walled. The vessels are small in diameter and lower in frequency. The wood rays are higher in frequency and a bit larger in size. The wood may be better in strength and can be used for various wood products. Preservative treatment of wood before utilization may be required to increase the service life. However, the process...
Muhammad Nawaz Rajpar and Mohamed Zakaria
...etermine and compare the species composition and relative abundance of waterbirds and terrestrial birds using mist-netting method at Paya Indah Wetland Reserve, Peninsular Malaysia. A total of 1,478 bird individuals that belong to 65 species (18 waterbirds and 47 terrestrial birds) and 33 families (6 waterbird families and 27 terrestrial bird families) were recorded during 105 netting days within December, 2007 to November, ...
Tanvir Hussain
...s of four low value wood species i.e. Ailanthus sp., Sapindus mukorossi, Cedrela toona and Ficus palmate collected from Azad Jamu and Kashmir (AJK). For this purpose wooden plates of 14"x7x3/4" sizes were prepared from each species and partioned into two portions i.e. uncoated and coated. The coating was done with commonly used five finishes (Lacquer, Varnish, Wax polish, Spirit polish and Lins...
Enefiok S. Udo1, Opeyemi Olajide1 and Eyo A. Udoh2
...m State, Nigeria. Plant species producing economically valuable non-timber forest products were enumerated in all the sample plots. Species diversity and dominance concentration indices of the different life-forms were determined using Shannon-Wiener diversity and Simpson's dominance concentration functions, respectively. Forty six plant species comprising 16 tree
Syed Said Badshah Bukhari and Ghulam Ali Bajwa
...hoods. A great number of species are facing extinction due to deforestation. Based on these findings it is suggested that sustainable forest resource management may be resumed to keep the forest ecosystems viable and their socio-economic services intact.

Key words: llegal logging, multiple uses, biodiversity, environment, livelihoods, sustainable forest management.

...
Akhlaq Ahmad Khan
...xb.), the principal tree species of the Irrigated Forest Plantations of Punjab, caused by a mysterious malady that is generally known as Sisham Die-back. This tree is the main species in the irrigated agriculture fields of Punjab as well. The problem is serious enough to have caused deliberations in three Seminars arranged by the Punjab Forestry Research Institute of the Punjab Forest Department at national level during th...
Muhammad Shabir Mughal, Asif Raza Wazir and Ch. Muhammad Muslim
...alue (HIV). The dominant species were Cedrus deodara, Pinus wallichiana, Abies pindrow, Picea smithiana, Pinus gerardiana and Quercus dilatata, Quercus incana etc. These plant species were the main source of income of the inhabitants. A number of medicinal plants like Berberis lycium, Thymus serpylum, Salvia sp., Solanum suratense were also found in the area. The data reveals that due to ever-incr...
Ghulam Mustafa Nasir
... wood of all the studied species may be somewhat non-durable because of higher frequency or larger size of wood rays and need chemical treatment before utilization. However, Neem, wood may not require preservation due to its chemical composition. Preservative treatment and seasoning of wood of all the studied species (except Sohanjna) may be slow or somewhat difficult due to medium sized or smaller vessels. In Sohanjna the v...
Maqsood Anwar1, Abdul Wahid Jasra2 and I. Ahmad3
...mber of animal and plant species have become threatened or endangered mainly due to over-exploitation and loss of natural habitat. Deforestation, overgrazing, soil erosion, salinity and water logging have become major threats to Pakistan's remaining biodiversity.

The Government of Pakistan being aware of the situation recognized the importance to protect country's environment and prepared the National Conservation Strategy (NCS) in 1992. Pak...

Tahir Laeeq1, Tariq Mahmood2 Mohammad Amin3 and Khurshid Alam4
... local as well as exotic species should be carried out and soil conservation technique should be adopted if lands are to be cultivated. ...
Naveed Ahmed, M. Hamayoon Khan and Mian Inayat-Ullah
...pring season. The insect species, belonging to 6 families of order Hymenoptera and order Diptera, were recorded on the blossoms of Paulownia in four time periods, 8-9 a.m, 11-12 a.m, 2-3 p.m and 5-6 p.m. Xylocopa fenestrate Fabr., family Xlycopidae, order Hymenoptera spent maximum duration on the blossoms. Among honeybees, Apis dorsata, family Apidae, order Hymenoptera was found more abundantly on the blossoms in all the time periods. A maximum p...
Md Golam Moula
...ut the suitable mangrove species for underplanting in the established coastal plantation. Nine major mangrove species namely Ceriops decandra, Aegiceras corniculatum, Phoenix paludosa, Excoecaria agallocha, Heritiera fomes, Lumnitzera racemosa, Xxlocarpus mekongensis, Cynometra ramiflora and Bruguiera sexangula were tried. The highest survivability was found in A. corniculatum and P. paludosa (87....
G. M. Nasir and Iqbal Mahmood
...rk to introduce new wood species for utilization in wood and wood based industries, basic properties of locally grown Robinia (Robinia pseudo-acacia) wood were studied to assess its various technological properties and find out better utilization. For anatomical properties, permanent slides of cross, radial and tangential sections of the wood were prepared by standard laboratory procedure and observed under the microscope. For physical and mechanical pr...
Malik Mahboob ur Rehman1, Muhammad Rafiq2, Amjad Ali Ch.3, Tariq Mahmood4, Javaid Ahsan5 and Shahzad Fazal6
... was the principal grass species (85%) in treated areas while Eleucine flagellifera (Chimber) (38.72%) in untreated areas. General grass coverage on the average was 9.7% and 36.75% in un-treated and treated pastures respectively. Carrying capacity based on dry biomass of grasses/herbs was found to be 18 Ac/AU/Yr and 10 Ac/AU/Yr in un-treated and treated areas. Study concluded that untreated area provides fodder to 944 Animal Unit/5664 Sheep Unit while t...
Iqbal Mahmood, Gul Rukh and Tanvir Hussain
...n compared with the same species found in Burma. On the basis of result of properties the locally grown Teak wood is not only superior in strength but also suitable for various purposes where high stress is required. The local Teak wood has favourable relationship between tangential and radial shrinkage and aptness for framework and similar articles where the dimensional stability is of high importance. It is also recommended for a number of uses due to...
Ghayyas Ahmad, Mian Muhammad Shafiq, Muhammad Shabir Mughal and Mahr Muhammad Asif
...f forest degradation and species loss. This study is aimed at the assessment and comparison of plant diversity of a Reserve forest with a Guzara forest in the Chir pine zone of Murree hill, so as to see which forest is richer and more diverse in plant diversity.

Systematic sampling design was used to record the plant species found in the Reserved and Guzara forests. Sample plots of sizes 500 m2 and 102 m were laid ...

J. Kayode
...e conservation of timber species was examined. A total of 53 timber species belonging to 20 different families were found to be supplied in the sampled area during the study. 33 of these species were found to be supplied regularly while 22 of them were found to be in high demand by respondents in the study area. 95% of these species were sourced from the...
Shad K. Khalil, John G. Mexal, Abdur Rehman, A. Z. Khan and Iftikhar Hussain Khalil
...ems associated with this species. Osmoconditioning has been used for the speedy germination of most plant species. Eldarica pine seeds were osmoconditioned with the objective to evaluate its response to priming. Seeds were preconditioned in an aerated solution of polyethylene glycol (PEG) 8000 and water for 1, 4, 8, and 12 days. The osmotic potential of PEG solution was -0.5 and -1.8 MPa. In two other treatments, the seed...
A. W. Jasra and I. Ahmad
...sues. Multipurpose plant species like seabuckthorn and fourwing saltbush together with improved irrigation system and urea molasses blocks as supplemental feed have been identified as viable interventions for livelihood improvement. A policy dialogue is needed to resolve the problems of nomadic community.

Key Words: Pastoralists, livelihood, Juniper Forest, Balochistan, Pakistan

...
G. M. Nasir and Noreen Fatima
...gential sections of each species were prepared by standard laboratory techniques and observed under the microscope for various structural features. Data were collected for the frequency and dimensional measurements of different wood elements/ structures in each species. Results showed that on the basis of fiber morphological characteristics, the wood of Phulai, Ipip Ipil, Black Siris and White Siris may be stronger or better...
Iqbal Mahmood
... woods and the same wood species found in United States of America. The results of this study reveal that the local white bakain is superior in strength than exotic species. It has also better strength when compared with other commercial hardwoods and is recommended for a number of uses. ...
Asad Ullah, Abdur Rashid and Sher Aman
...habitants about the Tree species of the area. Twenty tree species belonging to eleven families and nineteen genera viz. Abies pindrow, Acer caesium, Aesculus indica, Betula utilis, Cedrus deodara, Corylus colurna, Crataegus songarica, Ficus carica, Juglans regia, Malus pumila, Morus alba, Picea smithiana, Pinus wallichiana, Populus alba, Punica granatum, Prunus armeniaca, Prunus domestica, Pyrus communis, Quercus baloot, ...
Mian Muhammad Shafiq and Muhammad Idrees
...re migratory birds. Many species of falcons visit Pakistan i.e. Saker Falcon (Falco charrug) Peregrine Falcon (Falco peregrinus) etc. The survey of migratory falcons was conducted in D.I.Khan, Mardan, Swabi and Nowshera districts of NWFP. It has been observed that Bala Aba Shaheed, Oubha, Kheshki Maira, Aman Garh, Marathi Maira, Naranji Maira, etc are the hot spots of hunting/trapping of migratory falcons in NWFP.

During the survey it has ...

Hasanuzzaman, Md., H. Mahmood, H.L. Sharif and Md. N. Islam
...nown as a premier timber species of the rosewood genus. This species deserves greater consideration for agroforestry applications for its multiple uses, tolerance to light, frosts and long dry seasons. Nutrients (P, K and Na) leaching from leaf litter of D. sissoo were studied in the laboratory. About 20% of initial weight of leaf litter was lost, while conductivity and TDS (Total Dissolved Solid) of leached water inc...
Ghulam Mustafa Nasir, Noreen Fatima and Kanwar Muhammad Suleman
...gential sections of each species were prepared by standard laboratory techniques and observed under the microscope for the structure and dimensional measurements of various wood elements/ structures. Results showed that in Amaltas, Ber, Bakain, White Bakain and Paper mulberry woods, the vessels were sufficient large in diameter and in Chinar and Paper mulberry woods, the frequency of vessels was found to be higher. Therefore, the woods may be easily seasoned a...
Mohammad Khan
...graft scion-wood of this species on root stock of chir pine, which has proved successful. This paper presents results of two experiments conducted for the purpose....
Ajiboye, A. A.1, Ebofin, A. O.1, M. O. Atayese,2, M. O. Adedire3, D. A. Agboola1 and M. Kadiri1
...on in the seeds of these species. Some standard methods of releasing seed dormancy were used. Percentage germination range in fresh seeds of P. africana and D. guineensis was 0-10%. The seeds of the two tree species exhibit physical dormancy due to hard seed coat. Dormancy in P. africana and D. guineensis was terminated by soaking of seeds in 90% concentrated sulphuric acid for 10-15 minutes; ...
Raza-ul-Haq and Mohammad Khan
...ive trials.

...
G. R. Keerio
...osopis cineraria (Kandi) species in riverine forests is very important operation for the development of forestry in Sindh. All the operations of regeneration process from seed collection to the protection of regeneration area require special attention in order to obtain the desired success. The artificial regeneration process includes three phases viz. pre-abkalani (before the arrival of inundation water), mid-abkalani (while inundation water is receding) and ...
Kabir Dihider Shahriar, Mahmood Hossain and Ripon Kumar Debnath
...nd multiple purpose tree species were studied in 65 households of eight villages of four Thanas in four different agro-ecological zones in Bangladesh. Among the eight villages 37,674, trees were counted including 98 species of 33 families. The family Leguminosae dominated with 17 species followed by Moraceae 7, Palmaceae 6, Myrtaceae 6, Rutaceae 5, Meliaceae 4, Anonaceae 3 and rest are in ...
Mohammad Athar and Syed Mahmood Nasir
...was trapped from 19 tree species belonging to nine genera distributed in seven families of angiosperms. Olives (Family Oleaceae) were the preferred host of the olive fruit fly. Family Rosaceae has nine tree species followed by Rutaceae (five tree species) as host of olive fruit fly. Other host tree species were distributed in Anacardiaceae, Fabaceae, Lyt...
J. Kayode
... and degraded lands. The species germinated in all the three soil samples Germination was most rapid in the fallow soil. Also the records of the seedling heights kept for three months indicated that increase in heights was most rapid in the fallow soil. However, there was no significant difference in the heights of the seedlings from the three soil samples at 5% level. Nodulation occurs in seedlings growing in the three soil samples....
Iqbal Mahmood and Tanvir Ahmad Qureshi
...igenous/naturalized wood species were tested for tangential and radial movement. Results revealed that eucalyptus (Eucalyptus camaldulensis) and chir (Pinus roxburghii) had large movement values (>4.5 %). Fir (Abies pindrow), kail (Pinus wallichiana), mulberry (Morus alba), bhan (Populus euphratica), walnut (Juglans regia), toon (Cedrela toona). Jaman (Eugenia jambolana) and semul (Bombax ceiba<...
Amjad Ali Chaudhry, Chaudhry Muhammad Muslim and Muhammad Mushtaque
...lifera was the key grass species. 26.37% and 16 88% ground was covered by grasses/herbs and shrubs, respectively while 56.75% was uncovered. Carrying capacity was found to be 1.003 AU/ha/yr and shrubs were the major contributors of forage. The Rakh presented miserable condition of grasses and it is strongly recommended that rotational system to be followed which promotes forage vigour by avoiding repeated and continuous grazing of one block year after year....
Kiramat Khan1, Tahir Sajjad2, Nasrullah Jan Malik2, Hassan Sher3, Farrukh Hussain4 and Muhammad Iqbal1
...e of six medicinal plant species (Bergenia ciliata, Crocus sativa, Dioscorea deltoidea, Paeonia emodi, Polygonum amplexicaule and Viola serpense) at four different locations in upper Swat valley during 2000-2001. The altitude of these locations ranged from 1200 to 1900 m.a.s.I. Suitability of ex-situ cultivation of these medicinal plant species and their economic feasibility was also worked out. The highest mea...
Bashir Ahmed Wani1, Shakeel Haider Zaidi2, Hakim Shah3 and Muhammad Muslim4
...es of thirty herbal drug species were traded in these markets and used by a number of leading manufacturing units of Greco-Arabic, Homeopathic medicines as well as allied food processing and cosmetic industries.

Keywords: Marketing potential, Herbal drugs, Medicinal plants.

...
Chaudhry Abdul Rashid1, Raja Muhammad Omer2, Chaudhry Muhammad Faisal2, Waqar Ahmed3, Zahid Ali4
...ffect of four leguminous species (Parkinsonia aculeata. Albizzia lebbek Leuceana leucocephala and Dalbergia sissoo) on the growth of fast growing species (Eucalyptus camaldulensis) Eight plants of E camaldulensis were replicated thrice in each treatment with a spacing of 2m x 3m. Plant height (m) and diametre at breast height (DBH) (cm) were measured annually from 1992 to 1998 Soil samples were an...
Altaf Hussain and Raja Muhammad Zarif
...ing of the planet. These species are causing varying degree of damage to biodivesity and valuable natural and agricultural systems upon which human beings depend. Direct and indirect health effects are increasingly serious and the damage done is often irreversible The effects are exacerbated by global changes and chemical and physical disturbances to species and ecosystem Alien tree species
M. Al-Amin and M. Alamgir
...lings and saplings of 39 species under 18 families were recorded in the sampled area Moraceae is the dominant family having 5 species followed by Anacardiaceae, Euphorbieaceae, Myrtaceae, Mimosaceae, Combretaceae and Verbenaceae (3 species each). Tectona grandis has the highest importance value index (31.05) followed by Gmelina arborea (16.05), Mangifera indica (13.59)...
Hassan Sher, Midrarullah, A. U. Khan, Z. U. Khan, Farrukh Hussain and Siraj Ahmad
...3. The study revealed 78 species under 37 genera belonging to 47 families, of which 68 plant were dicotyledons, 6 monocotyledons, 1 gymnosperm, 2 pteriodophytes and 1 fungus. The largest family was Lamiaceae (9 species) followed by Asteraceae, Poaceae (each with 5 species), and Rosaceae (4 species). The family Apiaceae, Asclepidaceae, Brassicaceae, Caryo...
Shams-ur-Rehman, Altaf Hussain and Riaz A. Khattak
...nd selection of suitable species in combating salinity seem to be one of the economically viable approaches to reduce poverty as several million ha. area has been severely hit by this menace in many countries of South Asia. The paper describes the screening/selection of species following use of some soil amendments to successfully establish trees on these marginal and extremely low nutrient lands. It is anticipated that the ...
Mohammad Ayaz
...ng upon distribution and species composition. However, this much forest is far less in consideration to national economic and ecological needs. Forests suffer from various injuries. These injuries in Pakistan are mostly due to biological and physical reasons. Biological injuries are the outbreak of forest pests and pathogens, which some times may attain the status of an epidemic, mainly under the influences of climatic conditions. Such catastrophes are control...
S. M. Rafique
... and there were 36 plant species. Out of it 18 were grass/grazing species, 2 forb species, 10 shrub species and 6 tree species. The bio-mass production was 752 kg (AD)/ha which was quite low. The study further indicated that range condition was poor to fair and the range trend was downward. The study has recommended ap...
Md. Aktar Hossain , Mohammad Kamaluddin and M. Serajuddoula
...ility of cuttings of the species. During propagation, cutting morphology is not significantly changed due to the etiolation of the stockplants. ...
Mirza Hakim Khan
...ta is represented by two species; Cuscuta reflexa and C. europea in Pakistan (Stewart, 1972). It commonly occurs on woody vegetation showing marked preference for certain species. Remedial measures through chemical control applying different doses of 2-4-D Sodium, Amine and Ester are suggested in this article....
Mahmood Nasir and Mohammad Noor
... winter In October 1995, species wise cover percent, density and above ground biomass data were collected to detect vegetation differences between protected and unprotected area. Twenty 1 m2 quadrats were studied randomly in both the areas.

The cover percent (10%) and above ground biomass (216 kg/ha) of Chrysopogon aucheri were higher three times in protected area than that of unprotected area, but its density remained unchanged which shows that ...

Abdul Ghani Awan, Sohail Jamil Qureshi, Mir Ajab Khan and Sofia Bano
...phology of two different species, Tragopogon dubius and T. gracilis, belonging to family Asteraceae was studied based on specimens collected within Pakistan. Characters like grain, shape of pollen grain, equatorial view, polar view, equatorial diameter (E), polar diameter (P). P/E ratio, length of colpus, exine surface, exine thickness, inter poral distance, inter spinal distance, inter spinal outline, length of spines, number of spines between c...
Rizwana Aleem Qureshi*, Mushtaq Ahmad**, Zaheer Yousaf* and Muhammad Arshad*
...ogical features of three species of Artemisia viz. A. scoparia Waldst. & Kit. A. absinthium Linn. and A. brevifolia Wall. Ex DC. For plant size, leaf-shape and size, petiole length, inflorescence type and capitulum, were studied on the herbarium specimens preserved at Herbarium of Quaid-i-Azam University, Islamabad. Medicinal properties and uses of these species were determined by interviewing Hakims and...
J. O. Adegbehin
...plantings of exotic tree species commenced in some parts of northern Nigeria over 40 years ago. Based on data from permanent sample and temporary plots, site index curves and yield tables were constructed for Pinus oocarpa, one of the promising exotics tried. The constructed site index curves revealed five (5) site classes at a reference age of 20 years; viz: I (24.9m); II (22.5m); III (20.1m); IV (17.7m) and V (15.3m). The growth figures derived from t...
M. Rahim Niazi, G. Habib and M.M. Siddiqui
...ons in Balochistan. Tree species significantly influenced ADF-P (P<0.001) and ISPD (P<0.001) of the leaves. ADF-P was higher (P<0.01) in wild than cultivated tree leaves (19.23% vs 9.01%). Conversely, ISPD was higher (P<0.001) in cultivated than wild tree leaves (54% vs 18%). A negative relationship between ADF-P in tree leaves may be done of the major factor limiting bio-availability of protein. It is concluded that in tree leaves crude protein is not a good ...
Muhammad Ibrar Shinwari, Maryum Ibrar Shinwari and Mir Ajab Khan
...arket value of medicinal species, rate of consumption, availability and vulnerability to harvesting. Questionnaires were adopted for interviews of local inhabitants, herbalists, pansaries, park authorities and societies on random bases. Only 26 species have been found as marketable medicinal plants collected by the inhabitants, drug dealers and herbalists for their socioeconomic value. Among the spec...
Ghulam Mustafa Nasir
...Important local hardwood species were studied for the volume of various wood elements. Photomicrographs of cross section of each species were prepared under standard laboratory procedures and data was collected by wood image weighing method for the percentage of wood volume occupied by fibers, vessels, longitudinal parenchyma and wood rays in each species. Results showed that in Acacia...
Raza-ul-Haq and Muhammad Tahir Laeeq
...val of seven forest tree species namely; Ailanthus altissima, Robinia pseudoacacia, Elaeagnus hortensis, Cedrus deodara. Pinus halepensis, Quercus baloot, and Eucalyptus camaldulensis. Treatments of mulching, species and irrigation frequencies indicated significant differences on initial survival of seedlings. Plants showed better survival under mulching and irrigation thrice a month, while E. camaldulensis<...
Muhammad Afzal, Muhammad Mushtaque, Aqeela Mubeen Akhtar, Nighat Chughtai and Shaheena Ramzan
...nal propagation of woody species through tissue culture technique has received much importance these days because the multiplication process is quite speedy and the ramets so produced are devoid of pathogens. Plantlets of Ipil Ipil (Leucaena leucocephala) were obtained through multiplication of ex-plants produced from aseptically raised germinates of the species. In the basal media (MS + 5 micro molar BAP), ex-plants ...
Mohammad Ashraf and Shams-ur-Rehman
...lensis are important species being used in afforestation in different parts of Pakistan. These species are hardy enough to minimum moisture and therefore, are very suitable for the hot deserts of this country. Ailanthus altissima is native while Prosopis chilensis has been recently introduced by PFI from Chile. The species was found better than native Prosopis i.e....
Syed Zainul Arifeen
...on of most suitable tree species, their care after planting and integration of other technical soil conservation measures with planting. Participation of the local people in watershed management activities is also suggested in the paper.

...
G.A. Bajwa and H. Gul
... extracts of three plant species, i.e. Azadirachta indica (Neem), Cassia fistula (Amaltas) and Calotropis procera (AK), to test their pesticidal effect, were tried separately and in mixture as growth inhibitor and pesticide in the laboratory against Plusia orichalcea, a serious defoliator of nursery plants being environmentally safe for this purpose seed of A. indica, bark of C. fistula and leaves & tender shoots of
Raza-ul-Haq and Abdul Khaliq Chaudhry
...thod of planting on four species viz. Eucalyptus camaldulensis. Leucaena leucocephala, Acacia nilotica and Acacia modesta at Kharian. Data on survival and growth of these species were recorded.

The survival under different water conservation techniques i.e. contour trenches, micro-catchment and Gradoni was 79%, 78% and 82% respectively while in simple pits it was only 70%. The average highest survival perce...

