Submit or Track your Manuscript LOG-IN

Souvik Ghosh, Nobumichi Kobayashi

British Journal of Virology
...ortant RVA VP7- and VP4- protein encoding genes are important for vaccine development or judging the efficacy of existing RVA vaccines, they do not always provide conclusive information on the overall and complex genetic makeup of RVAs, as the remaining 9 RVA gene segments are also susceptible to the forces governing RVA genetic diversity. Whole genomic analysis of RVAs has revolutionized the study of RVA genomics, providing a plethora of conclusive and vital ...

El-Sayed M. Abdelwhab, Jutta Veits and Thomas C. Mettenleiter

Avian Influenza H5N1 in Egypt: What we Know and What we have to Know?
...n the hemagglutinin (HA) protein which improved the binding affinity to human receptors but simultaneously retained its specificity for avian-receptors. Vaccines were applied nationwide to control the disease in poultry. Meanwhile, the viruses accumulated several point mutations in the HA immunogenic epitopes resulting in antigenic drift and the establishment of infections in vaccinated poultry. The Egyptian H5N1 viruses remain susceptible to oseltamivir, but ...

Kathryne E. Taylor1 and Karen L. Mossman1,2*

...ature regarding the ICP0 protein from herpes simplex virus is complex and frequently contradictory, meaning that although this protein has been implicated in a wide variety of diverse functions, the mechanisms through which it produces these effects continue to be elusive. Recent investigations into the ability of ICP0 to block the activation of antiviral signaling have revealed a potential explanation for some of this confu...

Qin Zhao1,2, Yani Sun1,2, Gaiping Zhang1,3, Frederik Widen4, En-Min Zhou1,2,*

[email protected]

....

...

Weili Kong1, Guangpeng Ma2 and Jinhua Liu1*

...e non-structural 1 (NS1) protein plays a crucial role in moderating the virulence of influenza virus by multiple mechanisms. Due to C-terminal ‘tail’ (CTT) truncation of NS1, there are length variation types of NS1 in different subtype influenza viruses. CTT functions in several ways to defeat the cellular innate immune responses. Here, we discuss those different effects of CTT truncation or elongation of NS1 protein...

Gerald Misinzo1,*, Tebogo Kgotlele1, Epaphras A. Muse1, Jan Van Doorsselaere2, Mikael Berg3, and Muhammad Munir4

...ce analysis of the nucleoprotein (N) gene, the PPRV has been classified into four lineages. Serological investigations in Tanzania indicate that peste des petits ruminants (PPR) was introduced in 2004 in Ngorongoro district bordering Ken- ya before official confirmation of the disease in most districts of Northern Tanzania in 2008. In 2011, the presence of PPRV in goats of southern Tanzania district of Tandahimba bordering Mozambique was reported. The aim of t...

Qingzhong Yu

 

...ting a green fluorescent protein (GFP) gene upstream from the GE sequences of the viral genes and subsequent quantitative measurements of the GFP fluorescence intensity, we have concluded that the P and M junction region is the optimal insertion site for a high level of foreign gene expression by a NDV vector.

...

Malik Ikram Ullah1, Abdul Aziz Khakwani1*, Muhammad Sadiq1, Inayatullah Awan1, Muhammad Munir2, Ghazanfarullah1

... dry matter yield, crude protein, crude fiber and ash percentage were significantly increased with increase nitrogen levels (200, 240, and 280 kg N ha-1). However, highest benefit-cost ratio was estimated when 240 kg N ha-1 was applied which was found best compromise between forage yield and quality for maize cultivar Kissan under the agro-climatic conditions of Dera Ismail Khan, Pakistan. The study also indicates that crude protein

Shumaila Manzoor1, Afshan Ahmed1 and Muhammad Abubakar2*

... against FMDV structural proteins.

...

 Shubhada K Chothe, Bhushan M Jayarao and Suresh V Kuchipudi

...hich can escape the anti-protein environment in the virus infected cells and are likely to be conserved across the species. Here, we summarize our current knowledge about the role of lncRNAs in influenza virus infection and the exciting prospect of exploiting lncRNAs as targets to develop novel anti-viral therapies.

...

Muhammad Imran1*, Muhammad Mobashar2, Muhammad Irfan3, Shazia Hanif4, Sumaira Hanif5 and Muhammad Abubakar6

...ents, the value of crude protein (CP) digestibility coefficient was high (P<0.05) in treatment MLM4 as compared to MLM1. Similar trend was also observed in case NDF among treatments. Daily milk yield and 4 % FCM has increased (P<0.05) in buffaloes fed treatment MLM3 and MLM4 as compared to other treatments. While there was no significant (P>0.05) difference of percentage of fat, protein, lactose, ash, total solids a...

Kang-Seuk Choi

...rising only viral capsid proteins mimic the naive configuration of authentic IBD virus particles. The VLPs show intrinsic immunogenicity and a high safety profile.  Thus, VLPs are considered one of the most promising approaches to vaccine development and are an alternative to inactivated IBD vaccines. In addition, VLP technology has many applications. This paper reviews the potential of VLPs as an alternative to IBD vaccines, along with their specific app...

Jonas Johansson Wensman1*a, Karl-Johan Leuchowius2,3 a, Jiting Yan1, Anna-Lena Berg4, Liv Bode5, Hanns Ludwig5, Sandor Belak6, Ulf Landegren2, Ola Soderberg2, Mikael Berg6

... for studying virus-host protein-protein interactions. BDV P (phosphoprotein) and N (nucleoprotein) have previously been reported to interact with several host proteins, thereby interfering with various signaling pathways. In this study, we focused on some of these interactions (BDV P-HMGB1, BDV N/P-Cdc2). First, we us...

Yongfeng Li, Mo Zhou, Xiao Wang, Libao Xie, Hua-Ji Qiu*

...ently tracking the viral proteins in live cells as well as improving diagnostic methods and vaccines for classical swine fever.

...

Mohammed A. Rohaim1*, Rania F. El Naggar2, Ahmed M. Helal3, Hussein Ahmed Hussein1 and Neil LeBlanc4

...e site of the fusion (F) protein indicated the emergence of PPMV-1 in Egypt. Phylogenetic analysis of the F and haemagglutinin-neuraminidase (HN) genes indicated that the isolate clustered with the PPMV-1 strains recently reported from Israel within subgenotype VIb. Our findings report the emergence of PPMV-1 in Egyptian pigeons and the potential role these wild birds can play in the transmission and evolution dynamics of PPMV-1.

...

Amitha Reena Gomes1, Belamaranahally Muniveerappa Veeregowda2, Sonnahallipura Munivenkatappa Byregowda1, Vinayagamurthy Balamurugan3*

... technology, recombinant protein based vaccines and/or diagnostics are being tested in various heterologous systems across the globe for development of vaccines and/or diagnostic antigens. The recombinant viral proteins, virus like particle based vaccines, bivalent/multivalent vaccines, recombinant viral vectored vaccines, RNA interference as a therapy, suicidal DNAs, synthetic epitopes and peptides, reverse genetics, anti i...

Mohammad Mushfiqur Rahman1, Rokshana Parvin1, Ataur Rahman Bhuiyan1, Mohammad Giasuddin2, Shah Md. Ziqrul Haq Chowdhury3, Mohammad Rafiqul Islam1, Emdadul Haque Chowdhury1*

 

...he partial sequence of N protein.The recent Bangladeshi isolates are somewhat divergent from the earlier Bangladeshi isolate, indicating that the PPRV strains in Bangladesh are continuously changing their genetic character.

...

Muhammad Abubakar1*, Shumaila Manzoor2, Jonas Johansson Wensman3, Emeli Torsson3, Qurban Ali1 and Muhammad Munir4

...bstitutions in the nucleoprotein (NP) gene. Genetic variations within NP gene, and possibly in other proteins which are essentially mediating protective immunity, may explain the extreme infectious nature of the virus and its host-specific pathogenesis. Moreover, understanding the nature of such circulating field viruses is essential to underpin the endemic potential of PPRV and its possible spread to the susceptible wild or...

 Ishfaq Ahmed, Ihsan Mabood Qazi and Suraiya Jamal

...t was found that percent protein (8.93–12.25%), ash (0.52–1.01%) and moisture contents (4.47–7.09%) showed significant (P < 0.05) increase, while fat content (1.41-1.17%) showed significant (P < 0.05) decrease by blending WF with BRF. Similarly, water solubility index (WSI), water absorption index (WAI) and swelling power (SP) showed significant (P < 0.05) decrease as the concentration of wheat flour in the blends increases. The valu...

 Zafar Khan, Asad Sultan, Rajwali Khan, Sarzamin Khan, Imranullah and Kamran Farid

 
...e of the main sources of protein but if contaminated by toxic heavy metals will cause a harmful effect on human health. The concentration of heavy metals (Pb, Cd, Cr, Fe, Mn and Zn) present in poultry egg and meat were determined in the following three districts; Peshawar, Dir Lower and Malakand of Khyber Pakhtunkhwa by using atomic absorption spectrophotometer. In all the three districts the egg albumen was found to contain significantly higher levels of Pb, ...

 John G. Bruno and Jeffery C. Sivils

... that the aptamers bound proteins of the correct molecular weights for intact outer membrane proteins (OMPs), intimins and SLT-2. Some bands on the aptamer Western blots were shared between the “Big 6” non-O157 Shiga toxin-producing E. coli (STEC), E. coli O157 and related Gram negative bacteria. However, unrelated Gram positive bacteria exhibited very few, if any, bands in common with those identified on the E. ...

Mian Shamas Murtaza1, Aysha Sameen1, Nuzhat Huma1 and Fatma Hussain2

...creased the moisture and protein content. The addition of gums further augmented the moisture level owing to owing to their water retention properties. The melt-ability, flow-ability and yield of cheese decreased significantly (p < 0.05) on reducing the fat level, as anticipated. However, the addition of gums gradually improved these aspects with higher values for cheese containing guar gum as compared to xanthan gum. The full fat cheese showed the minimum ...

 Shaoling Lin and Jiamiao Hu

...ify;"> The tegument protein pUL23 of human cytomegalovirus (HCMV) plays an important in the virus pathobiology, however, its role in viral assembly and replication is poorly defined. In this study we demonstrated that HCMV pUL23 interacts with an essential component of capsid, the minor capsid protein (mCP, pUL85). Interaction was determined and confirmed with yeast two-hybrid, GST pull-down and co-immunoprecipitation a...

Wan-Long Zhu* and Gao Wenrong 

...ncrease in mitochondrial protein contents and COX activity both in liver and brown adipose tissue, suggesting that A. chevrieri was more sensitive to cold than that of photoperiod. Together, these data suggested that A. chevrieri mainly depend on increasing thermogenic capacity to cope with cold or winter condition.

...

Zuhao Huang1, Feiyun Tu2 and Dianhua Ke1*

...5 bp and comprises of 13 protein-coding genes, 22 tRNA genes, two rRNA genes and two control regions CR and CCR, which was first reported in the order Coraciiformes. The overall A+T content for the mitogenome is 52%, and the GC and AT skews are -0.400 and 0.108. Unlike to many other birds, no extra base is inserted at certain position relative to ND3. Interestingly, a 484bp repeated sequence appears in both CR and CCR. Genetic distance shows that the differenc...

Laila M. Fadda1, Nouf M. Al-Rasheed1, Iman H. Hasan1, Hanaa M. Ali2,3*, Nawal M. Al-Rasheed1,4, Musaed Al-Fayez5, Aly M. Ahmed5, Nada Almutlaq1, Nehal Qasem1 and Reem Khalaf1

...hydrogenase (LDH), total protein, total bilirubin, hepatic glutathione (GSH), nitric oxide (NO), superoxide dismutase (SOD) and lipid peroxides (LP) levels were estimated. Moreover these biochemical parameters were confirmed by histopathological examination using hemotoxylin and eosin (H&E) and Mason trichrome stains (MTC). Immunohistochemical investigations for the expression of the proapoptotic protein (Bax) and the ex...

Zisha Liu1, Na Song1, Takashi Yanagimoto2, Zhiqiang Han3, Bonian Shui3 and Tianxiang Gao3*

...a concatenated set of 12 protein-coding genes, and adding 16 other species of gobies (Gobiidae). The mitogenome sequences of O. lacepedii, O. rebecca

Ambreena Hafiz1, Tanzeela Riaz2 and Farah Rauf Shakoori1*

...t was found that soluble proteins, glucose contents and free amino acids increased, whereas glycogen and lipid contents were reduced in all deltamethrin-resistant populations as compared to deltamethrin-susceptible population. Soluble Proteins were significantly elevated (79, 100 and 37%) in 4th and 6th instar larvae and adult beetles of Gujranwala, (14, 24 and 14%) in Okara and (14, 13 and 2%) in D.G Khan populations, respe...

Misbah Riaz1, Qaiser Mansoor2, Maleeha Akram1, Muhammad Ismail2, Parveen Akhtar3, Shakeel Mirza4, Mazhar Qayyum1, Afzaal Ahmed Naseem1, Faheem Tahir5 and Syed Shakeel Raza Rizvi1*

...ify;">The signaling of G protein-coupled receptor 54 (GPR54) is a key regulator of secretion of gonadotropin-releasing hormone (GnRH), whereas GnRH is a crucial neurohormone regulating the secretion of follicle stimulating hormone (FSH) and luteinizing hormone (LH) at puberty. The deficiency in release or action of GnRH leads to hypogonadotropic hypogonadism (HH) characterized by low FSH, LH and testosterone (T) and absent or impaired sexual development at pub...

Siyu Yang1, Fukuan Du2 and Pao Xu1,2*

.... This SS cDNA encodes a protein with 114 amino acids that contains the SS14 sequence at its C-terminus. This putative peptide is identical to that generated by the SS1 gene in other vertebrates. Tissue distribution of C. nasus SS1 mRNA was analyzed by real-time polymerase chain reaction (PCR), which demonstrated high expression level in the brain. During embryogenesis, SS1 mRNA was detected during early-stage embryonic development, decreased during subsequent...

Wenmin Cheng1,2*, Weirong Pan1,2, Yubo Qing1, Yingchao Liu1, Xingqin Zha1,2, Yan Huang2, Jige Xin1,2, Hongjiang Wei1 and Yangzhi Zeng2

...pm) is the most abundant protein in the nucleus of oocytes which can promote in vitro nucleosome formation. In this study, to improve the efficiency of SCNT in Banna Mini-pig Inbred Line (BMI), we obtained the recombinant nucleoplasmin (Npm) by using a prokaryotic expression system and compared the difference on the developmental effects between exogenous Npm and its structural analog, polyglutamic acid (PGA). We chose the pMD18-T vector for Npm expression and...

Giselle R.R. Ayres* and Brandão P.E

... code for non-structural proteins (nsps) that are enrolled in viral transcription, replication and pathogenesis. The last 3’ one-third of the genome codes the four structural and accessory proteins. Nsps act in a complex replication process, made possible by the special characteristics of AvCoV genome. This manuscript aims to present an overview of the main aspects of the current knowledge on the main AvCoV replicase g...

Abdur Rahim1, Ghulam Abbas1, Muhammad Naeem2, Sara Ferrando3, Lorenzo Gallus3, Noor Khan4, Muhammad Hafeez-ur-Rehman4, Abdul Ghaffar5 and Abdul Mateen6

...ferent units showed that protein contents were 50.51% – 61.26% and energy was determined as 4042.0 cal/g – 4558.0 cal/g. Dry mater was calculated as 87.43% – 93.13% and fat was noted as 15.29% – 26.23%. Ash was found to be 12.32%–18.32% and fiber remained as 7.52% – 13.12%. Phosphorus was found as 0.21%–1.8%. In fish meal preparation, 24 species belonging to different families were noted in which the most abundantly us...

Muhammad Hafeez-ur-Rehman1, Farzana Abbas1, Muhammad Ashraf1, Naeem Tariq Narejo2, Khalid Javed Iqbal3, Ghulam Abbas4* and Syedah Andleeb5

... fed on 40%, 35% and 30% protein diet @5% of their live body weight. In 40% protein diet treatment, male fish was injected 1st dose with ovaprim + HCG (0.3+0.3ml) and female fish was given 2nd dose after 24 hrs of intervals with ovaprim (0.2ml), while 1st dose ovaprim (0.7ml)+HCG (1.0ml) and 2nd dose ovaprim (0.7ml) was given to the females. The treatment which was given 35% protein diet r...

Tasnim Farasat*, Saima Sharif, Farkhanda Manzoor, Muneeza Zafar and Shagufta Naz

...female. High density lipoprotein (HDL), both systolic and diastolic blood pressure, cholesterol level and serum insulin were significantly higher (p< 0.05) in proliferative group of diabetic retinopathy, while triglyceride level, HbA1c (%), and low density lipoprotein (LDL) were non-significantly higher (p> 0.05) in diabetic retinopathy groups. To conclude high prevalence of diabetic retinopathy was observed among newl...

Dilawar Hussain* and Abdul Mateen

...ficiency ratio (FER) and protein efficiency ratio (PRE), irrespective the addition of the 4TX in the diets. Among different dietary groups of the fish, % survival was not affected significantly (p<0.05). T1 showed maximum NWG (45.49±3.85), FER (0.739±0.02) and PER (36.36±1.83) when compared to other dietary treatment groups. The addition of 4TX clay in the diets at both 2 and 4 ppm AFB1 concentrations have almost the same effect on the ...

Xiangxing Zhu1, Junyu Nie1, Shouneng Quan1,2, Huiyan Xu1, Xiaogan Yang1, Yangqing Lu1, Kehuan Lu1 and Shengsheng Lu1*

...s carrying a fluorescent protein (DsRed) reporter gene regulated by the 2.2-kb human glial fibrillary acidic protein promoter (hGFAP-DsRed). This study characterized transgene expression in such transgenic Guangxi Bama mini-pigs and their offspring. Our findings indicate that the hGFAP promoter contains matching regulatory elements for directing specific expression in porcine astrocytes. However, the practical application of...

Abdur Rahim1, Ghulam Abbas1*, Lorenzo Gallus2, Sara Ferrando2, Muhammad Hafeez-ur-Rehman3, Abdul Ghaffar4 and Abdul Mateen5

...with diet comprising 40% protein and 20% lipid for 75 days. Higher percent weight gain (% WG), best feed conversion ratio (FCR) and specific growth rate (SGR) were recorded at ration level from 2.5 to 4.5% BW d−1 and feeding frequency of three to four times daily. The moisture, protein and ash contents of whole body of the fish were not significantly (P>0.05) affected by feeding frequency. The highest lipid contents...

Salma Shaheen, Mumtaz Khan, Muhammad Jamil Khan, Saleem Jilani, Zarina Bibi, Muhammad Munir and Mehwish Kiran

 

...ber, vitamin C and crude proteins were also increased in spinach with pressmud + EM application. It was concluded that EM-inoculated pressmud has higher potential to increases soil fertility as well as stimulate spinach growth and quality. Therefore, warrants further testing under field conditions.