J.O. Adegbehin and J.E. Onyibe
...plantings of exotic tree species commenced in some parts of northern Nigeria over 40years ago Based on data from permanent sample and temporary plots, site index curves and yield tables were constructed for Pinus caribaea. var hondurensis, one of the promising exotics tried. The constructed site index curves revealed five (5) site classes at a reference age of 20 years; viz: I (25.8m); II (23.2m); III (20.5m) IV (17.8m) and V (15.2m). The growth ...
Muhammad Naqash, Anwar Ali, Ahmad Hussain, Mamoona Wali Muhammad, Ahmad Zamir, Ikram Ul Haq
...he area. Data on type of species, natural regeneration, the density of pits, and number of seed bearers, soil, survival rate and occurrence of any disturbances was collected. The results showed that the pit density was 1261 pits per hectare, while the average number of plants regenerated per hectare is estimated to be 136, some of which were coming out of natural regeneration besides plantations. The average survival rate was 92.36% in Mingora and Matta Forest...
Anwar Ali, Kamran Khan, Ayaz Khan Marwat, Sajid Aman and Irfan Ullah
... survival of seven plant species planted in 2017 in hillside ditches under semi-arid conditions at Paya Muslimabad, District Kohat was carried out. Seven drought resistant tree species were planted in three replications on RCB design. After plantation in 2017 the survival and height data of each species were collected every year in June till 2020 and analysed statistically. Acacia ampli...
Tanvir Hussain, G. M. Nasir, and Khalid Hussain Sulangi
...han temperature, and the species has potential for the climate reconstruction in the study area....
Ayaz Khan Marwat, Kamran Khan, Anwar Ali, Sajid Aman and Irfan Ullah
...survival of twelve plant species planted in 2017 in Roaded Catchments under semi-arid conditions at Mujahid Town, District Lakki Marwat was carried out. Twelve drought resistant tree species were planted in three replications on RCB design. After plantation in 2017 the survival and height data of each plant species were collected every year in June till 2020 and analysed statistically. The...
Siraj-ud-Din and Abdul Waheed Baloch
... of different plant\tree species at Karak and Mianghundi (Quetta) and Mastung districts of Balochistan.
Rainwater harvesting and dry afforestation techniques were compared with conventional method of planting (simple pit planting) of three species viz. Pistacia khinjak, Elaeagnus angustifolium and Atriplex spp. at Mianghundi Quetta. The above techniques were also compared at Karak valley on Atriplex canisence, A. lent...
Khalid Hussain and G. M. Nasir
...se identification of the species, evaluate various technological properties and find out its better utilization. Permanent slides of cross, radial and tangential sections of the wood were prepared by standard laboratory procedures and observed under the microscope. Data were collected for the frequency and dimensional measurements of different wood elements/structures. Results revealed that in Elm wood, the fibers were longer, ...
Tanvir Hussain, G. M. Nasir and Ayaz Khan Marwat
...e manufactured from this species....
Muhammad Muslim and Hafiz Muhammad Sufyan Babar
... study recorded 22 plant species belonging to 20 families. The highest (Relative Density) RD was 13.6% for Valeriana wallichii while the lowest was 0.1% for Arisaema wallichianum and Podophyllum emodi. The RF 12.6% was highest for Adiantum capillus-veneris followed by 10.9% for Viburnum nervosum. Lowest (Relative Frequency) RF was found to be 0.4% for Podophyllum emodi. The maximum (Relative Cover) RC was 11% for Valeriana wallichii and Viburnum nervosum while...
Anwar Ali, Muhmmad Ayaz, Saz Muhammad
...4 sample plots. The tree species sampled predominantly consisted of conifers (85%). The remaining 15% trees were broad-leaved trees belonging to 23 different species. In conifers, Fir (Abies pindrow) is the dominant species (38%) followed by Kail (Pinus wallichiana) with 35%, Deodar (Cedrus deodara) 11% and Spruce (Picea smithiana) with 10% share. The average st...
Iqtidar Hussain and Adnan Noor Shah
...lyptus to different weed species, namely Bindweed, barley, London rocket, wild safflower, Wild oat, common lambsquaters, Bird�s seed grass, Broad leaved dock and Umbrella milkweed .In addition to the control, 10 ml of dry leaf water extract was applied at intervals of 3 days for each treatment. The data obtained after 20 days showed that the fresh weight and dry weight of each tested weed were significantly reduced compared to the treatment with water (control...
Sanam Zarif Satti, Tanvir Ahmad Qureshi, Iftikhar Ahmad and Sumara Zarif
...that among all the plant species highest amount of Carbon (C) in B. aristata (55.63%), Oxygen (O) in C. alba (44.93%), and Magnesium (Mg) in B. monnieri (0.55%) was recorded. Likewise promising concentration of Aluminum (Al) (0.23%) in C. alba, highest value of Silicon (Si) (0.33%) in C. obliqua and Phosphorus (0.32%) in B. variegata was observed, while Aluminum was not detected in B. monnieri and B. variegat...
Naveed Ahmed
...ders, 35 families and 76 species were recorded during the study. Lepidoptera represented by 12 families (35%) comprised of 28 insect species (37%), Coleoptera consisted of 12 families (34%) had 22 insect species (29%), whereas order Homoptera represented by 5 families (14%) with 8 insect species (10%), Hemiptera by 4 families (11%) with 16 insect
Tanvir Hussain and G. M. Nasir
...oefficients of this tree species during the months of August and September of the previous growth year to current growth year because of monthly mean temperature and precipitation. Temperatures during the spring season coupled with the availability of water from precipitation found important for the growth of these trees and this relationship may be used to reconstruct the temperature from the developed chronology for Chitral area....
Zahid Rauf, G. M. Nasir and Sohaib Ahmed
...different low value wood species grown in Khyber Pakhtunkhwa were tested to determine their physico-mechanical properties and evaluate their utilization potential for manufacturing of various wood products. Testing of the standard wood samples prepared from each species was carried as per ISO standards. Results showed that the studied wood species also are used as substitute for the commer...
G. A. Bajwa and Hanif Gul
...ia fast growing tree species of Chinese origin were introduced in different ecological zones of Pakistan. Studies conducted by recording the observations fortnightly on nurseries and plantations at the Pakistan Forest Institute Campus, Peshawar showed that the Paulownia spp. Fell prey to the attack of fourteen insect species like Agrotis ypsilon Rott. (Noctuidae), Aleuroplatus pectiniferus Qui...
Abdul Samad Mumtaz, Mir Ajab Khan and Tanweer Akhtar
...ogical studies of twelve species of the genus Artemisia Linn. (family Asteraceae) were analyzed. Pollen grains in each species differ, especially of those, which resemble in their plant forms (gross morphology). Characters like pollen shape, polar diameter 'P', equatorial diameter 'E', 'P/E' ratio, exine thickness and pore diameter are found considerably important. Artemisia japonica an...
Ghulam Mustafa Nasir and Iqbal Mahmood
...hanical properties of 3 species of (Paulownia fortunei, P. elongate and P. tomentosa) wood grown at Pakistan Forest Institute, Peshawar were studied under standard laboratory procedures. In all the studied species, vessels were found larger in size, the fibres were thin walled and wide lumened and frequency and size of wood rays was somewhat higher. The wood of all the three spec...
Amjad Ali Chaudhry, Muhammad Afzal, Muhammad Mushtaque and Barket Ali Awan
...the top of the palatable species (24.80%). The other species included Eleucine flagellifera (27.52%) and Elionurus hirsutus (13.85%)....
Shams-ur-Rehman
...veral provenances of the species alongwith the data on soil and geoclimatic variables has been collected during the past several years. Seedlings were also grown in a greenhouse to compare the level of association of genetic variation with those observed in the natural stands. An ecotypic level of differentiation has been confirmed with several recommendations to improve plantations of the species in northern Pakistan and ...
Kh. Rizwan Shehzad, Z. H. Malik and Rizwana Aleem Qureshi
...ncy and coverage of each species in the different stands were recorded. It was changed to relative scales and then added together to get the importance value for each species in each stand. Communities were named after the 3 leading dominants. The following five communities were recognized: (I) Melia-Lantana-Stellaria, (II) Morus-Dodonaea Melilotus, (III) Dodonaea-Grewia-Melia, (IV) Stellaria-Zizyphus...
M. Rahim Niazi, G. Habib and M. M. Siddiqui
...ed (P>0.001) due to tree species, but were not affected by location. Ash contents ranged from 4.62 to 17.02 percent of dry matter (DM) and remained higher in the cultivated tree leaves. CP in DM ranged from 7.17 percent in Olea cuspidata to 15.19 percent in Acacia modesta. Mean CP across all the species was 11.10 percent in DM. The ADF and NDF in the leaves ranged from 12.71 to 30.41 and 14.25 to 40.95 percent ...
Mahmood Hossain and Saberi Otham
...early extinction of some species. This study revealed the occurrence of only 9 economically important species belonging to 8 families which generally decreased in the interior of the forest area. Only 4 important tree species viz. Amoora cucullata, Cynometra ramiflora, Ecoecaria agallocha and Heritiera fomes were found in the interior of the area. Heritiera fomes had h...
Wali-ur-Rehman
...es sarta and Aegeria species were recorded in Northern areas and Chitral infesting Populus nigra, P. X-euramericana and P. alba. In Gilgit and the adjoining areas A. sarta caused 80 to 100% infestation of P. x euramericana. At Gahcuch, 70 to 90% each at Jaglot and Sherqilla and 60 to 80% each at Singal, Gulmati, Babur and Gulabpur. P. nigra was infested by the pest from medium to heavy at Singal (60-80%), Jaglot, Sherqill...
Mian Muhammad Shafiq and Abid Ali
... status of large mammals species population was carried out in Khunjerab National Park, Northern Areas. The observation recorded showed that the population of Tibetan Red fox (Vulpes vulpes montana), Snow leopard (Uncia uncia), and Wolf (Canis lupus) have, though a bit, increased but are still in the rank of Endangered. While the population of Himalyan Ibex (Capara ibex sibirica) is increasing more rapidly and their status is...
Muhammad Ibrar Shinwari and Mir Ajab Khan
...this regard. In total 27 species of trees and 24 species of shrubs were recorded as used medicinally by inhabitants of the park. Among these 10 species of trees and 5 species of shrubs are being sold in the local market. Berberis lyceum Royle is found vulnerable to harvesting. Acacia modesta Wall, A. nilotica (L.) Delile, and Dod...
Muhammad Ibrar Shinwari and Mir Ajab Khan
...d to enlist the fuelwood species and to assess their rate of consumption, availability and threats facing by the park authorities. A total of 35 species, belonging to 29 genera and 24 families of wild tree and shrubs, were found to be commonly used as fuelwood in Margalla Hills National Park by the people. Acacia modesta Wall., A. nilotica (L.) Delile, Buxus papillosa C.K. Schneid. and Dodonaea visco...
Mian Muhammad Shafiq
..., 1975). The palaearetic species contain a mixture of those common to a large part of Eurasia, and with those with affinities to the Middle East, Western Asia, Central Asia and Tibet. The rate of endemism is relatively and 11% low (5% for plants, 4% for mammals, none for birds, 10% for reptiles for fish) but the blending of elements from different origins has ensured a diverse and interesting flora and fauna....
Muhammad Afzal
...Seeding cycles vary from species to species and may be 30-100 years (Banik, 1980). Due to long inter-seeding intervals, the propagation is done vegetatively. Bamboo cultivation by rhizome planting is the most common method applied in this country. Normally, it takes 10 years for nonclump-forming (Monopodial) types of Bamboos to reach a size suitable for harvest, but the time is shorter for the clump-forming (Sympodial) types...
Wali-ur-Rehman
...hundred and thirty plant species were recorded as bee flora at the Pakistan Forest Institute, Peshawar and adjoining areas. The data on flora, comprising 39 species of forest trees, 12 of fruit trees, 28 of ornamentals, 13 of agricultural crops and vegetables and 38 of annual herbs, are given in a table with major and minor sources of nectar and pollen and the blooming period of each plant species
Shams-ur-Rehman
...ta of 40 fuelwood/fodder species was made under eight barani and irrigated conditions in Pakistan. The results revealed that the Eucalyptus camaldulensis provenance originating from Australian Northern Territory of Alice Springs, E. nucrotheca and AY-48 clone of Populus deltoids gave the best growth. For fodder, Acacia nilotica, Albizia procera, Leucaena leucocephala and Robinia pseudoacacia were rated best. Steps to bring ab...
Sardar Muhammad Rafique
...tion of grass and forbs species had improved manifolds. The vegetation cover percentage, herbage production, species composition, species distribution and number of species had increased under combined effects of protection and fertilizer application. The Poa alpine - Potentilla fragarioides vegetation type was transformed to Poa alpine - Digi...
M. Mohiuddin and R. Ara
...n behavior of three tree species of medicinal value viz. Terminalia belerica, T. arjuna and Aegle marmelos, was studied in an open nursery at Chiittagong, Bangladesh. The influence of two different water soaking periods viz. 02 and 24 hours, on germination of seeds, sown both in seed bed and polyethylene bag containing a sowing medium of nursery soil and cow dung (3:1), was determined. Seeds of all three species
Md. Serajuddoula, A. S. Khan, M. R. Islam and M. A. H. Shahjalal
..., respectively) planting species. This established man-made mangrove forest along the coastal belt and off shore islands face major problems viz. site suitability, regeneration for second rotation crop and insect infestation under present management system. Considering the sustainability of the existing plantation, research on mesophytic trees has been carried out. Eleven commercially important mesophytic trees species were ...
S. M. Rafique
..., forage production and species composition. Four major variables namely; no grazing, no grazing + over-sowing, conventional grazing + over sowing and conventional grazing only were tested in two replications. The variables were assigned randomly to 4 plots of 10 x 10 m. Each plot was subdivided into two subplots of 10 x 5 m and one sub plot under each major variable was fertilized for 1st 3 years with uniform dose of NPK (1:2:2) at the rate of 100 kg...
Shad K. Khalil, J. G. Mexal and M. Ortiz
...nation of the most plant species. The objective of this study was to evaluate the effect of osmoconditioning on germination speed of Eldarica pine were assessed by seed treatment with different polyethylene different experiement. In experiment 1, seeds were 7, 9, and 11 days with three PEG concentration having water potential of -0.5, -1.1, and -1.8 MPa. In experiment 2 seeds were treated with PEG for 1, 4, 8, and 16 days having water potential of 0, -0.5, -1...
Shaukat Ali
...f young seedlings of the species. Depot was efficient to allow longer and better developed root system as compared to other containers. Total biomass of seedlings in depot by mid-fall was also greater. Seedlings raised in polythene bag competed with depot seedlings till late summer but the former excelled in most of the growth parameters in subsequent period....
Fauzia Balqis Malik and Bashir Hussain Shah
...lopathic effect of three species of Eucalyptus namely Eucalyptus camaldulensis, Eucalyptus citriodora and Eucalyptus terticornis on tow legume vegetables, Pisum sativum and Phaseolus vulgaris was investigated. There is no significant inhibitory effect due to allelochemicals on various growth parameters including yield (weight and number of pods) of Phaseolus vulgaris. However, the growth of Pisum sativum was significantly reduced due to al...
Wang Shiji and Li. Huqun
...ne of the important tree species in arid and semi-arid areas of the world. During the last forty years about 2000 ha euphrate poplar plantations have been established in Xinjiang and Gansu provinces of China. This paper describes the nursery and afforestation techniques for P. euphratica....
Mohammad Noor and Bashir Hussain Shah
...and biomass of five tree species planted in 1983 in a roaded catchment under rainfed conditions at Dagarkotli, were compared. Twenty plants of each of the five fodder tree species were planted in each of 6 replications on RCB design. Survival, growth and airdried biomass data were collected in January, 1994 on each tree species, and analyzed statistically. Acacia modesta, Prosopi...
A. U. Khan, S. Siddique and F. Naz
...e compared with the same species of trees in a relatively cleaner atmosphere. Tree species growing along the Mall reveal departure in their morphological, reproductive and phenological pattern. The amount of lead absorbed by the trees along the road is greater than those growing in the garden but the effect is more pronounced on some than others. The tree Ficus species are better adapted ...
Hanif Gul
...nt localities showed the species wise distribution along with their strength. Wood resistance, trials showed the Dalbergia sissoo, Cedrus deodara and Acacia nilotica as the most resistant wood while Salmalia malabarica and Populus x-euramericana were found as the most susceptible woods. Extractive of the resistant wood were chemically obtained and D. sissoo, C. deodara, extractive have shown resistance against termite...
Mohammad Hafeez and Muhammad Rafique
...val and growth of tree species....
Abdul Khaliq Chaudhry and Jehangir Ghauri
...

Amongst the various species in agroforestry programme, Eucalyptus has established itself as a tree most suitable for Agroforestry, as it can grow on a variety of soils under various climatic conditions. It has desirable qualities, such as fast rate of growth, clean straight bole, thin crown, ornamental value and less shade casting. Besides that, it has multiple uses i.e. poles, pulp, fuel, charcoal, fiber board, chipboard etc. and above all it...

Umeed Khalid, Abdul Ghafoor and Naeem Ashraf Raja
...s listed as a threatened species in IUCN Red Data Book and is regarded as a priority or key species for conservation in Palas. ...
S. M. Raidh, M. K. Hossain and S. Akhtar
...ty seedlings of both the species within three months time and the size may be used in quality seedling production purposes for a short time. But, for large scale plantations, the polybags of T2 treatment (23 x 15 cm size) is the optimal size for raising quality seedlings of Acacia auriculfiormis and the polybags of (30.5 x 15cm size) is optimal size for Chickrassia tabularis....
Muhammad Ayaz
...imensions. Among all the species investigated softwoods are the best material for pulp and paper, followed by bamboos and other grasses. Most of the hardwoods and shrubby materials yield short fiber. To produce a strong paper from hardwoods and shrubby materials use of a pulp furnish of softwoods and/or bamboos is recommended. In addition to fiber dimensions, economic availability is the main governing factor in the use of a raw material for pulp....
Muhammad Shabir Mughal and Muhammad Arif Chaudhary
...ously....
Muhammad Shabir Mughal
...ions. There are over 400 species of Oaks which are distributed in the moist and dry temperate forests of the world. Six species namely Quercus baloot, Q. dilatata, Q. glauca, Q. incana, Q. rubra and Q. semicarpifolia are found in temperate and sub-tropical forests of Pakistan. The key character, brief description, distribution, ecology and uses of these species are discussed....
Bashir Hussain Shah and Mohammad Noor
... five multipurpose tree species under barani conditions planted in the roaded catchments with a trench. The experimental design was randomized complete block with six replications. The plot size was twenty seedlings.

In January, 1994 the survival, height, diameter at breast height (dbh) and biomass data were collected. There was no significant difference among the tree in survival. Acacia albida showed significantly greater growth in height...

Maqsood Ahmed and H. Verplancke
...eeds of three different species. Germination and growth were recorded. Both growth parameters responded positively to the addition of polymer, and negatively to the salt concentration in saturating solutions. A variation was also observed between the species....
K. M. Siddiqui
...e total number of bamboo species worldwide is 1250, out of which Asia has 900 species. Almost all countries of Asia have either natural forests or man-made plantations of bamboo. In Asia the widespread distribution of some bamboo species parallel man's past migration. Bamboo may also have traveled along the several ancient maritime spice routes between China, Indonesia, Sri Lanka...
Ghulam Akbar, Shahid Rafique and Muhammad Asghar
...arm-season exotic grass species were raised and evaluated for above ground dry matter biomass in Mastung and Tomagh areas in upland Balochistan. Tall wheatgrass and pubescent wheatgrass exhibited high dry matter biomass in southern upland region (Mastung) both in fall, 1989 and spring 1990. In north-eastern region (Tomagh), weeping lovegrass outperformed in dry matter biomass production, however, some other species s...
Mohammad Arif Chaudhry
...ts of 5 Paulownia species namely P. australis, P. elongata, P. fortunei, P.tomentosa and P. forgesii indicated that flower bud production occurred in the month of August in the first four species . P. forgesii did not produced any flower buds. The blooming took place in first week of March before foliation. P. elongata flowered earliest of the species in ...
Sahibazada M. Hafeez
...ntify salt tolerant tree species which could be grown in such areas, seeds of 26 salt tolerant species were procured from CSIRO Australia, plants raised in the nursery and then out planted in the field trial during September, 1990. Three years survival and growth data have been analysed and better performing salt tolerant species have been identified. ...
K. M. Siddiqui and Muhammad Tahir Laeeq
...kg seeds of various tree species would be required during this period....
Udo Schickhoff Dr.
... and browsing resistant species. A detailed vegetation mapping has revealed that the potential forest areas have decreased by c. 50%. The historical transformation processes from forests into farm and rangelands can be differentiated into several periods with varying degrees of intensity. It turns out that the dynamics of landscape change are heavily dependent on the general socio-economic conditions. Until the beginning of the nineteenth century the ...
Mohammad Saleem and C. A. Call
...chistan rangelands. Both species were grown in monoculture and in a 50:50 mixture in an 11-month (44-week) greenhouse study. Defoliation treatments were implemented when plants were 32 weeks old; and consisted of: equally clipping (3-cm stubble height) plants in monoculture and mixture zero, one, two or three times at 4-week intervals (32, 36. and 40 weeks after emergence), and clipping (3-cm stubble height) one species in...
Mohammad Saleem and C. A. Call
...sa seedlings. Both species showed evidence of sub-coleoptile internode elongation and sub-coleoptile internode root development characteristic of panicoid-type seedlings. The different types of grass seedling morphology are discussed in relation to seedling establishment on arid and semiarid rangelands....
K. M. Siddiqui and B. H. Shah
...er of multipurpose tree species adapted to the desert environmental conditions in Thal were identified. These were Acacia albida, Acacia tortilis, Acacia elata, Tecoma undulate, Acacia victoriae, Tamarix aphylla, Acacia modesta, and Prosopis cineraria. For semi-arid area of Kharian, Eucalyptus camaldulensis, Acacia saligna, Acacia elata, Acacia albida and Leucaena leucocephala were found to be quite successful....
Wali-ur-Rehman
...eds of 30 out of 70 tree species were infested with 24 insect species. Among them 86% Coleopterous and 5.6% Lepidopterous adults represented 23 species of seed pests while 8.4% adults belonged to a Hymenopterous parasite. 13 of the 24 insect species, identified by the I.I.E. London, belonged to Coleoptera (9 species<...
Raja Atta Ullah Khan
...ortant multipurpose tree species in Punjab which is extensively cultivated on public as well as private lands. It is propagated with root shoot cuttings. Prevailing technique of raising of shisham nursery consists of broadcasting sowing of shisham pods on raised beds and keeping the beds moist with water through trenches till the seed germinates. Although the seed germinates very profusely and the density of seedlings in good nurseries varies...
Hanif Gul and M. Ismail Chaudhry
...s (1950) cited over 100 species and sub-species of nematode associated with insects in France. Ruhm (1956) listed a similar number of nematodes associated with Scolytide in Germany. Masey (1960) recorded several nematodes parasites considerably reducing reproductive potential of bark beetles by causing sterility and in some cases killing the host. Coutruier (1963) described two species<...
Raza-ul-Haq
...ngs, is normal for many species of Abies. This paper discusses the effects of vegetation cover ground conditions and grazing on the establishment and survival of the natural regeneration....
M. Ayaz and G. M. Nasir
...odar, Yew and four pine species were collected from different coniferous forest of Pakistan. The objective was to study their microscopic structure for the preparation of an identification key based on minute anatomy. Results showed clear variations in the occurrence, number, size and type of different anatomical structures, such as resin canals, wood rays pits ray crossing, ray tracheids, procumbent cells, vascular tracheids, pits on vascular tracheid...
Raza-ul-Haq
...-tolerant nature of the species. Age of the planting stocks therefore, plays an important role in the initial survival, establishment and growth of the seedling in natural forests....
Mohammad Rafique Sardar
... biomass of fodder tree species during December, 1991 to January, 1992. Selective parameters of growth of all the sample trees of different fodder tree species were measured. Green weight of stem wood, branch wood, leaves and pods were recorded separately for biomass calculation. Dry weight after 6 weeks was also measured. The results showed that 12 years old Ceratonia siliqua yielded the highest amongst all f...
Abdul Khaliq, Ahmad Hayat and Anwar Hussain
...record for Pakistan. ...
Hakim Shah and Malik Illahi Bakhsh
...Mango (6%) are the main species in irrigated areas. Ber (31%) Phuli (20%), Kiker (19%) and Shisham (7%) are the predominant species in un-irrigated areas. Tree stock mostly consists of young trees. About 75% of all trees have diameter smaller then 24cm. The total estimated volume of growing stock is 46.6 million m3 of which 44.1 million m3 (95%) is in irrigated areas. The per ha volume of growing...
Muhammad Rafique Sardar
...sers (highly palatable) species were reappearing. The estimated forage production was 1234 Kg/per hectare, carrying capacity was 1.1 ha / Markhor / annum and range condition (health) had improved inside the enclosure. The study also suggested detailed investigation on proper use-factor of different forage/browse species, their palatability index and the climax species in park....
Mohammad Noor, Mohammad Khan and Gul Nabi
...ation. Average yield and species composition of grasses, forbs and trees/shrubs were not significantly different in the exclosed and adjacent grazed areas. The higher ( P = 0, 05) forage production and composition of Aristida depressa in the grazed area showed that this species increased under continued grazing. Frequency of grasses, forbs and trees/shrubs was not affected by the exclusion of livestock. The data indic...
Zahid Javid and R. F. Fisher
... non dinitrogen - fixing species are raised. The fast growing hybrid poplar and mulberry deplete the soil of its essential nutrients. The soils under Pinus roxburghii Sarg., Leucaena and Eucalyptus camaldulensis Dehn. Show increased net nitrogen mineralization rates, whereas continuously grazed and leaf-litter harvested sites of mulberry and hybrid poplar (1-214) have comparatively low total soil nitrogen, net nitrogen mineralizati...
Zahid Javid and R. F. Fisher
... non dinitrogen - fixing species are raised. The fast growing hybrid poplar and mulberry deplete the soil of its essential nutrients. The soils under Pinus roxburghii Sarg., Leucaena and Eucalyptus camaldulensis Dehn. Show increased net nitrogen mineralization rates, whereas continuously grazed and leaf-litter harvested sites of mulberry and hybrid poplar (1-214) have comparatively low total soil nitrogen, net nitrogen mineralizati...
S. M. Rafique
...p of volume table of the species....
Muhammad Khurshid Swati and Muhammad Afzal Cheema
...ds on parameters such as species, taper, site quality and density of the crop. At present there is no sound basis for accurate assessment of outturn volume in the form of logs and scants a certain forest. As such forest officers do not have the estimates of the outturn from the.marked trees....
Hakim Shah, Malik Illahi Bakhsh and Mohammad Amjad
...0%) are the pre-dominant species in irrigated areas. Ber (23%) and ailanthus (14%) are the most common trees in un-irrigated areas. The tree stock is mostly concentrated in lower diameter classes. The dia classes 5-9, 10-14 and 15-19 account for 42%, 24% and 13% respectively of the total tree stock.The estimated volume of gowning stock is 14 million m3 of which 10.6 million m3 (76%) is in irrigated areas.The per ha volume of growi...
K. M. Siddiqui
...5 multiple purpose tree species planted in the form of both linear and block plantations in the irrigated plains on state as well as on private farmlands through the country. The results indicate that cost benefit ratio of the plantations under the existing conditions depend upon the tree species, demand and marketability of forest produce and intensity of management practices. Generally, tree planting on the farmland...
Inayat Ullah Chaudhry
...n is home to two otter species i.e. the Himalayan otter, Lutra lutra kutab and Sindh otter L. persipicillata sindica. Locally both species are known as Ludhar. The two species are described in the following paragraphs:

Lutra lutra kutab, SCHINZ 1844; Himalayan Otter or common otter.

...
K. M. Siddiqui
...bundance of forest tree species in some regions of Northern Hemisphere. Similarly, there is evidence to believe that climate has changed in some parts of the world as a result of disappearance of forests. This paper briefly discusses the changes in climate over major parts of Pakistan in the past due to clearance of forests and assesses impact of future climate changes on the remaining forests and future of forestry on the country if present rate of d...
*Nasir M. But, **Noor Mohammad, *Sartaj and *M. I. Sultani
...an....
Bashir Hussain Shah
...he establishment of tree species. Both the survival as well as growth rate of seedlings planted with water conservation techniques was almost double as compares to those planted in simple pits at both sites. At kharian the seedlins of E. camaldulensis showed highly positive response to water conservation techniques by attaining three times height of seedlings planted in simple pits. The response of A. modesta was however, low. A. niloti...
S. H. Iqbal, Shahbaz and Ghazala Nasim
...hizae were prevalent in species of most families including Pinaceae which normally forms the ectomycorrhiza. Fungal hyphae colonized the young roots and formed coils, arbuscules and vesicles inside the cortical cells. Coiled and linear hyphae were very common, digestion stages were observed. Extrametrical mycelium was also found. Some endophytes other then VA, with septate, hyaline or coloured mycelium were found penetrating into the root. A mi...
*Moinuddin Ahmad, **Ehsan Elahi Nagi and **Eugene Liang Min Wang
...lochistan. No other tree species was recorded in the study area. Vegetation composition of the juniper was described. Mean density of juniper was 105 individual ha-1 with a basal area of 18.4m2 ha-1. Juniper density and basal area were significantly correlated (r =.35, P< .05). Density of female trees was higher than male. Healthy trees produced only 21% of heavy (embryonic) seeds. Healthy trees produced only 21% of hea...
G. Stoehr, K. Brunner, J. A. Khan and I. Mahmood
...8 local and two imported species of hickory and ash, in terms of their breaking strength and stiffness. Of the 8 local timber species, white bakain was found to give best overall performance for tool handles. The effect of various factors such as orientation of growth rings in relation to the direction of loading in strength tests on handles and the mechanical properties of wood on the ultimate strength of the handle ...
J. A. Khan
...ntation. Four different species viz ; Shisham (Dalbergia sissoo) , Mulberry (Morus alba) , poplar (Populous spp.) and Semal (Salmalilia malabarica) where tested for loss of strength in relation to storage time. The results indicated that both popular and semal were severely decayed even after a storage period of few months while the other two species were least affected....
Zakaullah
...llows and poplars. Three species of willows, i.e. Salix purpurea, S. seriocarpa, S. tetrasperma and a single species of poplar, Populus nigra (Lombardy poplar) were found commonly grown in the area. Nevertheless, a few hybrid poplars (P. X. euramericana) were also noticed around Phander Rest House. Willows are grown for fodder, basket-making, roof construction and for timber; whereas Lombardy pop...
Raja Walayat Hussain
...ss in green form of four species grown in arid conditions was determined using five growth models. Out of these, allometric model gave a better result which was used for estimation of stem, branch and total weight separately of trees with varying diameter at breast height....
K. M. Siddiqui and M. Khan
...eous. The genus has nine species of fast growing trees indigenous to China with wide distribution from 18 to 40° North latitudes and from 100 to 128° East longitudes. It grows equally well on the plains and in mountainous regions upto 2000 m altitude (Anon, 1986). One of its species (P. tomentosa) was accidentally introduced into United States about 150 years ago and now appears throughout the southern and...
K. M. Siddiqui
...e term multipurpose tree species with acronym of MPTS has been introduced in forestry literature only recently, though, the history of use of such tree species is very old. Almost all trees are multipurpose, some more so than the others. In the early fifties, the emphasis was placed on multiple use of forests for timber, fuelwood, fodder, watershed protection, water, grazing, recreation etc. Later, the idea of communi...
Nasir M. Butt, Noor Mohammad and Rex D. Pieper
... is a widely distributed species in northern Pakistan. It has high forage and fuel wood value. Its nitrogen contributing potential to soil was studied at Lohi Behr Range. Soil samples were taken under and outside of the canopy of phulai trees at various depths. Significantly higher nitrogen content was observed under the canopy. A general trend of decreasing nitrogen with depth was found. Two soil series did not show much difference in nitrogen content. Key w...
Abdur Rashid and A. R. Beg
...luding native and exotic species of Solanaceae, is presented. ...
S. M. Yasin and T. A. Qureshi
...lubles of eight hardwood species was determined as a basis for assessing their suitability for wood cement boards. From the values it is predicted that poplars would provide a better raw material for wood-cement boards than Acacia nilotica Willd., followed by Dalbergia sissoo Roxb., and Tamarix aphylla Vahl., while among the poplars, Populus alba L., would be better than P. deltoides March., P. cilliata Wall., <...
Mahmood Iqbal Shiekh, Saliheen Khan and Hakim Shah
...ood of the various tree species, mostly Dalbergia sissoo Roxb. and Cerdrus deodara (Roxb.ex Lamb) G.Don for the year 1990,1995 and 2000 were worked out to be 18,012, 27,379 and 36,745 m3 respectively....
Editor
...ing on multipurpose tree species (February 15-16,1989)
Home and Foreign News...
K.M. Siddiqui, J. A. Khan and Iqbal Mahmood
...erties of three softwood species growing in dry and wet temperature forests exhibit slow growth rate and high density and strength samples from dry temperate forests exhibit slow growth rate and high density and strength properties than those from wet temperate forest. The results of this study would enable efficient and economical utilization of scarce coniferous timber resources in the country....
M. I. Sheikh, K. M. Siddiqui and S. Rehman
...rboreal varieties of the species have done well under varying climatic and edaphic conditions of Pakistan. The present paper outlines the performance in Pakistan and compares it with a number of South Asian Countries....
Anwar Ahmad Khan and Shakeel Haider Zaidi
...be suitable in both the species. S. khasianum on the basis of better performance and resistance to black shank disease could be recommended for cultivation by pharmaceutical concerns under Peshawar climatic conditions....
Mahmood Iqbal Sheikh
...ite preparation and tree species. The water harvesting methods used i9nvolved preparation of trenches with and without catchments, sloping catchments without a trench, pits and flat ground to serve as control.

The tree species tested included Acacia albida (Sudan). Acacia aneura (Australia), Amodesta, A. tortilis (Sudan), A. victoriae. (Australia), Parkisonia aculeate, Prosopis cinera...

Mohammad Afzal Cheema and Raja Walayat Hussain
...ad Kashmir. Wood of this species is used for cattle troughs, packing cases, veneer sheets and match splints. ...
S. M. Yasin, T. A. Qureshi and S. M. Raza
...iperus excelse) wood species. The durability of these adhesives was also estimated after conditioning the wood joints to 65%, 80% and 95% RH at 35°C. In addition the optimum pressing time for each adhesive was determined. Taking shear strength of walnut wood as a standard for comparison of bonding strength it was observed that different commercial adhesives exhibited highly variable bonding and durability qualities. Rubber based adhesives exhibi...
Hanif Gul, M.I. Chaudhry M. Farooq and Rahmatullah Jan
... Out of the broad leaved species and Cedrus deodara (Roxb Ex. Lanb) G. Don in the coniferous timbers showed antitermitic properties at Peshawar, National Park Lalsoharna (Bahawalpur) and Changa Manga so far.

Wood extractives of Cedrud deodara (Roxb Ex. Lanb) G.Don inner and outer wood portions, Abies webbiana, Lindl., P. roxburghii.Sargent inner and outer portion and Platanus orientalis. L. heart woods were extracted with ...

M. I. Shiekh
...uchistan and Punjab. The species is now naturalized in almost all parts of the country. Prosopis juliflora was introduced in 1912 and has been planted in Lahore (Compounds of the old forest office) etc. While Prosopis glandulosa is occasionally a tree of 6 m high with a trunk of one meter in girth. Prosopis juliflora is the comments tree form in the country. ...
S. Rehman, A. Hussain and S. Ameen
...f indigenous and exotic species and seed sources of Acacia and Prosopis in the nursery gave significant differences among sources indicating the possibilities of selection of best seed sources for afforestation in Pakistan. Further scope of improvement of these species is discussed....
M. I. Sheikh
...ed. Distribution of the species, various nursery and field planting techniques, species trials, rate of growth and yield management of the plantations, water requirement etc. have been discussed....
Jehandar Shah
...nus Swertia L .five new species are described. One new name is proposed. Three new combinations are made....
Qutabuddin Marwat and Naseer Ahmad Khan
...alue. There are 81 plant species in the area, including 15 medicinal plants and 11 grasses....
Mohammad Hafeez
...her more valuable forest species cannot be successfully grown. Mesquite grows fast and can tolerate heat and drought and a variety of soils. It is excellent for firewood and makes superior charcoal. It is an exceptionally high yielder of biomass....
Moinuddin Ahmad
... of similarity, dominant species and floristic composition fifteen community types were recognized. The area shows three ecogeomorphological regions which differentiated into various habitats. Rainfall, temperature altitude, plant cover and vegetation composition show wide variation in the different sectors of the study area....
J.O. Adegbehin, S. Nokoe, J. A. Okojie and G. O. Otegbeye
...plantings of exotic tree species which commenced in the Northern areas of Nigeria over 20 years ago, apart from some species of eucalypts which have been earmarked as promising and mow feature prominently in afforestation programmes in these areas, Pinus caribaea variety hondurensis (out of all the varieties of the species tried) has been identified as the next most promising...
Mohammad Afzal Cheema and Raja Walayat Hussain
...oad leaved. Wood of this species is used for furniture, carriages, small table tops, toys, and solid wheels of country carts. The tree grows to a large size specially under favourable conditions....
Mahmood Iqbal Sheikh
...a matter of fact several species of flora and fauna are on the verge of extinction. All wildlife in Pakistan as to lean so heavily on assorted vegetation for shelter, food, survival and multiplication. The article brings into sharp focus the necessity of giving maximum attention to the protection of habitat to save whatever is left of the wildlife in Pakistan....
Zakaullah, Jehan Ara and Abdul Jabbar
...w hosts including timber species, orchard plants, condiments, medicinal herbs and weeds. However, earlier workers (Ahmad 1956, 1956, 1978; Spaudling 1961; Sadiq and Shah 1986) have significantly contributed to the records of fungi and their hosts occurring in different regions of the country. The present article describes the fungi comprising 3 Classes: Ascomycetes, Basidiomycetes and Fungi Imperfect with information on habitat, locality and date of col...
Mirza Hakim Khan Dr.
...ectares. Most important species in plantation are: Poplar, Willows, Equalyptus, Alder and Pines. Natural geographical regions are Black sea, Marmara sea, Aegean sea, Mediterranean and Central Anatolia. Successful mechanical operations in the forests are carried out during all plantation campaigns....
Mohammad Afzal Cheema, Mohammad Aliul Hassnain Fatime and Raja Walayat Hussain
...te of other broad leaved species in high hill coniferous forests of N.W.F.P., Punjab and Azad Kashmir. Its wood is pale pink, soft and used for light constructional work, packing cases water troughs and furniture. The tree grows to a large size specially under favourable conditions. It is a moderate light demander and has good coppicing power....
Hanif Gul and M. Ismail Chaudhry
... spaced planting of tree species susceptible to nematodes may promote an increase in the nematode population that result in an unacceptably large decrease in rate of growth. Nematode diseases are one of the causes of poor crop yield on the old farmlands and contributed to their abandonment....
Raja Walayat Hussain and M. Afzal Cheema
...quite sometime back. The species adopted well to the prevalent climatic and edaphic conditions....
Qaisar Ali, Mohammad Yousaf Wazir and Mirza Hakim Khan
...indicated that some tree species like Phoenix dactylifera and fodder plants like Diplachne fusca and Juncus maritimus can be tried successfully in the area for land reclamation and range management....
Abdul Aziz Memon
...ed Biri-Leaf Tree species, in Sind province, arises out of the necessity, which can be measured and is underlined with the following figures of foreign exchange being spent on the import of Biri-Leaves and distribution thereof among the four provinces. (T.C.P.)...
Raja Walayat Hussain and M. I. Sheikh
...t suitable for growth of species/ poplar clones. Original spacing was 10' x 6' (3 x 2 m) and one year old entire plants were transplanted at the above spacing in RCB design with four replications. First thinning was done in the crop in autumn of 1980 but it was rather on conservative side. The crop gave a congested appearance on visit in September 1984. Therefore second thinning was done giving a release to the left over plants to put up better growth....
M.I. Sheikh
...enty five plants of each species were planted in a replication in each depth of planting at 2 x 2 metres spacing. The plants were planted at two depths i.e. 30 cm and 18 cm in the pits of 0.5 meter diameter...
K.M. Siddiqui and Iqbal Mahmood
...rowing Eucalyptus species which are currently extensively being planted in Pakistan. The strength properties of three species viz. E. tereticornis, E.kitsoniana and E. sidropholia were determined and found to better than those of commonly grown local species of hard-wood. The results of current study indicate good utilization potential of these Eucalyptus
Charles D. Bonham, Javed Ahmed and Larry L. Larson
...ements of vascular plant species and the physical attributes of the site. Data analyses included principal component, McNaughton and Wolf's niche index, and discriminate and canonical analyses. The analyses techniques identified under story sensitivity to aspect, elevation, and soil profile attributes that influence soil moisture. The under story species studied exhibited a relative independence to over story composit...
K. M. Siddiqui and Iqbal Mahmood
...orted values of the same species in the literature. The strength properties of locally available walnut wood are somewhat better than those reported in India for the same species and in Canada and West Germany for Juglans nigra and J. regia respectively. The testing was done in air-dry condition in accordance with standard procedures....
Shams-ur-Rehman and Altaf Hussain
...netic improvement in the species are discussed in irrigated plantations of Pakistan. ...
K.M. Siddiqui, M.I. Sheikh and S. Rehman
...of progenies/clones. The species can be easily propagated asexually and the application of hormone had no significant effect on rooting. The narrow and broad-sense heritability was low emphasizing the importance of uniform site conditions and inclusion of a large number of progenies and clones in test plantations. These investigations suggest that a suitable breeding strategy would further bring about genetic improvement in Populus ciliata....
Mahmood Iqbal Sheikh
...growth of different tree species over a period of time. With a view to finding out as to how Dalbergia sissoo, Salmalia malabarica, Eucalyptus citriodora and Populus deltoides 1-63/51 would compare under the climatic conditions obtaining in Peshawar, a study was laid-out in February, 1978. 120 plants of each species were planted in 16 subplots at a spacing of 4 x 4 m. In each subplot, 30 plants were planted...
Muhammad Shafiq and M. I. Nizami
...suitability of some tree species. Four tree species (Leucaena leucocephala, Euclayptus camaldulensis, Morus alba and Ailanthus altissima) were tested during the year 1983-84 at Mangial (Fateh-Jang) under rain fed conditions. The survival percentage was 86, 88, 73 and 77 whereas mean monthly growth (height) attained was 18cm, 16cm and 4cm respectively....
M. Afzal Cheema and Mohammad Aliul Hassanin Fatime
... of volume tables of the species. After supplementing the above data from Azad Kashmir the present volume tables have been prepared....
K. M. Siddiqui, S. Rehman and A. Hussain
...lts of Eucalyptus species trials at three locations in Pakistan have shown that the survival and growth rate of Eucalyptus kitsoniana are high as compared to other species of this genus. Large scale planting of this species is recommended in afforestation programmes in the country....
Sultan Maqsood Khan
... of desirable adaptable species, soil and water conservation, range suitability classification, crossing local cattle with yak, preventive medication, increasing off takes and extension practices....
G. M. Baloch, M. I. Arif and M. Irshad
.... As a result of this 20 species of insects and a disease of Lonicera spp., 12 species of insects on Ribes spp. and 8 species of insects on P. tuberose were recorded. Among these, 6 insects (Alucita spilodesma Meyr., Psychromnes stra phaeothicta Meyr., Phyllonorycter montanella Bradley, Caloptilia delosticata Meyr., Paraphytomyza sp. a...
M. A. Ogigirigi and A. B. I. Igboanugo
...f exotic and native tree species were exposed by digging trenches adjacent to tree stands in plantation at four vegetative zones of varying dryness and soil types (Afaka, Miango and Nimbia ) in Nigeria. Root size and distribution were measured and compared at three determined depths along the soil profiles. Although all the soil types have a layer of hard iron crust (plinthite layer) with in a depth of 40-60 cm in the soil the roots of the exotics were...
S.M. Chughtai, Abdus Sadiq and Sardar Hussain Shah
...ndus was the pioneer species which dominated the old field in the first autumn. In summer, Conyza bonariensis shared the dominance with C. rotundus. The spring vegetation was dominated by Coronopus didymus. Of the total 45 species recorded in four seasons, only 13.3 percent were found to be exclusively confined to spring season. In the second autumn of abandonment, Amaranthus viridus be...
A. Mahmood and Tariq Mahmood
...cana whereas in the species lignin content of trunk and branch wood showed little variation. ...
Mahmood Iqbal Sheikh
... Most of the indigenous species are rather slow growing and take a long time to mature. The existing deficiencies can only be met through planting of local and exotic fast growing tree species such as poplars and willows in climatically suitable areas. Exotic poplars were, therefore, introduced in late fifties. Over a period of time techniques of scientific production of nursery stock and field planting have been dev...
S. H. Bangash and B. N. Gardiner
...r boron levels in these species. ...
M.I. Sheikh, R. W. Hussain and M. Khan
...e of growth of four tree species planted in the agricultural fields has been compared. Populus deltoides I-63/51 has come out the best after six years for all the three parameters, viz, diameter, height and volume. For quantity of wood available on first thinnings Populus deltoides I-63/51 is followed by Salmalia malabarica, Eucalyptus citriodora and Datbergia sissoo. ...
M. A. Latif, S. A. Khan and M. K. Bhuiyan
...> is a fast-growing tree species of the family Leguminosae. In the Forest Research Institute campus, Chittagong, 80 seedlings were planted in 1979. At the age of 4 and half years the trees attained an average height of 10.3 m with 10.4 cm diameter at breast height. The growth rate is comparable to that of Eucalyptus camaldulensis and better then that of Pinus caribaea and Swietenia macrophylla which were planted simultaneously. The
Ioryisa Verinumbe
...made from Nigerian-grown species, to determine some physical and mechanical properties. The plywood contains 3 plies: 1mm thick Antiaries Africana facings and 4mm thick Terminalia superba as core. Static binding strength, impact strength, density, moisture content, and glue bond quality were determined as specified in B.S. 4512 (1969) and B.S.1445 (1972). modulus of rupture (MOR), modulus of elasticity (MOE), impact strength, density, moisture content a...
Mohammad Noor
...mpared with other forage species. The two ecotypes of Festuca elatior did not show any significant difference in the air-dried forage production between themselves. Phalaris tuberose produced less air dried forage in both the harvesting seasons. None of the ecotypes / species showed any significant difference in the number of established plants among themselves except Festuca elatior (Kenwell) whi...
S. Fazal Hussain and Arfa Yasmin
...ntent of Berberis species found in the forests of Punjab and N.W.F.P. The study would help in process development and its economic feasibility evaluation....
Pazir Gul, Salahuddin Khan and F. W. Khan
...alba and other Datura species. It was concluded that this oil was of the same nature as those of the other Datura species and could be similarly used in medicine....
Abdur Rashid Tariq and Haji Moosa A. Tayab
...cv: Pioneer as a pasture species was undertaken in the United Arab Emirates in 1981 for the first time from the seed stock imported from Australia. The purpose was to provide fodder for the rapidly developing livestock population of the country. In the beginning an area of 200 hectares was brought under a crop of Pioneer Rhodes grass on sprinkler system of irrigation. The irrigation water of these sites was drawn from the subsoil and it contained 3500ppm of di...
S. M. Chughtai, Abdus Sadiq and S. Zahir Shah
...l. The rare arborescent species are Acacia modesta, Maytenus royleanus, Reptonia buxifolia, Olea ferruginea and Sageretia thea var. brandrethiana; but none of them is perpetual. The area is much disturbed biotic ally and A. modesta seems to be the prime target of fuel hunters. ...
Zakaullah, Mohammad Irfanul Haque and Khial Badshah
...2 timber and fruit plant species some of which had been reported earlier L. longiflorus was more prevalent particularly on old trees of Acacia modesta, while L. pulverulenrus had comparatively low incidence. Only four host species were found commonly attacked by both parasites. For the rest of 28 species they were host specific. L. pulverulentus is a new record ...
M. Aliul Hassnain Fatime and S. Hasan Abbas
...lly important coniferous species of Azad Kashmir i.e. deodar (Cedrus deodara) Kail (Pinus wallichiana), Chir (P. roxburghii) and fir (Abies pindrow) were originally prepared by Malik et al. (1971), based on the data collected from the forests of Azad Kashmir. As spruce (Picea smithiana) forms a small percentage of the coniferous forest and has also a close relationship with fir in height and form for the same diameter...
K.M. Siddiqui
... on wood samples of this species on laboratory scale are presented in this article. Trial cooks were made to determine the most suitable kraft (sulphate) pulping conditions for producing bleachable pulp with Kappa number of about 25 from 15 chir pine trees of three age groups. In laboratory tests trees of 36 - 45 years age gave maximum pulp yield. However, hand sheets prepared from the pulp of 26 - 35 years-old trees had higher breaking length and burst...
M.I. Sheikh, Bashir Hussain Shah and Abdul Aleem
...vival and growth of tree species and experiment was laid put at Rakh Dagar Kotli in Thal desert. Acacia modesta and A. torrilis were planted with plastic apron, stone pitching, and grass mulch and without mulch in March, 1981. Observations after one year and two months revealed that the mulches did not have any effect on the survival of plants. However, out of the lour treatments, plastic aprons were significantly effective in improving t...
M.I. Sheikh and Sultan Maqsood Khan
...no watering on 4 fodder species viz. Leucaenea leucocephala, Robinia pseudocaeia, Ceretonia siliqua and Tecoma undulate during July, 1982. By November, 1982 it was found that species differ appreciably in the survival percentage as well as the average height of survived plants. The irrigation frequencies had a differential effect on the biomass production of leucaenea and the height of trees but not on ...
Mohammad Noor
...lovers (Trifolium species) were sown in November, 1978 under barani conditions at Jaba. Trifolium hybridum produced maximum air-dried forage in April, 1979 . Trifolium hybridum and Trifolium incarnatum produced significantly more air dried forage (2200 kg/ha and 2160 kg/ha) as compared with Trifolium pratense,(1007 kg/ha). There was no significant difference in forage production between Trifolium hybridum and <...
Anjum Amin and Raja Mohammad Ashfaq
...e most important forage species occurring in these valleys but also suggest the best use of these species in the correct season of grazing. Productivity and phonological studies involved important forage species such as Dactylis glomerata, Festuca elatior, Festuca arundinacea, Phalaris tuberose. Sorghum helepense, Lolium multiflorum, Lolium perenne, Trifolium pratense, Trifolium ...
Ashiq Ahmad
...unting. To introduce the species back, 10 animals were donated by World Wildlife Fund in 1970 which were kept in an enclosure having 518 ha area. Original stock of 10 blackbuck increased to 34 only by 1982 which is quite a slow progress....
M. I. Shiekh and B. H. Shah
...h rate of both the tree species. ...
R. W. Hussain and S. Hasan Abbas
...00 trees per acre of the species were available at the above age i.e. planting was done with a spacing of 10″ x 6″ and no thinning was done and only 26 trees were lost on account of mortality or other factors. Under proper management the actual number of trees constituting main crop at the above age is almost half of the above figures. Therefore mean annual increment is less and ranges between 250cft to 400cft per acre for this spacing....
M. I. Shiekh-Raza-ul-Haq
...uired by different tree species for their survival and optimum growth has not been known. A study was started in Chichawatni plantation to ascertain the effect of three deltas of water viz.3,4.5 and 6 feet in four species Eucalyptus camaldulensis, Bombax malabarica, Morus alba and four exotic clones of poplars. It was found that there was almost linear relationship between the depths of water applied and volum...
K.M. Siddiqui and Shamsur-Rehman Khan
...owth performance of this species appears to be better than most of the Eucalypt species currently being planted in Pakistan....
M.I. Sheikh, B. H. Shah and A. Aleem
...ythene tubes. Three tree species viz: Acacia aneura, A. tortilis and Tecoma undulata were planted at two depths i.e., 30 and 18 cm in July 1980. After one and half year it was found that in deep planting 64% plants of all species survived and in shallow planting 54%. In both depths maximum survival was of A. tortilis being 75% followed by 58% of T.undulata and 44% of A.aneura. In dee...
Mohammad Ayaz
... most important softwood species of Pakistan. It is extensively used on account of its properties e.g., lighter weight, straight grain, good seasoning and working characteristics and high durability. One of its important uses is the manufacture of containers for various items. However, tarnishing of the metal surface of the material kept in deodar containers is generally observed. This difficulty arises due to the presence of oleo-resins in the wood which ar...
Anjum Amin and Raja Mohammad Ashfaque
...Importance value of tree species and Summation value of herbs and shrubs. The ubiquitous presence of regeneration of Acacia modesta in all the habitats least effect of topography and the highest summation values of the regeneration of Acacia modesta, lantana camara, Ehretia obtusifolia, Dodonaea viscosa and Zizyphus nummularia indicates future trend of the vegetation with the probable chances of Olea cuspidate and Sageretia bran...
Mahmood Iqbal Sheikh
...One year old plants of 3 species viz. Acacia victoriae, Acacia aneura (Australia) and A. tortilis (Sudan) were planted in August 1979. One hand watering was given at the time of planting. 16 plants of each species were planted in one plot at 2 x 2 m, in 5 replications; 80 plants each of the three species, 240 plants in all. The study was assessed in October, 1982....
M.I. Sheikh and Raza-ul-Haq
...> (Shisham) is the major species planted in the irrigated plantations and riverain forests over a period of time. It can be regenerated from root suckers, from coppice and by planting root-shoot cuttings. For the last one hundred years the tree has been planted at a conventional spacing of 6 x 10 ft. To release the congestion and depending on the condition of the crop, first thinning is done in the 6th year, the second in the 12th, another in the 18th year if...
Mahmood Iqbal Sheikh and Raza-ul-Haq
...1978. 120 plants of each species were planted in 16 sub-plots at a spacing of 4 x 4 m. In each sub-plot a randomised complete block design, replicated 4 times....
Mahmood Iqbal Sheikh and Raza-ul-Haq
...ival and growth of three species viz. Eucalyptus camaldulensis, Ceratonia siliqua (Carbo) and Zizyphus mauritiana (Ber). While major treatments were deep and shallow ploughing, minor treatments were (i) shallow planting with mulch, (ii) shallow planting without mulch, (iii) deep planting with mulch and (iv) weep planting without mulch in three replications. Size of the plot was 50 x 20 m. Out of this 3 subplots of 17 x 6.5 m were ploughed upto a ...
Ghulam Rasul
...ographical races of this species viz; Himalayan Ibex or Alpine Ibex, Siberian Ibex, Spanish Ibex and Caucasian Ibex....
Pazir Gul and Fazli Wahid Khan
...e of seeds of and exotic species of Quercus incana. The result compared well and justified the exploitation of the indigenous Quercus as a poultry and live-stock feed on a cottage Industry level. It was also concluded that because of their high carbohydrate content they can be used for the preparation of alcohol by fermentation....
M. Saleem Khattak, Hafiz Inayatullah and Sharafat Khan
...uttings of the aforesaid species. Better routings (22.25%) were produced with Indole 3-butyric acid at 6000PPM as compared to I.A.A. and NAA. The non-treated cuttings totally failed to produce any roots. The number and length of roots per cutting were greater with 9000 PPM of Indole butyric acid. In general the effect of 1-Naphthalene acetic acid was found comparatively inferior Indole 3-acetic acid and Indole 3-butyric acid. ...
Raja Walayat Hussain and Mahmood Iqbal Sheikh
...00 trees per acre of the species were available at the above age, that is, planting was dine with a spacing of 10'x 6', no thinning was done up to the age of 6 years and only 26 trees were lost on account of mortality and other factors up to this age. This plantation was however not maintained properly, no soil cultivation was done and irrigation was erratic. Since hybrid poplar had been tried in different plantations with varying spacing since 1...
Adil Al-Kinany
...ermination period of the species seed. This treatment excelled all others tested on this score.GA3 at a concentration of 200 ppm significantly enhanced the length of transplant roots, while P5 had no significant influence on all the characters observed. Similarly, CO2-gas exchange level of transplants was found to be of the same magnitude in different treatments....
Sarfaraz Hussain Bangash and Mahmood Iqbal Sheikh
...on different forest tree species at seeding stage, a study was conducted in Pakistan Forest Institute, Peshawar during 1980. Data indicate that the Greenzit nutrient solution significantly increases the height growth of Eucalyptus camaldulensis, Juniperus excelsa and Pinus reoxburghii seedlings. However, there seems to be no positive response of the nutrient on diameter of species under study....
Mohammad Noor
...Six grass and six legume species were sown i.e. November, 1977 under barani conditions at Peshawar (av, rainfall 350 mm) in eleven blocks. Festuca arundinacea (R.M. No.70) produced maximum green and air dried forage in April 1978. There was no significant difference of forage production amongst the Medicago spp. and Vicia spp. Forage production of grasses was significantly more as compared to Medicago spp. and Vicia spp. How...
K.M. Siddiqui and Mohammad Pervez
...ent seed sources of this species in these studies. It was observed that the viability of blue pine seed is significantly reduced within short period if it is stored at high temperature. Seed stored in dry cold or stratified condition retains its viability and maximum terminations per cant as well as speed of germination are obtained if the seed is stratified for 120 days. Insecticidal treatment of seed in storage adversely affects its germination. Larg...
Mahmood Iqbal Sheikh
...growth of different tree species, under climatic conditions obtaining in Peshawar, three studies were laid out in the Pakistan Forest Institute in 1977. In all the three studies one year old tube plants were used. Planting was done just after rain....
Sultan Maqsood Khan
... production of desirable species, undesirable species, Chrysopogon aucheri and Cymbopogon martini. However, both nitrogen and phosphorus, when applied separately had no effect on the production of total forage, grass, any palatability class or any important forage species. No fertilizer treatment appreciably affected the forage production of intermediate
Sultan Maqsood Khan
...t of undesirable forage species on field boundaries and range fertilization can further increase for age production by 27 and 128 thousand tones respectively. In this way the annual forage production can be increased to 1604 thousand tones and the animal units to 628 thousand. At the present level of efficiency of conversion of feed to animal products, they can be increased 2.9 times by increasing their feed production through better management. ...
Relph R. Stewart
...d to be similar to modem species and some I could not identify. The most interesting seemed to be a Ginkgo or a fem leaflet resembling it. I named the specimens as far as I could, without a great deal of microscopic work, and gave a list to Dr. de Terra which he published in 1939 in De Terra, H. and Patterson, T.T., Studies on the Ice Age in India and Associated Human Cultures. Carnegie Inst., Washington, D.C....
Mahmood Iqbal Sheikh
... seeds of different tree species do not germinate easily, mostly due to a hard seed coat, seeds of Melia azedarach, Zizyphus mauritiana and Cassia fistula were put to miscellaneous treatments....
Adil Al-Kinany
...sden. The choice of the species for this work was predominantly guided by their close similarity in silvicultural behavior with economically important species of Iraq. The IBA and NAA treatments of the four experiments were laid in randomized complete block design, each treatments being replicated three times with 18-20 cuttings per replication. The results of the study showed that IBA up to 4000 ppm in mixture with ...
Raja Walayat Hussain
...t of sample plots of the species in irrigated plantations of the Punjab, data were collected from 230 trees, ranging in diameter at breast height from 2 in. (5 cm) to 14 in. (36 cm). These trees were removed in thinnings. Data from about 1070 trees were made available by Genetics branch of Pakistan Forest Institute who felled some plots of this species last year. The latter group of data consisted of small sized trees. In...
K.M. Siddiqui and Altaf Hussain
...comparative growth of 52 species of Eucalyptus at Peshawar at the age of 10 years. Significant differences of survival and height and diameter growth of different species are reported. In addition to commonly planted species of Eucalyptus, other species have also shown promising growth in this study. ...
Safia Khanum, Farrukh Hussain and Himayat Hussain Naqvi
...on aucheri. Both the species exhibited self-toxicity. The toxicity of each species depended up to the amount of material soaked, soaking duration, freshness of the material assayed and the test species used....
Mohammad Hanif
...ad 8098 trees of various species, 29 check dams and 7 spillways, Missa control, 3218 trees and 3 spillways. During the period of study (January 1973 to December 1978) 4828 mm rainfall was received in 348 rainy days. Of this, 3536 mm (73%) occurred in 143 rainstorms and was effective to produce runoff. The capacity of the experimental watershed to reduce runoff and sediment decreased from 1973 to1977 due probably to the siltation of check dams and the destruc...
Khial Badshah and Zakaullah
...everely attacked by a species of Fusarium causing longitudinal stripes on the stem and chlorotic spots on leaves which wilt and fall prematuiely. The pathogen was found to invade the plants through injured roots. Plant debris, infected young transplanting mateiial and seeds served as source of infection. The pathogen proved specific to Ocimum spp.