...
Sidra Ilyas1, Abdul Rehman1* and Qasim Ilyas2
...r treatment, whereas non-protein thiol levels were higher after Cd and As treatment followed by those of Pb, Cr and Cu treatment. Candida sp. PS33 was able to remove 78% (Cd), 70% (As), 82% (Cu), 65% (Cr) and 87% (Pb) from the medium after 8 days of incubation. This multi-resistant yeast can be used efficiently for the removal of toxic metals from the wastewater.
...
Abdur Rahim1, Ghulam Abbas1,*, Sara Ferrando2, Lorenzo Gallus2 and Abdul Ghaffar3
...ed with artificial diet (protein 42%, lipid 20% and energy 25.2 kJ g-1) for 120 days in three equal meals. On the other hand, control ponds remained without additives. During the whole study period, water quality parameters of the experimental ponds remained as salinity (15‰ -20‰), dissolved oxygen (5.6 to 7.5ml/l), temperature (25°C to 28°C). pH (7.6-7.8), ammonia (NH4-N) and `nitrites (NO2-N) ...
Yang Wang1, Zhide Cheng2, Mengjie Tang3, Haixia Zhou1, Xiaolu Yuan4,Muhammad Aqeel Ashraf5, Shuting Mao1 and Jing Wang1,*
...mal saline. The mRNA and protein expression levels of Ldh-c in plateau pika skeletal muscles were determined by real-time PCR and Western blot. The LDH activities, lactate contents and ATP levels in skeletal muscle were compared between the experimental group and the control group. The results showed that 1) the expression levels of Ldh-c mRNA and protein were 0.804±0.059 and 0.979±0.176, respecti...
Jun Cui, Xiaoxu Zhou, Zhicheng Wang, Derong Kong, Xuemei Qiu, Hongdi Wang and Xiuli Wang*
...ture acclimation-related protein, and it plays an important role in adapting temperature shock. But the research about Wap65 in crucian carp is very limited. In this study, the CDS of Wap65 was firstly cloned and characterized from crucian carp (Carassius carassius). This sequence is 1338bp that encodes a polypeptide of 445 amino acids. The calculated molecular weight of crucian carp Wap65 protein (CcWap65) is ...
K.N. ArulJothi1, M. Abinaya1, B. Suruthi Abirami1, Melvin George2, S. Elangovan3 and A. Devi1*
... receptor class B type I protein (SCARB1) plays an essential role in cholesterol homeostasis. The effect of the polymorphisms in the gene have varying influences on lipid levels and development of cardiovascular disease (CVD) in different populations. In this study, we investigated the association of rs5888 polymorphism with serum lipid levels and CVD risk in an Indian population. A total of 412 samples which included 148 myocardial infarction survivors...
Zafar Iqbal1* and Muhammad Khurshid2 
...low leaf curl virus-coat protein (TYLCV-CP) and African cassava mosaic virus-coat protein (ACMV-CP) were used. However, immunocapture of ToLCNDV could only be achieved by using the TYLCV-CP antisera followed by PCR detection by using specific and degenerate primers. ToLCNDV is geographically wide spread Begomovirus (Family Geminiviridae), considered as a close relative of TYLCV, and cause severe losses for many economical im...

 Eman M. Farghaly1, Ahmed Samy1,2*, Heba Roshdy

...er the deficit in animal protein in developing countries including Egypt. However little is known about the prevalence and antibiotic resistance of major bacterial pathogens such as Escherichia Coli, Staphylococcus aureus Salmonella and Pasteurella spp. in Egyptian quail farms. Such information is important for drug choice and success of treatment as well as spotting the light on emerging antimicrobial resistance that represent major concern for public health....

 Abdul Wajid Khalil and Zafar Iqbal

...1.22±0.05%) while protein (37.46±0.02%) and organic matter (21.25±0.03%) was recorded higher in roots than the aerial parts of B. procumbens. Calcium (309.73±0.06mg/100g), potassium (274.59±0.08mg/100g) and iron (32.58±0.05mg/100g) were found in highest amounts in aerial parts as compared to the roots. The Cadmium metal was not detected while lead was found in permissible limits in both the aerial parts and roots of B....
Abdul Malik1,4, Ghulam Abbas1*, Hameeda Kalhoro2, Illahi Bux Kalhoro3, Syed Sajjad A. Shah4 and Halima Kalhoro3 
...pellets having 35% crude protein at 2% body weight twice a day for 60 days and eggs were collected weekly. Results showed that fertilized eggs were found to be greater in number at low salinity level as compared to higher salinity level. Survival of fry ranged from 1058 to 1100 at salinity level of 0‰ – 20‰ with 5% increment, after which fry number decreased significantly (P<0.05). The fertilized eggs did not differ for the fish at salin...

Mohammad Raoofi and Mohammad Taghi Alebrahim

...ms of nutrient elements, proteins and factors such as ADF, Ash, CF, NDF.

...

Wesam Hasan Mohamed Mady 1*, Bing Liu2, Dong Huang2, A. Arafa1, M.K. Hassan1, M.M. Aly1, Pucheng Chen2, Yongping Jiang2* and Hualan Chen2

... (HEK) cell line. The HA protein was analyzed using SDS-PAGE followed by Western blot and immunofluorescence assays. The pCAGG-optiH9 vaccine efficacy was evaluated by intramuscular immunization of SPF chickens with different concentrations of plasmid DNA and the sera were collected weekly post vaccination for antibody detection by HI test. All immunized chickens shown high HI antibody titers (9Log2) two weeks post-booster dose. The chickens were then challeng...
Adel Eid Mohamed Mahmoud*
...on coefficients of crude protein and digestible crude protein. Ruminal pH values and ammonia nitrogen concentrations did not show any significant differences among groups.No significant differences were observed in meat chemical analysis of slaughtered animals among different groups. Animals fed BBP recorded insignificant increase in growth rate by 9 g daily with improvement in feeding cost by 10%.Bakery waste can replace co...
Muhammad Tahirand Memoona Shehzadi*
...yield, harvest index and protein content were recorded where seed inoculation with PGPR-1 + PGPR-2 and full dose of recommended chemical was applied during both the growing seasons. Overall the performance of sunflower was better in spring as compared to autumn season. However, it was also noted that the combination of PGPR-1 + PGPR-2 and half recommended doses of chemical fertilizer gave results as full recommended dose of chemical fertilizer alone. Therefore...
Neenish Rana, Nosheen Ehsan, Awais Ihsan and Farrukh Jamil*
...rved that their putative protein products will be thermodynamically stable. The sequence-based predictions suggested that the pseudogenes-derived proteins may involve in different biological functions like translation, energy metabolism, amino acid metabolism and transport and binding.
...

A. K. Chaubey and Satyandra Kumar

Bio-management of root knot nematode and root rot disease by antagonistic fungi and rhizobacteria
...n and cultured in liquid protein supplemented broth medium and culture filtrates (CF) were prepared. In in-vitro test single eggmasses of uniform size were kept in 5ml CF in 5cm diameter Petri plates. Antifungal activity was tested by dual culture of wilt fungus with antagonist fungus and bacteria isolates in PDA media plates. In in-vivo test soil was amended with antagonist and wilt fungal and bacterial isolates 2 x 106 CFU/ml and 2 x 108 CFU/ml respectively ...
Beenish Zahid1,*, Asim Aslam2, Zafar Iqbal Chaudhry2 and Raheela Akhtar2
...s. The Albumin and total protein values were significantly low (P<0.05) in infected groups A and B as compared to control groups C and D on 5th and 7th day. The alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were significantly (P<0.05) high in infected groups A and B. On 3rd, 5th and 9th day five birds from each group were slaughtered and histopathological lesions observed in bur...
Muhammad Mansoor, Zaigham Abbas and Nageen Husssain*
...e individuals. Gluten, a protein fraction commonly found in wheat grains, associated with food related disorders and a number of autoimmune diseases. We hypothesized that gluten containing diet would further exacerbate an already undergoing arbitrary immune reaction in SLE patients. Pristane was injected in female BALB/c mice to induce the disease. After five months, mice in various groups were treated with prednisone and fed with gluten containing and standar...
Bushra Niaz1,*, Tahir Zahoor1, Muhammad Atif Randhawa1 and Amer Jamil2
..., a multifunctional glycoprotein, occurring as awhey constitute in milk secretions of animals and humandisplays a variety of antimicrobial, antioxidant and immunomodulatory as well as a number of other biological functions. Its potential can be exploited in several food applications. Keeping in view the increased demand of natural antimicrobial agents to control prevalence of food borne pathogens in final packaged food products as well as for food preservation...
Burhan Azam1, Muhammad Naeem Tahir2,*, Faisal Shahzad2, Abdul Ghaffar3, Ghulam Abbas4, Madiha Gohar5 and Saima1
...opped. The yield of milk protein, fat, solids not fat and lactose were not affected (P>0.05). Milk fat, solids not fat and lactose concentrations differed (P<0.001) among the treatments but did not show (P>0.05) any linear or quadratic trends with increasing level of enzyme in the diet. Milk protein concentration linearly (P<0.001) increased with increasing level of enzyme in the diets. It is concluded that fibro...
Ayesha Zahid,Ammara Muazzam, Sidra Mustafa, Saba Irshad*,Malik Siddique Mahmood and Rehman Shahzad

 

...onal analysis of mutated protein was anticipated by bioinformatics tools, which manifest mild changes in overall charge but altered post translational modifications in a way which might have a deleterious effect on ion channels anatomy and on the whole, pave ways to the genesis of cataract.
...
Fariha Imtiaz1, Muhammad Islam1, Hamid Saeed2,*, Bushra Saleem1, Maryam Asghar1 and Zikria Saleem2
...tities of carbohydrates, proteins and secondary metabolites in methanol compared to other extracting solvents. Moreover, only ethanol (5 and 10%) and petroleum ether (5%) demonstrated significant hair growth promoting effects (p < 0.05) compared to standard, i.e., 5% minoxidil and extracts in other solvents. Likewise, ethanol (5% and 10 %) and petroleum ether (5%) extract had significant impact (p < 0.05) on hair length in comparison to minoxidil,...

Hussein Aly Hussein1*, Omneya Mohamed Khattab2, Shereen Mohamed Aly2, and Mohammed Abdel Mohsen Rohaim1 

...study, we analysed the G-protein-coupled chemokine receptor (GPCR) genes of two LSDV isolates from Ixodid (hard) ticks (Amblyomma hebraeum) in Egypt. Multiple alignments of the nucleotide sequences revealed that both isolates had nine nucleotide mutations in comparison with the local reference strain, LSDV-Egypt/89 Ismalia. Compared with the GPCR sequences of SPV and GPV strains, 21 nucleotide insertion and 12 nucleotides deletions were identified in the GPCR ...
Rafi Ullah1, Sarzamin Khan1,*, Abdul Hafeez1, Asad Sultan1, Nazir Ahmad Khan2, Naila Chand1 and Naseer Ahmad1 
...ly be used as a low-cost protein constituent in the broiler finisher ration.
...
Viram Kumar1,*, Moolchand Malhi1, Saeed Ahmed Soomro1, Toufique Ahmed Qureshi2, Muhammad Nawaz Sanjrani3 and Khushal Das Malhi1
....05) and the serum total protein and Mg concentrations were significantly lower (P < 0.05) in male compared to female peafowl. In conclusion, the present study provides base-line values for hematology and serum biochemistry of apparently healthy Indian adult blue peafowl of Thar and can be used as reference values to evaluate the health or diseased conditions in the same species.
...
Muzammil Sattar
...ing amounts of different proteins in the diet of adult Chrysoperla carnea (Stephens). Results show that proteins play a vital role in the fecundity, fertility and all the biological parameters of F1 for mass rearing. The tested proteins were: Casein, Protein hydrolysate, Torula yeast and Nu lure. Al these protei...
Muhammad Ayaz1,*, Muhammad Athar Abbas2, Pervez3, Noorulain3, Yasir Amin1, Zubair Ali3, Naila Siddique2 and Khalid Naeem2
...ggs. Identification of H protein was undertaken through hem agglutination Inhibition (HI) test while N typing was done using reverse transcriptase polymerase chain reaction (RT-PCR) procedure. Out of 600 examined locations twenty two (22) H9N2 subtypes isolates were recorded. The total prevalence recorded was 3.66%and out of 498 broiler operations yielded 17 (3.4%) positive isolates and 44 golden type native chicken farms yielded 05 (11.3...

Shahid Iqbal Khattak1*, Mohammad Safdar Baloch1, Khalid Naveed2 and Ejaz Ahmad Khan1

.... However, maximum grain protein content was recorded in soil applied method in comparison to foliar N application. In conclusion, higher results for all the quantitative parameters were observed at 120 kg N ha-1.

...
Aneela Qureshi1, Ammara Ainee1*, Muhammad Nadeem1, Masooma Munir1,2*, Tahir Mahmood Qureshi1, Saqib Jabbar2
...e, color, moisture, fat, protein, ash, NFE and fiber content changed significantly (p<0.05). Gross energy level in cake which is desirable by consumers was reduced but high fiber cake was dark colored, low in volume and with increased hardness. Treatment (T3) containing 5.6g grapefruit albedo powder shows significantly (p<0.05) higher sensory scores in term of color (8.02±0.50), flavor (8.04±0.29), taste (8.18±0.37), mouth...
A. Hamid1,*, M. Ilyas2 and S. Kalsoom3
...C), very low density lipoprotein (VLDL), low density lipoprotein (LDL), high density lipoprotein (HDL) and triglyceride level. Group I comprised control group of induced hypercholesterolemic rats fed on purified diet AIN-93 G. Group II comprised induced hypercholesterolemic rats fed on WBF. Group III comprised induced hypercholesterolemic rats fed on MBF, Group IV comprised hypercholestero...

Wesam Hasan Mohamed Mady1*, Bing Liu2, Dong Huang2, Abdel Satar Arafa1, Mohamed Khalifa Hassan1, Mona Mehrez Aly1, Pucheng Chen2, Yongping Jiang2* and Hualan Chen2

.... The confirmation of H5 protein expression was performed using SDS-PAGE followed by Western blotting and immunofluorescence assays. The humoral immune response was evaluated by intramuscular immunization of specific pathogen free (SPF) chickens with two different concentrations of Egy-H5 plasmid DNA 15µg and 60 µg. Results demonstrate that chickens developed detectable HI antibody titers up to 6log2 within two weeks post-booster vaccination. The c...
Yijin He1, Song Ma2, Bo Liu1,*, Ting Xue1, Qunlan Zhou1, Wu Jin1 and  Kui Chen2,*
...etween speculated fusion proteins. Under bioinformatics analysis, the T2R1 gene without introns was consistent with the structural domains characteristics of this family genes. The translation protein of T2R1 gene displayed with corresponding signal loci and functional domains of this gene family, and the result showed that the taste receptor translated by T2R1 gene belongs to G ...
Syed Makhdoom Hussain1,*, Tasneem Hameed1, Muhammad Afzal2, Arshad Javid3, Nosheen Aslam4, Syed Zakir Hussain Shah6, Majid Hussain5, Muhammad Zubair ul Hassan Arsalan1 and Muhammad Mudassar Shahzad1
...70% and 12.70% for crude protein, crude fat and apparent gross energy as compared to the reference diet, respectively at 1000 FTU kg-1 level. It was concluded that the phytase supplementation to sunflower meal based diet at 1000 FTU kg-1 level is optimum to release adequate chelated nutrients for maximum growth performance of C. mrigala fingerlings. Our results also suggested that phytase supplementation to sunflower meal based die...

Muhammad Abid1*, Tahir Yaqub2, Arslan Mehboob3 and Muhammad Zubair Shabbir4

...arious regions of the NA protein were determined with unknown functions and consequences. These findings warrant future studies for analysis of whole genome sequencing of prevailing H9N2 viruses in Pakistan which may further contribute towards the better understanding of the genetic nature and evolutionary behavior of these viruses in the country.

...
Netti Aryani1, Azrita2, Ainul Mardiah3 and Hafrijal Syandri2*
...kg, made up of 30% crude protein, 7% crude lipid, 6% crude fiber, 12% ash, and 12% moisture as a percentage of fish body weight, with three replicates per treatment. Fish were fed three times per day at 09:00, 14:00, and 18:00. The experiment was carried out for 120 days. Each month, 30 fish were removed from each of the floating net cages to be measured and weighed. The biomass of fish was calculated, and the amount of feed was adjusted. The feeding rate sign...
Tiansen Li1, Meiling Huang2, Zhen Wang1,Fei Guo3,Hui Zhang1,* and Chuangfu Chen1,*
...ts of the outer membrane protein 10 (Omp10) on bacterial survival, virulence, phagosome-lysosome fusion, and apoptosis induction, as assessed in appropriate in vitro (cell culture) and animal models. Results showed the omp10 mutant was dramatically attenuated for survival in macrophages and mice than the parent strain 2308. With decrease in the spleen/body weight ratios of mice infected with omp10 mutants were noted, inhibition of phagosom...

Kamran A. Awan1, Jawad Ali2 and Mohammad Akmal3

...5 in the season. Grains protein was observed high for sowing made on November 15-25 for wheat varieties Dharabi, Shahkar-2013, Pakhtunkhuwa-2015 and Ghanemat-2015 as un-irrigated crop for the area. The study suggests that none of the existing wheat variety has potential to sustain grain yield of wheat if planted on December 5 or thereafter. However, Ghanemat-2015 is relatively better option over the other varieties for Peshawar.

...
Muhammad Tariq Saeed1*, Muhammad Ashfaq Wahid1, Muhammad Farrukh Saleem1, Mumtaz Akhtar Cheema2, Muhammad Shahid1, Abdul-Shakoor1, Abdul-Sattar3
...mes rich in high quality protein and oil. Its cultivation in Pakistan is restricted to few areas due to poor germination and low seed viability. The optimum yield and quality of this oil seed crop is noticeably affected by its lower germination rate. To address the problem of poor germination and low seed viability, a field study was conducted at Agronomic Research Area, University of Agriculture Faisalabad, during spring 2011. The experiment was composed of t...
Furqan Sabir1, Muhammad Tayyab1,*, Bushra Muneer2, Abu Saeed Hashmi1, Ali Raza Awan1, Naeem Rashid3, Muhammad Wasim1 and Sehrish Firyal1
... the size of recombinant protein as 70 kDa. The optimization studies demonstrated the maximal production of recombinant phytase, when the recombinant cells were induced with 1.4 mM IPTG with the post induction time of 6 hours. PHYTN showed maximal activity at 80°C in 50 mM sodium acetate buffer pH 6. Presence of Fe3+ or Cu2+ showed an enhancing effect on the PHYTN activity. Thermostability studies demonstrated th...

Muhammad Sohail1, Muhammad Nauman-ul-Islam1, Hayazuddin2*, Imtiaz Ali Shah1, Abdur Raziq1, Subhan Ullah3 and Arsalan Ali Shah1

...nt (p>0.05) effect on protein, SNF and Lactose contents of the milk. These results concluded that milk yield and milk fat were increased by supplementation of MSC in the dairy cattle ration. The proportion of MSC up to 12% in the ration has shown the best efficiency of production as compare to other rations. 

...
Aqsa Qayyum1*, Masooma Munir1, Saeeda Raza1, Mussarat Gillani1, Saima Kanwal1, Nouman Rashid1, Amer Mumtaz1, Naeem Safdar1, Zarmina Gillani2
...y while ash, fat, fiber, protein, iron, zinc, magnesium and manganese contents increased significantly (p < 0.01). There was a non-significant (p > 0.05) effect on the color, flavor, taste and texture of biscuits. So, it is concluded that replacement of wheat flour with pea flour up to a level of 20% improved the nutritional potential of biscuits without affecting the consumer acceptability score.
...
Masooma Munir1,2*, Aqsa Qayyum1, Saeeda Raza1, Nouman Rashid Siddiqui1, Amer Mumtaz1, Naeem Safdar1, Sahar Shible1, Sohaib Afzal3, Saiqa Bashir4
...good source of fiber and protein but they provide appreciable amount of minerals and phenolic compounds. Swollen basil seeds were used to prepare beverage at three supplementation levels i.e. 0.2, 0.3 and 0.4%. Sensory evaluation of basil seed drink revealed that 0.3% basil seeds supplemented drink was liked most in term of taste, texture and over all acceptability whereas 0.4% basil seeds supplemented drink were least liked as compared to other treatments. It...
Aqsa Mehboob1, Noor Khan1,*, Usman Atiq1, Khalid Javed Iqbal2, Rafia Tayyab1, Syeda Suhaira Batool1, Hafiza Saleha Batool1, Sana Amjad1 and Mehwish Tanveer1 
...ts and control for crude protein while rest of the parameters remained same. Apparent digestibility of crude protein and fat was found non-significantly different among treatments. It is concluded that addition of fenugreek in fish feed can improve growth performance and also protein content of the fish meat as well.
...