Vergouskii (1958) studied some peculiarities in the development of Fusariosis in basi...

Mahmood Iqbal Sheikh
...rizonica as the test species. The method involves supply of water direct to the plant roots through sub-surface irrigation. Since there would be no loss of water due to evaporation or seepage, the plants are supplied with a quantity just sufficient for their survival and growth....
K.M. Siddiqui and Mohammad Parvez
...e over all range of this species is 25° 30' to 36° 10' north latitude and 69° to 98° east longitude in the countries of Afghanistan, India, Pakistan, Nepal, Bhutan and China (Critchfield and Little, 1963). The range of natural distribution of blue pine is continuous over a greater part of the tract but isolated patches of this species are also found in extreme west and east of this range. The distribution...
Mahmood Iqbal Sheikh
...ars back. Although the species is actually a native of the USA and grows from mid west all the way to the south, the seed was imported from Japan, where it has been extensively planted to cover the bare hill slopes. The plant being leguminous improves and binds the soil and is a nutritious fodder. The plants in the first instance were raised in Silvicultural Research Nursery, Lahore and planted in different climatic zones in the country. The sites incl...
K.M. Siddiqui and M. Khan
... the lowest level of the species altitudinal range e.g. 1000 meters. About a kilogram of this seed was procured and sown in the nursery at Nawanshehr (Abbottabad) alongwith the seed of this species which was collected from seed stands selected from amongst the best natural stands of chir pine in the same locality under our Agricultural Research Council project (1). This note compares the performance of one year ...
Mahmood Iqbal Sheikh and Abdul Aleem
...gia) is an important species of the Himalayan Moist Temperate Forests. Because of its high value for ornamental veneer, attempts are being made to grow it artificially. Usual methods are: planting one year old bare rooted nursery raised stock, and dibbling of seed. In the Murree Hills, dibbling of seed has been the usual method with poor results. This investigation was started to find the best method of growing walnut in that area....
Nasim Akhtar, Himayat Husssain Naqvi and Farrukh Hussain
...growth but also to other species used in the bioassays. The toxicity in both the cases increased with increasing concentration and soaking time. Cinhrus had more allopathic potentiality than Chrysopogon. The toxicity in both the cases was species slated. The possible effect of allelopathy of these grasses is discussed in relation to the vegetation dynamics....
M.A. Quraishi, A. Khalique, Shahida Perveen and Perveen Akhtar
...eb as the principle tree species and a plenty of shrub growth in much open spaces (Troup, 1921; Champion et al., 1965). The average number of juniper trees per hectare have been estimated at hardly twenty eight (Khattak, 1976) and Caragana ambigua and Pervoskia abrotenoides are amongst the most frequent of the shrubs. Caragana is a medium sized bush growing on gritty sites while Pervoskia is a herb with bulbous thick ta...
Moinuddin Ahmad, Asrar Hussain and Tariq Hussain
...ighly correlated. ...
Mahmood Iqbal Sheikh
...d out to be a very hardy species and has survived the extremely cold and dry conditions of Ziarat (Baluchistan)....
M. A. Quraishi, A. Khalique, Shahida Perveen and Perveen Akhtar
...ts it mainly infects the species of Juniperus (Hawksworth 1972) During British India, Brandis (1906) and Parker (1924) reported it on juniper but its pathological significance was brought up recently by Jamal and Beg (1974) while conducting a survey of the diseases of forest trees. According to Zaka (1977) about 36 percent of the trees in Sasnamana forest are infected. The only known control method for the control of the pruning of infected brunches. But this ...
S. Maqsood Khan
...han in the open. All the species recorded in the grazed area were also found inside the exclosure, but with lower forage yield and frequency, while some new more palatable species got established inside the protected area....
M.Iqbal Ahmad, I. A. Hafiz and M. Ismail Chaudhry
...chinar and several other species and widely distributed in Pakistan. Beetles measuring 35 mm (female) and 32 mm (male) emerge from 20th March to 15th April with peak emergence during 1st to 10th April. They mate in 8 hours to 2 days after emergence with a copulation period of 5 to 25 minutes. Longevity of males is 7 to 15 days while females live for 19 to 25 days. While elliptical eggs measuring 3.1to 4.9 mm are laid in clusters 1 to 5 emergences usually at ni...
M. A. Quraishi, A. Khalique, Shahida Perveen and Perveen Akhtar
...al regeneration of this species is scanty and efforts are being made to plant it.
The aim of the present investigation was to gain information about the water balance factors of this species under natural conditions....
Sarfaraz Hussain Bangash
...eds and seedlings of six species: Acacia arabica, Albizzia lebbek. Parkinsonia aculeate, Prosopis spicigera, Robinia pseudoacacia, Zizphus jujube. The salt concentration was varied from 0.05% to 0.80% for all species. It was found that under the experimental condition Zizyphus jujube, Albizzia lebbek and Acacia Arabica were the most salt tolerant of the species studied...
M. A. Quraishi and Abdul Khalique
... in Pakistan. All the 57 species examined were found capable of farming ectorophic mycorrhizae. General structure of mycorrhizae encountered is the same as described for euclypts growing in Australia. Based on their characteristics, three types of mycorrhizae were identified, viz., white nodular, white pyramidal and brown pyramidal. Of these, the last named was the most prevalent and was described....
S. M. Chaghtai and Mohammad Yusuf
...the relationship between species diversity and its components was studied. Species diversity and its components were correlated with the structural characteristics of the communities. The general behavior of some important species has also been discussed....
Ghaus Mohammad Khattak
...o babul as the principal species in the irrigated plantations. The Sind riverain forest of babul and kandi are managed the clear-felling system with broad-cast sowing in receding flood water. Aerial seeding is being increasingly employed since 1974. Yield regulation is by area. Areas threatened by river action are given the highest preference in cutting followed by burnt areas, dead-wood, windfalls and special purpose fellings and the balance of the year's pr...
Abdul Khalique and A. R. Beg.
...ldulensis Dehn., - a species extensively planted under irrigated conditions in Pakistan (Khan, 1955). Presented here is the description of an ectomycorrhiza in this species which is adversely affected by soil salinity....
M. Ismail Chaudhry, Bashir Hussain Shah and Hanif Gul
..., 100% mortality of both species was observed due to virus infection while 62% and 63% larvae of A. segetum and A. ypsilon. Pupated successfully in check treatment....
M. A. Tahir
...ing soft wood industrial species....
Raja Walayat Hussain and Zaheer Ahmad
...mong fast growing tree species owing to their intrinsic qualities and in Poplar clone 1-214, in particular, which is a natural selection and has widely been cultivated in Europe (Sheikh)....
F. W. Khan and Pazir Gul
...owed that the indigenous species was of good quality and can be used in the manufacture of mild mercurous chloride pills. Yield and chemical characteristics of the oil from the seed of the Indigenous species were compared favorably with those of the exotic species given in the literature. It was observed that the oil, being of semi-drying type, can be used in cosmetics and varnish industr...
Mohammad Yasin and Qaim Hussain Shah
K.M. Siddiqui and M. Saleem Khattak
...aphic variation in the species. Studies carried out in the past have shown that pollen and seed travel relatively short distances and gene flow is limited enough to promote genetic differentiation (Wright, 1953, 1962; Strand, 1967; Sluder, 1969). On the other hand, though it implies that breeding unit is small in most tree species, even in those species with arealy con...
M.Ismail Chaudhry and Bashir Hussain Shah
...untry fast growing tree species like poplars and eucalyptus are being introduced. Poplar wood is very useful for paper-pulp, match and plywood industries. With the separation of East Pakistan where most of the match and paper industries were situated, the country is facing a grave situation. A huge amount of foreign exchange is being spent on import of these products and the government is planning to establish match and paper industries...
Sultan Maqsood Khan
...uction of suitable grass species is important for the production of good quality water and for increasing effective life if the Mangla reservoir by retarding its siltation rate. To find out suitable species for introduction in the Mangla watershed project area (dry sub-tropical) grass introduction trials with 39 cotypes of 14 species are being carried out in collaboration with Watershed Ma...
A. R. Beg
...oxb.) Nees is a tropical species. As a natural growth, it is extremely rare and is known to occur only at a very few places in Pakistan. It was recorded so far in the Margalla Hills, Nurpur Hills and Chattar, Islamabad-Murree Road, in eastern Salt Range and Shahpur, Kandi and in Billawar, Mirpur, Udhampur and Jammu upto an altitude of 800 m (Stewart, 1972). During a recent visit to Buner, the present author spotted a few clumps growing i...
K.M. Siddiqui
...f selected trees of this species. Seedlings within families were selected for straightness of stem and height growth. Selection thinning in the experimental plantation will leave only the best individual trees to produce seed. Seedlings were assigned to blocks according to size ranking within the families, with a view to reduce the influence of nursery environment variation on the selection outcome. ...
Ali Akbar Khan
...nsity, varying slope and species composition of Kaghan Reserved Forests, were sampled, by prism of B.A.F. 20 and also enumerated totally. This paper is confined to the discussion of conifers only. The deviation of Basal Area varies from 13 to 29%for different compartments. The compartment wise variation between total number of trees and total volume with prism sampling and total enumeration ranged from 12 to 46% and 11 to 28% respectively. The variatio...
Jalal-ud-Din and M. Farooq
...r shisham and other tree species under irrigation. Under the existing conditions of arid climate and shortage of irrigation water the problematic soils could better be used for original flora or drought/salt resistant tree species. If, however, sufficient water is made available for intensive forestry, the reclamation of saline-sodic soils could be undertaken by using gypsum and growing high delta crops. The dense soil mass...
Mahmood Iqbal Sheikh
...under fast growing tree species, employing the most modern and scientific techniques. Through consistent effort, the best methods of growing and managing these species have been developed over a period of time. Since enough state land is not available to practice poplar cultivation with intensive agriculture, the farming community has been encouraged and persuaded to grow this tree on their land in the form of widely spac...
Shan Ahmad Naveed
...ut 1100,00 fries of this species reared in the hatcheries of Shinu, Madyan, Jaghoor and Bombret and have been released in the cold water streams of this area since the commencement of this work....
Jalil Ahmad Khan and Pervaiz Akhtar
...e then a large number of species have been tried in nurseries as well as in plantations. The number of species which have been planted in different areas is somewhat limited the most common being Eucalyptus tereticornis and Eucalyptus carnaldulensis. According to Parker (7), Eucalyptus tereticornisisthe most common species found in the Punjab and with the possibl...
Ishtiaq Ahmad Qazi and Raja Walayat Hussain
...mber and volume for each species (4,5)....
Mohammad Shahid
... biotic potential of the species from being realised. The species existed but usually maintained a low level of population or equilibrium between the forces within the species and the environments. All the pests that are present today were there 70 years or more ago. However, they did not matter much because their population density was always low....
Qamar A. Abbasi and Narjis Yousuf
...Abstract
A new species belonging to the genus Macrocephalus swederus is described below from Swat and is compared with Macrocephalus notatus Westwood its close ally. This is the first record of a phymatid from Pakistan....
I. A. Qazi and Raja Walayat Hussain
...bout 3,200 cubic feet of species....
Mohammad Amin Siddiqi
... It deals with two plant species which have not been previously described in Hooker�s Flora of British India or any other regional or local floras of this sub-continent. These two plants belong to a very small genus Emex australis with only two species, of the family Polygonaceae. One of the species is Entex australis and the other is Emex spinosus. The first one is na...
Raja Walayat Hussain and Muhammad Afzal Cheema
...autiful specimens of the species are also found in Gilgit agency specially towards Punyal and Yasin side where it attains huge dimensions and seems to be pyramidalis variety. When the trees attain a diameter between 5 inches to 10 inches at breast height these are felled by the farmers to meet their small constructional demands. The wood is in great demand for making of packing cases and crates etc. Since the trees have almost clear and straight boles t...
Saeeda Akhtar
...>Abstract:
Some species of Eucalypts are considered the best amongst the fast growing broad-leaved trees and have been selected for large scale afforestation in West Pakistan. This prompted a study on the germination behaviour of these species. Seeds of Eucalyptus camaldulensis, Dehn., E.melanophloia. F.V.M., E.microtheca, F.V. M., and E.tereticornis, Sm. have been used in this study. B...
Ishtiaq Ahmad Qazi, Raja Walayat Hussain and Muhammad Afzal Cheema
...am is the principal tree species being grown in the irrigated plantations of the Punjab for over a century. The main object of raising these plantations was to produce fuelwood initially for railway engines and later for meeting fuel requirements of the big cities of the province. The object of management was, in due course of time, modified to include timber production also. At present almost all the plantations are being managed with this combined objective ...
Mohammad Hafeez
...low soil where few other species can survive. It may occur pure or in mixture with other trees. It is not found in loamy soil but has been introduced. (3). In West Pakistan it is mainly found in Attock, Jhelum and Rawalpindi Forest Divisions. It is also found in small quantity in Baluchistan, Sind and Hazara (N. W. F. P.).
It is used as fuel wood, for agricultural implements and for hedge purposes. In some places the wood is also used for building small h...
Mahmood Iqbal Sheikh
...were used. Miscellaneous species of Pines, Eucalyptus and Acacias were tested. On the basis of the data collected it has been found out that tube size 6 X 2.5-in c he s and 6.0 x 2.0 inches and with 45 and 36 Perforations of 1/8* dia. are the most useful ones for broad leaved and coniferous species respectively. ...

Muhammad Ikram Ullah Malik1*, Aamir Saleem1, Lubna Ansari1 and Arshad Mahmood Malik2

...r the plantation of tree species (Poplar and Sheesham), to increase the soil fertility and production of income for the household. 2 kanals were used for the growth of agricultural crops such as wheat (Triticum aestivum), to meet the basic needs of the local communities. The wheat was sown by broadcasting of seed. 2 kanals were used to grow the fodder crop such as Berseem (Trifolium alexandrinum). 1 kanal was used for livestock and poultry, to generate income ...

Rabab Abd Alameer Naser1*, Sameer Ahmed Abid Al-Redah2, Enas S. Ahmed3, Fatimah S. Zghair2, Ali Ibrahim Ali Al-Ezzy4

...y, the esophagus in both species had four layers. The mucosa was lined by a thick, keratinized stratified squamous epithelium. Immunohistochemical analysis revealed the presence of serotonin receptors in this layer. The density of glands in the lamina propria increased distally. Turkeys possessed tubular acinar glands, while ostriches had simpler tubular glands. The submucosa was less distinct in turkeys compared to ostriches, where it was well-developed. The ...

Muhammad Ali Raza1*, Wali Ullah Falahi2, Aneela Zameer Durrani3, Bilques Bano4, Muhammad Muddasir Ali3, Nazia Rubab4, Syed Tasadak Mehdi4, Muhammad Wasim Iqbal5, Kumayl Hassan Akhtar6, Aqeel Raza7, Muawuz Ijaz3, Ujala Fatima Shan3, Muhammad Aftab3

...in different categories (species) of meat through HPLC in Lahore has been first time studied.
...

Muhammad Wasim Khan*, Ghulam Abbas, Asma Fatima and Shahnaz Rashid

... from study area and 246 species or groups of species have been identified. Significant variation was noted in the frequency of fish catch/kg/hr tow per month, particularly during pre-monsoon, post-monsoon. High abundance (74.95%) of estuarine fish species was found followed by marine fish species (23.27%) and freshwater fish spe...
Luqman1*, Zahid Hussain2, Tamana Bakht3, Miftah-Ud-Din1, Haroon Khan2, Muhammad
Rameez Khan1, Ata Ullah1 and Faraz Ali Shah1, Imtiaz Khan2 and Abdul Majid Khan Dawar2
...m
tenulentum species. The Importance Value Indices for these weeds were 14.01, 13.96,
13.07, 11.83, 11.57, 11.12, 10.35, 10.09, 10.02, and 9.99, respectively. Moreover, these
IVIs indicate that out of the top most 10 problematic weeds eight weeds are broad leaved
and two are grassy weeds. Therefore, for planning of the weed control measures it must be
kept that broad leaf weed problems are higher
Fawad Khan1, Zahir Muhammad1, Tahseen Ullah1, Khushdil Khan2 , Shabir Ahmad2, Asif Kamal2 and Khafsa Malik2
...he plant consists of 143 species belonging to 47 families including 42 dicots and 5
monocots. Poaceae was the dominant family containing 18 species followed by
Brassicaceae, Fabaceae, Asteraceae and Solanaceae. Therophytes were dominant class
having 89 species (62.23%) followed by Microphanerophytes with 19 species (13...

Maqsood Anwar, Shah Khalid and Naveed Akhtar1*

...calculated for each weed species. Twenty weed communities were
established in 20 selected sites/stands. Comparative evaluation of diversity revealed
that Menhinick’s index ranged from 0.61 to 1.72, Margalef’s species richness index
ranged from 2.82 to 6.31, Simpson’s diversity index ranged from 0.78 to 0.94,
Shannon-Wiener diversity index varied from 2.13 to 3...
Mamoona Arooj1, Bilal Ahmad Khan*1, Muhammad Ather Nadeem1, Muhammad Mansoor
Javaid1, Erum Rashid2, Muhammad Saleem Jilani3, Jamshahid Qamar1, Faryal Ali4, Sadaf
Javeria5, Muhammad Faisal4
...several crop
species has been observed both in controlled as well as in the field conditions; however
available data of hermetic effects on weeds growth is very limited. This study investigates
the promotive effect of low doses of atrazine on growth of Tribulus terrestris. Pot
experiments were conducted at Agronomic Research Area, collage of Agriculture, University
of Sargodha, during 2019. Six differ...

Shabana Mangi1, Waheed Ali Pahnwar1* and Abdul Manan Shaikh1

...were identified into two species i-e: Agriotes pakistanicus sp. nov and Agriotes bulgaricus
(Platia and Gudenzi, 2007). Out of which: Agriotes pakistanicus sp. nov is reported as new
species to science while Agriotes bulgaricus is first time reported from Sindh Pakistan.
Besides this, morphological description along with digital images are provided. Definitely this
study will p...

Abdul Basit1 and 2Sana Ullah*

...>
ornamental plant species. The main objective was to improve the current situation of the
nurseries and suggest recommendations in light of the highlighted problems. Various
attributes i.e. identification of plants, total area of nurseries, soil type, irrigation system,
weeding, fertilizer application, propagation method, propagation time, transplanting time,
field situation and finally problems of the nur...

Muhammad Idrees1, Wisal Muhammad Khan1*, Haroon Khan2, Arshad Iqbal1, Nosheen Umar3, Shah Khalid1 and Nisar Ahmad4

... The flora comprised 238 species, 164 genera associated with 60 families. The most prevailing family was Asteraceae with 42 species (17.64%), trailed by Rosaceae 16 (6.72%), Brassicaceae 13(5.46%), Solanaceae 11 (4.62%), Papilionaceae 10 (4.20%), Apiaceae, and Poaceae each with 9 (3.78%), Lamiaceae 8 (3.36%), Boraginaceae, Euphorbiaceae and Moraceae each contributed by 7 species (2.94%), A...

Zara Naeem1, Khajista Jabeen1*, Muhammad Khalid Saeed2, Sumera Iqbal1

...y;">Mycotoxigenic fungal species are a major cause of various infections in plants and their post-harvest produce that pose a serious threat to humans and animals. In the current study, the objective was to examine the in vitro efficacy of different concentrations of methanolic leaf extract of Sorghum halepense (L.) Pers. against target pathogenic mycotoxin producing fungal species (Trichoderma viride Pers., Trichoderma harz...

Asad Alam1, Asad Ullah2*, Imad Khan2, Yaseen1, Rafiq Ullah1, Tahira Tayyeb1, Muhammad Hanif1, Maiz ur Rahman1, Muhammad Owais Khan1, Fatima Syed3, Raheela Taj3, Shumaila Gul4, Muhammad Sadeeq5 and Muneeb Islam6

...t common marketable fish species in biofloc throughout the world. It has higher growth rate and is reared in limited resources when compared to other aquaculture species. This research work identified the requirements needed for installation of biofloc setup in winter session; different physico-chemical parameters and optimized the floc density for growth of Nile Tilapia (O. niloticus) in the study area. A total of three tan...

Imania Ghaffar1, Ali Hussain2*, Arshad Javid1 and Shahid Mehmood1

...on of filamentous fungal species is very scarce. Fungi have made a prominent mark in the area of heavy metals’ bioremediation. This study attempts to check the influence of microplastic pollutants on Hg2+ uptake potential of metal-resistant Aspergillus flavus at laboratory scale under pre-optimized conditions. A. flavus showed a remarkable potential of remediating simulated wastewater, i.e., 100% Hg2+ reduction was achieved at 25 mg/L of the added metal ...

Zahid Ali1,2, Muhsan Ali Kalhoro1*, Nazeer Ahmed1,3, Muhammad Shafi1, Faisal Saeed1 and Abdul Majeed1

...mercially important fish species from Balochistan coast, Pakistan.

...

Xinyue Wang1, Shengao Chen1,2*, Fangze Zi1, Jianmin Ge1, Desheng Chang1, Yong Song1 and Congxin Xie2

...digenous endangered fish species in the Tarim River. In order to study its population characteristics and improve the conservation measures, 940 specimens of T. yarkandensis were collected in 2018 and 2020 from the Alar Section of Tarim River. Otoliths were chosen as the main age structure in this study. Results showed that the rings of T. yarkandensis formed once per year from March to May. The ages ranged from 1+ to 10+, with 2.5+ to 6.5+ predominating in th...

Rawa Abdulkareem Abd

... demonstrating increased species refinement, environmental changes influence microbial response prediction, and microbial omics data integration into the models. To sum up, this research has illustrated the need to discover new bacteria in the lift of study of biogeochemical cycles and its implication for ecosystems’ dynamics, the environment, and biotechnologies. As a result of unveiling the secrets of the microbial dark matter, we shall enhance our und...

Anwar Ali1*, Muhammad Ayaz Khan2, Muhammad Atif Majeed1 and Nowsherwan Zarif1

... low as only 7 different species were recorded during the field measurements. Tamarix dioca has dominated the growing stock with a 41% share in the total trees, followed by Acacia nilotica and Prosopis cineraria, each having a 27% share in the growing stock. The average stocking was estimated at 90 trees per ha, which is quite low compared to a well-stocked riverine forest or plantation. The average diameter at breast height (DBH) was recorded as 12.49 cm, and...

Shaofei Zhang1, Na Xu2 and Gang Liu2*

...rence of 27 gut archaeal species between A. erythropus wintering at Shengjin Lake and those at Caizi Lake. Archaeal network analysis results fell into four major modules, with Methanolobus psychrotolerans and Thaumarchaeota archaeon as the hub modules. The abundances of several bacterial and fungal genera were significantly correlated with abundances of archaeal genera in pairwise populations, and a positive correlation was observed between archaeal, bacterial...