Sanjukta Chakrabarti1, Colin J. Barrow2, Rupinder K. Kanwar3, Venkata Ramana1*, Rakesh N. Veedu4,5 and Jagat R. Kanwar3* 

...ial growth factor (VEGF) protein and its family of ligands and receptors (VEGFRs). Survival, proliferation, migration and invasion of endothelial cells which give rise to the vascular network, is mediated through VEGF/VEGFR activation of the signal transduction pathways. Thus blocking VEGF is an efficient strategy for blocking tumor angiogenesis. Several anti-VEGF drugs have been developed over the last two decades and some are still at different development s...
Naheed Bano* and Muhammad Afzal
...ment in body dry matter, protein, fat, energy and ash contents of L. rohita. Acidification and phytase supplementation showed significant (P < 0.05) interaction on body composition and mineral utilization in rohu. Citric acid and phytase supplementation improves the diet by increasing the availability of minerals and quality of fish by positively affecting the body composition of fish. 3% citric acid and 1000FTU phytase proves to be interacted positi...
Talat Bilal Yasoob and Nasir Ali Tauqir* 
....363%, respectively. The protein and energy level were 18% and 2800 kcal/kg, respectively. One eighty day-old broiler chicks were distributed in 18 units having 10 chicks each according to completely randomized design. Feed consumption, weight gain and feed conversion ratio (FCR) were significantly (P<0.05) improved in broilers fed all the experimental diets as compared to control during starter and finisher phases. A quadratic response was also obse...
Jiandong Wu, Miao Ye and Zaigui Wang*
...TG), and low-density lipoprotein-cholesterol (LDL-C) and increasing the concentration of high-density lipoprotein-cholesterol (HDL-C).
...
Xue-yang Wang1, Shang-zhi Zhang1, Ming-hui Liu2, Dong Yu1, Yan Ma1, Dong-qiong Fei1, Hai-zhong Yu1 and Jia-ping Xu1,*
...v>Armadillo (ARM)-repeat protein is involved in many biological processes, including cell–cell adhesion and the Wnt signaling pathway. However, the function of ARM-repeat protein in Bombyx mori has not been completely clarified. In this study, a gene encoding ARM-repeat protein was identified, which has an open reading fragment of 1923 bp, encoding a predicted 641 amino...
Farid S. Ataya,1,2,* Dalia Fouad,3,4 Ajamaluddin Malik,1 Nikolaos E. Labrou,5 Mohamed S. Daoud1,6 and Hesham M. Saeed7
...E3) as a ~24 kDa soluble protein and showed to be catalyticly active towards the model substrate 1-chloro-2,4-dinitrobenzene. The results of the present study provide new information into camelid evolution and give further insights into the diversity and complex enzymatic functions of GST superfamily.
...
Jianping Li1, Qian Jiang2, Wei Chen2, Yumei Li3, Huaizhi Jiang4, Jinlong Huo5 and Qiaoling Zhang2*
... KIT gene and its protein ingoats of different fur colors. The effect of KIT mutations on KIT protein expression was examined in white cashmere and black cashmere goats. A single A→G missense mutation in exon 13 differentiated cashmere goats with different colors. Only a histidine (H)→arginine (R) amino acid (AA) change was detected at KIT exon 13 in both the white cashmere goat and the ...
Amtul Jamil Sami1,*, Madeeha Khalid1, Rehman Shehzad1, Sana Mughal1 and A.R. Shakoori2 
...raction of extracellular proteins at pH 9.5 using Tris-Glycine buffer. Placental lactogen was purified by gel filtration chromatography using Sephadex-G100 and ion exchange chromatography on DEAE- Sepharose, employing a linear salt gradient. SDS-PAGE was used to monitor the purification steps, and protein band was located by immunoblotting technique. Bubaline placental lactogen was purified to homogeneity and showed a molecu...
Jing Xin Mao1,2, Guo Wei Wang2, Yuan She Huang3, Rui Wang2, Guo Ze Wang4, Bing Zeng1 and Fu Yuan Zuo1,*
...div>BPI is a pluripotent protein located in neutrophils and tissue that likely plays a vital role in host defense against GNB (gram-negative bacteria) and their endotoxin by means of its antibiotic and endotoxin neutralizing and disposing functions. BPI has several biological functions in mammals such as human, bovine, pig and rabbit, it also has major influence in the natural defense of the animal body. In this paper, by comparative study on BPI gene expressi...
Pei-feng Yin1,2,Xiu-xiu Li1,Qi-wei Zeng3, Cheng-chen Shen1, Le Gao1 andJian-zhang Ton2,*
...e differential expressed proteins. Almost 78 patho-stress responsive proteins which expression level more than 1.5-fold were identified, where 50 proteins were up-regulated and 28 proteins were down-regulated; The identified proteins were categorized into 16 classes, which are mainly including energy metabolism, gene e...

Muhammad Aqeel Sarwar1,2*, Muhammad Tahir2, Abid Ali3, Manzoor Hussain3, Muhammad Waheed Anwar4, Muhammad Khubaib Abuzar5 and Ijaz Ahmad

...ndex (34.22 %) and grain protein content (8.56%) was obtained with (moringa green manuring).While Among fertilizer levels (100% of RDF) produced maximum plant height (189.02 cm) cob length (18.21 cm), number of grains per cob (438.7), 1000-grain weight (216.57 g), biological yield (17.79 t ha-1) grain yield (6.99 t ha-1) harvest index (39.37%) and grain protein content (8.78%). It can be concluded from above results that alo...
Hailong Dong1, Hui Zhang2, Kun Li2, Khalid Mehmood2,3, Mujeeb Ur Rehman2, Fazul Nabi2, Yajing Wang2, Zhenyu Chang1,2, Qingxia Wu1,* and Jiakui Li1,2,*

 

...) and outer membrane protein (ompA). Moreover O-antigen serotype was tested by slide agglutination test and a mouse model was built to assess the lethality of the E.coli isolates through subcutaneous-infection. Out of 81 E.coli isolates, the most prevalent gene detected was ompA (90.12%), followed by ETT2 (69.14%), irp2 (54.32%), EAST1 (46.91%), CS31A (41.98%), estB (19.75%), eaeA (14.81...
Anan Kenthaoand Pornpimol Jearranaiprepame*
...ce as source of low-cost protein in Lower Mekong Region. The present study applied multivariate morphometric technique to identify fishery management units of C. apogon from six populations of three different river drainages: Pong, Chi, and Mun Rivers. Thirty-two truss measures and standard length were obtained using digital calliper from 291 fish individuals, and raw measured data were then subjected to allometric equation to remove size-dependent vari...
Aqsa Imtiaz and Abdul Rehman*
...d copper ions. A 130-kDa protein was detected from feather-treated bacterial cells, suggesting its role in degrading feather. B. subtilis BML5 can be used to overcome the poultry wastes based environmental pollution and keratinase could be used to improve feather meal digestibility in animal feed as an additive.
...
Muhammad Saqlain1, Humaira Kalsoom1, Muhammad Fiaz1,2, Abid Mahmood1, Rizwan Aziz Qazi4 ,Waseem Safdar5, Pakeeza Arzoo Shaiq1,Bernard M.Y. Cheung3 and Ghazala Kaukab Raja1,*
...tinal fatty acid binding protein in the pathogenesis of MetS.
...
Serap Gelibolu1,*, Yasemen Yanar2, M. Ayce Genc3 and Ercument Genc4
...rease in live weight and protein efficiency rates when were directly compared with mock-treated fish control. However, there was no statistically supported level of significance was observed for growth rates and feed conversion rates among groups. Improved live weight and protein efficiency rates reflected positively on the survival rate in MOS-fed fish. Interestingly, the whole body and fillet fatty acid composition shown n...
Lihong Qin1, Guoliang Zhang1, Chaojie Zhu1, Jian Wu1, Zhihui Zhao2,* and Yumin Zhao1,*
...addition, genes mRNA and protein levels were detected after bull testicular Sertoli cells were transfected with miR-122 and miR-449a. Meanwhile, DUSP4, PDK4 and FKBP1B overexpression experiments were conducted. Eventually, MTT assay was performed to observe the cells proliferation. The results showed that miR-122 and miR-449a were highly-expressed in testis tissues (p<0.01). The expression levels of miR-122 and miR-449a in the 24-month-...
Bian Xunguang1,2, Li Jiancheng1, Xu Chu1 and Yang Li2,3,4,*
...ibution of intracellular proteins in the oviduct of the hen, which provides an important basis for the regulation of the physiological activities of poultry oviduct and the molecular mechanism of sperm storage.
...
Tanzeela Riaz1, Farah Rauf Shakoori2,* and Syed Shahid Ali3
...hydroxylase) and soluble protein contents of a wheat grain pest, Trogoderma granarium collected from godowns of Punjab, Pakistan. Six populations of khpara beetle with different levels of susceptibility to phosphine were used in this study. Based on LC50, five populations (previously exposed to phosphine for 15 years)viz., Mandi Bahauddin-I (MBDIN-I), Mandi Bahauddin-II (MBDIN-II), Gujrat, Gujranwala and Sargodha were labeled as phosph...

Irfan1* , Arshad Javid2 , Muhammad Altaf3 , Muhammad Shahbaz3 , and Khalid Javed Iqbal4 

...±0.58 g/dL, total protein 5.35±0.55 g/L, urea 26.95±0.65 mg/dL, creatinine 0.83±0.01 µmol/L, alanine aminotransferase (ALT) 35.56±1.16iu/L and aspartate aminotransferase (AST) 44.16±1.83 iu/L were recorded for adult birds while alkaline phosphatase (ALP) values were significantly (P<0.05) higher 104.86±16.39 iu/L in grower birds. Similarly, the rearing systems also influenced biochemical parameters of M...

 Asma Akhtar, Abdul Rehman

...ial pattern of bacterial proteins in tellurite stress was obtained by SDS-PAGE. Both bacterial strains can be utilized to convert toxic tellurite into its elemental form from the contaminated sites.

...

Hafiz Muhammad Tahir1, Khanum Zahra2, Arooj Zaheer2, Khizar Samiullah3

...s categorized as fibrous protein. Spiders produce several types of silk. Spider silk is important because of its maximum mechanical strength, biocompatibility and biodegradability, pore filling ability and very low immunogenicity. In this review structure and types of silk producing gland, spinning process, chemistry of spider silk fiber, mechanical properties and applications of silk in health, military industry and many other fields is discussed. Its antifun...
Abdul Malik1,2, Ghulam Abbas1,*, Abdul Ghaffar3, Sara Ferrando4 and Lorenzo Gallus
...ial floating pellet (35% protein) at 3% body weight per day for 40 days. Results showed that fish growth was significantly (P<0.05) higher in term of weight gain, WG % of initial weight, mean daily WG, SGR, feed conversion and survival rate from 15‰ to 30‰ salinity than those reared in 35‰ and 40‰ salinity. Condition factor was found to be significantly higher on 40‰ salinity than 15‰ to 35‰ salinity. Feed co...
RuiHua Zhang, YongFang Jia, TingTing Liang, QianWen Yang, QiYan Du and ZhongJie Chang*
..., 784 and 602 amino acid protein, respectively. Chromosome synteny analyses revealed that CcSox5 and CcSox13 weretightly linked with the etnk gene, which was conserved in all species; however, there were no conserved regions flanking CcSox6. Numerous essential transcription factor binding sites (TFs) were predicted within the 2000 bp upstream of the 5’ end of these genes. These TFs include BSX, BRN4 and NGN–NEUROD, which have b...
Yunjun Yan, Zhenming Lü, Tianming Wang, Yongjiu Chen, Jingwen Yang, Baoying Guo, Lihua Jiang, Changwen Wu and Liqin Liu*
...ide pairs and encodes 13 proteins, 2 ribosomal RNAs (rRNAs), 22 transfer RNAs (tRNAs) and a major long noncoding region (LNCR) of the mitochondrion’s own protein synthesizing system. Seven of thirteen proteins, eight tRNAs are encoded by the plus strand, while the other proteins and tRNAs, as well as two rRNAs are encoded by the minus strand. Two (...
Abdul Malik1,2, Ghulam Abbas1,*, Abdul Ghaffar3, Sara Ferrando4, Lorenzo Gallus4 and Syed Sajjad A. Shah2,3
...d constituting 35% crude protein with 2% body weight twice a day. Eggs were collected on weekly basis by cultch removal method. Results showed that the highest fecundity, fertility, hatchability and survival of fry were obtained on salinity of 0%-15% and significantly decreased on 20‰ and 25‰. The eggs per gram body weight were also recorded in all treatments and highest eggs were obtained i.e. 4.0-4.3 per female on 0‰-15‰. W...
Jo Ik-Hwan1, Choi Kwang-Won1 and Muhammad Fiaz2,*
...reased (P<0.05) crude protein (CP) yield and carrying capacity for Hanwoo heifers than that of rye monoculture. DM and TDN yield under 100 kg manure was higher (P<0.05) than control and 50 kg N/ha levels but not different (P>0.05) with that of 150 kg N/ha. Manure levels did not affect (P>0.05) protein yield. The carrying capacity for Hanwoo heifers was not different among zero, 50 and 100 kg manure levels, wherea...
Abdul Malik1,2, Ghulam Abbas1,*, Abdul Ghaffar3, Ghulam Dastagir4, Sara Ferrando5, Lorenzo Gallus5, Asad Ali Muhammad1,6, Abdul Jabbar2 and Khalil-ur-Rehman2 
...ial floating pellet (35% protein) with 3% of total biomass day-1 for 50 days. Results showed that the growth increment reared on 10‰ - 20‰ salinity were significantly highest in term of weight gain, WG % of initial weight, daily weight gain, specific growth rate, condition factor and survival rate than those reared on 25‰ and 30‰. Feed conversion ratio was found similar in all levels which is not significantly different (...
Muhammad Hafeez-ur-Rehman1,Farzana Abbas2,Ghulam Abbas3,*, Arshad Javid4, Ali Hussain4, Syedah Andleeb5,Khalid Javed Iqbal6 and Muhammad Akmal1

 

...ect of different dietary protein levels on the growth and chemical conformation of broodfish and its eggs. There were three treatments (T1, T2 and T3) and a control with three replicates in each group. Control group was exclusively fed on natural food composed of tilapia fry while fish in T1 was fed on 30%, T2 on 35% and T3 on 40% protein diet, respectively. A...
Muhammad Aqeel Sarwar1*, Abid Ali2, Manzoor Hussain2, Saadia3, Muhammad Khubaib Abuzar4, Ijaz Ahmad5 and Sohail Latif6
...(5.40 t ha-1) protein contents (12.52%), nitrogen (28.22kg kg-1), phosphorus (34.85 kg kg-1) and potassium (47.40 kg kg-1) use efficiency were obtained with the treatment F2 (100% recommended dose of NPK).While in seed inoculants, maximum values of yield and yield contributing parameters were obtained in I1 (Inoculation with Azospirillum). However despite the better performance of F2...
Yanjie Guo1, Weini Wu1, Hongmei Wang2, Xiao Guo2 and Yongping Xu2,*
...t IL-18Rα mRNA and proteins are expressed in the IMG, which provides molecular evidence for the study of immune and neuro-modulation in the female reproductive system.
...

Muhammad Naeem Safdar, Khalid Naseem, Muhammad Amjad, Amer Mumtaz and Saeeda Raza*

...d grains, moisture, ash, protein (N x 5.7), wet and dry gluten, falling number, and minerals (copper, manganese, iron, zinc). It was observed that wheat samples varied considerably within each region and also between regions. Attock region samples had highest test weight (80.50 kg hl -1), protein (11.80 %) and lowest nonedible foreign matter (0.45%) and broken/shrunken grains (0.88 %). Highest wet and dry gluten (27.44 % and...

 Abdullah Adil Ansari* and Kumar Sukhraj**

...r percentage of fats and protein content in VW+VC when compared with those grown with chemical fertilizers by 23.86% and 19.86%, respectively. The combination treatment [VW+VC] also have a significant influence on the biochemical characteristics of the soil with marked improvement in soil micronutrients. The combination treatment [VW+VC] was found better suggesting qualitative improvement in the physical and chemical properties of the soil, which is substantia...

 Shazia Erum, Rashid Anwar and Shahid Masood*

...e analysis of total seed proteins of Kasuri methi (GI of Kasur, Pakistan) was evaluated with other Trigonella genotypes by SDS-PAGE. Results showed that at protein level Kasuri methi acquired a unique status as a G.I of Kasur. Cluster analysis (UPGMA) of 28 genotypes including both methi and methray from various agro ecological zones of Pakistan were interlinked to some extent however Kasuri methi make their identity by stan...

 Shazia Erum*, Muhammad Naeemullah, Shahid Masood** and Muhammad Irfan Khan*

... the basis of total seed protein and phenotypic characters, except Siam Queen and Lime basil stand alone, respectively. Euclidian distance for morphological traits ranged from 3.60 to 7.26. Conversely on the basis of total seed proteins genetic distances ranged from 0.11 to 1.00. Due to greater genetic diversity in Ocimum germplasm and its suitability for commercial cultivation even in the area under small holdings, the inve...

Iracema Nunes de Barros1,2, Luciane Dubina Pinto3, Rosely Bianca dos Santos Kuroda1, Sheila Oliveira de Souza Silva1, Leonardo José Richtzenhain1,2, Cláudio Wageck Canal3 and Paulo Eduardo Brandão1,2* 

...d (N) and non-structural protein 3b genes. Out of the samples collected, 40.17% were positive for CCoV; 57.45% of CCoV-infected animals showed enteritis and most of these (76%) were younger than 3 months and unvaccinated. Distance genealogy using CCoV sequences from GenBank for M gene showed that eight strains were CCoV-II twenty-six were CCoV-I. These findings show some genetic features of CCoV in Brazil and may require future studies to elucidate full genome...
Maryyum Khalil1, Hamda Azmat1,*, Noor Khan1, Arshad Javid2, Ali Hussain1, Syed Makhdoom Hussain3, Asim Ullah1 and Sumaira Abbas1
...n;0.36 g). The 40% crude protein diet was prepared by adding feed ingredients along with 0.75, 0.50, 0.25, 0.00 g kg-1 of α-amylase as T1, T2, T3 and T4 (control). At the end of feeding trial, 100% survival rate was recorded. Growth rate was significantly increased in fish fed with enzyme supplemented diets in comparison with control group. The maximum increase in growth rate was recorded in treatment # 2. Highest prot...
Saba Rafique1,2,*, Khalid Naeem1, Naila Siddique1, Muhammad Athar Abbas1, Aamer Ali Shah2, Akbar Ali1, Abdul Rahim1 and Farooq Rashid1
...to 974 base pairs. The S protein sequence was submitted to the GenBank with accession number KU145467. Phylogenetic grouping and maximum nucleotide sequence identity values were used to identify the isolate that looked to be derived from recombination. It showed maximum nucleotide homology 99.5% with ck/CH/LHB/121010 (KP036503), India/IBV572 (KF809797) and Japan/JP/Wakayama-2/2004 (AB363951.2) and 99.3% with 4/91 vaccine (KF377577), Iran/491/08 (HQ842715) and ...
Amtul Jamil Sami1,*, Sehrish Bilal1, Madeeha Khalid1, Muhammad Tahir Nazir1 and A.R. Shakoori2

 

...>T. castaneum enzyme protein. Computational studies inidicate that A. mellifera enzyme had a little binding affinity for saponin as compared to T. castaneum AChE. The amino acid residues of T. castaneum AChE identified at positions 259(SER), 176(SER), 173(GLY), and 502 (HIS) are involved in binding with saponin molecule to form four hydrogen bonds. Whereas in A. mellifera hydrogen bonds are formed at two positions by SER 171 and...

 Saima Rani and Irum Raza*

COMPARISON OF TREND ANALYSIS AND DOUBLE EXPONENTIAL SMOOTHING METHODS FOR PRICE ESTIMATION OF MAJOR PULSES IN PAKISTAN
...xpensive livestock-based protein-rich food will be badly affected.

...

 Munir Ahmad* and Asif Ali Mirani**

HEATED AIR DRYING OF GROUNDNUT
...roundnut contains 25-32% protein and 42-52% oil, therefore, it has the potential to become a significant contributor to edible oil production in Pakistan. It is harvested in October-November in Pakistan, when the weather is cold, and it is not possible to dry it down to a safe moisture level by sun drying. Therefore, the chance for developing aflatoxins in it is high. To solve this problem of the groundnut growers, a low cost mobile flat-bed dryer designed and...

 Nasia Batool*, Imtiaz Ahmad Qamar**, Imdad Hussain Mirza** and Muhammad Fateh Ullah Khan**

MIXING LESS PALATABLE GRASSES WITH UREA, MOLASSES AND EFFECTIVE MICROORGANISMS AND ITS EFFECT ON CHEMICAL COMPOSITION AND DIGESTIBILITY IN GOATS
...s was carried out. Crude protein content of mixtures improved as compared with sole grasses. Digestibility of HC supplemented with urea, molasses and EM in various combinations was also studied in growing goats. The highest digestibility of DM in goats was recorded in HC + 4% urea + 4% molasses treatment (85.51%) followed by HC + 4% urea (78.57%) and HC + 4% urea + 4% molasses + 1:100 EM (78.00%).

...