Mati Ullah1*, Muhammad Rizwan2, Ali Raza3, Xianlin Zhao4, Yanling Sun4, Sarah Gul5, Muhammad Ihtesham Waheed6, Muhammad Nadeem Khan7, Alvina Gul8, Sami Ullah Jan9* and Chao Huang4*

...ous probiotics bacterial species for general as well as commercial applications. This study could also be used basis for similar studies.

...

Muhammad Qasim1, Muhammad Zeeshan Majeed1*, Muhammad Arshad1, Umair Abbas1, Mehar Zubair Shehzad1 and Abu Bakar Muhammad Raza1,2

...nd as a dominant termite species in district Sargodha. Filter paper disc-based bioassays revealed that all insecticides showed a significant impact (P < 0.001) on the mortality of C. heimi workers and this mortality response was directly proportional to insecticidal concentrations and exposure times. Significantly higher mortality was recorded by chlorpyrifos (100.0%) and fipronil (95.0%) at 72 h post-exposure with minimum LC50 values of 1.29 and 2.04%, res...
Guangcan Lin1,2,3, Xingyu Chen1,2,3, Xiaohao Shi1,2,3, Xiaolin Li1,2,3
Anwar Tanwari Kamran4, Zhengxiang Wang1,2,3, Qing Zhu5, Gaodao Liang5* and Lei Pan1,2,3*
... the existence of native species. Therefore, evaluation of the condition and fitness of the invasive P. parva population in different regions is necessary. However, no systematic reports of the P. parva length-weight relationships (LWRs) around the world has been documented, especially comparing indigenous and non-indigenous populations. Thus, the goal of the current study was to offer a systematic report of P. parva LWRs worldwide and a comparison of P. parva...

Komal Hingoro1, Muhammad Saleem Chang1,2* and Ghulam Sarwar Gachal1

... seven freshwater turtle species (Order Testudine). For this purpose, a total of 30 blood samples were collected from different turtle species including Aspideretes (A) gangeticus, A. hurum, Chitra indica, Lissemys punctata, Kachuga (K) tecta, K. smithi and Hardella thurjii exhibiting different habitats in the Guddu Barrage, Indus River, Pakistan. Hematological and biochemical analysis showed a significantly higher and lower...

Rumisha Raza1*, Ali Raza Awan1, Muhammad Wasim1, Shagufta Saeed1, Muhammad Tayyab1, Aftab Ahmed Anjum2, Muhammad Muddassir Ali1 and Sehrish Firyal1*

...o diverse range of avian species. Among avifauna of Pakistan, Birds of prey or raptors are well-known because of their beauty and speed of flight. Falcons, hawks, kites, eagles, and vulture are common birds of prey. They are geographically widespread and common among the vertebrates. Being predatory birds, they are found on the top of food chain. Unfortunately, birds of prey are facing serious threats such as loss of habitat, pollution, poaching and injuries. ...
Qurat-ul-Ain Ijaz1, Amna Sulaman1, Dost Muhammad Baloch2, Muhammad Shafi2, Faiz Muhammad1* and Shahnaz Rashid1
...the variety of gastropod species commonly found on the coast during low tide at rocky shores. In the present investigation, nine species of gastropods were identified using the foresaid modern technique such as (Thalessa savignyi, Purpura persica, Turbo sparverius, Lunella coronata, Cellana karachiensis, Nerita albicilla, Nerita tristis, Ischnochiton australis, Astralium tentorriformis). T our knowledge among them three are ...
Zain-ul-Aabdin Abro1*, Naheed Baloch1, Raza Muhammard Memon2 and Niaz Hussain Khuhro2
...le higher number of both species of fruit flies were recorded in untreated blocks of guava at both experimental sites. Present Investigations suggested that in spite of expected results of both parasitoids releases and mass trapping other eco-friendly techniques are also necessary to reduce the amount of injuries caused by Bactrocera species in mango and guava orchards of Sindh.
...

Sardorbek N. Turgunov, Oybek O. Amirov*, Erkinjon B. Shakarboev, Abdurakhim E. Kuchboev

...ad of male of P. equorum species. QIAamp DNA Mini Kit reagents (QIAGEN, Germany) were used for genomic DNA isolation. According to the results of molecular genetic study, the nucleotide sequence belonging to the ITS1-5.8S-ITS2 region of the ribosomal DNA of P. equorum species was analyzed, and it was found that 100% nucleotide similarity with P. equorum species (MH030605) and 95.85% simila...

Azhar Ali1, Faheem Ahmed Khan2, Wu Di3, Huang Chunjie3, Muhammad Rizwan Yousaf1, Bilal Ahmed1, Farwa Shakeel1, Nuruliarizki Shinta Pandupuspitasari1, Windu Negara2, Bambang Waluyo Hadi Eko Prasetiyono1*

...d originate from various species. Our findings indicates that the gastrointestinal system of dairy cows harbors a repertoire of 216 antimicrobial resistance genes, which are presumed to confer resistance to 23 distinct antibiotics. The identified ARGs were associated with tetracyclines, macrolides, bacitracin, quinolones, β-lactams, and aminoglycosides, which correspond to antibiotics often administered to both animals and humans. An important discovery i...

Tanvir Hussain*, Zahid Rauf, Mansoor Ali Khan and Khalid Hussain 

...ubstantial impact on the species ’ growth . Furthermore , precipitation was discovered to be a limiting factor for this species’ growth. From the results, it was concluded that blue pine growing under the prevailing climatic conditions of Shangla has good potential for dendroclimatic studies and could be helpful for scientists and researchers to forecast regional and global climate change by reconstructing past c...

Aura Oktiefa Adyantono, Sugiharto Sugiharto, Daud Samsudewa*

...tive quality between two species showed different result. The aim of this research is to compared the reproductive quality of Bos indicus crossbred and their crossbreds with Bos taurus. A meta-analysis involving 43 studies on reproductive hormone levels, 25 studies on estrus activity and 65 studies on reproductive performance. Article search, article selection, data extraction, statistical analysis (heterogeneity, summary effect, publication bias test) were us...

Tariq Zaman1*, Fawad Khan2, Sajjad Ahmad2*, Alia Mehsud2, Atta Ur Rahman3, Muskaan Zaman2 and Sumaira Noor2

...lora. A total of 42 weed species belonging to 20 families were investigated from research area. The dominant families in terms of species richness were Asteraceae and Poaceae with 6 species (14.28%) each, followed by Brassicaceae and Papilionaceae with 4 species (9.52%), Apiaceae and Solanaceae with 3 species (7.14%), ...

Muhammad Wasif Gulzar*1, Riffat Maqsood1, Hussain Abbas1, Musharraf Manzoor1, Muhammad Suleman1, Hassaan Ahmad Bajwa2, Ali Hamza2, Shaher Yar1, Muhammad Zain1, Abdul Wadood1 and Noman Aslam3

...ucts.They destroy useful species in the ecosystem and put our lives and health in peril. This review highlights the current standing of the impact of insecticides on viral diseases in man and animals. We observed that in addition to their surroundings, people also consume these hazardous substances from the air, water, and agricultural goods. They result in mortality and a variety of illnesses, malignancies, and mutations. These substances deplete pollinator p...

Muhammad Muneeb1, Ali Hussain2*, Qurat-ul-Ain Ahmad3, Arshad Javid1 and Jibran Hussain3

...phate-reducing bacterial species in the form of a co-culture to treat an in-vitro prepared sulphate-rich wastewater while employing various agro-industrial organic waste as economical growth substrates. A combination of sulphate-reducing and cellulolytic bacteria in a ratio of 1:1 (v/v) was proved to be efficient for the reduction of sulphate in controlled as well as in the experimental conditions. The implicated microbial co-culture reduced 96 and 93 % of the...

Kashif Haleem, Basheer Ahmad, Muhammad Rayyan, Nowsherwan Zarif, Saif Ullah Khan, Salman Ahmad and Anwar Ali*

...benefits of various tree species, including environmental benefits, fruits, and fodder, and provide tree saplings. Additionally, new plantations should be established to combat climate change.

...

Asad Ali, Anwar Ali, Muhammad Farooq and Basheer Ahmad* 

...rmation on regeneration, species planted, pit density, survival rate, aspect, and species composition. Analysis of the field data revealed a pit density below the required 10x10 spacing, with only 663 pits found compared to the required 1075 pits per hectare. The average regeneration per hectare was estimated at 75 plants in pits and trenches at the plantation, with a composition of 70% Prosopis juliflora, 19% Zizyphus nummu...

Barkat Ullah Khan*, Ayaz Ahmad, Ashar Farooq, Muhammad Bilal Zia, Hammad-Ud-Din and Muhammad Atif Majeed

...fy;">This paper analyzes species occurrence data obtained from multiple sources through the Global Biodiversity Information Facility (GBIF) to understand the distribution and density of recorded biodiversity observations patterns in Khyber Pakhtunkhwa (KP), Pakistan. The dataset includes 4,638 observations with spatial coordinates available. The data was analyzed using MS Excel and ArcGIS. The sources of observations include iNaturalist, the Natural History Mu...
Langgeng Priyanto1,2*, Herdis2, Santoso2, Pradita Iustitia Sitaresmi2
Tri Puji Priyatno2, Rahma Isartina Anwar2, Desiana Ade Mahari2
Florentina Bety Indah Lupitasari2, Maman Surachman2
I Wayan Angga Darmawan2, Arfan Abrar1 and Arum Setiawan3
...aused by reactive oxygen species produced by the biological molecules of sperm. Alpha-tocopherol (Vitamin E) and ascorbic acid (Vitamin C) are two potent antioxidants that operate to prevent oxidation processes. The objective of this study was to analyze the effects of α- tocopherol and ascorbic acid on the motility, viability, abnormality, and plasma membrane quality of post-thawed Tropical Brahman bull sperm. Sperm samples were obtained and pooled from...

Murad Muhammad1,2,3*, Shahid Ullah1, Nimrah Ameen4, Abdul Wahab3,5, Abdul Basit6, Muqadas Batool7, Muhammad Nazim2,3 and Haroon Khan

...collected. A total of 65 species from 24 families were recorded across the four different seasons (spring, summer, autumn, and winter) in 2021–2023, including 54 angiosperms, 10 tracheophytes, and one pteridophyte. The dominant family was Poaceae (25%), followed by Asteraceae (15%) and Asclepiadaceae (2%). Given the essential roles that these weed species play in medicine, future research on the use and conservation of...

Marriyam Batool1*, Ahmed Zia2, Shabir Ahmed1, Imran Bodlah3, Waheed Ali Panhwar4, Muhammad Ashfaque5, Falak Naz6 and Muhammad Muneer5

...host plants of which, 23 species and 13 genera are reported for the first time for this valley. Within the recorded fauna, Macrosiphum euphorbiae was found to be abundant with 103 individuals followed by Myzus persicae and Aphis craccivora, respectively. Impact of altitudinal variations over the distribution of recorded fauna was also studied and discussed in detail.

...

Daniel Offiong Etim1*, Etim Johnson Umana1, Idorenyin Asukwo Udo2, Ndarake Eden Ini-Ibehe1

...nfested with Trichoderma species served as control. Two weeks old okra plants were inoculated with 5,000 larvae of M. incognita and one gram of S. rolfsii (3 Sclerotia g-3) in a heat sterilized soil. The obtained results showed highly susceptibility of okra to M. incognita and S. rolfsii infection without neem cake and Trichoderma species infestation. Amendment of soil with neem cake at 4.00t/ha in combination with T. viride...

Saba Mehnaz1*, Farhan Ahmad Atif2, Rao Zahid Abbas1, Muhammad Kasib Khan1 and Muhammad Saqib3

...ale analysis of multiple species by using duplex and multiplex PCR and also for improving the control of associated tick-borne diseases in endemic regions through vaccine development. 

...

Muhammad Zahir Shah1,2 and Syed Basit Rasheed1,*

...aspirator. A total of 28 species belonging to two genera i.e., Phlebotomus represented by 12 species and Sergentomyia represented by 16 species were collected during the present study. Phlebotomus mongolensis is reported for the first time from Pakistan. Phlebotomus sergenti (48.77%) was the most abundant species followed by Phlebotomus paptasi (17.89%),...

Hafiz Muhammad Ashraf, Hafiz Abdullah Shakir* and Javed Iqbal Qazi

...is to determine the fish species diversity of the river Ravi, Punjab, Pakistan. Eight sampling sites were surveyed during the year of 2020 to ascertain fish diversity and abundance. Diversity indices computed by using Primer 7 Software for whole study compared seasonally. Cluster analysis (Euclidian distance) and poly component analysis performed by using Origin Software (2016). A total 877 (258 in low and 619 in high flow season) fish specimen was collected u...

Hui-juan Yan1, Wei Wang2,*, Jian-qiu Yu1, Jun Yi2, Li-li Niu1, Hong-wei Chen1, Yu Qu1, Yang Pu 1, Ang Chen1, Yan Zhong1, Wei-gang Chen1 and Xing-ming Yu1

...annon Index and observed species) of Z2 was significantly higher than that of Z3 (P < 0.05). The Shannon Index of Z1 was higher than that of Z2. At the genus level, Christensenellaceae_R-7_group and Ruminiclostridium_5 had higher abundance in Z2 compared with Z3, whereas other genera, such as Fibrobacter, Lachnospiraceae_AC2044_group and Oscillibacter were enriched in Z3. In conclusion, our results reveal significant microbiota composition changes that occu...
A.M. Ahmed1*, R. Dutta1, H. Pokhrel1, D. Nath1, L. Mudoi1, R. Sarmah1, S.K. Bhagabati1 and I. Ahmed2
...tal of 81 different fish species were identified, divided into 10 orders, 24 families, and 52 genera. The orders Cypriniformes, Siluriformes, Anabantiformes, and Synbranchiformes accounted for 88.88% of the total fish population and the remaining 12.12% is being contributed by other orders. The family Cyprinidae was found to be the most prevalent (40.74%). Minnows and barbs contributed the most (30.49%) among the 11 common groups of fishes identified. Accordin...

Fatima Kanwal

...tal of 14 different weed species belonging to 10 distinct families were identified. Goose grass (Elusine indica), Lambsquarters (Chenopodium album), and Black nightshade (Solanum nigram) accounted for 87% of the weeds and had densities of 1.82%, 1.82%, and 1.71%, respectively. Species of Amaranthus viridis were found to be 37% prevalent, with the highest density of 10.40%. and was only determined in the Karachi region while ...

Abdulaziz S. Alatawi*

...;">Habitat loss and prey species shortages represent serious issues for many wild carnivores. Carnivores may expand their search for prey and suitable habitat to cover a wide area, seeking alternative sources of food at different localities, including human-modified land such as agricultural areas. Agricultural areas in Tabuk Province, north-western kingdom of Saudi Arabia have been expanded substantially over the last three decades. This research studied the ...

Xiaoping Gao1, Yanping Li2*, Renyi Zhang3, Yunyun Lv2, Yongming Wang2, Jinrong Shi2, Jiang Xie2, Chiping Kong1 and Lekang Li1

...led all Sinocyclocheilus species in this research formed a solid monophyletic group and grouped into two major clades with strong support excluded S. jii. Additionally, S. cyphotergous in this study was closely related to S. multipunctatus and S. punctatus. In summary, this study provided novel insights into the phylogeny of the Sinocyclocheilus fishes, conducive to the conservation genetics and cave adaptation for S. cyphotergous.

...

Real Datta1*, Md- Tariqul Islam2, Md. Afradul Islam3, Apurbo Kumar Mondal4, Tilak Chandra Nath1, Kazi Mehetazul Islam1, Jamal Uddin Bhuiyan1 

...testinal (GIT) nematodes species affecting cattle and to ascertain the prevalence and associated risk factors of GIT nematodes in cattle in Sylhet district of Bangladesh. The investigation included the identification of nematode species, a questionnaire survey, and fecal testing. This study investigated the connections between various significant risk factors and the prevalence of GIT nematodes in Cattle. A total of 246 feca...
Shahida Rashied1*, Ahmed Zia2, Riaz Aziz Minhas1, Sumera Aslam3, Abdul Rauf Bhatti4 and Ghulam Ali1
...his area for the Odonata species complex. In study area first time detailed surveys were conducted for exploring the diversity of both sub orders of Odonata (Anisoptera and Zygoptera) during the summer season of 2018-2019. A total 346 specimens were collected yielding 20 anisopterous species under 13 genera of 5 families and 7 zygopterous species under 4 genera of 3 families. Among these 8...

Abd El-Nasser Ahmed Mohammed1*, Mohammed Al-Saiady2, Ahmed El-Waziry3 and Tarek Al-Shaheen1

...body health in mammalian species. The present on-farm experiment was designed to evaluate the effects of omega-3 fatty acids sources, extruded flaxseed and salmate, on reproductive performance and biochemical parameters in lactating dairy cattle. Two hundred and sixty-eight lactating cows were blocked by stage of lactation and assigned to three groups, a control group and two treated groups fed diets containing salmate (25 g/head/day) and extruded flaxseed (7....

Yusra Karim1, Munawar Saleem Ahmad1, Javed Khan2, Imtiaz Khan3*, Said Hussain Shah2, Syeda Anika Shamsher4, Imran Qazi5, Habib-Ur-Rehman Kakar6 and Wajih Ullah7 

... pests, particularly the species of Lepidoptera. The goal of the current investigation was to evaluate the bio larvicidal effects of endotoxins produced by B. thuringiensis from the CRY1F gene against widely encountered lepidopteran pests (Spodoptera litura and Helicoverpa armigera). Insect-proof netting was used to contain the vegetable plants in a small field. B. thuringiensis with active CRY1F was cultivated in Luria-Bertani (LB) media under controlled labo...

Waqas Ahmad Shams1*, Gauhar Rehman2, Muhammad Ismail3, Rahmul Kabir4 and Abdul Qahar1

...idant properties in this species, adding valuable data to the field of marine-derived bioactive compounds.
...

Syeda Rubab Zaidi* and Safdar Ali Mirza

...belonging to Aspergillus species of microscopic fungi, only 04 strains were screened for laccase production. In order to select most potential laccase enzyme producing strain among different isolated strains, quantitative analysis was carried out. Results clearly indicated that Aspergillus niger isolated from soil sample collected from agricultural area produced remarkable zone diameter and culture colony diameter. The remaining strains showed variable results...

Waheed Iqbal* and Muhammad Faheem Malik

...s of butterflies from 32 species across 22 genera, 11 subfamilies, and four families from this study. With 14 (43.75%) species, the Nymphalidae family was dominated that was followed by the Pieridae family, which had 13 (40.62%) species, the Lycaenidae family, which had three (9.37%) species, and the Papilionidae family, which had two (6.25%)

Bilal Ahmed Qazi, Nowsherwan Zarif, Anwar Ali*, Faizan Ahmed, Asim Karim and Ali Nawaz 

...everal multipurpose tree species were recommended for the desert environmental conditions in Thal, such as Acacia albida, Acacia tortilis, Acacia elata, Tecoma undulata, Acacia victoriae, Tamarix aphylla, Acacia modesta, and Prosopis cineraria,. For semi-arid areas Eucalyptus camaldulensis, Acacia saligna, Acacia elata, Acacia albida and Leucaena leucocephala were found to be quite successful. These techniques have shown positive outcomes regarding runoff indu...

Muhammad Shahid Hassan1, Nargis Naz2, Hassan Raza Javeed1*, Sabahat Zafar1, Laraib Kanwal1, Seerat Mariyum1, Areej Fatima1, Areeba Bashir1 and Muhammad Imran Atta3

...reas encompasses 18 weed species with 17 Genera and 11 families. The dominant families of weed flora were Poaceae (22.22%), Fabaceae (16.66%), Ammaranthaceae (11.11%), and Brassicaceae (11.11%). The dominant weed species in study area were Anagallis arvensis (78.63%), Phalaris minor (6.7%), Melilotus indica (4.22%), Avena futua (3.5%), Chenopodium album (1.51%), Sisymbrium irio (1.05%), Medicago denticulata (0.70%), Sonchus ...
Muhammad Nauman Khan1*, Fazal Hadi1, Maryam Bibi1, Naushad Khan1 and
Syed Mukaram Shah2
...on on 18 families and 34 species was collected with regard to their ecological characteristics, medicinal and other economic uses by local inhabitants. The dominant families were Fabaceae and Poaceae represented by 5 species each, followed by Asteraceae with 4 species. Biological spectra expressed that therophytes were the major life form class with 31 species

Abdessatar Omezine1

... or more different plant species interacting with each other in different manners. Interspecific competition, resource complementarity and facilitation may modulate better performance of a mixture. It is difficult to interpret the results of a simple mixture experiment, if the phenomena act together. An experimental design is used to study interactions between chilies or peppers, Capsicum annuum L. var. ‘Baklouti’ and Setaria verticillata (L.) P. B...

Zahid Fazal1, Jaweria Gul2, Muhammad Subhan, Khan Sher and Qasir Ali

...% in mungbean, among all species. In all three crops studied, 23 weed species were competitive with the crops. Based on the Importance Value Constancy value index the most competitive weeds in all crops studied were Digitaria sanguinalis (L.) Scop. (123.3), Amaranthus viridis Linn. (107.9), Rumex dentatus L. (89.3), Solanum nigrum (79.7), Chenopodium album L. (75.8) and Setaria viridis (64.6). Digitaria sanguinalis (98.6), S...

Shahida Naveed1, Salma2, Inayatullah Khattak3 and Khan Bahadar Marwat4

...ing nine genera and nine species (14.75 %) followed by dicotyledonous family Asteraceae with seven (7) genera and seven (7) species (11.47%). Amaranthaceae and Brassicaceae were represented by five (5) species each (8.19 %). Chenopodiaceae was represented by one genus having three (3) species (4.91 %) and Euphorbiaceae was represented by three (3) genera...

Umm-e-Kulsoom1, Saima Hashim2, Fazli Wahid3, Haseena Gulzar4 and Tamana Bakht5

...stem and leaves of these species (donor plants) were collected and stored. After drying, the plant materials were grinded. The powder of each species and each part were soaked separately at 100 g per liter and 150 g per liter to get two different aqueous extracts. The objectives of the studies were to investigate the allelopathic effect of extracts of different parts of donor species on we...

Fawad Ali1, 2, Gul Hassan2*, Naveed Akhtar3, Muhammad Jamal Babar3 and Ataullah Jan4

...2013. A total of 32 weed species belonging to 18 families were recorded from the research area. The predominant families were Brassicaeae (5 spp.), Poacea and Fabaceae (4 spp. ea.) followed by Polygonaceae, Asteraceae, Caryophlliceae and Plantaginaceae (2 spp. ea.), while the remaining families were represented by only one species each. Five weed communities were established on the basis of importance value constancy index i...

Gul Hassan, Anees Amin, Haroon ur Rashid, Naqib Ullah Khan and Hussain Ali1

...howed that regardless of species the highest fresh and dry biomass plant-1 (9.52, 3.22 g), plant height (46.98 cm), leaf area (71.94 cm2) and root length (10.27 cm) were recorded in the 2% parthenium + NPK recommended dose, but for all the parameters differences were non significant from 3% parthenium + NPK and the NPK alone. These treatments ranked higher than 2% berseem + NPK and the untreated check, where berseem is a conventional green manure crop. Incorpo...

Ghulam Rasool1, Ayesha Aihetasham1*, Zulfiqar Ali1* and Rida Ahmad1,2

...tify;">Understanding the species assemblages and migration connectivity of geese species is crucial for their conservation and management. It helps identify important stopover sites, breeding grounds, and wintering areas, allowing for targeted conservation efforts and the preservation of key habitats along their migratory routes. This study was designed to investigate the avian richness and habitat suitability of geese
Adyasha Sahu1*, V. K. Venkataramani1, Natarajan Jayakumar1
Durairaja Ramulu1, Preetysh Nanda Patnaik1 and Sudhan Chandran2
... important portunid crab species viz., Portunus pelagicus (Linnaeus, 1758), Portunus sanguinolentus (Herbst, 1783), Portunus gladiator Fabricius, 1798 and Charybdis natator (Herbst, 1794) collected from the Gulf of Mannar, Southeast coast of India. A total of 1,391 specimens were collected and measured from January to June 2022. All CLW and CWW relationships were linear (R2 >0.95 and R2 >0.91 respectively). The slope (b) of the CLWR ranged between 2.8210...
Abdul Majeed Saim1, Arshad Javid1, Misbah Sarwar2­, Muhammad Hafeez-ur-Rehman3 and Ali Hussain4*
...ed wild and captive bird species in Pakistan. E. coli and S. enterica were isolated from fecal samples of birds and identified by phenotypic, biochemical, and molecular characterization of ABR genes by PCR. E. coli colonies appeared circular and dark purple on EMB agar media plates while S. enterica colonies were small, circular, and red on SS agar media plates. E. coli and S. enterica isolates were found resistant to amoxicillin, ciprofloxacin, and sulfametho...

Taqwa Safdar, Khalid Abbas*, Muhammad Sarfraz Ahmed, Hina Amjad, Sumra Naz and Jamal Kazam

...ed by Labeo rohita cross-species amplification of H. molitrix. The results showed a low-to-moderate level of genetic diversity. The number of alleles on each locus ranging from 2.0 to 6.0, with an average of 3.48 was observed at various loci. The average observed and expected heterozygosities ranged from 0.664 to 0.76 and 0.631 to 0.664, respectively. For all tested loci, population combinations showed significant deviation (p<0.05) from HWE. The AMOVA indi...

Huzaifa Hammad1, Bakhtiar Gul1, Haroon Khan1, Muhammad Fawad1*, Hafizullah2, Haidar Ali3 and Tamana Bakht4

..., dry weed biomass, weed species composition, biological yield, thousand grain weight, grain yield, harvest index and cost benefit ratio. The results showed that both the herbicides (Atrazine and Stomp 300 EC) were effective in weed control having lowest fresh weed biomass of 29.31 and 32.65 kg ha-1, respectively. Maximum biological yield (8309.7 kg ha-1) was recorded in cowpea as living mulch while minimum biological yield (5909 kg ha-1) was recorded in contr...

YP Arios1,2*, J Pamungkas3, IWT Wibawan3, D Iskandriati4, CS Tan5, SPH Rahman5

...es were tested using the species-independent Surrogate Virus Neutralization Test (SVNT). A total of 12 sera (8 cat serum and 4 dog serum), based on the results of the Surrogate Virus Neutralization Test analysis, formed antibody titers against SARS-CoV-2 in as many as four individuals (33.33%). The existence of protected antibody titers in dogs and cats can provide initial information for further studies.
 