 Khalid Naseem*, Naseem Bibi**, Saeeda Raza*, Amer Mumtaz*, Nouman Rashid Siddiqui*, Amina Bibi*** and Muhammad Ahsan Khan****

DEVELOPMENT, CHARACTERIZATION AND EVALUATION OF HIGH ENERGY BISCUITS FOR COMBATING MALNOURISHMENT AMONG CHILDREN IN PAKISTAN
...t the highest values for protein, zinc and iron. Results of all treatments were in acceptable range regarding sensory evaluation. These results indicate that biscuits can be successfully supplemented with chickpea and oat. According to sensory evaluation, biscuits containing 20% chickpea and 15% oat were found to be the best among all treatments and could be a potential composition for preparing high energy biscuits for malnourished areas of Pakistan.

...

Ayesha Tahir* and Sonila Hassan**

ECONOMIC FEASIBILITY OF SMALL SCALE BUTTON MUSHROOM PRODUCTION IN PAKISTAN
...s widely cultivated as a proteineous vegetable in many countries of the world including Pakistan. Its cultivation requires less space, care, equipment and cost compared to many other crops and livestock. The present study was conducted in 2010 to estimate the profitability of small scale button mushroom production at National Agricultural Research Centre (NARC) Islamabad, Pakistan. The cost of production methodology was used for this study. The yield and gross...

 Adnan Umair*, Safdar Ali**, Muhammad Sarwar***, Kashif Bashir**, Muhammad Javed Tareen**** and Muhammad Asghar Malik*****

ASSESSMENT OF SOME PRIMING TECHNIQUES IN MUNGBEAN (VIGNA RADIATA) : A GREEN HOUSE STUDY
...riming also improved the protein concentration at the early stage of seedlings. Phosphorous application through priming significantly improved germination up to 95%, seedling -1 vigour index up to 23.05 and protein content up to 2.17 (g FW).

...

 Imtiaz Ahmad Qamar*, Maqsood Ahmad*, Gulshan Riaz* and Sartaj Khan*

PERFORMANCE OF SUMMER FORAGE LEGUMES AND THEIR RESIDUAL EFFECT ON SUBSEQUENT OAT CROP IN SUBTROPICAL SUBHUMID POTHWAR, PAKISTAN
...an had the highest crude protein content (23.2 %) followed by cowpea (22.6 %), lablab bean (21.6 %), rice bean (20.1 %) and sesbania (19.1 %). Millet had the lowest crude protein content of 6.2%. Dry matter yield of oats owing to the previous crops was least after millet (7.5 -1 -1 tha ) and ranged from 8.5 to 8.9 tha after sesbania, cluster bean and cowpeas. Differences in crude protein c...

 Mustaring,* I. Subagyo,** Soebarinoto** and Marsetyo*

 
GROWTH, YIELD AND NUTRITIVE VALUE OF NEW INTRODUCED BRACHIARIA SPECIES AND LEGUME HERBS AS RUMINANT FEED IN CENTRAL SULAWESI, INDONESIA
...llage number (64), crude protein (CP) content (8.64%), in vitro organic matter (OM) digestibility (47.36%) On the other hand, B. mulato had highest tillage number (117) and DM yield (0.79 kg -2 DMm ). Legume herb species affected significantly (P<0.05) plant height, yield, in vitro digestibility. At 8 weeks of age Dolichos lablab showed the -2 highest plant height (189 cm), DM yield (0.45 kg DM m ) and in vitro OM digestibility (71.12%). The nutrient conten...

 Saima Rani*, Hassnain Shah*, Umar Farooq** and Bushra Rehman**

SUPPLY, DEMAND, AND POLICY ENVIRONMENT FOR PULSES IN PAKISTAN
...lation in fulfilling the protein demand. Hence there is need to increase production through improving management practices and dissemination of improved technologies.

...

 Syeda Nasreen*, Mehwish Ishaque**, Muhammad Ayub Khan*, Saleem-ud-din* and Syeda Musarrat Gilani*

COMBINING ABILITY ANALYSIS FOR SEED PROTEINS, OIL CONTENT AND FATTY ACIDS COMPOSITION IN SUNFLOWER (HELIANTHUS ANNUUS L.)
...alues for seed 1 1 total proteins, oil content and fatty acids composition. Among parental lines, CMS-64, CMS-53, CMS-H55-2-2-1 and CMS-53 were the best general combiners for seed total proteins, oil content, oleic and linoleic acid, respectively. Among males, C-206-R, SF-187R, RHA-295 and RHA-854 were the potential parents exhibiting desirable GCA for seed total proteins, oil content, ole...

 ZafarUllah*, Muhammad Azim Malik*, Muhammad Ansar*, Shahzada Sohail Ijaz* and Muhammad Rasheed*

WINTER FORAGE QUALITY OF OATS (AVENA SATIVA), BARLEY (HORDEUM VULGARE) AND VETCH (VICIA SATIVA) IN PURE STAND AND CEREAL LEGUME MIXTURE
...e higher values of crude protein (CP) and lower values of neutral detergent fiber (NDF) and acid detergent fiber (ADF) reflected quality forage. CP for oats in oats-vetch -1 -1 mixture and barley in barley-vetch mixture was 175 g kg and 170 g kg , -1 respectively. NDF and ADF for oats in oats-vetch mixture were 494 g kg -1 and 341 g kg , respectively; while these values for barley in barley-vetch -1 -1 mixture were 340 g kg and 176 g kg , respectively.

...

 Maimoona Bashir*, Imtiaz Ahmad Qamar*, Muhammad Fateh Ullah Khan* and Abdul Razzaq*

EFFECT OF MIXING LOW PALATABLE GRASSES AND IPIL IPIL LEAVES ON FORAGE QUALITY
...ximate parameters (crude protein (CP), crude fiber (CF), total ash and ether extract (EE)). The results revealed that there were significant differences in dry matter (DM) among different grasses. DM content of low palatable grasses was generally high (70-75%) as compared to Ipil ipil leaves (45-55%). DM content among mixtures was also variable. For the treatment grass 75% + Ipil ipil 25%, DM range was 65-70%, for grass 50% + Ipil ipil 50%, it was 60-65% and f...

 Maimoona Bashir*, Imtiaz Ahmad Qamar*, Muhammad Fateh Ullah Khan* and Raheel Babar*

EFFECT OF MIXING LOW PALATABLE GRASS OF HETEROPOGON CONTORTUS WITH IPIL IPIL LEAVES ON DIGESTIBILITY IN GOATS
...% dry matter (DM), crude protein (CP) and crude fibre (CF) consumption among all the treatments. The digestibility percentage of dry matter intake (DMI) varied among the treatments ranging from 68.25% to 41.66%. Mixtures of low palatable grass and Ipil ipil were in general more digestible with more than 65% dry matter digestibility. The lowest digestibility of dry matter (41.66%) was observed in HC 100%. A similar trend was noted for CP digestibility. However,...

 Muhammad Ayub*, Rizwan Maqbool*, Muhammad Tahir*, Zoaib Aslam*, Muhammad Ather Nadeem* and Muhammad Ibrahim**

IMPROVED GROWTH, SEED YIELD AND QUALITY OF FENNEL (FOENICULUM VULGARE MILL.) THROUGH SOIL APPLIED NITROGEN AND PHOSPHORUS
...arvest index by 162% and protein content by 6%. However, fertilizer NP -1 (90:45 kg ha ) decreased oil content by 26%. Therefore, addition of NP fertilizer had the potential to increase fennel seed yield, but reduce oil content, under Faisalabad conditions.

...

 Muhammad Akhter*, Muhammad Azhar Ali**, Zulqarnain Haider* and Shahzad Muzammil***

PHYSICO-CHEMICAL CHANGES IN GRAINS OF SOME ADVANCE LINES/ VARIETIES OF RICE (ORYZA SATIVA L.) AFTER PARBOILING
...matter, crude fat, crude protein, crude fiber, vitamin B6; milling quality parameters such as total milling recovery, head rice recovery, ratio of broken grains and cooking quality parameters such as curling, bursting and cooked grain length. The study showed significant variation in efficacy of parboiling to different varieties/lines. The results clearly showed average increase in mineral contents in terms of ash% increase, dry matter, longer cooked grain len...

 Riaz Hussain*, Muhammad Riaz**, Mushtaq A. Saleem*** and Muhammad Ishaque Mastoi**

BIOCHEMICAL ABNORMALITIES INDUCED BY ABAMECTIN IN SIXTH INSTAR LARVAE OF THE RED FLOUR BEETLE, TRIBOLIUM CASTANEUM (HERBST)
...phosphatase (AcP), total protein, soluble protein and free amino acids (FAA). The sixth instar larvae of T. castaneum were released and exposed for 48h without food on abamectin treated glass petri dishes. The surviving ones were then homogenized in saline and centrifuged prior to biochemical analyses. Results showed differences in the activities of enzymes and quantities of total protein,...

 Muhammad Arshad Ullah*, Nazir Hussain**, Helge Schmeisky*** and Muhammad Rasheed**** 

IMPROVING FODDER QUALITY OF PANICUM GRASS THROUGH INTERCROPPING OF LEGUMES AND THEIR INOCULATION
...n. The 6-7% higher crude protein (CP) of mixed fodder was recorded from 67% intercropping in comparison to grass alone while inoculation increased it by further 1-2%. Results also suggested that total digestible nutrients (TDN) were increased by 2-4% as compared to other treatments.

...

 Zafar Abbas*, Ijaz Ahmad**, Adnan Shakeel**, Muhammad Abdullah***, Muhammad Islam**, Sadiq Muhammad*, Ghulam Murtaza* and Mushtaq Ahmad**

EFFECT OF PHOSPHORUS FERTILIZER AND WATER STRESS ON PROTEIN AND PHENOLIC CONTENTS IN COTTON (GOSSYPIUM HIRSUTUM L.)
...tative analysis of total protein and phenolic compounds, respectively. Proteins were greatly affected by fertilizer treatment and water stress, but phenolic compounds remained unchanged upon fertilizer treatment. However, they were greatly affected by irrigation and water -1 stress. Crop treated with 100 kg ha P O under water stress maintained high 2 5 protein content as compared to unfert...

 Saima Kanwal*, Saeeda Raza*, Khalid Naseem*, Muhammad Amjad*, Naseem Bibi* and Musarrat Gillani*

DEVELOPMENT, PHYSICO-CHEMICAL AND SENSORY PROPERTIES OF BISCUITS SUPPLEMENTED WITH PUMPKIN SEEDS TO COMBAT CHILDHOOD MALNUTRITION IN PAKISTAN
...our (20%) 5 with maximum protein (12.30%), fat (28.29%), ash (4.13%), iron (2.28%) and zinc (3.11%). Sensory results also revealed increasing trend in all sensory parameters. Results showed acceptability at all levels but treatment T with 15 % pumpkin 4 seed flour scored highest (8.0) for maximum overall acceptability. It was concluded that pumpkin seed flour can be supplemented successfully to partially replace wheat flour to prepare highly nutritious biscuit...

 Doulat Baig*, Fida Mohammad Abbasi*, Habib Ahmed*, Maqsood Qamar** and Muhammad Ayub Khan**

RESPONSE OF SUNFLOWER HYBRIDS TO DIFFERENT NITROGEN LEVELS FOR PHYSIOLOGICAL AND AGRONOMICAL TRAITS UNDER FIELD CONDITIONS
...d yield of the crop. The protein is wholly dependent upon the amount of nitrogen fertilization available in soil for the plant use. A two year study was conducted in 2012 and 2013 at National Agricultural Research Centre (NARC), Islamabad, Pakistan. The experiment was aimed to –1 –1 evaluate the effect of different nitrogen (N) levels (N = 0 kgha , N = 60 kgha , N = 0 1 2 –1 –1 –1 –1 80 kgha , N3 = 120 kgha , N4 = 180 kgha a...

  Sohaib Arshad*, Sarwat Naz Mirza*, Imtiaz Ahmad Qamar** and Maqbool Shahbaz**

DETERMINATION OF FORAGE QUALITY OF INDIGENOUS AND EXOTIC RHODES GRASS ACCESSIONS UNDER RAINFED CONDITIONS
...e energy, carbohydrates, proteins and other important minerals. As global warming is increasing, overall water scarcity is resulting in deterioration of natural resources, and it is need of the hour to find fodder crop resources which are more accustomed to change climatic conditions. Hence, different exotic and indigenous varieties of Rhodes grass were tested for quality and yield parameters. Three varieties were imported from Australia and Zimbabwe namely Sa...

 Muhammad Tahir* and Nawal Zafar* 

FORAGE YIELD AND QUALITY PERFORMANCE OF RABI CEREALS SOWN ALONE AND IN BLENDED POPULATION AT VARIABLE SEED RATIOS
...00% seed ratio and crude protein percentage was highest when oat was blended together with barley at 75% + 25% seed ratios.

...

 Muhammad Tahir* and Neelam Yasin*

EFFECT OF MICRONUTRIENTS FOLIAR APPLICATION ON YIELD AND QUALITY OF MAIZE
...ld, harvest index, grain protein and grain oil contents. However, micronutrients application at stem elongation stage showed non-significant effect on plant papulation and number of cobs plant . Therefore, for attaining maximum yield of maize, it is suggested that 250 ml ha at stem elongation stage of maize should be used.

...

 Tassadduq Rasool*, Ali Zohaib*, Ehsanullah*, Riaz Ahmad*, Tasawer Abbas*, Tahira Tabassum*, Muhammad Ather Nadeem*, Mahmood-ul-Hassan*

FORAGE YIELD AND QUALITY IN PEARL MILLET-SESBANIA INTERCROPPING SYSTEM UNDER VARIOUS GEOMETRICAL PATTERNS
... to sole-cropping. Crude protein (84%) was improved most by cross planting over sole pearl millet, while, crude fiber (36%) and ash contents (20%) were improved by blended seed sowing, as compared to sole cropping of sesbania. Potential benefits of forage pearl millet can be acquired by intercropping with sesbania and following the planting geometry of sesbania intercropped in 45 cm apart two-row strips of pearl millet.

...
Yanling Xia1,2, Heping Li2, Yuntao Liang2, Jichen Zhao2, Binshan Lu2 and Di Liu1,*
...transport of the recycle proteins from the endosome to Golgi, and Vps26A protein is an important component of the retromer complex. In the present study cDNA sequence of the full coding region of the Vps26A gene was successfully cloned from antler tip of the Sika deer (Cervus nippon hortulorum). The Vps26A cDNA contains an open reading frame of 984bp encoding a polypeptide with 327 amino acids. The deduced mole...
Rabia Faiz and Dilara A. Bukhari*
...usion bodies Cry and Cyt proteins. The present study focuses on determining the insecticidal activity of cyt positive B.t. strains against 3rd instar larvae of mosquito. Larval mortality was noted after 24 h and GCU B.t. 4 (400± 1.15) was found to be the most toxic against 3rd instar larvae of mosquitoes. Spores LC50 values of other isolates were 451± 0.90 (GCU B.t. 1), 511± 0.85...
Xiaopeng Tang1,3, Rong Xiang1, Sijia Chen1,3, Shufen Yang1,3, Hu Liu1,3, Rejun Fang1,3,* and Aike Li2,
...cottonseed meal on crude protein (CP), water-soluble protein (WSP), amino acid (AA) and peptide fractions, and the AA digestibility and metabolic energy of fermented cottonseed meal (FCSM) and enzymatic hydrolyzed cotton seed meal (EHCSM) in white leghorn roosters. Firstly, CSM were fermented with Aspergillus niger, or hydrolyzed with alcalase and flavourzyme. Secondly, a total of 32 white leghorn roosters with simila...
Zhiping Hu, Hussain Ahmad, Jingfei Zhang, Lili Zhang and Tian Wang*
... content (21d) and total protein content (42d) were lower in T2 group than that of CON group. Serum total antioxidant capacity was higher and malondialdehyde content was lower in T1 group than that of CON group at 21d. Serum glutathione peroxidase enzyme activity was significantly increased in T1 group compared to CON group at 42d. Malondialdehyde content of liver in T1 group was lower than that of CON group. These results suggested that dietary supplementatio...
Basit Zeshan1,2,*, Mushtaq A. Saleem2,Javed Iqbal Wattoo2, Mohd Mokhtar Arshad1 and Maizan Mohamed1
...acid residues of S1 glycoprotein) were amplified by overlap PCR, cloned into prokaryotic expression vector resulting pET-Sf200 and confirmed the construct by sequencing. The recombinant plasmid was identified by restriction enzyme and sequencing analysis. The in vitro expression of the truncated protein was analyzed in E. coli with a molecular weight of 38kDa determined through SDS-PAGE and confirmed...
Saba Parveen Samo1, Moolchand Malhi1,*, Javed Gadahi2, Yan Lei3, Allah Bux Kaciwal1 and Saeed Ahmed Soomro1
...f dry matter (DM), crude protein (CP) and crude fiber (CF) increased (P < 0.05) by 13.71, 12.02 and 4.78% at week 3 and by 11.11, 11.8 and 3.46 % at week 6 in B compared to A. Among carcass characteristics the carcass dressing % (52.99 ± 0.77 vs 49.41 ± 0.6 ) and leg weight (kg) (1.28 ± 0.06 vs 1.05 ± 0.04) increased (P < 0.05) in B compared to A. The physico-chemical properties of meat were not significantly different between...
Wei Dang1, Ning Xu1, Wen Zhang1, Jing Gao2, Handong Fan1 and Hongliang Lu 1,*
... adaptations. Heat shock proteins and other molecular chaperones play specific physiological roles in such thermal adaptation. Here, we analyzed heat shock protein 70 (Hsp70) expression in six lizard species to investigate the variation in Hsp70 response contributing to thermal adaptation. At first, we collected three lizard species of the genus Takydromus from different geographical locations. We found that either th...
Sabah Mansoor1, Muhammad Tayyab1,*, Amna Jawad1, Bushra Munir2, Sehrish Firyal1, Ali Raza Awan1, Naeem Rashid3 and Muhammad Wasim1
...denaturing the insoluble protein using 8M urea followed by refolding through gradual dialysis. The refolded enzyme exhibited optimum activity at 55 °C between pH 8-9. The effect of metal ions on the activity of AMYSBS showed that Co2+ remarkably enhanced the enzyme activity and 500µM was recorded as optimal Co2+ concentration for the maximal activity of AMYSBS. Presence of ionic (SDS) and nonionic (Tween-20...

Ikramullah Khan1,2*, Muhammad Subhan Qureshi2, Sohail Akhtar2, Ijaz Ali3 and Ghufran Ullah4 

... cortisol and Heat shock protein-70 (HSP-70). Thermal stress increased all physiological parameterssignificantly (P < 0.001). Holstein Frisian manifested maximumincrease in RT, RR and PR (3.33, 209.50 and 59.41%) than crossbred (0.59, 40.22 and 22.0%), Sahiwal (0.78, 42.54 and 34.31%) and Achai (0.78, 39.22 and 33.85%) respectively (P < 0.001).Thermal stress increased biochemical changes significantly (P < 0.001). The increase in serum glucose, cortis...
Ambreen Asghar, Tasleem Akhtar, Nadeem Sheikh*
... the variations in serum protein level induced by fat rich diet. For this purpose, two groups of Wister rats were fed with diets carrying difference in percentage of fats. Protein profiling of treated groups indicated a marked increase in serum protein (related to iron metabolism and immune response) level compared to low fat-fed rats. Additionally, a decreased level of serum

Hamza Khan1, Safdar Ali1, Ijaz Ahmad*2, Ihsanullah Khan3, Shujaat Hussain1, Bashir Ahmad Khan4 and Muhammad Suhaib5  

...ed upon oil content (%), protein content (%) and Fatty acid profile. Results showed that SMH-1001 and SMH-1215 hybrids performed best for yield and quality parameters, whereas, SMH-1006 and SMH-0909 were considered best for early maturing traits.  

...