Keywords | Antibody tite...
Safaa Sabbar Atiyah1*, Ali Abdullah Zuairi Al-Sadoon2, Shifaa Kadhum Jieish2
...in different farm animal species to improve semen properties such as viability, motility, and membrane integrity, which thereby increase sperm fertility. The current study was conducted to investigate the effect of adding an aqueous extract of Aloe vera leaf gel (AEAV) to the epididymal spermatozoa of local goats during the cooling process for different periods. The AEAV was prepared and stored in the refrigerator until the time of use. Epididymal spermatozoa ...
Sohaila Fathi El-Hawary1, Nermeen M.L. Malak2, Reda A. Gomaa3, Hesham Z. Tawfeuk3, Suzan Ismail4, Nady Khairy Elbarbary5*
...ract | Vibrio species are significant pathogenic bacteria found in fish that induce gastroenteritis, a major public health issue. The present research investigated the occurrence, virulence gene detection, antibiotic resistance profile, and the antibacterial influence of lemon juice and pomegranate peel extract on V. cholerae and V. parahaemolyticus. Samples were 150 fish (30 of each Nile tilapia, Nile perch, sardine, Mugil cephalus, a...

Muhammad Farooq* and Sanam Zarif

...concerned about invasive species, both plant and animal. These species, which are non-native to the area, seriously threaten native biodiversity and disturb local ecosystems. Invasive species spread more quickly as a result of increased worldwide travel and trade, necessitating management and control. This review study examines the numerous facets of invasive speci...

Raad M. Sayed-Lafi*

...Ctenopharyngodon idella) species are among the commercially most valuable. To find patterns and trends in the published research on this subject, we used a bibliometric approach to evaluate the body of literature that has been published in the field of grass carp study over the last ten years (2013–2023). Based on articles retrieved from Scopus, the analysis was carried out; a total of 1751 research publications were examined. The bibliometric analysis&r...

Mushtaq Ahmad1, Hikmat Ullah Jan2, Kanwal Raina3, Nazara Shafiq3, Syed Mukarram Shah1, Muhammad Ibrahim4, Shaha Buddin1 and Gulnaz Parveen3*

...tional knowledge on weed species in maize and wheat crops. A semi-structured questionnaire along with group discussion and interviews were used to gather ethnobotanical data. A total of 93 weed species were collected from wheat and maize crops which belonged to 31 families and 77 genera. Among these 31 families 29 families were of Dicots and only 2 families were of monocots. The 71 (76%) species

Israa M. Essa*, Ghazi Y. Azzal, Alaa Tariq Abdulwahid

... more prevalent Fasciola species in sheep of Basra province. In addition, our results provided an initial basic data for monitoring this potentially important parasite in field. However, the main limitations of the present study include the low number of examined animals, short period of study, and disapproving of some owners to examine their slaughtered animals. Therefore, it is necessary to develop the suitable parasite control measures (e.g. controlling the...

Ali Abd Kadhum  

...ons. Different bacterial species was confirmed using the Enterosystem 18 R system and using a device. Vitek-2 compact system. Results of an antibiotic resistance test showed that the isolates showed a “significant” change in resistance to antibiotics, as the isolates showed the bacterial species Staphulococcu aureus, Pseudomonas aeruginosa, Streptococcus pneumonia, Moraxilla catarrhalis, and Klebsiella pneumonia ...

Baraa Najim Al-Okaily 

... kidney. Reactive oxygen species (ROS) are highly reactive chemicals generated within cellular mitochondria that can impact plenty physiological functions in either a positive or negative manner. Under normal physiological circumstances, the cells of the body generate a minimal amount of ROS, which corresponds to a low level of oxidative stress. These molecules play a crucial role in regulating cellular signaling pathways, facilitating communication between ce...

Wali Muhammad Mangrio1*, Yasmeen Buriro1, Hakim Ali Sahito1, Faheem Ahmed Jatoi1 and Fahmeeda Imdad Sahito

...three replications. This species of insect pest is sporadic in its feeding habits and habitat, causing great losses to the economic heritage of many nations. It is further suggested that more work should be carried out on different survival patterns of this invasive pest species of date palm orchards.

...

Wali Muhammad Mangrio1*, Hakim Ali Sahito1, Abdul Hafeez Mastoi2, Sanaullah Sattar3, Fahmeeda Imdad Sahito4 and Shahid Ali Jakhrani1

... destructive insect pest species of the cotton crop in future endeavors. 

...

Nasr Tarq Mohammed 

...prevalent in some animal species, such as dogs, than in humans. Garlic organosulfur compounds possess anti-carcinogenic, antibacterial, antifungal, antiviral, and immune-boosting properties. This study aimed to evaluate the anticancer potential of aqueous garlic extract (AGE) against breast cancer cell lines. The use of a simple aqueous extract allows for easy and cost-effective preparation while retaining bioactivity. In this research, the effectiveness of AG...

Meray Nabil Ramsis

...s in comparison to other species. Ten healthy adult donkey’s cadavers were used. Six of them were injected with heparin into the common carotid artery and they are subsequently washed with a warm saline solution of 0.9%. 60% gum milk latex neoprene, stained with red Rottring ink, was injected in order to examine the artery supply. For radiography, 50 g of lead oxide powder was injected into the other four heads after being dissolved in 100 ml of red gum ...

Haifen Qin1,2, Yujia Liu1, Yujie Zhang1, Jingfeng Liu1, Zhenkun Zhao1,2 and Lichun Jiang1,2*

...at of other Cucujiformia species. The Anoplophora species control region sequence with rich A+T content exhibited high genetic variability. All PCGs initiate with ATN and terminate with the TAA or TAG except for COXI-COXIII and ND3-ND5, where they end with an incomplete stop codon (T--). All tRNAs form clover-leaf structure only apart from trnS (AGN) which possess a reduced DHU arm. The motifs ‘ATGATAA’ between N...

Xinxing Wang1,4, Yunrong Shi2, Guobao Chen1, Tao Chen1, Kui Zhang1,3* and Wenhua Liu4*

...channel to multiple fish species located in the northern South China Sea. Keeping in mind limited data available on the taxonomic diversity of fishes from this region, we compiled time-series data on fish species from the PRE collected since the 1980s, and analyze diversity at different taxonomic levels using an inclusion index at the taxonomic level, and indexes of taxonomic diversity. Species

Iqra Almas, Samia Afzal*, Muhammad Idrees, Muhammad Shahid, Iram Amin and Kausar Malik

...ral and escape) and quasispecies analysis of the HBV. All samples in family were infected with genotype HBV/D1 and had high viral load (10e8 IU). An vaccine escape mutation “C137W” was identified in mother and a son. Mother sample were shown more number of haplotypes and total diversity as compared to sons. The quasispecies analysis showed the mother and sons were infected with HBV having similar genetic makeup, ...

Yingying Wang1, Sufen Zhao2* and Qunxiu Liu3*

...ch 100% due to different species, which needs to be verified in future work. Therefore, if necessary, the vaccination interval between administration of AI vaccines (H9 subtype) can be appropriately extended to reduce the stress reaction caused by capture and vaccination and reduce the economic cost of disease prevention and control. In regard to the ND vaccine, different immunization programs should be formulated for different bird sp...

Zulfiqar Ali1, Asad Ullah2*, Shumaila Gul3, Maryam Begum4, Raheela Taj5, Tahira Tayyeb1, Maiz ur Rahman1, Muhammad Owais Khan1, Rafiq Ullah1, Imad Khan2, Ali Gohar2, Shakirullah Khan6, Khudija Ghani7 and Muneeb Islam8

...e identification of tick species is crucial for effective disease surveillance, prevention, and control strategies. Morphological identification and epidemiology based on the examination of key external features remain a fundamental and widely used approach for tick taxonomy. This research work provides a comprehensive overview of the morphological characteristics used in the identification of ticks, focusing on the main genera and spe...

Rand K. Abbas1, Zahraa S. Hadi1*, Zainab A. Hussein2, Sajad K. Matooq3

... mixed infections). Five species of cestodes were recorded included: Raillietina echinobothrida (71.15%), Raillietina tetragona (38.46), Raillietina cesticillus (13.46%), Choanotaenia infundibulum (17.31%), and Hymenolepis sp (53.85%). There were three type of nematode: Ascardia galli (28.85%), Heterakis gallinarum (21.15%), and Epomidiostomum (7.69%). Our results showed that there is significant decreasing in the concentration of Hb, PCV, and RBC (P values= 0...

Ashraf Samir Hakim1*, Doaa Diab Khalaf1, Engy Farahat1, Mohammed Darwish Mohammed1, Wahid Hussein El-Dabae1, Khaled Abd El-Hamid Abd El‑Razik2, Amany Nabil Dapgh3, Ehab Ali Fouad4, Hussein Ahmed Abuelhag1

...on revealed existence of species specific ‘yaiO’ (100%), virulence; ‘fimH’ (71.43%), ‘iutA’ (26.98 %) and ‘iss’ (20.63%). The harboring of blaNDM-1gene was presented among 15 E. coli isolates as (23.81%); dog (11), human (3) and one in cat. The obtained data of our study asserted the potential role of companion animals in transmission of zoonotic E. coli serotypes especially those of exposing resistance to severa...

Eman Mamdouh Qenawy1, Mohamed Abou-Ellail1, Fatma Abdel-Motaal2, Mohammed O. Alshaharni3, Nady Khairy Elbarbary4*

...dentify the various meat species in meat products marketed as 100% beef and sold in Aswan City, Egypt, with distinct microbiological analysis that highlighted the detection of Pseudomonas aeruginosa and Escherichia coli. Ninety samples of meat in total (15 of each minced beef, sausage, burger, shawarma, and hawawshi) were obtained from several markets in Aswan City, Egypt, and exposed to bacterial analysis and PCR methods. The fraud samples exhibited a higher ...

Preetysh Nanda Patnaik1, V.K. Venkataramani1, N. Jayakumar1, R. Durairaja1, Adyasha Sahu 1 and C. Sudhan2*

...rphometry to investigate species delineation of four portunid crab species from the Gulf of Mannar coast. Four closely related commercially significant portunid crab species such as Portunus pelagicus, Portunus sanguinolentus, Charybdis natator and Portunus gladiator were selected based on body morphometry and morphology to delineate them by employing a truss network. With regard to conven...
Faiza Ghazanfar1, Masood Rabbani1*, Aamir Ghafoor2 and Muhammad Hassan Mushtaq3
...ic identification of the species. in vitro antibiotic disc diffusion method of those selected isolates was performed against 20 most common human therapeutic antibiotics. The isolates were found to be highly resistant against most of the available antibiotics leaving behind very less choice of selection for treatment. The results are as follows: ciprofloxacin (91%), clindamycin (87%), moxifloxacin (84%), telithromycin (82%), erythromycin (82%), clarithromycin ...

Rahmat Ullah Khan* and Karim Gabol

...tal of eighty-three bird species were reported that belonged to 15 orders and 40 families; of these, the Passeriformes was the dominant order. However, the habitat having the richest average avian diversity was; agriculture at 51.42% (540.85±25) followed by residential at 42.61% (706.78±32) and low at mountains at 5.96% (165.87±36). Regarding feeding habits, most bird species were insectivores (49.39%) f...

Wen Xiong1, Zhimin Jin1, Zinuo Yuan1, Qin Liu2* and Peter A. Bowler3

..., we identified 137 fish species (including two non-native species), representing 9 orders, 26 families and 88 genera, that are distributed in the Yujiang River and its drainage basin. According to the International Union for Conservation of Nature (IUCN) criteria, six of these species (Anguilla japonica, Cyprinus carpio, Luciocyprinus langsoni, Pseudohemiculter dispar, Ptychidio jordani, ...

Abdur Rehman*, Muhammad Umair Khan, Zahid Rauf, Saeed Akhtar, Abdur Rahman Khan and Mansoor Khan

...om rapidly maturing tree species (Agro-forestry). The sources for the pulp and paper manufacturing sectors would be broaden by investigating the pulping capacities of underutilized humid-zone Broadleaf woods. The present work will be relying on the equitable woody fiber anatomical dimensions of two types that are Willow (Salix tetrasperma) and Lachi (Eucalyptus camaldulensis). The excellence of pulp and paper is directly linked to the fiber characteristics suc...

Yasemin Öztürk

...p the areas rich in bird species diversity in Isparta Province (Turkey). The study area, with a total surface area of 8933 km2, was divided into 64 sample sites created by dividing it into a 1/25000-scaled grid. Between 2014 and 2015, each sample site was visited over the four seasons. Point count and line transect methods were applied between the early hours of the morning and sunset, when the birds were active. According to Shannon-Wiener diversity values, t...

Shahid Ali Khan1*, Farooq Ahmad1, Muhammad Zubair Akram2, Yan Tongyu3, Fatima Urooj1, Kamran Ahmad1, Saeed Ullah4, Sharmeen Zulfiqar5, Tahira Batool6, Aqsa Sarwar1, Yaqoob Sultan7 and Samreen Nazeer8*

...s of 340 genera and 9000 species and is cosmopolitan distributed throughout the world. The habits of plants are annuals, perennial herbs, shrubs, and trees. The identifying characteristic feature of plants in this family is the formation of milky latex, because of their succulent nature; they can tolerate or resist water deficit conditions. Different ecotypes of this genus were collected from different areas of Faisalabad region. Different

Fahad A. Alshanbari1, Abdelrahman M. A. Elseory2,3* 

...ry camel is an important species for milk and meat production as well as transportation, racing, and beauty competitions in many countries around the world. Camel milk marketing has rapidly increased globally in the past decade. Improvement of reproduction technologies such as artificial fertilization is still limited in the dromedary due to physiological difficulties such as sperm collection and ovulation occurring during mating. Superior dromedary camels wit...
Nur Amira Idayu Romzi1, Aina Zahirah Mohd Suhaili1, Norhayati Ngah1,2 and Mohd Fahmi Abu Bakar1*
... were used for the plant species, including control, NovaTec, foliar, and urea. The data for morphological and physiological characteristics, including plant height, the distance of nodes, leaf width, and leaf length, were taken every two weeks. The physiological parameters, including chlorophyll content and stomatal conductance, were recorded during plant growth. The results showed that there is an increase in crude protein content from the difference in nitr...

Sami ul Haq, Basheer Ahmad* and Bilal Ahmed Qazi 

...s study investigates the species composition of moist temperate forests in Shahpur Valley, District Shangla. Fifty 20x20 meter plots were randomly selected across the valley, considering factors like spacing, tree population, size, density, crop variation, altitude, and slope. Tree species were identified and counted in each plot, while soil samples were collected from plots with notable species
Nur Anis Hashim1, Nor Hasima Mahmod1*, Abubakar Abdullahi Lema2, Lee-Hoon Ho3 and Mohammad Moneruzzaman Khandaker1
...ntioxidant content. This species is originated in West Africa and spread to Asia by the colonials in 1700s. The optimal conditions for the preparation of dried materials for further processing and suitable drying techniques while preserving their antioxidants have yet to be inferred. Thus, the present study aims to determine the content and activity of the antioxidants in fresh and dried roselle calyx. The random sampling technique was applied by collecting th...

Imtiaz Khan1, Arsalan Khan2*, Umme Aimen2, Waseem Ullah2, Akhtar Ali2, Qamar Ullah3, Muhammad Faimullah Khan4, Abdul Wadood Jan5, Salma Zaman6, Abdul Qadoos1, Tayyeb Ullah7 

...ent of Fasciola hepatica species in cattle that have contracted the disease naturally at a dairy farm in district Tank, Khyber Pakhtunkhwa. The trial involved the selection of 40 dairy cattle, which were divided into three treated groups and one untreated control group. A single anthelmintic drug was administered to each cohort on day zero. Fecal samples were collected from each animal in the groups on the first, seventh, fourteenth, twenty-eighth, sixty-fifth...

King Hei Ip

...nnotation of all the bat species, a lack of understanding of bat-virus interactions and viral co-infection, and biases in bat-virus relationship studies hinders the understanding towards bat antiviral innate immunity. By completing the genetic annotation of bats, developing wild-like environments when studying the bat immune system, improving data collection methods and conducting further studies on bat immunity and viral co-infection would further the underst...

Muhammad Ehsan Maqbool1*, Muhammad Nadeem Mushtaq1, Tamathues2, Khadija Tul Kubra1, Arish Zulfiqar1, Muhammad Shoaib Sarwar1, Zeeshan Yousaf3, Mudassar Yaseen1, Farwa Nosheen3

...sity of different insect species in the okra crop. A total of 2613 specimens belonging to 19 species and 6 orders were collected with different methods. Most species (9) belong to the order Hemiptera, four species from Lepidoptera, three species from Coleoptera, and one species each ...
Aamir Khan Awan1, Nighat Sultana1*, Rahmat Ali Khan2, Rifhat Sultana3
Umm-e-Kalsoom1, Fayaz Ahmed Sahibzada4, Rifat Ullah Khan5, Naimat Ullah Khan6, Nazir Ahmad Khan7, Syed Haider Zaman8, Mir Sadiq Shah9 and Assar Ali Shah10*
...nolic extracts and other species against hyperglycemia and biochemical profiles of treated rats. It was concluded that the extracts of peels of P. granatum possess significant antihyperglycemic and antihyperlipidemic potentials due to presence of phytochemical and have no side effects. Based on the outcome of the study it can be recommended that the peel of P. granatum can be further used for the development of antidiabetic drugs or in folk medicines tradition...

Siew Ing Nguang, Nur Syafiqah Binti Zainal, Ahmad Mukhlis Bin Hafas, Hou Chew Ha, Connie Fay Komilus, and Asmad Kari*

...g and thawing. Each fish species requires a specific extender because of diverse sperm characteristics. Tilapia (Oreochromis sp.) popular in Malaysia for its hardiness and rapid growth is an excellent choice for aquaculture. Aloe vera (Aloe barbadensis) (Av) shows promise in spermatogenesis, but its use as a cryoprotectant in semen extenders is still underexplored. This study investigates the effects of antibiotic- and sugar-free Av-based extende...

Awang Hazmi Awang-Junaidi1, Yeoh Boon Nie2, Siew Te Wong2, Nur Nabila Sarkawi3, Wafeq Mu’izzadin Khairul Anuar1, Siti Mariam Zainal Ariffin1* 

...zed as the smallest bear species globally and is vulnerable to degenerative joint disease (DJD). This study presents the results of a detailed examination of the skeleton remains of one adult male captive Bornean sun bear obtained from the Bornean Sun Bear Conservation Centre (BSBCC), Sandakan, Sabah, Malaysia, specifically for DJD lesions. The examination revealed osteoarthritis in multiple sites of the appendicular joint, including the hip joint, stifle join...

Hassan Ismail Musa1,3*, Latiffah Hassan1, Chandrawathani Panchadcharam2, Zunita Zakaria1, Saleha Abdul Aziz1 

...ease in different animal species were calculated and the relationships between the prevalence and climatic factors were examined. A total of 72,941 animals were sampled from 1,765 livestock farms across all the states and tested, out of which 4,516 (6.20%, 95% CI 6.02-6.37) were serologically positive for melioidosis. Correlation analysis of seroprevalence and the climatic factors showed strong, positive and statistically significant correlation (r =0.58, 95% ...

Pankaj Gargotra1*, C. Judith Betsy1 and J. Stephen Sampath Kumar2

 

... unless we diversify our species and production systems. Loaches are an important category of freshwater fish with a global distribution, and studies have shown that loach meat has great nutritional value. There is a scarcity of data on their population structure, breeding behavior, and growth biology. Lepidocephalichthys thermalis, a member of the superfamily Cobitidae and the order Cypriniformes, is a significant alternative species<...

Samah Abou Asa1, Omnia Tag2 and Walid Elmonir2*

...d fish especially mullet species. Only few residents (14%) had knowledge about Heterophyiasis in the study area. Residents also reported many risk practices as consuming fresh without prior freezing (92.7%), salting fish for less than 10 days (50%), and cooking fish for less than 10 min (2.3%). Health education for residents and infection control in fish are mandate preventive measures in the study area.

...
Anum Razzaq*, Tariq Mahmood, Ammara Saman, Ammara Baig, Nadeem Munawar and Muhammad Farooq
...n dietary habits of this species in particular Plateau. Therefore, the focal aim of the current study was to investigate the dietary habits of Indian gerbil by using micro-histological analysis of stomach contents in croplands of the Pothwar Plateau and to study the variation in its food composition during cropping and non-cropping seasons. A total of 30 specimens were trapped by using snap traps in wheat, groundnut and adjacent non-crop habitats. Results show...

Bushra Sial1, Arif Muhammad Khan1, Mohsan Raza1,6*, Azhar Abbas Khan2, Sayyad Ali Raza Bukhari1, Muhammad Kashif Hanif3, Sher Khan Panhwar4, Muhammad Ashfaq5

...olutionized the world of species classification and identification. In this study, we delved into the fascinating domain of DNA barcoding precisely for rare marine species and delineated species population genetic variability, genetic differences, and phylogenetic relationships between families/genera. 542 COI sequences from experimental species and an o...

Shahid Ali Khan1*, Farooq Ahmad1, Fatima Urooj1, Shabana Ehsan2, Yan Tongyu3, Tahira Batool4, Aqsa Bibi1, Muhammad Bilal1, Amrat Eman1, Javeria Tariq1, Ansa Asghar1, Yang Yan5, Asima Shabbir2 and Samreen Nazeer6*

... has 340 genera and 9000 species and is found in many parts of the world. Plants of this family exhibit various habits, including annuals, perennial herbs, shrubs, and trees. The distinguishing trait of plants in this family is the production of milky latex due to their succulent nature, enabling them to withstand or withstand water scarcity conditions. Various ecotypes of this species were gathered from distinct regions wit...

Wirokartiko Satyawardana1,4, Umi Cahyaningsih2*, Fadjar Satrija2, Safika Safika3, Arifin Budiman Nugraha2

... two infected rickettsia species, including Babesia canis vogeli, Hepatozoon canis, Anaplasma platys, and Ehrlichia canis. Using the t-test, data analysis, which covered numerous categories, comprising city of origin, sex, and age for each species of blood parasites and rickettsia, showed that only the male had a significant difference in Babesia canis vogeli infections with P-value of 0.023. In contrast to the other categor...

Muhammad Ashfaq Khan, Basheer Ahmad, Sami Ul Haq, Bilal Ahmed Qazi*, Saifullah

...nd analysis of the plant species present in the ChirPine forest. The study area is characterized by a dominant presence of Pinus roxburgii, accounting for a substantial 73.0% of the total trees. However, this forest is not a monoculture; it boasts a diverse array of tree species. Robinia pseudacacia, Pyrus pashia, Alianthus altissima, and Eucalyptus camaldulensis make up significant portions of the forest at 6.4%, 0.1%, 4.6%...

Aamara Ibrahim1, Ihsan Mabood Qazi1, Majid S. Hashmi1, Ayaz Ahmad1*, Hisham Javed1, Fawad Ahmad2 and Sadia Mukhtar1

... prepared from different species like cow and goat while ensuring both quality and consumer satisfaction.

...

Nuttanun Leamkrajang, Somkiert Prasanpanich, K. Teepalak Rangubhet, Phongthorn Kongmun*

...en fluid among different species of ruminants, specifically focusing on rumen fermentation characteristics and the population of rumen microorganisms. The investigation utilized a 3×2 factorial in CRD, incorporating four replications. The inoculum sources included three animal species (swamp buffalo, beef cattle, and goat), while the dietary treatments consisted of two roughages to concentrate ratios: 100:0 and 70:30, ...

Bounthan Sounyvong1, Yohan Lee2 and Eun-Jae Lee3*

...nce of five small rodent species, the chestnut white-bellied rat (Niviventer fulvescens), red spiny rat (Maxomys surifer), long-tailed giant rat (Leopoldamys sabanus), house mouse (Mus musculus), and black rat (Rattus rattus), and the stand structure of primary and secondary forest stands resulting from two types of post-fire silvicultural management practices in the Phou Khao Khauy National Protected Area (PKKNPA), Lao PDR. Post-fire silvicultural practices c...

Jumiati Asis1, Nur Aainaa Hasbullah1, Mohamadu Boyie Jalloh1, Noor Khairani Mohamad Basri1, Palanivell Perumal2, Peter Mojiun2 and Mohd. Rashid Mohd. Rakib1* 

...mal;">Trichoderma species are well-known biological control agents (BCAs) that have significant antagonistic activity against various fungal phytopathogens. On the other hand, Ganoderma boninense has been identified as the phytopathogen causing basal stem rot (BSR), a devastating disease in oil palm crop (Elaeis guineensis). In this study, the in vitro and in planta inhibition of G. boninense using Trichoderma i...
Jessenia Castro-Olaya1, Dorys T. Chirinos1* and Takumasa Kondo2
...s (Fabricius) is the species reported in Ecuador, 13 additional taxa were detected. This research reports for the first time 13 scolytine taxa associated with cacao in Ecuador.
...

Muhammad Ahsan Raza1,2*, Nabila Roohi2, Abdul Qayyum Khan Sulehria3 and Muhammad Khalil Ahmad Khan4

...ing this time period, 34 species of rotifers belonging to 10 families and 12 different genera were identified. Brachionidae was proved to be the most abundant family followed by Asplanchnidae. Population density was maximum in June and lowest in January. Rotifers displayed positive relationship with electrical conductivity, pH, temperature and total hardness while negative correlation was recorded with dissolved oxygen. Atomic absorption spectrophotometer was ...

Ye-Ling Lao, Jin-Long Huang, Cheng-He Sun, Xiao-Ying Huang, Ting Wu and Qun Zhang*

...sification of the target species M. altispinosus. According to our analysis, further studies should focus on the relationships between Amphilophus and Symphysodon. By determining the complete mitogenome of M. altispinosus, this study improves the phylogenetic resolution of New World cichlids. This new resource is highly important for the classification of New World cichlids and provides valuable data for subsequent studies on Cichlidae evolution.

...
Chang Guoliang1,2*, Pan Zhengjun1,2, Zhu Chuankun1,2, Zhao Haitao1,2
Yan Zhang3, Summaya Rajput4 and Laghari M. Younis4*
...an important aquaculture species in China, Japan and Southeast Asian countries. But up to now, no special commercial formulated feed has been developed for M. nipponense that meets its nutritional requirements. Generally, soybean lecithin oil (SO) is used as a major source of phospholipids and an emulsifier in aquatic animal feed, which is very costly. In recent years, as a good emulsifier, lysolecithin attracted increasing interest in fish

Shibao Guo1, Junhua Chen1, Nan Song2, Fangmei Zhang1*

... the available sequenced species of family Tephritidae by maximum likelihood and bayesian inference methods suggested the genus relationship of Tephritidae: ((Bactrocera, Dacus, Zeugodacus), Felderimyia, Anastrepha), (Acrotaeniostola, (Neoceratitis, Ceratitis), Euleia, Rivellia), (Procecidochares, (Tephritis, Sphaenisscus))))). Our results presented the first mitogenome from Sphaeniscus and provide insights into the species ...

Sehar Aslam1, Muhammad Qasim1*, Mohsin Khurshid2*, Usman Ali Ashfaq1 and Muhammad Akhtar Ali3

... Lactobacillus fermentum species, exhibited remarkable tolerance against bile salts, acidic environments, and temperature, and had excellent adhesion ability, indicating their potential as probiotic strains. Additionally, all isolates were non-hemolytic and displayed significant antimicrobial activity against antibiotic-resistant pathogens, such as Escherichia coli and Staphylococcus aureus. The anti-cancer activity of all isolates was also evaluated against t...

Wen Xiong1, Yifan Huang1, Yue Liu1, Shuyin Li2* and Baoqiang Wang3*

...ghu Lake. In total of 96 species belonging to 7 orders, 26 families and 65 genera were listed in the Honghu Lake in past seventy years. And the fisheries resource decreased quickly due to hydrological disconnected, overfishing, and non-native species. In order to protect freshwater fish biodiversity and fisheries in Honghu Lake, some measures including establishment of protect area, artificial propagation and artificial rele...

Ho-Kyoung Bae, Jae-Kang Lee, Tae-Kyung Eom, Dong-Ho Lee, Hyeongyu Ko, Joo-Hee Kim, Sung-Hyun Ahn and Shin-Jae Rhim*

... the conservation of the species and their habitat, these habitat variables should be considered and addressed by forest managers.

...

Mohamed E. Enany1, Ahmed M. Hamouda2, Reem M. Khashaba3*

...ce of Enterobacteriaceae species with prevalence 40% (40/100) of the tested samples. Escherichia coli has the highest prevalence rate with 77.5% followed by klebsiella spp and Salmonella spp. with7.5%and 5% respectively.Resistance of the collected Enterobacteriaceae strains was determined by the Kirby-Bauer disk diffusion test against a panel of antibiotics.. The isolates were highly resistance for Amoxicillin clavulanic acid with 71.05% of tested isolates fol...

Bakht Zada1, Ahmed Zia2, Sardar Azhar Mehmood1, Abdur Rehman3*, Toheed Iqbal4*, Kiran Shahjeer5 and Shabir Ahmed1

... district, revealing two speciesCinara atrotibialis and Cinara atlanticathat are newly recorded in the country. The study provides detailed information on morphometry, taxonomic descriptions, host plants, and global distribution for each of the identified species

...

Qasim H.A. Aljboori* and Saadoon Murad Saadoon

...nt growth. Many Fusarium species can infect rice plants and affect its growth, in addition to producing various mycotoxins that are dangerous to humans and animals. Therefore, a study was conducted to evaluate the effectiveness of four levels of agricultural sulphur (0,100,200 and 300 g/m2)and the fungicide Benomyl (100 ppm) against F. solani fungus infecting three varieties of rice (Anbar33,Yasmeen and Mishkhab2) grown in Iraq. The study results showed that s...

Hammad Ali, Basheer Ahmad, Asim Karim*, Saifullah and Salman Ahmad 

...g the number of distinct species within a specific area or sample. Species richness serves as a physiologically meaningful indicator for alpha (α) diversity. The purpose of this research was to examine the biodiversity of the chir pine forests in the Abbottabad city region. Because this kind of forest is a distinct and significant ecological habitat, the researchers aimed to learn more about the different animals that ...

Jaafar Haider Abd Alrudah1, Nada Fadhil Abbas2*, Farah Ali Hadi1, Haider Tuma Kaab3 

... accurately diagnose the species of Candida. The identification was confirmed using PCR targeting the ITS gene region. Live attenuated antigen was prepared using sonicater device and then injected subcutaneously in healthy pigeons. A group of pigeons at one month old (n=10 birds/group) was immunized with the prepared antigen. Another group, as a control group, was injected with normal saline via the subcutaneous route. The second booster was done seven days la...

Rehan Ullah1, Fazli Rahim1, Muhammad Sajid1, Shakir Ullah2*, Shahab Ali2, Lubna Shakir3, Mohammad Sohail4 and Ghani Subhan5

...s, focusing on medicinal species, in Khazana Munda, District Dir Lower, Khyber Pakhtunkhwa. The study was conducted in 30 isolated villages of the research area through questionnaires to collect information from 500 native people of different ages (35 to 75 years old) who were interviewed and included men and women, who were involved in the compilation and utilization of plants. The study region was carefully visited in all four seasons of the year and 183 pla...

Athar Mustafa Laghari1*, Naeem Tariq Narejo2, Muhammad Hanif Chandio1, Faheem Saddar3, Muhammad Yunus Laghari4, Munawar Lal1, Urooj Imtiaz4, Majida Parveen Narejo5, Hameeda Lashari4, Ghulam Abbas5 and Shahnaz Rashid5

...gth analysis of dominant species in Haleji Lake, District Thatta Sindh, Pakistan was enumerated during September-June 2017-2019 accordingly. Total collection of fish in the studies was 1066 number and consists of 28 kinds related 11 families. Simpson’s biodiversity index (1-D=0.927) shows that the surroundings of Haleji lake observed as low in terms of fish diversity, propagation and growth. Shannon- Weiner index (H) was used to compute richness and abun...
Muhammad Safdar1*, Muhammad Younus2, Faiz-ul Hassan1 and Yasmeen Junejo3
... of pork, donkey and cow species in real food samples. For this purpose, a total of 150 samples including blood samples, tissue samples, laboratory prepared food samples and commercial foodstuffs including chicken karahi, beef biryani, chicken samosa, chicken pakora, haleem, nihari etc. were collected from Bahawalpur, Multan, and Rahim Yar Khan. DNA was extracted from all the targeted samples. We developed the first multiplex PCR assay to identify pork, donkey...

Hina Jabeen*, Usman Irshad, Kainat Azhar, Alisha Fatima, Asma Zaheer Abbasi, Tayyaba Sadia and Jaweria Aqeel

...ime. Both water and fish species are contaminated with heavy metals due to anthropogenic activities i.e., domestic, sewage, industrial and agricultural runoff. Heavy metals concentration in the seven fish species was analyzed from different riverine and marine sites of Pakistan. Freshwater fish were collected from Rawal Dam (Islamabad), Mini Dam at Fateh Jang (Attock) and Sulemanki Headworks at River Satluj, Head Sulemanki a...

Jiaojiao Wang, Peng Pan, Tingting Wu and Jianhua Hou*

...ustica) is a common bird species in airfields and is one of the most common species involved in bird strikes. To identify the activity pattern of barn swallows within airfields, a study was conducted in August 2017 using route survey methods. The results revealed that moving vehicles easily attract barn swallows, which start following the vehicle after it has been moving for 2.250 ± 0.228 min; the number of barn swall...

Shaila Akter1, MD Zobayer Rahman2*, Farzana Islam1, Zamal Hussan1, Rasel Mia3, Kazi Rabeya Akther1, Nirmal Chandra Roy1

...s administered. Finally, species obtained an average weight of 2.82±0.14 g, a final length of 9.0±0.40 cm, a mean final weight gain of 2.82±0.14 g, and a relative growth rate of 589.67±55.70%, lower FCR of 0.78±0.03 value with maximum growth. These changes took place during the T2 trial, keeping the feed ratio at 75% feed and 25% floc. The survival rate, on the other hand, remained constant throughout all treatments. Only two...

Muhammad Saleem Chang1*, Muhammad Nawaz Kandhro1, Bakhat-un-Nisa Mangan1, Zia-ul-Hassan Shah2 and Siraj Ahmed Channa

...n. The most common weeds species of sesame were selected and tested. The analysis of variance shown all levels of sorghum water extract and powder resulted in substantial suppression of weeds as compared to control. Sorghum extract @ 40 ml kg-1 soil exhibited the strong allelopathic potential with significant reduction of weeds seed germination (37.20, 42.34, 39.57 and 39.67 %), root length (8.06, 3.56, 4.48, and 2.23 cm), shoot length (4.40, 42.34, 39.57 and ...

Trang Nguyen Phan*, Loc Bao Nguyen, Thi Anh Ngoc Tong

...ar identification at the species level by 16 S rRNA sequencing revealed that selected LAB isolates belonged to the species Pediococcus pentosaceus, Limosilactobacillus fermentum, Lactiplantibacillus plantarum, Weissella confusa, and Weissella paramesenteroides. The differences in LAB species found in meat versus vegetables-fermented foods reflect these bacteria’s adaptability and eco...

Suhad I.J. Al-Asady1*, Mohammad H. Al-Hasnawy2

...egarding Cryptosporidium species infection in dogs is available in Iraq. Therefore, the current study aimed to detect and identify Cryptosporidium species infecting dogs using microscopy and molecular techniques. For the microscopic examination, feces samples of 100 dogs were examined from September 2023 to March 2024 by the flotation technique based on the modified Ziehl–Neelsen-staining technique. The results showed ...

Salma Ali Munshed*, Fadwa Abdul Razaq Jameel

...virulence factor in this species. The question of whether Aspergillus species can actually create biofilms has gained attention in recent times. Our work aimed to isolation and identification of Aspergillus flavus from dogs with study and evaluate some of virulence factors of this fungus like proteinase, hemolytic activity and biofilm formation in Laboratory. Fifty clinical isolates of respiratory infections in dogs were col...

Amal S.Omar, Mahmoud A. Ahmed, Nada A.S. El-Shahawy, Wael A.H. Ali, Sabbah F. Youssef, Hoda M.A. Shabaan, El-Sayed M. Abdel-Kafy* 

...ompared to other poultry species, and hold cultural significance as part of local Egyptian heritage. Furthermore, geese meat was considered delicious. Most breeders concurred that the geese population has decreased over the past decade. Opportunities within the geese production system include serving the domestic market and increasing income. Notably, women play a significant role in managing and selling geese. Overall, this study provides valuable insights in...

Muhammad Jahangeer*1, Muhammad Siddique Awan1, Muhammad Altaf2*, Riaz Aziz Minhas1 and Usman Ali3 

...xt-align: justify;">Bird species diversity and distribution research is important for conservation efforts in various protected areas. However, the richness and distribution of birds in Ghamot National Park are unknown. Based on land cover attributes, the research region was divided into five habitat categories. During 2020-21, a point transect count was used softly up to 30-50 m radius with a random sample approach. One-way ANOVA was used to evaluate the data...

Soumble Zulfiqar* and Abdul Rauf Shakoori

...across diverse bacterial species. These results enhance our understanding of metal resistance mechanisms and could inform future research on bacterial adaptation to environmental stresses.

...

Quddusi B. Kazmi* and M.A. Kazmi

...ublished and unpublished species of planktonic and phytal Ostracoda and Diplostraca recorded from the Pakistan coast (northern Arabian Sea). We report hereby two halocyprid ostracods Conchoecia sp. and Halocypria sp. of the family Halocyprididae Dana, and podocopid ostracod species Parasterope sp. of the family Cylindroleberididae Müller; another species- Ancohenia robusta (Brady, 189...

Yong Su Park1a, Dong Won Seo2a, You Sam Kim2, Myung Hum Park2, Min Jee Oh3, Sang Hwan Kim3,4*

...ationships of various subspecies of deer are known to be uncertain, so securing deer genes that can represent Korea is very important. We found a document observing Sika deer near the 38th parallel, and we were confident that this deer would inhabit North Korea and the Russian Maritime Province. Therefore, in this study, in order to explore the phylogenetic relationships of various Sika deer, we collected samples of Sika deer living around the Maritime Provinc...

Sahir Odhano1*, Michael S Rosenberg2, Noor Us Saher3, Guan Yang Zhang4 and Mustafa Kamal5

...ochistan (Sonmiani). The species belonging to the genus Ocypode are commonly known as ghost crabs. Previously, there was no such research conducted on biochemical and molecular studies. Polyacrylamide gel electrophoresis was used for the biochemical study to identify and quantify proteins and other enzymes by using seven markers: Coomassie brilliant blue (COM), creatine kinase (CK), carbonate dehydratase (CD), catalase (CAT), amylases (AMY), peroxidase (PXD) a...

Zeng Jianhui, Shao Mingqin*, Zhi Yijin and Yang Fucheng

...s. Three families and 11 species were recorded. Scolopacidae had the highest number of species (7), which accounted for 63.64% of all species of shorebirds surveyed. From 2015 to 2020, the number of species (5–7) showed little variation, indicating that the reserve could provide a stable wintering environment for a variety of shorebirds. The number...

Zhenghua Deng1,2,3, Wang Zhao1,2,3, Mingqiang Chen1,2,3, Gang Yu 1,2,3 and Yu Wang1,2,3*

...l compositions. As these species are easy to cultivate, can endure high temperatures, and are rich in unsaturated fatty acids, they are widely used in tropical and subtropical regions for invertebrate larval rearing. These three microalgae species were tested for ingestion, digestion, growth and survival of Pinctada fucata larvae, using an optical microscope, in order to identify an appropriate diet for P. fucata. An experim...

Hangyu Lin1, Minhui Chen1, Hao Yang1, Xinying Xia1, Huaying Zhou1, Xi Song1 and Tao He1,2*

...umulation in vivo on the species of rotifers Brachionus plicatilis. We analysed the relationship between the ratio of photoluminescence (PL) intensities (I585/I480) and MeHg concentration (CMeHg) to create a master curve for calculating MeHg concentration based on the measurement of PL intensities. Quantitative results showed that the bioaccumulation of MeHg in the rotifers increased from 1.65 μg at 30 min to 2.33 μg at 180 min and reached a plateau conc...

Muhammad Shehzad1, Fida Ullah1, Shahid Niaz Khan1, Abdul Majid1*, Muhammad Rais2, Muazzam Ali Khan3, Tariq Ahmad4 and Sanaullah Khan5 

...aphical distributions of species hinders research and management agendas. Species checklist and herpetofauna inventories of various areas of Pakistan are available, but many geographical areas of the country have still not been explored. We, therefore, conducted the present study to fill this gap. We carried out this study in 21 randomly selected sites featuring mountain regions, tropical dry deciduous forests, sandy patches...

Touseeq Haider1, Saeed Gulzar1, Sabeeqa Usman Malik1*, Aamir Saleem1, Zuhair Hasnain2, Nazakat Hussain3, Syed Ali Abbas1, Amir Hussain4 and Qadir Hussain4 

Pacifica Chepchumba Bwogo1*, Samuel Mong’are1, Rael Masai1, Dr. Damaris Matoke-Muhia2

...go. The collected vector species did not show any presence of Plasmodium falciparum sporozoites. Conclusion: Anopheles funestus has been identified as the key vector in malaria transmission, in malaria endemic zones of Kisii County, and it is majorly influenced by human activities. Effective environmental management, particularly through habitat manipulation, has the potential to mitigate malaria transmission in the study area. This is because the expanded cov...

Nounagnon Darius Tossavi1,2*, Mariette Sindété3, Nike Fumilayo Aladetohun4, Marie-Line Escande5, Adam Gbankoto3

 
...ify;">For around 49 fish species, respiration is partly ensured by a specific organ called Air Breathing Organ (ABO). ABO replaces fish gills in hypoxic conditions. The present study is dedicated to investigate the occurrence and potential physiological effects due to a myxosporean parasite infecting ABO in Clarias gariepinus. To achieve this goal, a total of 339 C. gariepinus was investigated for myxosporean infection. Fish sex, size and weight were recorded ...
Muhammad Sarwar1*, Areej Javaria2, Muhammad Zain-ul-Abideen3, Muhammad Farhan Sarwar4 and Muhammad Haroon Sarwar5
...sis Gray was the primary species in wheat fields followed by Indian gerbil Tatera indica Hardwicke, house mouse Mus musculus L., soft-furred field rat Millardia meltada Gray and short tailed mole rat Nesokia indica Gray and Hardwicke. These different pests began to raid and damage the wheat crop right from sowing, depredation increased during booting stage and peaked up to the time of harvesting. Such damage was likely influenced by a number of factors, such a...

Esam M. Al-Shaebi, Saleh Al-Quraishy, Saleh N. Maodaa, Hossam M.A. Aljawdah and Rewaida Abdel-Gaber* 

...align: justify;">Eimeria species parasite resistance to drugs has been reported, which infects many animals and leads to great economic losses. Medicinal plants are a promising source of a cure for many diseases. This study aimed to investigate the effect of Allium sativum juice (ASJ) on the sporulation of oocytes and as an anthelminthic effector via in vitro study. Characterization of the plant was done by Fourier-transform infrared spectroscopy (FT-IR) and d...

Ali Akhter1, Bushra Allah Rakha1*, Muhammad Sajjad Ansari2, Shamim Akhter1 and Sakhawat Ali3

...d recognized as flagship species of Margalla Hills National Park (MHNP), Pakistan. Data on breeding biology of kalij pheasant in MHNP are not available. Therefore, present study was conducted to document the breeding parameters and influence of slope, aspect, elevation and clutch size on breeding success. Kalij pheasant constructs nests with needles of chir pine Pinus roxburghii (65% by mass), oak leaves Quercus incana (20%), sticky hop bush (sanatha) Dodonaea...

Muhammad Waseem1, Santosh Kumar1* and Riffat Sultana2

...s) includes 54 described species, with 8 species identified in Pakistan. These species are Omorgus (Afromorgus) frater Pittino, 2005, O. (Afromorgus) granulatus (Herbst, 1783), O. (Afromorgus) haagi (Harold, 1872), O. (Afromorgus) italicus (Reiche, 1853), O. (Afromorgus) maindroni Pittino, 2005, O. (Afromorgus) procerus (Harold, 1872), O. (Afromorgus) testudo (Arrow, 1927), and the newly d...

Zhishuai Zhang, Zhiyuan Sui, Jihu Zhang, Qingjin Li, Yongjie Zhang, Chenguang Wang, Xiaojun Li and Feng Xing*

...mpared to those of other species and a phylogenetic tree was produced. qPCR was used to detect the expression levels of the TTR gene in the tissues. TTR gene was transfected into granulosa cells of the ovaries of Dolang sheep and was detected by fluorescence quantification. The cDNA sequence of the TTR gene of Dolang sheep was 444 bp and encoded 147 amino acids. Amino acid sequence identity of TTR from Dolang sheep was 99.32%, 99.32%, and 93.20% with sheep, go...

Yushuang Zhao, Jin Li, Ling Mao, Juan Guo and Yu Zeng*

...netic information on the species is quite scarce, as well as scientists have long disagreed on how to dispose of Squalidus and its related genera. In this study, we primarily reported the complete mitochondrial DNA genome of S. nitens by high-throughput sequencing, and explored the phylogenetic position of S. nitens within the subfamily Gobioninae. The entire length of the mitochondrial genome is 16,606 bp, containing 13 protein-coding genes (PCGs), 2 ribosoma...
Abdul Majeed Saim1, Arshad Javid1, Misbah Sarwar­2
Muhammad Hafeez-ur-Rehman3 and Ali Hussain4*
...that three Haemoparasite species, six nematodes species, one cestode species, three protozoan species and two trematodes species of parasites were observed and identified from fecal and blood samples.

...
Sanjay Chandravanshi1*, H.S. Mogalekar2, Omkar Sahu2, C. Sudhan3
Roshan Kumar Ram2 and Shivendra Kumar2
... a total of 12 shellfish species under 4 orders, 9 families and 10 genera. Identified shellfishes comprised of 5 species of crustaceans (3 species of freshwater prawns and 2 species of crab under 2 orders, 2 families and 3 genera) and 7 species of molluscs (5 species of snails and 2 ...

Ehsan Elahi Valeem1, Quddusi B. Kazmi2*, Farhana S. Ghory2 and Shazia Sadiq2

...spects of the structure (species composition and relative abundance, species associations and interactions, habitat preferences, species diversity and abundance relationships) of algal crustacean assemblages have been investigated from a range of algal types collected in clear Manora and Buleji waters. A total of 23 crustacean species were separated from...
Muhammad Saeed1, Farhana Aslam2, Muhammad Sajjad Khan2,  Asghar Ali Kamboh3, Zahid Farooq2, Rifat Ullah Khan4, Rizwana Sultan2, Ahmed Ali Moryani3 and Huayou Chen1*
...pared with other poultry species. The present review aimed to cover the study related to quail egg and meat nutritional composition, their nutraceutical importance and suggest ways to capitalize from the information for future purposes.

...

Wakeela Gul Mughal1, Muhammad Younis Laghari2*, Zameer Ali Palh2, Summaiya Rajput2, Ikram Hussain3, Punhal Khan Lashari2 and Maryam Sheikh2

...dy. Five Cyprinidae fish species (Labeo bata, L. pangusia, L. barbus, L. potail, and L. porcellus) were collected from the lotic water body to calculate the LWR in order to assess the population status of the lotic water body. All of the five species showed significant positive correlation (r2=>0.5) between length and weight. The values of the growth exponent ‘b’ in the LWR ranged from 2.089 to 3.193. LWR indi...

Mubashar Hussain*, Syeda Nafeesa Kazam, Aqsa Noreen, Suleman Hussain Shah, Uswa Zeb and Aniza Iftikhar

...pecimens representing 19 species which belonged to two suborders, three families, nine subfamilies, 12 tribes, and 15 genera. Acrididae (933 specimens; 15 species) was the most abundant family followed by Tettigonidae (1197 specimens; three species) and Pyrgomorphidae (136 specimens; one species). Maximum relative abundance was shown by Oxya hyla hyla (1...

Zarina Chang1, Nadir Ali Birmani1, Adil Hassan Chang2, Laraib Jamali2, Noreena Chang3 and Fouzia Chang4*

...he effects of Plasmodium species on hematological parameters in a descriptive case study was carried out on malaria positive patients. The objective of the study is to determine how malaria disturbs complete blood cell parameters. If it is left untreated, it will only get worse and may even result in human death. Therefore, it is essential to observe blood cell parameters sensibly. In this observational study, the data has been collected from 220 malarial pati...

Madeeha1, Shahida Naveed1*, Ayosha Hanif1, Jalwa Afroz1, Abdul Haq1, Gul Rose2, Inayat Ullah3 and Zunaira Inayat4

...l against four bacterial species including two gram positive bacteria (Staphylococcus aureus and Streptococcus mutans), two gram negative bacteria (Escherichia coli and Salmonella typha) and one yeast species (Candida albicans) using agar well diffusion method. Among the extracts, methanol was found best solvent for extraction followed by acetone. Qualitative Phytochemical screening of leaf nut galls extracts confirmed the p...

Bridget Maria Jessica Adah1, Samuel Mailafia1, H.O.K Olabode1, James Agbo Ameh1, Martha Echioda Ogbole1, Ebenezer Odey Odey1, Ifeanyi Cajetan Cashmir1, Hakeem Onigbanjo1, Monday Onakpa2, Enid Godwin3, Chinwe Elizabeth Okoli3, Nicodemus Nnabuike Mkpuma4, Oluwa Adikpe Agbonu5, Rabi Rebecca Mairabo6

... regards to other animal species in Nigeria, as this will guide clinicians in antifungal agents’ selection towards achieving effective therapy as a control strategy for eradicating the disease.
 
Keywords | Aspergillus niger, MARI, Zoonotic, Antifungal agents, Potato dextrose agar, Aspergillosis
...

Mahnoor Baloch* and Sanam Zarif Satti

...of the pathogen to Pinus species in the region, raising concerns about the long-term sustainability of these forest ecosystems.

...

Burhan Khalid1*, Muhammad Umer Javed2, Talha Riaz3, Muhammad Atiq Ashraf4, Hafiza Zara Saeed5, Musrat Shaheen6, Shumaila Nawaz4, Amir Khan Korai7, Rabiya Riaz8 and Muhammad Asim4

...infect a variety of host species is influenced by genetic uniqueness, adaptive trade-offs, and virus-vector interactions. This review also looks at how ecological factors, like species cohabitation and community interactions, affect the dynamics of viral transmission. Because environmental heterogeneity makes it difficult to extrapolate trends, the interaction of ecological and genetic models is essential to comprehending ho...

Wessam Monther Mohammed Saleh1*, Afrah Ali Dakhil2, Saad Shaheen Hamadi Al-Taher3, Mazin Mahdi Naji4, Layth Mohammed Salih AbdulRasool4, Khazaal Abbas Khazaal Alqaisi4

...CHF Double-Antigen Multi-species – CCHFDA” ELISA-Kit). The results showed that the incidence of CCHF in the examined sheep and goats was 49.3% (P≤0.01). In sheep, the overall seroprevalence rate was 52.9%, while in goats it was 35.5%. The current investigation showed a substantial difference in seroprevalence rate between animals that had a high level of tick infestation and those without ticks. However, 57% (P≤0.001) of sheep and 29.2 % (P&l...

Imtiaz Kashani1*, Asadullah Ali Mohammad2, Abdul Hameed1, Ali Jan3, Nazeer Ahmed4 and Kishwar Kumar Kachhi1

...i Beach, boasting higher species richness despite facing greater tidal influences. Mollusks, particularly gastropods, thriving in these rocky havens. The number of individuals per unit area of intertidal fauna was higher at Mubarak Village, which was dominated by mollusks and arthropods. Mollusks were consistently more abundant than other species. Balanus balanus is the common species foun...

Koffi Komoe1, N’Guessan Roméo Lozo1*, Estelle Sévérine Konan2

...he distribution of algal species in the Ouladine lagoon is influenced by pH, turbidity, dissolved oxygen, orthophosphate and nitrate levels.
 
Keywords | Phytoplankton, Physico-chemical parameters, Ouladine lagoon, Grand-bassam, Côte d’Ivoire
...

 Qin Yang Xinlei Fan

Volume 2, Issue 1 January and February 2018 Pages 17-18
...f host plants. Diaporthe species are well-known as the causal agents of many important plant diseases; including root and fruit rots, dieback, stem cankers, leaf spots, leaf and pod blights, and seed decay (Udayanga et al., 2011). Diaporthe helianthi is the causal agent of one of the most important diseases of sunflower (Helianthus annuus) worldwide, and is also listed in the Chinese quarantine directory (Thompson et al., 2011). For plant pathologists, studyi...

 

Abo-State M.A.M. Partila A.M.

Volume 2, Issue 1 January and February 2018 Pages 19-32
...ential of four bacterial species for extracellular production of nanosilver (AgNPs) from 3 mM concentration of silver nitrate (AgNO3) after incubation for 4h at 85°C. Biosynthesized AgNPs were characterized by using different methods such as; UV/vis spectroscopy, Transmission electron microscope (TEM), X-Ray Diffraction (XRD) and Fourier Transform Infra-red (FTIR) spectroscopy. Results of UV–vis spectroscopy showed maximum absorption at 401-432 nm, ...