Azhar Mehmood1,2,*, Muhammad Farrukh Saleem2, Muhammad Tahir2, Muhammad Aqeel Sarwar3, Tasawer Abbas4, Ali Zohaib2, Hafiz Tassawar Abbas

...lower plant. The oil and protein contents of sunflower were significantly affected by varying levels of both nitrogen and boron and maximum oil contents were observed when boron was applied @ 2 kg ha-1 with 0 kg ha-1 of nitrogen whereas maximum protein contents were recorded when 2 kg ha-1 boron was applied in combination with 150 kg ha-1 of nitrogen of both hybrids (H1=Hysun-33 and H2=DK-4040). The combined application of n...
Hamayun Khan1,*, Abdul Wahab1, Navaid Kazi2, Younas Muhammad1,Summaya Kazi3, Salman Kazi4, Azmatullah Khan1, Ikramullah Khan5 and Shakoor Ahmad1
... includes glucose, total protein, albumin, creatinine, triglycerides, blood urea nitrogen (BUN), alanine transaminase (ALT) and aspartate transaminase (AST). The current study demonstrated the ascertained value in amniotic fluid for glucose, total protein and albumin at day 18, 25 and 28 was 42.9±0.80, 37.4±0.90, 36.5±0.88mg/dl; 17.9±0.30, 16.1±0.22, 13.9±0.34g/l; 13.9±1.6,11....
Leila A. Kaimbayeva1,*, Elena S. Malysheva2, Rashit Kazikhanov3 and Saule R. Kazikhanova4
...s revealed the nature of protein substances, altered рН value of the meat and the intensity of glycolysis. All these parameters were indicative of autolysis process in the meat. The levels of water-binding capacity and structural-mechanical properties of red deer meat that occurred during the course of autolysis were further confirmed by the histological changes in the meat. Specifically, it was observed that post-mortem changes were characterized ...

Qasim Iqbal1, Safdar Ali1*, Muhammad Naveed Tahir1, Obaidullah Shafique1, Bashir Ahmed Khan2, Ijaz Ahmad3 and Ihsanullah Khan4  

...ed upon oil content (%), protein content (%), and fatty acid profile. The results showed that significantly highest seed yield (2187.3) kg ha-1 was produced by SF 16003 followed by SF16010 and SF 16002 having (2016.2) kg ha-1 and (1888.2) kg ha-1 seed yield respectively. The Cluster analysis also determined SF 16003 as best hybrid which was at a very close distance from the group of SF16010 and SF 16002. 

...
Muhammad Shahbaz Aslam1, Iram Gull1, Zaigham Abbas2,* and Muhammad Amin Athar1
...inant expression of some proteins in E. coli produces inclusion bodies which are misfolded proteins. The objective of this study was soluble expression of IFNα2-Tα1fusion protein in E. coli using pET-SUMO vector and determination of its biological activity. SUMO-IFNα2-Tα1 was successfully expressed in soluble form with IPTG induction to final concentra...
Farah Rauf Shakoori1,*, Anum Feroz1, Ayesha Gondal1,Sahar Akram2 and Tanzeela Riaz3
... amino acids and soluble proteins while contents of total proteins, lipids, glycogen and trehalose were significantly reduced with reference to their control (untreated group). Among carbohydrate metabolizing enzymes, the activities of amylase and invertase were significantly reduced while activity of trehalase were significantly increased after treatment with sub lethal dose of λ-cyhalothrin as compared to control. T...
Asad Sultan1,*, Shahroom Khan1, Sarzamin Khan1, Naila Chand1, Muhammad Shuaib Khan2 and Hamza Maris3
...05) in OA-2, while crude protein, crude fibre, ether extract and metabolizable energy increased significantly (P<0.05) in OA-1.5 and OA-2. In conclusion, addition of OA in drinking water at the rate of 2 ml/L improved weight gain, feed efficiency, nutrient digestibility, and tibial mineralization of Ca and P in broiler.
...
Baoying Guo*1, Yu Chen1, Chuan Zhang2, Zhenming Lv1, Kaida Xu3, Hongling Ping4 and Huilai Shi4
...,228 bp and contained 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and 2 long-noncoding regions [both in the control regions (CR)]. The composition and order of genes in S. lycidas were similar to those of most other invertebrates. The overall base composition of S. lycidas is 35.8% T, 14.8% C, 41.3% A, and 8.1% G, with extremely high A+T content (77.1%). Both control regions contain termination-associated sequences and ...
Yijiang Liu1, Kun Li2, Hui Zhang2, Khalid Mehmood2,3, Muhammad Shahzad3, Houqiang Luo1,*, Muhammad Asif Yaseen4 and Xiong Jiang2,5,*
...79 bp) is composed of 13 protein coding genes, 22 tRNA genes and 2 rRNA genes. The ratio of the bases of the mt genome of R. pruinosus from Wenzhou are A (32.31%), T (31.04%), C (24.77%), G (11.88%), A+T (63.35%), respectively. The multivariable sites in rRNA were 1.98% and 5.53% in 12S rRNA and 16S rRNA, respectively. The multivariable sites in protein coding gene were ranged from 0 to 4.83%, while the multiva...
Muhammad Nazar Aftab1, Ahmed Ali1, Muhammad Asad1, Sadia Fatima2 and Furhan Iqbal2,*
...des (P = 0.0075 ), total proteins (P = 0.042) and creatinine (P = 0.0038)were significantly higher in treated male mice when compared with their untreated control group indicating the hazardous effects of AlCl3 on blood chemistry of adult male albino mice.
...
Farrukh Jamil*, Samra Raheel and Haroon Rasheed
...he other heme containing proteins and it may be a phosphate sensor.
...

Fatma Abdallah1*, Ola Hassnain2, Elsayed Attar3, Haytham Ali3,5, Mohamed Megahed1 and Venugopal Nair

...no acid sequences of Meq proteins possess several amino acid mutations associated with the MDV virulence and a unique distortion in the Proline repeats (Proline-to-Alanine) at position 176 in the Egyptian MDV strains. The Phylogenetic analysis grouped the eight analysed sequences with the previously investigated Meq from Egypt (2011-2013) together with the very virulent European and Chinese MDV isolates. The latter confirmed the geographical structuring of the...
Musrrat Fatima, Muhammad Saad Khan, Hamid Rashid, Asim Mehmood, Sumaira Kanwal, Muhammad Asif Rasheed and Farrukh Jamil*
...s been identified in the protein. Moreover, the identified site is used for structure-based virtual screening. After screening 100,000 compounds, 14 compounds are selected, which fulfilled different already established drug likeliness parameters such as rule of five and nontoxic nature. These 14 compounds are used for pharmacophore modeling, and Zinc natural compounds database (ZND) is screened against the developed pharmacophore. The compounds with the highes...
Tayfun Karataş
...crease in glucose, total protein, triglyceride, cholesterol, high-density lipoprotein and low-density lipoprotein levels as well as protein and lipid reserves in liver and muscle tissue of fish (p<0.05). The fasting period had no significant effect on the hepatic thiobarbituric acid reactive substances (TBARS), but, it caused a significant decrease in...
Changqing Zhao*, Zhuochi Chen and Yubin Li
...ermented jerky; the true protein content of the fermented jerky was lower than that of the non-fermented jerky; the free amino acids content of the fermented jerky was higher than the non-fermented jerky; the acid protease activity was slightly higher than the neutral protease activity in the fermented jerky; four and fifteen volatile compounds were detected for the non-fermented and fermented jerky, respectively. The important compounds affecting the flavor o...
Jia Chen*, Yuanxi Deng and Hui Xu
...ergen in mutton, soluble protein from mutton was extracted, and separated by SDS-PAGE. With the positive and negative sera of rats, the special allergen was identified with the Western Blot, showing that the 12kDa was the specific allergen. The protein of 12kDa was then analyzed by ion exchange and gel filtration chromatography, and the MALDI-TOF/TOF-MS search on the Internet. The results indicate that the
Bin Wang1, 2, Qianji Ning1,*, Qian Wang2, Wei Peng2, Tong Hao2,*and Jinsheng Sun2,*
...ndent analysis of single protein, rather than a protein-protein interaction. In this work, with the systematic point of view, the subcellular location of 830 unidentified proteins were annotated based on the previously reconstructed protein-protein interaction network (PIN) of E. ...
Syed Makhdoom Hussain1,*, Muhammad Zubair ul Hassan Arsalan1Arshad Javid2, Abdullah Ijaz Hussain3, Nosheen Aslam4, Qasim Ali5, Majid Hussain6Muhammad Masoom ul Hassan Rehan7, Muhammad Mudassar Shahzad1,8Anam Khalid1 and Danish Riaz1
...52% for crude fat, crude protein and supposed gross energy when compared to control diet, respectively. The next higher growth performance and nutrient digestibility values were observed at 20% replacement level based diet. It was concluded that the 10% replacement level of fish meal with MOLM is optimum which release adequate amount of chelated nutrients for maximum growth performance of L. rohita fingerlings.
...
Syed Makhdoom Hussain1,*, Nosheen Aslam2, Arshad Javid3, Shehzadi Liaquat1,Muhammad Mudassar Shahzad1, 4, Muhammad Zubair-ul-Hassan Arsalan1 and Muhammad Adnan Khalid1
...rcass composition (crude protein 17% and crude fat 10%) was found in fish fed on 3 gKg-1 level of probiotics supplemented canola meal based diet. Whereas higher ADC% of Na (75%), K (67%) and Mg (62%) were recorded by fish fed on 4 gKg-1 level of probiotics supplemented canola meal based diet. Similarly maximum improvements in RBCs, WBCs and Hb as well as higher mineral absorptions were recorded in fish fed on the said test diet. On the ba...
Selçuk Kaplan
...ding. Leptin is a 16 kDa protein which is highly expressed in adipose tissue. Leptin is one of the most significant candidate gene marker for MAS studies. Therefore, bubaline leptin gene exon 2, part of the intron 1 and intron 2 region were amplified and sequenced to identify nucleotide variations in Anatolian water buffaloes. Sequence analysis were revealed seven polymorphic site (G1072A, T1081C, T1131G, T1143C, T1145G, T1151G and C1221T) and one monomorphic ...

Muhammad Rehan Aslam1, Muhammad Maqsood1, Zahoor Ahmad2*, Sajjad Akhtar3, Muhammad Rizwan4 and Muhammad Usama Hameed

...st index (38.43%), grain protein contents (8.09%) and grain oil contents (4.76%) were obtained when two foliar sprays of 0.5% MgSO4 (T2) were applied. Similarly, highest cob weight without sheath (258 g), number of grains per cob (475.1), 1000-grains weight (272.5 g), biological yield (13.4 t ha-1), grain yield (5.15 t ha-1), harvest index (38.20%), grain protein contents (9.01%) and grain oil contents (4.76%) were recorded ...
Doğan Türkyılmaz1,*, Selçuk Özyürek2,Nurinisa Esenbuğa1 and Mustafa Yaprak1
... solid non-fat, density, protein, lactose and ash. Density of the milk is expressed in kg/m3 and the other components are in percent. Fat, solid non-fat, density, protein, lactose and ash percentages of the milk in this study were respectively 7.19%, 9.67%, 1030.78 kg/m3, 3.18%, 5.55%, 0.93% in Morkaraman; 7.20%, 9.95%, 1031.78 kg/m3, 3.29%, 5.70%, 0.96% in Tuj; 6.79%, 9.60%, 1030.77 kg/m
Farhat Ijaz1, Rana Khurram Aftab2*, Samia Jawed3
...rkers such as C-reactive protein (CRP), interleukins 6 (1L-6) and tumor necrosis factor alpha (TNF-α). Relation of TNF-α with obesity induced IR and T2DM is unclear as results obtained from different studies are very controversial.
Objective: This study was designed to compare TNF-α levels and insulin resistance in obese and non-obese type 2 diabetics.
Methodology: A cross sectional comparative study was ...
Nuzhat Huma1, Fozia Ghaffar1, Saima Rafiq2,*, Imran Pasha1, Aysha Sameen1, Imran Hayat2 and Imtiaz Hussain2
...itrogenous compounds and protein fractionations of casein and whey proteins of milk from different dairy animals like buffalo, cow, sheep, goat and camel. The buffalo and sheep milks have comparatively higher fat, solid-not-fat and total solid contents than other milks. Maximum whey proteins were found in the sheep milk (0.78%) whereas cow milk had lowest contents (0.54%). Non-casein-nitro...
Sana Rafique1, Hina Saqib1, Khushi Muhammad2, Nazia Akbar2, Abdul Rauf3, Muzafar Shah4,*
...gue virus non-structural protein using Rapid Diagnostic kit for Dengue virus (DENV) i.e. SD BIOLINE Dengue IgG/IgM. Data was obtained from patient’s record, filled forms and through questionnaire. Total 1332 blood samples were collected from 3 tehsils of District Mansehra. Out of which, 725 were found positive for dengue fever infection. Out of 725 positive cases, 410 (56.5%) were males and 315 (43%) were female’s patients. The high rate of ...
Rafa Almeer1,*, A. Alqarni1,2, S. Alqattan3, S. Abdi4,*, S. Alarifi1, Z.Hassan5 and A. Semlali6
...sue inhibitors of metalloproteinase (TIMPs) and two matrix metalloproteinase (MMPs) were measured by real-time PCR. All subgroups exhibited altered morphology with accelerated detachment compared to untreated cells. The MTT assay after 48 h revealed that treatment with H1 and H2, reduced cell viability by 48% and 91% respectively, compared to that of untreated cells. These results suggest that anticancer effect of Sidr and W...

Kashif Akbar* and Muhammad Ayub 

...73%), fat 24.23-23.94%), protein (8.20-7.68%), fiber (6.47-6.38%) while NFE increased slowly (57.86-58.60%). The color of the cookies ranged from F0-F6 (6.88-6.93), taste ranged F0-F6 (6.82-6.04) and texture ranged F0-F6 (6.91-6.15). Maximum overall acceptability was recorded in F2 (7.32) proceeded by F0 (6.99) whereas minimum mean score was recorded in F6 (6.37) proceeded by F5 (6.47). 

...

Ahmed Zein Elabdeen Mahmoud1, Muaz Magzob Abdellatif2* and Mohamed Abdelsalam Abdalla

...ied out to analyze nucleoprotein (N) gene of PPRV from fatal infections in small ruminants. For this purpose, RNA was extracted from suspected animal samples (n=18) and were screened by real time-PCR. Additionally, to assess the phylogenomics, the N gene was amplified and sequenced from sheep and goats (n=12). Nucleotide identity among Hail strains was identified to be 96.2-100%, while identity with previously sequenced Saudi Arabian strains and with reference...
Tanveer Hussain1,*, Masroor Ellahi Babar1, Marcos De Donato2, Abdul Wajid1, Asif Nadeem3, Zahoor Ahmad3, Waqas Ahmad Khan4, Sunday O. Peters5 and Ikhide G. Imumorin6
...mino acid changes in the protein sequence. The UPGMA tree showed a clear differentiation between taurine and indicine cattle, except mitochondrial taurine sequences in Lohani and Nari Master breeds. The within-breed estimates of divergence were very low in all breeds except for Nari Master (mixed-bred). The estimates of divergence among breeds were also low for most breed pairs, except for Nari Master and Dhanni. While the overall genetic divergence within the...
Jingen Xu1, Yang Liu2, Erhui Jin1, Youfang Gu1, Qin Zhang3 and Shenghe Li1,*
...ocesses, including the G-protein coupled receptor protein signaling pathway, intrinsic to membrane, cell junction and ion transport. KEGG pathway analysis showed that the neuroactive ligand-receptor interaction was significantly enriched. The results offer a foundation for exploration of immune functions and genetic control of peripheral blood T lymphocyte subsets. Also, several differentially expressed immune-related genes ...

Muhammad Khalid1,2 and Muhammad Naeem2* 

...composition of moisture, protein, lipids and carbohydrates. The purpose of this study was to affirm the proximate composition and nutritious status of Ctenopharyngodon idella. Standardized methods were used to determine the proximate composition of 72 samples. On wet weight basis, mean percentage for water was 80.76 %, ash 3.40 %, 4.31 % for fat and 11.53 % for protein in C. idella. Percent water contents showed inverse rela...
Wei Meng1,3, Tianyan Yang2,*, Yunguo Liu1, Mahmut Halik1 and Tianxiang Gao2
...enated H-strand-encoding protein genes were conducted by Neighbor-Joining method to reveal the evolutionary relationships within subfamily Schizothoracinae. Three different grades of schizothoracine fishes were well recognized from each other in branching diagram. The primitive group and the specialized group + the highly specialized group constituted a sister relationship with strong supports.
...
Ai Guo1,2,3, Jiaguang Xiao4, Binbin Shan4, Tianxiang Gao5 and Yongdong Zhou3,*
... ribosomal RNA genes, 13 protein-coding genes and non-coding regions. The mitogenomes of C. mystus N and C. mystus S shared the identical structural organization and gene arrangement with those of other Coilia fishes. Both lineages of C. mystus showeda similar features in not only the strand-specific asymmetry of nucleotide composition, but also the codon usage of genes. Whereas a significant variation among Coilia species wa...

Muhammad Amir Maqbool1*, Muhammad Aslam1, Waseem Akbar2, Muhammad Waheed Anwar3 and Ehtisham Shakeel Khokhar

...ustify;">Major intrinsic proteins (MIPs) of chickpea (Cicer arietinum L.), barrel medic (Medicago truncatula L.) and maize (Zea mays L.) were targeted in current studies. Amino acid sequences of major intrinsic proteins of chickpea, barrel medic and maize were retrieved from NCBI database followed by BLASTP. Pairwise and multiple alignment of sequences was done by using ClustalX software, and phylogenetic trees were construc...
Hülya Şereflişan and Beyza Ersoy Altun*
...ke Gölbaşı. Crude protein and lipid contents were higher in U. tigridis (10.75%, 0.96%) than in A. pseudodopsis (8.63%, 0.77%, respectively), whereas the situation was vise versa for fatty acid compositions. The proportions of Omega-3 (n3) were higher than those of Omega-6 (n6) in both of the mussels. n6/n3 ratio, which was 0.90 for A. pseudodopsis and 0.99 for U. tigridis, is an index for comparin...
Zisha Liu1, Na Song1, Takashi Yanagimoto2, Zhiqiang Han3, Bonian Shui3 and Tianxiang Gao3,*
...a concatenated set of 12 protein-coding genes, and adding 16 other species of gobies (Gobiidae). The mitogenome sequences of O. lacepedii, O. rebecca and Odontamblyopus sp. were all circular double-strand molecules, 17245 bp, 17009 bp and 17004 bp long, respectively. Compared with other bony fishes, the three species shared the similar features in gene arrangements, base composition and tRNA structure. The control region spanned 1571 bp, 1...
Farah Rauf Shakoori1,*, Tanzeela Riaz2, Uzma Ramzan1, Anum Feroz1 and Abdul Rauf Shakoori2,3,*
...e amino acid while total protein and total lipid contents, were significantly increased with reference to their control (untreated group). Among carbohydrate metabolizing enzymes, the activities of trehalase, amylase and invertase were significantly reduced after treatment with sub lethal dose of esfenvalerate as compared to control. The metabolic derangements induced by sub-lethal dose of esfenvalerate suggest that infestation caused by T. granarium in...
Muhammad Mobashar1, Muhammad Tahir1, Shahbaz Javaid2,*, Muhammad I. Anjum2, Insha Gul3, Nazir Ahmad1 andAbdul Sami1
...ilarly, intakes of crude protein (CP) and crude fat (CF) were significantly higher (P<0.05) on ration II compared to rations I and III. Neutral Detergent Fibre intake (Kg/day) in rations I, II and III was 5.4, 6.8 and 6.19, respectively. Intake of Acid Detergent Fibre (Kg/day) was higher in ration II while lower in ration I. Acid Detergent Lignin intake (Kg/day) in three rations ranged from 2.26 to 2.61. In vitro DM digestibility (%) signi...

Muhammad Zahid1, Naeem Iqbal1, Sohaib Muhammad2*, Summiya Faisal3, Wajid Mahboob3, Makhdoom Hussain4 and Zaheer ud din Khan2 

...tivity and total soluble proteins were increased with increase in sugar treatments under drought. Osmotic and water potentials were reduced under drought but foliar glucose sprays of 10 mM and 50 mM applied at reproductive phase significantly reversed the adverse effects of drought. Gas exchange characteristics including CO2 concentration, transpiration and photosynthesis rates were raised by glucose treatments under irrigated and non-irrigated conditions. Hen...
Nevran Eylem Akman Gündüz1,* and Özgür Özcan2
...o the synthetic diet and protein, lipid, carbohydrate and glycogen levels in the hemolymph were evaluated for the GA3 concentrations. The hemolymph protein level of the larvae increased significantly at 5, 10, 50 and 200 mg/L with respect to the control group. The lipid level of hemolymph fluctuated among the tested GA3 concentrations. It was significantly reduced at 5 and 10 mg/L, but increased at 50 a...
Arifa Mehreen1, Iram Liaqat2,Muhammad Arshad3, Muzzamil Waheed4 and Najma Arshad1,*
...n, Staphylococcus protein A (spa) was identified most frequently (81%) and proportions of capsular polysaccharides (CPs8), clumping factor A (clf A) andintracellular adhesion A (ica A) were 78%, 68.5% and 40%, respectively. ica D and CPs5 could not be amplified from any isolate. Toxin genes were present in 43.5% isolates. Among toxin genes, enterotoxins (SEs) were most frequently detected followed ...
Binbin Shan, Yan Liu, Changping Yang, Shengnan Liu and Dianrong Sun*
...t clusters of eukaryotic proteins. In addition, a total of 17,671 unigenes were classified into 311 KEGG pathways. Finally, we predicted the coding sequences of 13,072 unigenes and obtained 9,222 SSRs in the present study. The whole transcriptome is an important foundation for future genomic research on the P. penicillatus and can provide comprehensively understanding and further characterizations of transcriptomes of non-model organisms.
...
Majid Hussain1, Syed Makhdoom Hussain1,*, Razia Iqbal2, Arshad Javid3, Muhammad Mudassar Shahzad1,4 and Muhammad Zubair-ul-Hassan Arsalan1
...t digestibility of crude protein (68.57%) was observed at 4% CA level, whereas highest digestibility of crude fat (72.23%) and gross energy (66.63%) was observed at 3% CA level. Fingerlings also showed maximum weight gain (WG), weight gain% (WG%), specific growth rate (SGR) and lower FCR value at 3% CA level. Hematological indices of fingerlings fed CA supplemented MOLM based diets were significantly (p< 0.05) improved as compared to control diet. Maximum n...

Saif Ullah and Mohammad Akmal*

...lower for better oil and protein. The study suggests that N, P and S at the rate of 80, 90 and 30 kg ha-1 is the best combination for soils remained with cereal crops in cultivation to plant with sunflower good quality of oil and protein.  

...

Safina Naz1, Muhammad Akbar Anjum1, Saeed Akhtar2, Syed Atif Hasan Naqvi3* and Muhammad Asif Zulfiqar

...roximate (moisture, ash, protein and fiber) and heavy metal (Pb, Ni, Cu, Cd, Fe and Cr) contents. Significant differences were found for proximate composition of canal, tubewell and sewage water irrigated vegetables. The vegetables grown with tubewell water had higher moisture, ash and fiber contents compared with those grown with canal and sewage water; whereas protein content detected was higher in okra, tomato and spinach...

Muhammad Javed Iqbal and Muhammad Naeem* 

... rohita fed with various protein: Energy ratios; fish meal (T0), 25%CP (Crude proteins) (T1), 30%CP (T2), 35%CP (T3) and 40%CP (T4). Experiment was designed to replace enriched fish meal diets with cheaper plant origin crude protein diets in fish culture. A total of 15 aquaria having 20 samples each were arranged in triplicate for 90 days to study the effect of five feeding groups on Lengt...

Safina Naz1, Khushbo Hussain1, Muhammad Asif Zulfiqar2* and Syed Atif Hasan Naqvi3
 

...33 (mg g-1), while total protein content were 25.33(mg g-1), SOD 214.30 (IU min-1 mg protein-1), 895.52 POD (mmol min-1 mg protein-1) and catalase value was 2159.90. Similarly, SA application promoted total phenolic content up to 157.84 (mg g-1), while total protein content were 26.66(mg g-1), SOD 199.33(IU min-1 mg protein
Wajid Ali1,*, Asma Karim1, Muhammad Irfan2, Hafiz Abdullah Shakir3*, Ghulam Mustafa4, Zeeshan Shafique1, Ijaz Anwar1
...e, cholesterol and total protein) and gills for histology were taken after 96 hrs. After acute exposure to pesticide, significant changes were observed in serum biochemistry and histology. Serum glucose and cholesterol were increased while total protein was decreased. Histopathological result reveled that gills of experimental fish was damage severely resulting Necrosis, Damaged nuclei , rupturing of epithelial cells, Mucous...
Faxiang Wang, Yan Chen, Sai Chen, Xianghong Li, Jian Yu, Jianhui Wang and Yongle Liu*
...properties of grass carp protein. The results show that muscle proteins of grass carp were degraded and underwent conformational changes when stored at 4 °C, and significant changes of the proteins content, as shown by the SDS-PAGE fingerprint, was observed after 6 days of storage. Protein’s surface hydrophobicity and total SH content increased...

Sana Rana1, Sajid Abdullah1, Huma Naz2* and Khalid Abbas1 

...rtial purification total protein contents and percentage recovery decreased from crude extract to desalted sample while fold purification was increased. The maximum activity of purified CAT was recorded at 6.0 pH and 30°C temperature for gills of C. striata. As the temperature was raised further the catalase activity decreased. 

...

Safina Naz1, Muhammad Akbar Anjum1, Syed Atif Hasan Naqvi2*, Bushra Siddique3 and Muhammad Asif Zulfiqar4

...icon esculentum (93.7%), protein in Spinacia oleracea (2.23g/100g), fats and fiber in Abelmoschus esculentus (0.44g/100g and 3.27g/100g, respectively), ascorbic acid in Spinacia oleracea (84.5mg/100g) and carbohydrate and energy values in Daucus carota (11.25g/100g and 55.80 cal, respectively). While, higher mineral contents were recorded for phosphorous (P) in Spinacia oleracea (85.5mg/100g), sodium (Na) and iron (Fe) in Lycopericon esculentum (65.33mg/100g a...
Yang Liu1,2,3, Baimei Liu1,2,3, Chenchen Li1,2,3 and Meiwen An1,2,3,*
... The mRNA expression and protein secretion of supernatant were tested using Q-PCR and ELISA method, respectively. Co-culture KM&FM under 3.4 kPa pressure enhanced typeIcollagen and type III collagen mRNA expression and protein secretion from KM. It however reduced typeIcollagen and type III collagen mRNA expression and protein secretion from FM; it promoted mRNA expression and
Xiaojie Ding, Xiling Sun, Zuien Wang, Qiusheng Zheng, Xiaofei Yu, Wenjin Hao, Kejun Wang, Wenjuan Xu and Zhengping Dong*
...mRNA, to decrease TLR4/9 protein synthesis and expression. So we concluded that Wumei Pill probably reduce the release of pro-inflammatory cytokines and the bacterial endotoxins by blocking the transmission of TLR4/9-NF-kB signaling pathway so that Wumei Pill has a significant therapeutic effect on IBS-D.
...
Soumble Zulfiqar1, Khuram Shehzad1, Sana Tahir1, Khalid A. Al-Ghanim2 and Abdul Rauf Shakoori1,2,3,*
...;KW strain. The CueO protein was purified to homogeneity by nickel affinity chromatography. Enzyme assays of CueO protein with phenolic substrates revealed its laccase activity. The kinetic studies showed Km value of 0.2µM, kKcat 0.68 S-1 and Kcat/km 1.2S-1 µM-1 for 2,6-Dimethoxyphenol (DMP) and Km value of 0.25mM, Kcat 300 S-1 and Kcat/Km=1200S-1mM-...

Ali Muhammad*, Yasser Durrani, Majid Suhail Hashmi, Ihsan Mabood Qazi, Muhammad Ayub and Saifullah 

...xt-align: justify;">Whey proteins have many nutritional and beneficial therapeutic properties, which are indispensable for the functional and nutritional properties of foods. The aim of the study was to neutralize whey by addition of NaOH (0.1 and 0.01N) and NaHCO3 (0.1 and 0.01N) for fortification and enrichment of foods. However, addition of these solutions results in an increase in total solids and ash content of the whey sample The samples were normal whey...

Ambrin Rajput* 

...w yield (31050 kg ha-1), protein (15.77%), shoot N, P and K (2.1, 0.3 and 1.3 %) concencentration and N, P and K uptake (95.3, 16.4 and 49.9 kg ha-1) were recorded by combined application of N, P and K fertilizer application. However, the minimum values were obtained from control treatment. The combined application significantly increased chickpea yield compared the one without K application. There was positive significant relationship between all yield parame...

Waqas Ali* and Mudasser Habib 

...ic region but as a whole protein was under negative selection pressure for serotype O, A and Asia 1. Therefore, under mass vaccination campaigns and drastic environmental conditions strains under negative selection has the ability to make escape mutants. 

...
Tahira Jamil*1, Mohammad Asghar1, Fatma Husain1, Haq Nawaz Bhatti2
...h blood cholesterol, lipoproteins like low density lipoproteins, very low-density lipoprotein and decreased high density lipoprotein levels are the major risk factors involved in the development of cardio vascular diseases. Lovastatin is formed as secondary metabolic intermediate initiated by anion moiety (acetate) through polyketide chain reactions. The...
Muhammad Babar Khawar1, Muddasir Hassan Abbasi2*, Zillay Mariam1, Nadeem Sheikh1,2*
... (P=0.0001), total proteins (P<0.0001) and albumin (P<0.0001) when compared against control. Similarly, hematological analysis revealed a significant decrease in WBCs (P<0.0001), RBCs (P=0.0001), Hemoglobin (P<0.0001), Platelets (P<0.0001) and MCHC (P<0.0001) while MCV (P<0.0001) showed a remarkable positive change when compared with control. Hematocrit (P<0.0001) was found to be enhanced significantly in Group 1 but decreased in ...
Asima Bano1, Hafiz Muhammad Tahir2, Hira Sherawat3, Muhammad Mutlib4, Muhammad Arshad5, Muhammad Akram Qazi6, Sajida Naseem5, Rabia Ishaq1, Iram Liaqat2 
...ine the overall level of protein was also found to be decline. It is concluded from the study that these enzymes can be used as biomarker in the diagnosis of breast cancer. 
...

Asma Sohail1*, Kashif Sarfraz Abbasi1, Maryum Arif2 and Fatima Najam1 

...lysaccharides, vitamins, proteins, essential amino acids, carotenoids, fatty acids like linoleic acid and linolenic acid, lignans, minerals and various phytochemicals. Due to the presence of two unsaturated fatty acids, these oils can reduce their biological activity on heating, volatilization, and other parameters like oxidation and UV rays. This limits the commercial application of these oils. To overcome such problems encapsulation could be a gentle approac...

Shoaib Nawaz1, Muhammad Razaq1, Zahid Mahmood Sarwar1*, Muhammad Sajjad1*, Syeda Aneeza Ubaid1, Muhammad Asif Zulfiqar2 and Usman Haider

...ue to its nutrients like protein vitamin calcium potassium, value play an important role in Ghanaians diet. Sucking pest jassid become major problem on okra in tropical and subtropical regions and cause heavy losses. Neonicotinoid insecticide, like nitenpyram was used on calendar basis and ETL basis. Data was recorded on weekly basis. In first week jassid population in control and ETL treatments was equal with non-significant difference between them while in c...

 Sumera Siddique1,†, Hafiz Abdullah Shakir1, Javed Iqbal Qazi1*, Amtul Bari Tabinda2, Muhammad Irfan1

Screening of some agri-wastes for economical cultivation of Candida tropicalis SS1
...sSS1 for the single cell protein (SCP) production employing different fruit’s peels. The C. tropicalis SS1 was cultivated in media containing 2% pulverized peels of apples, mangoes, water melon and bagasse singly as well as in eleven different combinations. The media were inoculated with 1% (w/v) suspension of 24 h old yeast cultured in nutrient broth. The strain grew best in water melon (WM) at pH 7.0 and 37 °C under non agitation conditions. The pr...

Muhammad Babar Khawar, Nadeem Sheikh*

Effect of paper industry leachate on various serological indices and serum proteins of wistar rats
...01) and High density lipoproteins (HDL) (P<0.0001) while a significant negative change in triglycerides (P=0.0002) and creatinine (P=0.0370) level in both experimental groups. Alanine aminotransferases (ALT) level showed a significant increment in Group 1 and a decrement in Group 2 compared to control group (P<0.0001). SDS page analysis revealed an overall decreased expression of various proteins in both experimental g...

 Tahir Abbas*1, Khawaja Raees Ahmad2, Asmatullah3, Khalid Pervaiz Lone4, Muhammad Ali Kanwal2, Sadia Suleman2

Reno-hepatic protective effects of Jambul against chromium induced anomalies in mice
...Phosphatase (ALP), total protein, bilirubin, globulin, creatine and uric acid along with reduction of SGOT/SGPT, Blood Urea Nitrogen (BUN), urea and albumin as compared to control. Treatments with JFE after Cr+6 exposures significantly improved the hepatic and renal functional profiles possibly by partial liver rehabilitation and regeneration. The JFE significantly recovered the histopathological alterations in reno-hepatic tissue by free radicals scavenging a...

Tasleem Akhtar, Nadeem Sheikh*

Induction of acute phase in response to tacrolimus induced hepatotoxicity
...the level of acute phase proteins due to the toxic effect of an immunosuppressive drug (tacrolimus). Aqueous suspension of tacrolimus powder (3 mg/ml) was orally given to four experimental groups of wistar rats. Control group was provided with normal drinking water and dissections were done after 6, 12, 24 and 48 h of tacrolimus dose. Densitometric analysis revealed considerable elevated level of some positive acute phase protein

Riffat Mehboob1*, Sami Ullah Mumtaz2, Zoya Manzoor3, Sajid Abaidullah2, Fridoon Jawad Ahmad1

Deranged biochemical and hematological profile of septicemia patients in Mayo hospital, Lahore
... of patients while total protein was in normal range in 97.02% patients and the trend of albumin was towards low (44.55%).In Renal function tests, urea was elevated in 71.29% and creatinine in 51.48% patients and in electrolytes Na+ was low in 41.58% patients K+ were normal in majority of patients. Hematological parameters such as WBCs were high in 84.16%, hemoglobin was low in 78.12% and platelets were normal. The most common causes were urinary tract infecti...

Muddasir Hassan Abbasi1, 2, Noor Fatima1, Syed Shahid Imran Bukhari1, Asma Rashid khan3, Nadeem Sheikh2*

Variations in proteins and transaminases following experimental induction of Bisphenol A in mice
... the estimation of total protein and albumin and aminotransaminases activity. The sodium dodecyl sulphate
polyacrylamide gel electrophoresis (SDS-PAGE) was also run to analyze protein bands. Statistically significant
increase in total protein contents, albumin and aminotransaminases were noted in sample in comparison with control.
Comparative analysis between experimen...

 Abir Ishtiaq, Muhammad Naeem*

Length-weight relationships and condition factor for farmed Catla catla (Hamilton, 1822) from southern Punjab, Pakistan
...d 15%, 20% and 25% crude protein (CP). The regression
estimates for LWRs were highly significant (P <0.001) with coefficient of determination, r2-values being >0.930 in the
three studied groups and for overall data. The value of the regression coefficient (b) indicated negative allometric
growth (b= 2.87), isometric growth (b= 2.95) and positive allometric growth (b= 3.22) for fish fed 15 %, 20 % and 25
% crude

 Jhan Zeb, Muhammad Javed

Forecasting percentage contribution of plankton biomass towards increase in fish yield under composite culture conditions
...mentary diets at varying protein level viz., 22, 24, 26, 28, 30 and 32% digestible protein (DP), respectively @
2% of their wet body weight daily. However, control fish (T7) although had an access to plankton; but were devoid of
the availability of any supplementary diet. Data on dry weights of plankton biomass and increase in fish yield were
collected on monthly basis and subjected to regression analysi...

Sadaf Niaz1, Masroor Ellahi Babar2, Tanveer Hussain2, Asif Nadeem1, Misbah Hussain1, Riffat Mehboob3*, Fridoon Jawad Ahmad3

Mutation analysis of RING1 domain of Parkin in early onset of Parkinson’s disease in Pakistani patients-a pilot study
... domain of Parkin
protein was performed in a sample set of 30 patients (selected from different areas of Punjab, Pakistan) to find out
any Single Nucleotide Polymorphism (SNP).No SNP was detected in RING1 domain that could be related to the
disease. The data suggests that no genetic predisposition in RING1 domain may be responsible for the occurrence of
disease in local population. It may be due to genetic changes in any other part ...

 Muhammad Babar Khawar1, Muddasir Hassan Abbasi1, 2, Sana Fatima3, Khawaja Abdul Mujeeb2, Nadeem Sheikh1

Alterations in proteins and transaminases activity induced by thioacetamide in albino rats
...n tissue and serum total proteins and
albumin along with urea, uric acid and serum transaminases activity after 12 and 24h of TAA administration in albino
rats. Rats were randomly divided into three groups (n=3) namely control group, 12h group and 24h group. Each
experimental group (12h and 24h) was administered 300 mg/ kg TAA intraperitoneally (i.p) while control received
same volume of normal saline solution. Rats of 12h and 24h g...

Nabila Roohi, Mehjabeen, Samina Ashraf*

Effects of cigarette smoking on serum proteins profile in male active and passive smokers
... analysis of serum total proteins and fractions
(albumin, total globulins, gamma globulins and non-gamma globulins) of active and
passive smokers. Blood samples of 180 cigarette smokers were collected from
different locations of Lahore and 60 healthy non-smokers from University of the
Punjab, Quaid-e-Azam campus Lahore, in terms of comparable age, height, weight
and socioeconomic set up. Serum protein...

 Siddra Tayyab Akhtar, Anjum Nasim Sabri

Twitching, swimming, swarming in biofilm forming strains in response to chemical and physical factors
...motilites whereas
proteinase K enzyme showed weak antimotility effect against all tested bacterial
strains. From this study we proposed that instead of biofilm detachment by
expensive commercial detergents, we could change the physical environment of
sewage systems as well as flooding some specific chemicals, which disrupt
bacterial motilities and biofilm formation.

...

Farkhanda Asad1*, Samina Qamer1, Tayyaba Ali1, Ammara Behzad1 and Tahira Yasmin2 

...4 mg/Kg while, for crude protein higher value of nutrient digestibility was recorded in test diet T3(G/0.2, CrCl3.6H2O mg/Kg).It was concluded that chromium supplementation with gelatinized corn in fish (Cirrhinusmrigala) diet can improve the nutrients digestibility more efficiently as compared to non gelatinized and Cr-free diet. 

...
Fatih Korkmaz1, Veysel Parlak2, Özgür Kaynar3, Arzu Ucar2, Gonca Alak1,* and Muhammed Atamanalp2
...e evaluated based on the protein profile, bacterial content (total aerobic mesophilic, psychotropic and lactic acid bacteria, Pseudomonas and Enterobacteriaceae), lipid peroxidation (TBARS), total volatile basic nitrogen (TVB-N) and pH values on quality during 12 days. The decrease in bacterial growth activity, physicochemical values (TVB-N, TBARS and pH) and prolonged shelf life in a natural preservative dependence were observed in the fillets. General...
Gangchun Xu1,2, Fukuan Du2, Yuyu Wang2, Yan Li2, Zhijuan Nie2 and Pao Xu1,2,*
...ing Frame that encoded a protein of 388 amino acids. The 5′ and 3′ untranslated regions were 269 bp and 139 bp, respectively. The full length ortholog PTGES2b was 1,457 bp and contained a 729-bp ORF that encoded a protein of 242 amino acids. The 5′ and 3′ untranslated regions were 402 bp and 326 bp, respectively. One polyadenylation signal (AATAAA) was present 14 nucleotides upstream of the pol...

Sahar Shibli1,2*, Farzana Siddique1, Saeeda Raza2, Zaheer Ahsan3 and Irum Raza4 

...1 to 26.43±1.15 % proteins, 13.23±2.20 to 19.42±3.83 % carbohydrates and 4.95±0.06 to 8.53± % fiber. Mineral analysis of peanut cultivars showed 12.60±0.38 to 16.61±1.51 mg/100g Fe , 2.34±0.075 to 3.37±0.040 mg/100g Zn, 38.64±3.50 to 48.24±32.58 mg/100g Ca, 67.81±7.86 to 82.72±9.09 mg/100g Mg, 199.19±33.18 to 342.00±19.03 mg/100g Na and 1220.6±9.045 ...