 

Mahesh Raj Pant 1 Dipti Shrestha 1 Shovana Thapa 2

Volume 2, Issue 3 May and June 2018 Pages 53-60
...ight different bacterial species were identified as; S. aureus 75 (56.8%), Coagulase negative S. aureus (CONS) 20 (15.2%), Escherichia coli 13 (9.8%), Citrobacter spp. 7 (5.3%), Pseudomonas aeruginosa 5 (3.7%), Klebsiella spp. 5 (3.7%), Proteus spp. 5 (3.7%) and Enterobacter spp. 2 (1.5%), all were isolated from culture positive specimens. Antibiotic susceptibility test (AST) of all Gram-negative isolates showed that Colistin and Imepenum were the most effecti...

Amirreza Amirmijani Mahdieh Sadeghian Behanz Karimi

Volume 2, Issue 6 November and December 2018 Pages 105-113
...order to identify fungal species associated with some dried fruits including; Common fig, Date palm, and White Mulberry, 35 fruit samples were collected from common markets in the south of Kerman province, Jiroft, Iran, during 2016. After surface disinfestation with 0.5% NaOCl, small fragments of each dried fruit were plated onto Potato dextrose agar (PDA) medium. Recovered fungal isolates were purified by single spore method. Morphological characteristics of ...
Samia Sharafat1, Dildar Hussain Kalhoro1*, Muhammad Saleem Kalhoro1, Shahid Hussain Abro1, Mazhar Hussain Mangi1, Azhar Ali Laghari2, Ali Raza Nizamani3, Abdul Ahad Soomro3, Rani Wagan1, Asmatullah Kaka1, Abdullah Channo1, Hubdar Ali Kolachi4, Muhammad Ibrahim Panhwar4 and Mehkar Hussain5
...onfirmation of bacterial species. Overall, 19%, 35% and 56% prevalence were found for Staph. aureus, Salmonella and E. coli, respectively. Antimicrobial resistance of fourteen antibiotics (gentamycin, erythromycin, penicillin, ampicillin, vancomycin, neomycin, tetracycline, oxytetracycline, doxycycline, bacitracin, cephalothin, norfloxacin, streptomycin and kanamycin) were performed by disk diffusion method against Staph. aureus, Salmonella and E. coli showed ...

Hongmei Dai1, Shixiong Xu1, Zhipeng Liu1, Hailong Huo2, Fuhua Yang1, Xia Zhang3* and Jinlong Huo1,4*

...nserved across mammalian species in evolution. PPI network, KEGG and GO analyses suggested that CDK16 interacted with 50 proteins, with mainly involving in the cell cycle, cellular senescence, p53 signaling pathway, protein kinase activity, phosphorylation, and G1/S transition of mitotic cell cycle. Furthermore, correlation analysis between these proteins and RNA-seq data from BMI testes revealed that CDK16 was significantly associated with CDC6, CDKN1A, BARD1...

Ashar Farooq1*, Mohammad Salim2, Zahid Rauf1, Muhammad Tahir Khan3 and Asad Abbas Khan4

...s included three Panicum species: P. antido tale, P. coloratum, and P .maximum, each assessed at different growth phases i.e., pre-boot, full-flowering, and seed-ripe. Fresh grass samples were collected and analyzed for several quality parameters. The samples were oven-dried in order to determine dry matter (DM) yield and subsequent analysis for Crude Protein (CP), Ash Content, Ether Extract (EE), Crude Fiber (CF), Acid Detergent Fiber (ADF) and Neutral Deterg...
Habtamu Tedila1*; Addisu Assefa1; Feto Haji
Novel Research in Microbiology Journal (2019), 3(1): 190-203
...style="font-size: 11pt;">species cause infections in individuals with deficient immune systems, and Th1-type cell-mediated immunity (CMI) is required for clearance of this fungal infection. Candida albicans is an opportunistic pathogen of humans and has a parasexual cycle that appears to be stimulated by environmental stresses. Aspergilli

 Yahaya, S.M.1*; Mardiyya, A.Y.1; Sakina, S.B.1; Hayatu, L.W.1

Novel Research in Microbiology Journal (2019), 3(1): 204-214
...of a wide range of plant species. This fungus is able to infect all aerial parts of its host plants; where infection may cause enormous damage both during plant growth and in the post-harvest stage (during cold storage or transport). B. cinerea is a major cause of economic losses in the production chain of cut flowers, bulb flowers and pot plants. Molecular-genetic studies performed over the past decade have provided a wealth of novel insights into the infecti...

 

Muhammad Junaid1*; Ayesha Bibi2; Musharaf Ahmad3; Muhammad Ali4; Yousaf Noor5

Novel Research in Microbiology Journal (2019), 3(2): 314-325
...ity of these isolates, a species-specific primers-mediated Polymerase chain reaction (PCR) was carried out. Two specific primers i.e. forward primer: 5'GTCGCCGTCAACTCACTTTCC3', and reverse primer: 5'GTCGCCGTAGCAATGCGGAATCG3', were used for amplification of the 281bp band. Twenty five isolates out of the 29 were genetically confirmed to be R. solanacearum based on their amplified 281bp band.

...

Maha E. Omran1; Azza A. Shafei2; Sally E. Abdel-Rahman2*

Novel Research in Microbiology Journal (2019), 3(3): 366-378
...erproduction of reactive species and microbial resistance to the existent antibiotics are still great health challenges. The current study aimed to evaluate the antioxidant and antimicrobial activities of Pterygota alata leaves extracts, in addition to isolation and identification of their chemical constituents. In vitro antioxidant activity was explored using 2,2'-diphenyl-1-picrylhydrazyl radical scavenging assay (DPPH), whereas the in vitro antimicrobial ac...

Eze, E.M.1*; Ezebialu, C.U.2; Unegbu, V.N.3; Nneji, I.R.4

Novel Research in Microbiology Journal (2019), 3(3): 379-386
... were classified into 19 species belonging to 11 genera mainly; Chrysosporium indicum, C. tropicum, Aspergillus flavus, Microsporum gypseum and Trichophyton terrestre were isolated frequently. C. indicum (13%) was the most predominant isolated species; C. tropicum (12%) was the second, followed by A. flavus (11%). In the current study; M. gypseum (9.3%) was the most common isolated dermatophyte, followed by T. terrestre (6%)...

Andriantsihoarana J. Razanatseheno1; Lovarintsoa J. Randriamampianina1; Hanitra R. Randrianarivo1; Danielle A. D. Rakoto1; Victor L. Jeannoda1*

Novel Research in Microbiology Journal (2019), 3(6): 502-510
...l) is the more resistant species. The majority of the extracts expressed bactericidal potency against the tested bacterial spp. Current results revealed the antibacterial potential of the Albizia mahalao leaves and root bark extracts thus could be used to treat infectious diseases.

...

 

Bassma H. Elwakil1; Safaa M. Ali2*; Soad F. Hafez3; Adnan A. Bekhit4; Moustafa Y. El-Naggar5; Zakia A. Olama5

Novel Research in Microbiology Journal (2019), 3(6): 535-545
...eumoniae. This bacterial species is the most commonly isolated pathogen (95 isolates) from all the examined samples (51.35%). Current results revealed that 30 and 14 strains of K. pneumoniae are positive to Extended spectrum β-lactamase (ESBL) production, and AmpC β-lactamase producers, respectively. On the other hand, modified carbapenem inactivation and modified Hodge test (MHT) were used to assess the carbapenem resistant strains. It is observed t...

 

Jonathan D. Hulse

Novel Research in Microbiology Journal (2020), 4(1): 606-612

Adamu, U.1*; Yusha’u, M.2; Usman, A. D.2; Abdulhadi, S.K.3

Novel Research in Microbiology Journal (2020), 4(2): 696-703

Adamu, U.1*; Yusha’u, M.2; Usman, A. D.2; Abdulhadi, S.K.3

Novel Research in Microbiology Journal (2020), 4(2): 696-703

Mastooreh Doustdar1*, Seyed Ahmed Reza Hashemi2, Asadullah Ali Muhammad3 and Maryam Forouzad1

...ome economical important species based on the Oman Sea ecosystem and to examine nutritional relationships among five economical species, including Saurida tumbil, Sphyraena jello, Acanthopagrus arabicus, Rastrelliger kanagurta, Trichiurus lepturus in the Oman Sea waters located in Sistan and Baluchestan Province. A total of 1065 fishes was randomly collected from fishing evacuation areas and fish market from April 2020 to Ma...

Shahzadi Sarrah Atique and Ishrat Aziz* 

... 110 parrots across nine species housed at the RASSA Bird Aviary and farm in Gujranwala, Punjab, Pakistan. The species examined included the Grey Parrot (Psittacus erithacus) (n=14), Cockatiel (Nymphicus hollandicus) (n=12), Senegal Parrot (Poicephalus senegalus) (n=12), Rump Parrot (Psephotus haematonotus) (n=14), Indian Ringneck Parrot (Psittacula krameri) (n=10), Lovebird (Agapornis spp.) (n=12), Sun Conure (Aratinga sols...
Xueyu Wang1,2, Dejun Zhang1,2, Wancai Xia1,2, Jie Hu1,2, Xiaoxia Yuan1,2, Ali Krzton3 and Dayong Li1,2*
... bieti) are a polygynous species, and the female individuals have to compete for access to a single male in their unit to get pregnant. We collected data on grooming in the mating and birthing seasons. We suggest that females directed more grooming to males in the mating season than in the birthing season, especially ‘non-mother’ females. After the mating season, female individuals redirected their attention to focus on babies in the birthing seaso...

Wafa H. Alamshani*; Faisal Al-Sarraj; Mashail A. Algamdi

...ates are the predominant species that belong to the family Lythraceae. Due to its
extensive range of bioactive compounds, the diverse parts of this P. granatum plant exhibit
significant pharmacological activities. The bioactive compounds of this plant have been shown
to possess several antioxidants; anti-inflammatory, antimicrobial, anti-diabetic, antiatherosclerotic,
and many other biological effects. Consequent...

Souvik Roy1*; Dibyanshu Shaw1; Tiyas Sarkar1; Lopamudra Choudhury2

...y metabolites of certain species of pathogenic fungi, are responsible for a variety of
adverse health effects that range from acute food poisoning to long-term effects, such as
cancer; pregnancy disruption, and immunodeficiency. Although fermented foods have been
consumed since time immemorial, in the 21st century, they are gaining immense popularity
owing to their numerous health benefits. However, it should be ...

Abeer Muazi Alenazi1; Yasir Anwar1*; Salah E.M. Abo-Aba1; Noor M Bataweel1,2

...ame genera, Streptomyces species produce several secondary metabolites.
However, despite the discovery of antibiotics, the infectious diseases remain the secondleading
cause of death worldwide. Each year, around 17 million people die from bacterial
infections; mainly children and the elderly. In addition to the overuse of antibiotics, a key
factor contributing to antibiotic resistance is self-medication, which re...

Sabrine Mannai*; Najwa Benfradj; Naima Boughalleb-M’Hamdi

...ained. The most dominant species were F.
oxysporum (33.9 %); Pythium ultimum (33.05 %), F. solani (16.95 %), and Phytopythium
mercuriale (16.1 %). Results of the seasonal variation showed that Fusarium spp. and
Pythiaceae populations had peaked in June. The populations of F. oxysporum and F. solani
were significantly and positively correlated to temperature. In relation to the soil
physicochemical cha...

Malathi H1*; Pooja Sharma2

...he appropriate microbial species is
chosen, and the harmful metals are easily accessible for absorption. This new technology uses
bacteria to remove the harmful metals from the environment at a low cost. This study analyzes
the effectiveness of bioremediation using microorganisms; using unique methodologies and
integrated assessment methods. In addition to providing an overview of ISB for pollutant(s)

Noha Mostafa Mahmoud*

...ionships. Novel taxa and species will be detected by optimizing the culture conditions;
followed by quick identification using mass spectrometry or molecular next generation
sequencing. Culturomics of the human gut microbiota can be used as a bactriotherapy for the
inflammatory bowel diseases and the respiratory illnesses like COVID-19, and as an
immunomodulatory agent for cancer therapy. Furthermore, culturomics...

Anjana Suresh*; Grasian Immanuel

...oulants made from marine species; especially sponges and corals, have gained
importance because of their performance in field tests; however, the gathering of larger
quantities of marine animals is not a feasible choice. Several recent researches revealed that
the marine microorganisms associated with sponges; corals, ascidians, seaweeds, and sea
grasses, serve as the primary sources of antifouling substances and...
Taha Chouati1,2; Ounayssa Ayadi1,3; Mohammed Ajdig1,4; Lahcen Ouchari1,4; Bahia Rached1,3; Jamila El Alami1;
Elmostafa EL Fahime1,2*
...al identification to the species level was performed using 16S rRNA gene
sequencing and MultiLocus Sequence Typing (MLST), a technique that is much more precise
and can identify the bacteria to the strain level. Strain B950 showed a relatively stable protease
activity at the tested extreme conditions (i.e., 130.8 U/ ml at 60 °C and 10 % NaCl). On the
other hand, strain B961 displayed a better overall activity...

Abdur Rauf1, Farooq Jan1*, Muhammad Yasin2, Muhammad Qayash3, Muhammad Luqman1, Kashif Hayat4, Fayaz Asad5, Ikramullah Khan1 and Muhammad Khalid6 

...ined temporally dominant species on these mountains, starting from present time (2022) going back till 500 calibrated years before present (cal.yrs.BP). A drastic decrease in the abundance of Conifers coupled with the simultaneous spread of different herb species, belonging to Poaceae, Cyperaceae, and Amaranthaceae families, was found from 500 back till 900 cal. yrs. BP. Further back in the late Holocene period from 900 to 2...

Nishat Zafar1*; Ashiq Ali2; Muhammad Yasir Afzal3; Qaisar Tanveer4; Sidra Bibi2; Irha Basit5; Huma Nasir1;
Shanzay Imtiaz3; Usman Nazir3

Novel Research in Microbiology Journal (2020), 4(3): 766-778
...eta, and Gamma hemolytic species. Streptococcus sp. produces a high amount of lactic acid through the fermentation of sugars, causes lowering of the pH leading to the plaque formation around teeth, and serves as a biofilm. Microbial biofilm provides certain attachment sites for growth and colonization of other bacteria, and also causes resistance to the antimicrobial agents. These Streptococci can be transmitted to the infants through parents or caretakers' ki...

Sheeza Sakhawat, Aniza Iftikhar, Uswa Zeb, Aqsa Noreen, Suleman Hussain Shah and Mubashar Hussain*

...cal location, and beetle species. The gut microbiota plays a crucial role in breaking down complex organic compounds, neutralizing toxins, and supporting the overall ecology of the beetle. This paper examines the bacterial population within dung beetles, focusing on their taxonomy, functionality, and ecological roles. It also explores how these gut bacteria vary based on the beetle’s environment and its symbiotic relationship with them. The bacterial tax...

 

Dhurva Prasad Gauchan1*; Ashok Kumar Bhattarai2; Shishir Pandey1; Sunil Bhandari1

Novel Research in Microbiology Journal (2020), 4(4): 921-938

Alaa Fathalla Mohammed

Novel Research in Microbiology Journal (2020), 4(5): 992-1004
... combinations of several species of Arbuscular mycorrhizal fungi (AMF), and promoting its growth under water stress conditions. In a greenhouse experiment, the effect of three AMF species on wheat plant growth was studied using single- inoculations with Glomus monosporum, G. mosseae and Gigaspora gigantean, and mixtures of various AMF species. Moreover, inoculation of wheat plant with pair...

 

Hani M. A. Abdelzaher1,2*; Koji Kageyama3

Novel Research in Microbiology Journal (2020), 4(6): 1029-1044
...ied. All of the isolated species have been previously recorded from aquatic habitats except for P. pachycaule. Sequencing of the internal transcribed spacer regions of ribosomal DNA (rDNA-ITS) including the 5.8SrDNA of these fungi confirmed primary identification based on morphological characteristics. This study proves the dense presence of different species of these Pythiaceous fungi, based on the latest modern identificat...

 

Fatma M. Abdel Baset; Noura Sh. A. Hagaggi*; Francis F. Hezayen; Usama M. Abdul- Raouf

Novel Research in Microbiology Journal (2020), 4(6): 1045-1056
... prevalent genus. At the species level, the bacterial diversity was high. Eight representative species were isolated including; Citricoccus alkalitolerans (Cps2) (NR025771), Bacillus cereus (Cps1) (NR074540), B. pumilus (Cps3) (NR112637), B. firmus (Cpl1) (NR025842), B. niabensis (Cpl3) (NR043334), B. subtilis (Cpl4) (NR113265), B. amyloliquefaciens (Cpl10) (NR041455) and B. subtilis subsp. spizizenii (Cpl13) (NR112686). Res...

Maysaa, T. Alloosh1*; Walid, I. Khaddam1; Adbulsalam, K. Almuhammady2

Novel Research in Microbiology Journal (2021), 5(1): 1077-1090
...l towards several fungal species that cause important human diseases mainly; Candida albicans and Aspergillus niger. Moreover, NPs has antibacterial efficacy against Staphylococcus aureus and Pseudomonas aeruginosa, which recently become less affected by several antibiotics like penicillin and methicillin. This review will help the researchers who work in biosynthesis of NPs and in the nano-medical application fields.

...

Nouran H. Assar1*; Aya allah T. Mohamed2,3; Rehab M. Abd El-Baky2,3; Reham Ali Ibrahem2

Novel Research in Microbiology Journal (2021), 5(3): 1256-1268

 

Sabrine Mannai1*; Naima Boughalleb-M‟Hamdi1

Novel Research in Microbiology Journal (2021), 5(6): 1431-1446
...ction. Several oomycetes species were associated with this disease. The aim of this study was to control this serious peach decline disease using several assays such as; in vitro poisoned food technique and in vivo greenhouse assay. About six chemical fungicides were evaluated for their in vitro and in vivo inhibitory potentials against Pythium ultimum and Phytophthora citrophthora associated with this disease, respectively. The in vitro poisoned food techniqu...

 

Ahmed, M.F.A.1*; Shaheen, S.I.2; EL-Fiki, I.A.I3; Ahmed, M.S.M.4

Novel Research in Microbiology Journal (2022), 6(5): 1682-1699

 

Fatma Ahmed Abdel Aziz1; Gamal Fadl Mahmoud Gad1; Ahmed Mohamed Kamal El Shafei2; Reham Ali Ibrahem1*

Novel Research in Microbiology Journal (2022), 6(5): 1725-1741
...to look at the bacterial species causing conjunctivitis, as well as their antibacterial susceptibility patterns. In addition to emphasizing on detecting the predominance of certain virulence genes of Methicillin Resistant Staphylococcus aureus (MRSA), and Methicillin Resistant coagulase negative Staphylococci (MR-CoNS), which are known to cause conjunctivitis. In this study, several swabs of bacterial conjunctivitis were sampled from patients who attended to t...

Syeda Sadaf Wajahat

Novel Research in Microbiology Journal (2024), 8(1): 2265-2284
...cs. The marine microbial species were uncultivable but recently, scientists cultivated certain seawater microbes effectively by a metagenomic technique. Several studies on the marine microbiome are undergoing and it can be assumed that approximately 91 % of the microbial species in the oceans are unidentified. The marine surroundings possess an exclusive environment with inimitable features and become a source of microbes fa...

 

Shrouk E.E. Farg1; Shafik D. Ibrahim2; Samir Mahgoub3*; Atef S. Sadik1; Mamdouh H. Abdel-Ghaffar1

Novel Research in Microbiology Journal (2024), 8(2): 2370-2392
...x ZYM- infected cucurbit species compared to the healthy plants of the same species. A total of 88 polymorphic DNA fragments were distributed as follows: 13, 7, 10, 6, 9, 10, 15, 8, and 10, which were generated using SCoT-02, SCoT-03, SCoT-04, SCoT-06, SCoT-08, SCoT-11, SCoT-12, SCoT-13, and SCoT-14 primers, respectively. The DNA polymorphisms of the six ZYMV-infected cucurbit species show...

 

Mohammed Ajdig1,2; Bahia Rached2,3; Ahlam Mbarki1,2; Taha Chouati2,4; Chouhra Talbi1; Elmostafa El Fahime2,4; Marouane Melloul1,2*

Novel Research in Microbiology Journal (2024), 8(3): 2414-2434
...rmis is a new identified species, which was distinguished from Bacillus licheniformis in 2015 through extensive phylogenomic and phylogenetic analyses. In this context, this study aimed to achieve a clear identification of the active plant-growth promoting rhizobacteria (PGPR) B. paralicheniformis isolates among the closely related B. licheniformis through molecular typing, helping for the development of clearly-identified PGPR isolates to be used as biofertil...

 

Fateh Merouane1*; Amani Kifadji2; Racha Mansouri3; Meroua Safa Mechouche1,4; Chemes El-Houda Messaad5,6; Anfal Bellebcir1

Novel Research in Microbiology Journal (2024), 8(5): 2555-2579
...lic health. Streptomyces species have been recognized as a prolific source of bioactive secondary metabolites, including antimicrobial compounds. In this study, we aimed to optimize the production of anti-MRSA compounds by Streptomyces sp. AR05; a strain isolated from hydrocarbon-contaminated soil, using an integrated approach combining response surface methodology (RSM), artificial neural networks (ANN), and genetic algorithms (GA). The strain was identified ...

 

Tran Thi Hong1; Ngo Van Anh1; Nguyen Thi Ngoc Anh2; Nguyen Van Phuong3*

Novel Research in Microbiology Journal (2024), 8(6): 2694-2711
... including un-culturable species in lagoon sediments collected from Tam Giang, Nai, and Thi Nai lagoons, which were located in the central coast of Vietnam using metagenomics approach. The results showed that all three large lagoons exhibited a high diversity of fungal species among the eukaryotic species and a high diversity of bacterial and archaeal species

 

Belal Natey1; Ahmed M.M.A. Kasem1; Younes M. Rashad2*; Nageh Fathy Abo-Dahab1

Novel Research in Microbiology Journal (2024), 8(6): 2712-2733
..., forty-nine Trichoderma species were isolated from the rhizosphere and tissues of 25 plant species collected from different sites across four Egyptian governorates. The antagonistic activity of all isolated Trichoderma strains was screened against S. cepivora BYAN1 in vitro. Microscopic examination showed that isolate B3R12 (identified as T. afroharzianum B3R12) has the greatest mycoparasitic level. Moreover, this isolate s...
Ahmed Guerfi1, Mohcen Menaa2*, Kaouther Guellati2, Lamia Boutabia1
Salah Telailia1, Moussa Houhamdi3, Rafik Boukhris1 and Mohamed Cherif Maazi2
...nd how a particular bird species responds to a particular forest habitat. We have conducted the first bird survey in Ouled Bechih forest of Mechroha municipality using the point count method across the three oak forest types (cork oak stands, mixed oak forests and zeen oak stands). A total of 62 species were observed among which 20 protected species, only one vulnerable

Ayesha Zulfiqar1,2, Sun Xue-ying1, Wu Qing-ming1*, Tariq Ahmad1, Xu Zhuo1,3, Anum Razzaq4, Wu Ming-hui1, Zhang Qi1, Li Xiao-qin1 and Zou Hongfei1*

...tion (1) a total 79 bird species from 32 families and 13 orders including six avian ecological groups were observed, namely grallatores, passeres, natatores, raptatores, scansores and terrestores. (2) The passeres, grallatores and natatores were the three dominant avian ecological groups during autumn migration. The reed marsh with more than 30cm water dept (WL4) and the lake, with more than 30cm water depth (WL4), were the most preferred habitats. It was conc...
Hayam Albalawi1,2, Muhammad Shahid Nadeem1*, Hisham N. Altayeb1
Saima Iftikhar3, Mariam A. Al-Ghamdi1,4,5, Jalaluddin Azam Khan1 and Ahmed Osman1
...ylogenetically different species

...

Hareem Fatima1, Lubna Ansari1*, Sajjad Haider Zaidi2, Shazia3, Saqib Mehmood4 and Nasim Iqbal Butt5

...justify;">Invasive alien species are the species that are not native to the certain ecosystem and have adverse effect on the native plant species. Prosopis juliflora and Arundo donax are invasive plants in Kundian irrigated plantation and produce competition for native plants. There was no research on drivers of Invasive species (Prosopis juliflora and A...

Hamza Iftikhar1, Ranra Jalal2, Mansoor Ali Shah1, Syed Anas Shah Bacha1, Amjid Ali1 and Syed Majid Rasheed1*

...ehavior of two honey bee species i.e., A. mellifera and A. cerana in Langstroth hives and A. cerana in traditional mud hives across eight weeks and three-time durations (T1, T2 & T3) at the Directorate of Non-Timber Forest Products (NTFP), Forest Department Khyber Pakhtunkhwa, Peshawar during spring, 2020. The highest outgoing foraging was recorded for A. cerana in a traditional mud hive (46.54), followed by A. mellifera (44.84), and the minimum outgoing f...

Mahfouz M.M. Abd-Elgawad

...well to control key tick species. Their applications will avoid not only ticks-direct damages but also many tick-borne diseases. These latter can even inflict humans which constitute a substantial public health concern worldwide. Fortunately, the basics/experience assembled in using EPNs against other arthropods can assist in developing tick biocontrol methods. As EPNs naturally live in/on the soil, where 95% of tick populations infesting livestock are found, ...

Wisam Naser Kadhim* and Qassim Gawad Ameer

...It is the most important species between humans and animals, causing diseases in humans. This is also determined the Sarcocystis heydorni which is zoonosis disease, and S. cruzi S. hirsute. With the use of (120 slaughtered cattle meat (esophagus) samples and 10 samples from imported meat were compared. In addition, the effect of some certain factors i.e. (age, gender, and months) was undertaken. Samples were collected from July into December 2022. PCR analysis...

Kamal Hachour1,2,3*, Noura Talmat-Chaouchi1,2 and Riadh Moulaï1

...21) study. A total of 17 species of water birds belonging to ten families and seven orders have been recorded. The number of water birds that frequented the study area varied from 1025 to 1396 individuals. The Anseriformes (Anatidae) were recorded as the most dominant, represented by five species: Mallard Anas platyrhynchos, Northern shoveler Spatula clypeata, Common shelduck Tadorna tadorna, Eurasian wigeon Mareca penelope ...

Zheng Han1, Junbo Liu2, Jingyao Luan2, Changlong Gao2, Yufeng Tai2, He Liu2, Saipeng Zhang2, Guanqiang Zhai2, Xi Yang1,3, Haitao Wang1,4*

...cations for various bird species. In this study, we first examined differences in surrounding habitat characteristics of occupied pylons among bird species in Baicheng City, northeastern China. Then we evaluated the relative importance of habitat variables on pylon selection by nesting birds. Among the 860 surveyed electric pylons in Baicheng, 56 nests of six bird species (Eurasian Magpie,...

Pakistan Journal of Zoology

November

Pakistan J. Zool., Vol. 56

Featuring

Click here for more

Subscribe Today

Receive free updates on new articles, opportunities and benefits


Subscribe Unsubscribe