Saima Yousaf1,2, Ali Zohaib2*, Shakeel Ahmad Anjum2, Tahira Tabassum2, Tasawer Abbas3, Sohail Irshad4, Usman Javed5 and Naila Farooq6 

...l yield, oil content and protein content of soybean, as compared to un-inoculated control. Seed inoculation with P. fluorescens was more effective than R. japonicum in improving grain yield and quality. The genotypes did not differ significantly in grain yield, biological yield and oil content; however, differed in protein content. Swat-84 was superior among all genotypes pertaining to yield formation and
Tamoor Azeem1,*, M. Yasin Tipu1, Asim Aslam1, Sajjad Ahmed2, Salman Ahmed Abid1, Abdullah Iqbal3, Naeem Akhtar4, Muhammad Saleem4, Aamerzish Mushtaq4 and Sajid Umar4
... while decrease in total protein and albumin (p>0.05).
...
Muhammad Huzaifa Mehmood1, Muhammad Ahmad Iqbal2, Muhammad Daood1, Muhammad Rizwan Tariq3*, Khubaib Ali3
...ed. The pH texture, fat, protein, blood lipid profile and PUFA concentration was significantly affected by the incorporation of oat in rabbit feed. It was concluded that the supplementation of 2% oat in rabbit feed increase n-3 PUFA in meat while improvement in serum lipid profile was observed by 4% supplementation of oat seeds. It was also observed that fat percentage in meat was also reduced by oat seed supplementation.
...
Pingping Cang1, Mingming Zhang1, Guo Qiao1,Qirui Sun1, Dehai Xu3, Qiang Li1, Xinghua Yuan4 and Wenbin Liu2,
...cal differences in crude protein (CP), crude lipid (CL) and ash contents of gibel carp muscle between BFT and control group at the end of experiment (P >0.05). The essential amino acids, non-essential amino acids and total amino acids contents of gibel carp muscle in BFT group were higher than those in control group. Bioflocs were composed with 29.8% CP, 3.2% CL and 19.1% ash at day 60. CP content was appropriate, and LP was lower for gibel carp. Eco...
Bei Liu1, Yanli Hong1, Huifang Zhou1,*, Zhenzhen Cao1, Shuang Zhang1, Jing Jin1, Miao Jiang1, Cunsi Shen2 and Jianjian Ji2
...each group. The mRNA and protein levels of GnRHR, the hub genes and key transcription factors in the downstream cAMP-PKA signaling pathways in RPC cells were also detected. The secretion and transcription levels of FSH and LH in Cetrorelix group were significantly decreased, while the expression of GnRHR was significantly increased compared to the blank group (p<0.05). Use of CSF with BSZYD alone showed no significant effect on the secretion of RPC, ...
Tafail Akbar Mughal1, Muhammad Zubair Saleem2, Shaukat Ali3,*, Khawaja Khurshid Anwar1, Muhammad Majid Bashir1, Muhammad Babar4 and Muhammad Adeeb Khan1
... lipids, cholesterol and protein contents both in the liver and blood while DNA and RNA contents only in liver. The administration of CCl4 resulted in increase in plasma ALAT and decrease in LDH. Vitamin E pre-treatment abolished CCl4-induced changes in the activities of these enzymes. Blood glucose content was increased while cholesterol content was decreased. Vitamin E pre-treatment abolished only CCl4-induced change in blood...

Omer Baris Ince* 

...gainst the nonstructural proteins (NSP) of Foot and Mouth Disease and evaluation the carrier rate in the region and the risk of infection and given information on the immune ratio of the animals. As a result, prevalence was observed to be 6.6% for breeding enterprises, 13.3% in bovine animals and 1% in ovine animals individually. Prevalence was found 13.3% throughout Konya. Generic immune ratio in bovine animals was found 58.8% for serotype O and 61.1% for ser...
Ali Raza Jahejo1,2, Nasir Rajput2, Wen-xia Tian1,*, Muhammad Naeem2, Dildar Hussain Kalhoro2, Asmatullah Kaka2, Sheng Niu1 and Fa-jie Jia1
... the absorption of crude protein (CP), crude fibre (CF), and metabolized energy (ME). However, the values of red blood cells and packed cell volume were non-significant whereas white blood cells, haemoglobin, and new castle disease antibody titer were significantly higher in basil supplementary group. The weight gain and feed conversion ratio significantly improved in basil treated group, while ascorbic acid and basil significantly decreased the water intake. ...
Hua-Lun Luo, Yi-Yu Zhang*, Yuan-Yu Qin and Lei Wu
...sponsive element-binding protein) plays a crucial role as a central regulator of lipid synthesis and glycolysis in animal liver. In this study, the relative quantitative real-time PCR analysis indicated that the duck ChREBP mRNA is widely expressed in all examined tissues. ChREBP mRNA level was the highest in abdominal fat and the lowest in gizzard. The g.247075G>A silent mutation in exon 10 was first identified by direct sequencing approach, and resulted i...
Rishen Liang*, Meng Zhou, Zhenxiang Lin, Guozhang Li, Yuan Chen, Xuan Lin and Zaohe Wu
... typical structure of 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and one noncoding control region. Genomic composition, organization and gene order were similar to that obtained in most vertebrates. By comparative analysis of the two genomes, 941 variable sites (5.69%) were found. Sequence divergences of 13 protein-coding genes, 2 rRNA genes and one control region which are commonly used as molecu...
Sakhra Mahmood1, M. Younus1, A. Aslam1, A.A. Anjum2, S. Umar3, Aamerzish Mushtaq3 and M.L. Sohail4,*
... the quails, an emerging protein source in developing countries.
...
Aisha Khalid1, Muhammad Tayyab1,*, Abdual Rauf Shakoori2, Abu Saeed Hashmi1, Tahir Yaqub3, Ali Raza Awan1, Muhammad Wasim1, Sehrish Firyal1, Zaheer Hussain4 and Munir Ahmad5
...binant enzyme as soluble protein. The recombinant protein was purified by affinity column chromatography. The characterization studies of purified protein demonstrated the optimal enzyme activity at 90°C and pH 4.8. The presence of cobalt enhanced the cellulase activity and 2.5 mM cobalt was recorded the optimal concentration for the maximal cellulase activity. SDS-PAGE ana...
Doğukan Ölmez1 and Gonca Alak2,*
... rich wastes in terms of protein. These wastes can be converted into different economic value products under controlled conditions. Under controlled conditions, byproducts have the potential to be converted into nutrients suitable for human consumption, as well as different products that have economic value. For this purpose, hydrolysates were prepared by enzymatic methods at different time periods using different trout byproducts. In this study, two different...
Yang Liu1, Jing-xin Mao2, Xiao-dong Wei2, Man Yi2, Xiao-long Zhang2, Ke Zheng3, Xian-xin Chen4, Guo-Ze Wang5 and Bing-bo Chen1,*
...the control group, total protein, albumin, and albumin/globulin ratio were increased in lactobacillus BFA group. The total bilirubin decreased significantly (P<0.05) both in lactobacillus BFA and Bacillus BFA group. Total weight gain and daily gain were increased in mixed fermentation BFA group significantly than the control group (P<0.05). For feed conversion rates in each group, the mixed fermentation BFA group had the highest feed efficiency, increase...
Naveed Ahmad1,*, P.J.A. Siddiqui1, Amjad Ali1, Khan Mir Khan2, Rafaqat Masroor3, Noor ul Akbar4, Muhammad Amin5 and Mohammad Attaullah6
...optimum level of dietary protein on growth performance, feed utilization, survival and carcass composition of yellowfin seabream, Acanthopagrus arabicus. Five semi-purified experimental diets were formulated containing 350 (P30), 400 (P35), 450 (P40), 500 (P45) and 550 (P50) grams of protein kg-1 of dry matter. Thirty healthy fish (20.94±0.81g initial weight) were stocked in each floating net cage (1...

Aqsa Khan1, Sabyan Faris Honey2*, Babar Bajwa2, Nelofer Jamil1 and Muhammad Sohail Mazhar2

...eir composition as major protein source and one diet without wheat germ were used. Addition of wheat germ in the diet composition for larvae resulted in significantly high percent survival (maximum value) (60± 4.56 and 56± 2.56) and significantly increased larval body weight of codling moth (0.58± 0.04 and 0.42± 0.03 gm). While diet without wheat germ resulted in low percent survival (40 + 5.46) and reduced larval body weight (0.15 ...
Shehzad Ghayyur1,3, Sadia Tabassum1, Munawar Saleem Ahmad2Naveed Akhtar1 and Muhammad Fiaz Khan1,*
...gent, while total plasma proteins and triglyceride level were significantly decreased (p < 0.05).

...
Jie Yang
...eptidoglycan recognition proteins (PGRPs) are innate immunity proteins that are conserved from insects to mammals, recognize bacterial peptidoglycan, and function in antibacterial immunity and inflammation. Mammals have four PGRPs (PGLYRP1, PGLYRP2, PGLYRP3 and GLYRP4). They are secreted proteins expressed in different tissues. It is significant to make a study of human PGLYRP1 because neu...

 Asad Sultan1, Rabia Ali1, Rifat Ullah Khan2,*, Sarzamin Khan1, Naila Chand1 and Ambrina Tariq3

...ofile with red higher in protein content (11.41%). It was observed that phytase inclusion in grain increased the availability of all nutrients except crude lipids. Total tract nitrogen retention was increased by 3% in red sorghum compared to white. Minerals absorption was increased but differently in different cultivars with higher degradation of phytate in both red and white sorghum. Apparent metabolizable energy was significantly enhanced both in red and whi...

 Mahroze Fatima1*, Muhammad Afzal2 and Syed Zakir Hussain Shah3

...nd for dry matter, crude protein, crude fat and ash content in fish body. Lipid peroxidation was determined in terms of thiobarbituric acid reactive substances (TBARS) and antioxidant enzyme activities. The minimum value of TBARS was recorded in VE150 group, which was increased again with supplementation of high vitamin E levels. Similarly, adequate supplementation levels (VE1000, VE1500) reduced the superoxide dismutase (SOD),...
Bibi Nazia Murtaza1,2, Azhar Qayum3, Shamaila Inayat Nadeem1, Naif Awdh Al-Maliki4, Abdulaziz Alamri4 and Abdul Rauf Shakoori2,5,*
...onal structure of mutant proteins were built by Swiss-Model and were further subjected to structural alignment and stability studies by I-Mutant Suite and DUET server. Both variants were predicted as ‘disease causing’ and protein stability analysis revealed p.G138V to be more destabilizing variant than p.E31K. When three-dimensional structures of variants were subjected to molecular docking with GTP, the mutated ...
Muhammad Shahid Nadeem*, Maryam A. Al-Ghamdi and Jalaluddin Azam Khan
...coli as heterologous protein under 0.3mM IPTG. The recombinant enzyme was purified by DEAE-Sephadex colum based anion-exchange chromatography. On SDS-PAGE, the enzyme exhibited a molecular weight of about 36 KDa. Its specific activity was 1650 U per mg of protein with about 5% glutaminase activity and no activity against D-asparagine. Optimal enzyme activity was found at 75°C and pH 9. The KM value of 5.9m...
Faiza Jabeen1,*, Bushra Muneer2 and Javed Iqbal Qazi3
...lded enough thermostable protein suggesting their potential in production of various enzymes and proteins in unconventional and economical substrates suitable for various industrial uses.
...
SiRui Wang1,2, Fekede Regasa Joka1,2, XiaoLong Wang1,2,* and SuYing Bai2,*
...yxovirus-resistance (Mx) protein in the evolution of different wild birds, 10 wild bird species, including Anas formosa, Anas crecca, Anas strepera, Mergus squamatus, Accipiter nisus, Buteo hemilasius, Buteo lagopus, Passer montanus, Psittacula roseata and Emberiza elegans, were selected.The sequences of the GTPase effector domain (GED) of the Mx gene were determined by PCR sequencing...

Fady Samir1, Rania F. El Naggar2, Mohamed M. Hamoud3, Manal M. Zaki1, Abdulrhman M. Gamal1, Samah E. Laban1, Shaimaa A. E. Nasr1, El Shaimaa Ismael1, Osama K. Zahran1* 

...ve pressures on NDV glycoproteins and their role in changing the NDV evolution in Egypt. 

...
Aisha Khalid1, Muhammad Tayyab1,*, Abu Saeed Hashmi1, Tahir Yaqub2, Ali Raza Awan1, Muhammad Wasim1, Shagufta Saeed1, Sehrish Firyal1 and Abdul Rauf Shakoori3
...roduction of recombinant protein. Higher level enzyme activity was recorded at 25°C, pH 7.0 when the cells were induced with 0.5 mM IPTG with 22h post induction incubation. Supplementation of LB medium with 1% glucose and yeast extract enhanced the production of recombinant thermostable cellulase. Enzyme showed strong potential for its use in paper and poultry feed industry. Under the optimal conditions we could able to produce 48 U/mL of recombinan...

Gulnaz Saleem1, Aijaz Hussain Soomro1*, Nouman Rashid2 and Mehar un Nisa Narejo3 

... Masoor-93 was higher in protein content (25.16%) than all other varieties. The supplementation resulted in a significant increase in protein, fat, crude fiber and ash contents of the biscuits. The thickness and spread factor of biscuits differ significantly while non-significant effect was observed in the width of the biscuits. Sensory analysis revealed that there were no significant differences (p>0.05) amongst all trea...
Zahra Nazir1, Saba Ijaz1, Roquyya Gul2 and Mahjabeen Saleem1,*
...nase was recognised as a protein with 47kDa molecular weight by SDS-PAGE. The optimum pH of purified polygalacturonase activity was found to be 4.5 and stable within pH range 3.5-5.5. Temperature dependent studies revealed temperature optimum of enzyme to be 40°C and stable up to 60°C. Among substrates, polygalacturonic acid was established as the best substrate for polygalacturonase showing its specificity in the hydrolysis of polysaccharide galacturo...

Fraza Ijaz1*, Umair Riaz2, Shazia Iqbal3, Qamar uz Zaman4, Muhammad Furqan Ijaz5, Hina Javed1, Muhammad Amjad Qureshi1, Zuhra Mazhar3, Ahmad Hassan Khan6, Hassan Mehmood7 and Ijaz Ahmad8 

...ritious Parameters crude protein (30.23%), neutral detergent fiber (33.45%) and acid detergent fiber (26.56%) gave significant results as compared to control (T1). Results indicated that the combined application of Rhizobium species and Tryptamine performed better by improving growth and yield and quality parameters. It is concluded that precursor-inoculum combination is an effective approach and should be tested in different ecologies. 

...

Muhammad Sohail1*, Asad Sultan2, Said Sajjad Ali Shah3, Muhammad Sajid1 and Adnan Khan4

...1% and 17.04 MJ/kg). The protein levels in wheat varieties were 12.15 and 11.89% which were more than that of both of corn (8.21 and 8.05% respectively) and sorghum varieties (10.41% and 9.89% respectively). The bioavailability of crude protein was higher in maize followed by wheat and sorghum. The phytic acid contents were found highest in both varieties of sorghum (0.85% and 0.87% respectively) as compared to the wheat var...
Shengjie Zhou1,2, Pengfei Wang1,2, Chao Zhao1,2, Mingjun Fu3, Jian G. Qin4, Lihua Qiu1, Zhenhua Ma1, 4,* and Maoshang Lin1
...-type fatty acid binding proteins (L-FABP) gene in golden pompano Trachinotus ovatus larvae was cloned in the present study. The full length of L-FABP cDNA from golden pompano was 604 bp, including a 5’-untranslated region (UTR) of 154 bp, a 3’-UTR of 69 bp and an open reading frame (ORF) of 281 bp. L-FABP encoding a polypeptide of 126 amino acids with a predicted molecular weight of 14.06 kDa and a theoretical isoelectric point of 8....

Bina Khanzada1*, Ghulam Hussain Abro1, Tajwar Sultana Syed1 and Nazir Ahmed2 

...ested were honey, sugar, protein hydrolysate solution to enhance fecundity and fertility of the parasitoid under laboratory conditions and compared with the provision of flower nectors such as ornamental sunflower, merry gold and hollyhock in the laboratory. The ornamental plants sunflower, merry gold and hollyhock were also tested in the field for conservation of the C. flavipes. The results showed that during 2013 and 2014, the C. flavipes fed on Hollyhock p...
Sheng Niu1, Ali-Raza Jahejo1, Fa-jie Jia1, Xin Li1, Guan-bao Ning1, Ding Zhang1, Hai-li Ma1, Wei-fang Hao2, Wen-wei Gao1, Yu-jun Zhao1, Shi-min Gao1, Jian-hui Li1, Gui-lan Li1, Fang Yan1, Rong-kun Gao1, Huan-chun Chen1,3 and Wen-xia Tian1,*
...-transferase A3 (rGSTA3) proteins. We explored the responses of HDPs in erythrocytes to thiram-induced TD and rGSTA3 protein by quantitative real time PCR (qRT-PCR). The results showed many HDPs expressions were suppressed by thiram-induced TD, and the expressions of HDPs were upregulated by rGSTA3 protein. These findings demonstrated that mRNA expressions of HDPs are highly related to thi...
Muhammad Ahmad, Zohaib Noor*, Karim Johar Khan, Waqar Younas and Ajmal Hussain
...ues of (P<0.05) crude protein, fats, carbohydrates, Mg (%) and K (%) was recorded in the H. molitrix than C. catla. The results of the study showed that H. molitrix probably consumed all the phytoplankton density by filtering the water continuously resulting in the reduction of growth in other fish species in the polyculture system.
...
Nursinatrio and Rudy Agung Nugroho*
...), feed efficiency (FE), protein efficiency ratio (PER), survival rate (SR) and carcass proximate of red tilapia were measured. The results showed that HCFM up to 12% could be used as supplementation and showed positive effects on all growth parameters. Supplementation of HCFM above 6% in the red tilapia diet increased the protein and fat content of red tilapia’s carcass. The highest survival was found on red tilapia f...
Yuyu Wang, Gangchun Xu*, Zhijuan Nie, Quanjie Li, Nailin Shao and Pao Xu*
... significant lower total protein (TP), cholesterol (TC), triglyceride (TG) and glucose (Glu) content in serum compared with those reared at low density on day 90 and 120 (P<0.05). In conclusion, the present results indicated that the largemouth bass (36-308 g) could be reared at high stocking density without depressed growth and chronic stress in commercial-scale in-pond raceway systems under this experimental conditions.
...
Wang Zaigui1,*, Guo Panpan1, Ye Miao1, Sun Linghong1, Zhang Hongfu2 and Liu Chaoliang1,*
...>P<0.01). (5) The proteinase activity in middle intestine was higher than that of the blank group (P<0.05). Collectively, the results indicated that adding B.subtilis to the feed of silkworm had positive effects on growth performances of the Bombyx mori L. apparently.
...
Iram Gull*, Muhammad Shahbaz Aslam, Imran Tipu, Roohi Mushtaq and Muhammad Amin Athar
...human latency associated protein with insertion of HCV NS3 protease cleavage site at splicing junction is reported.
...
Pin Lyu1, Xiangxian Chen2* andQinlong Liu3*
...structure and C-reactive protein levels, followed by the other three groups. C-reactive protein decrease in exercise and massage, massage only or exercise only groups was significantly different comparing to control group (p<0.05).Combined treatment of exercise and massage therapy showed the best effect in inflammation suppression, skeletal muscle regeneration, control of skeletal muscle fibrosis and muscular tissu...
Xiaona Cao1,3-5, Yuanyuan Ren2-5, Xiaoteng Cui2-5, Baoxin Qian2-5, Chunyan Zhao 2-5, Jie Yang2-5, Chao Su2-5,* and Xingjie Gao2-5,*
...ibution of three nuclear proteins, including heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1), Hu Antigen R (HuR) and T cell intracellular antigen 1 (TIA1), in the SG aggregation and nucleus/cytoplasm localization under stress condition. We found that hnRNP A1, HuR and TIA1-containing SGs were aggregated in the cytoplasm of HeLa cells, and accompanies the alteration of nucleus/cytoplasm localization during arsenite indu...
Hong Zhang1, Shu-Fen Han2, Jing Wang1, Shao-Kang Wang1, Gui-Ju Sun1 and  Cheng-Kai Zhai1, *
...ease in high density lipoprotein cholesterol. However, CWD can improve blood lipid and blood sugar levels, and at the same time improve obesity and fat accumulation in rats. CWD significantly augmented the relative level of peroxisome proliferators-activated receptor γ (PPARγ) and suppressed the sterol regulatory element-binding protein 1c (SREBP-1c) protein expre...
Jun Yan Bai*, Shuai Yang, You Zhi Pang, Xiao Hong Wu and Guang Lu Li
...e quail (P<0.05), the protein height of Beijing white quail is greatly higher than those of ret two species (P<0.05). Based on comprehensive evaluation, the egg quality of Korea quail is better than those of other two species, egg production and laying rate of China yellow quail are significantly higher than those of Korea quail and Beijing white quail (P<0.05). The average egg weight of Korea quail is significantly higher than those of China yellow q...
Hashim Ullah1, Abdur Rahman1, Rifat Ullah Khan2, Shakoor Ahmad2 and Ambrina Tariq3, Shabana Naz4,*
... cholesterol, fat, crude protein, ash, moisture and dressing percentage of WaziriandMazaisheep. A total of 36 mature sheep of Waziri and Mazai were selected and processed for dressing percentage and meat quality through proximate analysis. Wazirisheephad lower cholesterol as compared to Mazai. With the increasing BCS, the cholesterol content was significantly increased in both the breeds. The dressing percentage and crude protein
Zhengfei Wang*, Dan Tang, Xuejia Shi, Huayun Guo, Xiuping Chen, Daizheng Zhang and Boping Tang*
...on between mitochondrial protein coding genes (PCGs) and adaptation to the extreme hydrothermal vent environment.Thirteen PCGs from mitochondrial genomes of 48 Brachyura species and one Diogenidae species were examined. Each of the genes was investigated and compared to orthologous sequences using PAML, Datamonkey, and TreeSAAP. Nine mitochondrial PCGs (ATP6, ATP8, COX1, COX3, CYTB, ND1, ND2, ND4, and ND5) were validated to have undergone positiv...
Hong Ma*, Bo Fu, Liang Wang, Zhong-qiu Li and Di Liu*

 

...ell 117 (HSPC117) protein has been identified as being involved in placental formation, and can be modified by epigenetics. However, whether HSPC117 affects development of cloned embryos mRNA expression is unknown. To investigate the influences of HSPC117 on embryonic development, we generated transgenic porcine embryos by handmade cloning. We then assessed the embryonic developmental rate at cleavage and blastocyst stages. Our results sho...
Muhammad Afzal1, Nighat Sultana1, Ali Hassan1, Syed Zakir Hussain Shah2,*, Mahroze Fatima3, Syed Makhdoom Hussain4, Muhammad Bilal5 and Majid Hussain2
...ies of dry matter, crude protein and crude fat in Labeo rohita juveniles when fed CA supplemented diet. Similar observations were also recorded for the group fed on PHY supplemented diet. Citric acid addition in the diet also resulted in improved (p<0.05) digestibilities of Ca, Mg, P, Na, K, Cu, Zn, Fe and Mn. Similarly, PHY pretreatment had also resulted in enhanced mineral digestibility as compare to control group. However, both the suppleme...
Junli Sun1,2,3, Lin Bai1 2, Xiaogan Yang1,2, Yangqing Lu1,2, Shengsheng Lu1,2,* and Kehuan Lu1,2,*
...embrane lipids, membrane proteins and nucleic acids. The PCA analysis also exhibited that these three groups were well distributed in different areas. In conclusion, the microoperation of ICSI caused some changes in the metabolism of embryos. Raman spectroscopy is a valuable technology for assessing embryonic metabolism.
...
Rabia Khalid1, Saleema Bashir Shams1, Bibi Nazia Murtaza1,*, Gaitee Joshua1, Saira Mushtaq1, Hassan Al-Talhi2 and Abdulaziz Al-Amri2
...s (TG), high density lipoproteins (HDL), low density lipoproteins (LDL) and fasting blood glucose (FBG) were used to demonstrate the incidence of metabolic syndrome. Overall, 39.025% of bank employees and 22.53% of randomly selected control individuals have metabolic syndrome. Among the bank employees, prevalence of obesity was 67.53% and in general population it was 57.1%. The mean values of body mass index (BMI) for bank e...
Iram Liaqat1,*, Nazish Mazhar Ali2, Najma Arshad3, Riffat Iqbal1 and Zain-ul-Abideen1
...icylidene acylhydrazide, proteinase k, trypsin and chymotrypsin target bacterial virulence in Desulfovibrio spp. that causes bacteremia, periodontitis and abdominal infections. Ten soil samples were collected and screened by morphological and biochemical study. Only one strain DUV1 was confirmed by 16S rRNA gene sequencing as D. vulgaris (accession number: KY698020). It showed significantly reduced biofilm formation (52%; p<0.05) by test tube ...

Ali Mahmoud Zanaty, Naglaa Mohammed Hagag, Neveen Rabie, Mahmoud Saied, Karim Selim, Saad A. Mousa, Azhar Gaber Shalaby, Abdel-Sattar Arafa and Mohamed Khalifa Hassan 

...g for the partial fusion protein. Phylogenetic analysis revealed that 20 samples are genotyped as very virulent NDVclass II of genotype VIIb, 4 samples were of high identity (94%-100%) with NDV class II of genotype II (vaccine strain) and 1 sample was phylogenetically related to NDV class II of genotype I with 98% identity. Furthermore, the intracerebral pathogenicity index (ICPI) for selected 5 virulent viruses reveals velogenic features with high pathogenici...
Jingchen Chen, Zhaochao Deng and Zhiqiang Han*
... TAA, T or TA) in the 13 protein-coding genes are found. Except for tRNA-Ser(AGN), the second-structure of other tRNAs is the typical clover structure. The lengths of 12S rRNA and 16S rRNA are 945 and 1,698 bp (AP1, AP2) and 1,696 (AP3). A control region containing key sequence tags have three different domains, namely, terminating sequences (TAS1, TAS2), central conservatives (CSB-F, CSB-E and CSB-D) and conservative sequences (CSB1, CSB2 and CSB3)...

Zafar Abbas1*, Muhammad Mubashir1, Umair Riaz1, Zeenat Javid1, Muhammad Ashraf1, Saeed ur Rehman1, Muhammad Javid Qamar1, Syed Ali Zulqadar1 and Shahzada Munawar Mehdi2 

...45 g 3.2 g and 1.48 g of protein, fat, carbohydrates, fiber and sugar, respectively. As well as one gram of okra contain 31.3 mg and 299mg of vitamin K and potassium, respectively. Therefore, to examine the effect of different forms of fertilizers (organic and inorganic) on the yield and physiochemical attributes of okra Abelmoschus esculentus a field trial was conducted. For this purpose, organic form of fertilizers like kitchen waste, poultry manure and comp...

Muhammad Shafique, Nosheen Noor Elahi*, Muhammad Rashid, Amjad Farooq and Kausar Hussain Shah

...production, nitrogen and proteins percentage of four mung bean varieties under different NaCI levels in sand culture after 5,7 and 9 weeks of sowing. Both inoculated and uninoculated plants were grown on mineral medium that were N-free either without NaCI or with a range of NaCI (20, 50,100, 200 and 300mM). Dry weight of plants was increased at 0-50mM NaCl and decreased at 100-300mM NaCI concentration. Inoculation effectively increased the dry weights of plant...

Samina Qamer1, Farkhanda Asad1*, Amna Faiz1, Robina Arshad1, Zunaira Shaheen1 and Tahira Yasmin2 

...on for dry matter, crude protein and gross energy. While comparing organic and inorganic Cr efficiency in fish feed, it was concluded that organic chromium (picolinate) inclusion increased the nutrients digestibility and enhanced the nutrients deposition in body muscles of fish. 

...
Tian-Yi Zhao1, Zi-Qing Liu2, Bo Yang1, Qiao Gao1, Hong-Yu Zhang1, Pei-Yu He1, Ming-Hua Duan1* and Yu-Li Yan1*
...t5, Bcl-2, and Cyclin D1 protein expression in peripheral blood.The red blood cell count and hemoglobin levels decreased in 5-Fu group compared with the control group (P < 0.05). 5-Fu+APs group showed a marked increase in the number of erythrocytes and a significant increase in hemoglobin content (P < 0.05). Compared with the control group, 5-Fu group showed a significant decreased in the number of CD71/Ter119-labeled erythrocytes (P <...
Syed Makhdoom Hussain1*, Nisar Ahmad1, Azhar Rasul1, Muhammad Mudassar Shahzad2, Muhammad Latif3, Muhammad Zubair Ul Hassan Arsalan1, Muhammad Umair1  and Hafiza Hina Shafqat1
...ent digestibility (crude protein 71% and gross energy 69%) and hematological parameters (WBCs 7.87×103mm-3, RBCs 3.04 ×106mm-3 and Platelets 67) were observed in the fingerlings fed with test diet supplemented with 2 mg kg-1 nano Cr while crude fat digestibility (79%) was found maximum at test diet supplemented with 1.5 mg kg-1 of nano Cr which were significantly different from fish fed with control and o...
Unal Kilic1*, Abdiwali Mohamoud Abdi1 and Deniz Ekinci2
...locks. In terms of crude protein content, the highest CP was obtained from the urea+molasses treatment for wheat, sorghum and soybean straws, while control groups were found to have the lowest CP content. The lowest NDF, ADF and lignin contents were found in sorghum straws (P<0.001). The highest gas production value was obtained from sorghum straws for 24-hours incubation process (P<0.001). Treatments did not cause any effects on 24-hours gas production ...

Asad Ali Khaskheli1*, Gulfam Ali Mughal1, Gul Bahar Khaskheli2, Allah Jurio Khaskheli3, Arshad Ali Khaskheli4, Abdul Samad Magsi5, Ghulam Shabir Barham2, Arab Khan Lund5 and Maqbool Ahmed Jamali4 

...h concentration of crude protein. Further the Prosopis juliflora against Zea mays, in Acacia nilotica versus Alhagi maurorum, in Tamarix orientalis versus Trifolium alexandrinum, Tamarix gallica versus Cordia sinensis (Linn.) crude protein content existed statistically non-significant, but each of above set varied significantly to one another. Trifolium alexandrinum and Zea mays though had statistically similar concentration...
Riyadh S. Aljumaah1, Mutassim M. Abdelrahman1,*, Moez Ayadi1 and Abdullah H. Alyemni2
...ent levels of energy and protein viz. higher protein than recommended by National Research Council (1985; TMR1), and higher energy than National Research Council (1985; TMR2) compared with the traditional feeding system of barley and alfalfa hay; Control). A total of 96 Najdi ewes, about nine months old, were divided randomly into three dietary treatments two months before parturition (Late gestation). Lambing percentage, la...
Xiaopeng Tang1, Wen-qin Su1 and Re-jun Fang1,2,*
... treatment. The NaPi-IIb protein expression was determined by Western Blot, and the NaPi-IIb mRNA expression was determined by RT-PCR. The results showed that, compared with the control group, different levels of CT had no effect on cell proliferation, but it inhibited (P < 0.05) the absorption of phosphorus at CT concentration of 1×10-11, 1×10-10 mol/L and 1×10-9 mol/L. There was no effect of...
Constance Obiageli Ejilibe1, Helen O. Nwamba2, Ifeanyi Chinedu Atama3,*, Chiamaka Lynda Ani2, Ifeanyi Oscar Aguzie3, Josephine C. Madu3 and Christopher Didigwu Nwani3
...sphatase (ALP) and total protein (TP) concentrations in homogenized muscle samples was determined by standard procedures. ALT, AST and ALP increased significantly in response to concentrations of Butaforce® (7.00, 9.00 and 11.00 µgL-1) and Termex® (15.00, 20.00 and 25.00 µgL-1) used. The TP decreased in response to the same concentrations of pesticides. The response of these biochemical parameters...
Abd El-Nasser Ahmed Mohammed1,2,*
...lobin, glucose and total protein), oocyte quality after ovarian transplantation (cumlus enclosed, brilliant cresyl blue stain and diameter) and reproductive performances (litter size and weight) were determined and recorded. In addition, values of body temperature and blood glucose were determined after general anesthesia. The results indicated that N. sativa oil supplementation resulted in significant (P < 0.05) increase of RBCs, hematocrit, WBCs an...
Kun Wang1,2, Yinglin Cui2, Xu Zhao2 and Changjiang Hu1*
...NMT3b) and Matrix metalloproteinase-9 (MMP-9) was evaluated by western blot. And microRNA-29b was identified using quantitative real-time PCR. 3). Compared with the Model group, the group treated with XN had a significantly reduced number of dead neurons in hippocampus and cortical regions of ICH rats. Furthermore, this treatment significantly increased protein expression of claudin-5, ZO-1 and VE-cadherin while
Tanzeela Riaz1, Farah Rauf Shakoori2,*, Hareem Mansoor1, Sana Khan1 and Mushtaq A. Saleem1
...ure on soluble and total proteins, total lipids, glucose, glycogen, free amino acid and trehalose contents was also recorded. The results indicated that contents of glycogen, trehalose, total lipids, free amino acids, soluble proteins and total proteins were significantly deceased in both larval instars except the free amino acids that increased in 4th larval instar of both popu...
Gul Afshan1,2,*, Soumble Zulfiqar2, Sumaira Mehboob2, Muhammad Tahir Javed Khan1 and Abdul Rauf Shakoori2,*
...zing HCV3a envelope glycoprotein E2. HCV3a E2 gene was amplified and cloned first in cloning vector pTG19 and subcloned in expression vector pET21a. E2 protein, expressed in insoluble form, was purified by repeated sonications, followed by denaturation and refolding through fractional dialysis with urea. Multiple alignment with other sequences showed nucleotide variations of HCV3a E2 compared with already reported seq...
Tahir Iqbal1, Umer Rashid1*, Naveed Shahzad2, Amber Afroz1Muhammad Faheem Malik3 and Muhammad Idrees4

 

...domain (ORF1) and capsid protein (ORF2) revealed clustering of Pakistani aHEV (Pak aHEV) strains with members of Orthohepevirus B species. However, Pak aHEV strains were highly divergent from other known members within Orthohepevirus B suggesting as novel aHEV strains circulating in the population of layer chickens in the country. Detection of HEV in layer chickens may pose public health risk in context of zoonosis and food borne transmiss...

Abir Ishtiaq and Muhammad Naeem* 

...e the effects of dietary protein levels on growth and to elucidate the optimal dietary crude protein requirement for Catla catla (Thaila) in a polyculture system was conducted. Four experimental diets containing graded levels of protein (15, 20, 25 and 30%) were tested. Triplicate groups of C. catla stocked in outdoors earthen ponds at 2000 fish/acre were fed at 4% of body weight, 2 times ...
Zijuan Li1,2, Rong Ma2, Muhammad Khan3*, Chenchen Liu2, Xiaolin Cui2 and Yongming Li1,2*
...he expression of various proteins. The data demonstrated that piceatannol inhibited growth and induced G2/M phase arrest and apoptosis. Further studies showed that piceatannol induces mitochondrial apoptosis as shown by Bcl-2 family proteins modulation. Finally, piceatannol significantly enhanced apoptotic efficacy of CDDP in U2OS cells. On the basis of our findings, piceatannol is a promising anticancer agent which could be...
Huma Sattar1, Sehrish Firyal1,*, Ali Raza Awan1, Habib-Ur -Rehman2, Muhammad Sajid Hasni3 and Amjad Islam Aqib4*
...nge in the folding of 3D protein structure of clinical sample, while in subclinical samples, showing the same variation in overall 3D protein structure analysis of TNF-α gene. The association between polymorphism identified within the TNF-α gene with mastitis reported in this study revealed that SNPs has potential to serve as a molecular marker for screening of mastitis resistant and susceptible Sah...
Laiba Shafique1,*, Muhammad Afzal2, Syed Zakir Hussain Shah3, Mahroze Fatima4, Huma Naz5, Saif ur Rehman1, Youchuan Wei1 and Qingyou Liu1,*
...sub> increased the crude protein, ash and decreased the fat contents in muscles while same result was observed by supplementation of formic acid. In conclusion, dietary formic acid and vitamin D3 improves the growth performance and muscle proximate analysis for the C. idella fingerlings.
...
Muhammad Suleman1,*, Abu ul Hassan Faiz2, Muhammad Shahbaz2 and Ayesha Riaz3
...2 KDa by SDS-PAGE. Total protein present in crude enzyme was calculated as 188 mg/ml. Crude xylanase showed specific activity of 41.22 IU/mg protein. Partially purified xylanase showed protein content of 80.6 mg/ml. The novelty of this study is basic sources used are indigenous and cheap for production of xylanase.
...
Lin Qi, Lu Li, Danyang Chen, Mingxiao Liu, Yan Wu and Wei Hu*
...dman degradation using a protein/peptide sequencer. The antibacterial activity of the protein monomer in antlerplate was studied by disc diffusion method, and the antibacterial ring diameter of each antibacterial agent was measured to determine its antibacterial ability. The molecular mass and purity of this polypeptide was 18.970kDa and 90%. Amino acid sequence analyses indicated that the N-terminal amino-acid sequence of t...
Jinfeng Liu1,2, Yanhong Cao3, Tong Feng1, Laiba Shafique1, Chan Luo1, Peng Zhu1,4,* and Qingyou Liu1,*
...y exhibited BMP15 protein was located in germ cells of testis, in primordial granulosa cells, primary, secondary, and antral follicles of ovary, and none in theca cells. The more conspicuous reaction for BMP15 was observed in germ cells than cumulus cells and granulosa cells, particularly in primordial germ cells of genital ridge or in foetus ovary of buffalo. The expression pattern of BMP15 suggested that it may play a key role in the for...
Sabbah M. Allam, T.M. El-Bedawy, M.H. Bakr and A.E.M. Mahmoud*
...DN) and digestible crude protein, showed that there were insignificant (P>0.05) differences between cows fed R2, R3 and R4 compared with those fed R1 (control), except digestibility of nitrogen free extract which was significantly (P≤0.05) decreased by feeding experimental rations by increasing replacement level of DOP to more than 25% (R2). Blood constituents of experimental cows on all rations were within normal range for platelets, red blood cells (RB...
Abdulkareem Mohamed Matar1, Moez Ayadi1,2, Hassen Mohamed Sbihi3*, Imeddine Arbi Nehdi3, Mutassim Mohammad Abdelrahman1 and Riyadh Saleh Aljumaah1
...> (6.40%); however, milk protein percentage was higher in the milk of ewes fed CF1 (4.29%) and CF3 (4.64%) compared to TF (3.78%) and CF2 (3.57%). Total (C12:0 + C14:0 + C16:0) saturated fatty acids were significantly lower in milk fat from ewes fed TF (45.67%) and CF1 (42.13%) compared to CF3 (53.65%) and CF2 (49.67%). Linoleic acid (C18:2∆9c,12c; n-6) was significantly higher in milk fat fro...

 Li-na Li1, Sheng Li2, Ping Gui3, Jing-hui Li1, Fen Ai4,* and Li-li Cai1,*

...γ at both mRNA and protein levels. Furthermore, we found that MSCCM inhibited the activation of NF-κB signaling pathway induced by irradiation as well. Our data suggest that MSCCM could reduce irradiation-induced TGF-β1 production and ameliorate collagen deposition by inhibiting NF-κB signaling pathway. Our present study provides new insights into the treatment effect of uMSCs in radiation pulmonary fibrosis.
...
Muhammad Usman Akhtar1,2, Abdul Qayum3, Anshan Shan1,*, Shuli Chou1, Hyeonsoo Jo4, Syed Waqas Ali Shah4 and Ishfaq Muhammad5
...0 and 70% RDP of dietary protein represented as 30RDP, 40RDP, 50RDP, 60RDP and 70RDP, respectively. Feed intake was recorded, nutrient digestibilities (DM, CP, ADF and NDF) were determined and blood samples were taken at 3, 6, 9 and 12 h post feeding, and examined for BUN. In addition, milk produced by each goat was recorded. The results showed that increasing RDP level in the diet has a linear effect (dose-dependently) on nutrient digestibilites, nutrient int...
Ping Jiang1 , Zhihui Zhao1, 2, Xiaohui Li2, Mengyan Wang2, Lixin Xia2, Yang Cao3, Runjun Yang2 and Xibi Fang2*
... 1 (ABCA1) is a membrane protein. As a member of the superfamily of ABC transporters, ABCA1 can transport lipids and cholesterol across cell membranes. To further verify the relationship between the ABCA1 gene and milk fat metabolism of Chinese Holstein dairy cows, we exploited transient transfection mediated-RNA interference technology to specifically knockdown expression levels of the endogenous gene ABCA1 in bovine mammary epithelial cells (BMECs) to analys...
Qi Ren, Shufeng Sun, Chen Niu, Yuhong Li, Yingzhi Chong, Biao Li, Guoying Zheng and Fumin Feng*

 

...then the CYP1A1 mRNA and protein expression decreased with cell damage, thus suggesting that elevated methylation of the promoter region of the CYP1A1 gene may affect its expression and could be associated with cell damage. After treatment of the cells with AZA, increases in methylation rate and DNMTs expression were reduced, CYP1A1 mRNA and protein levels increased, and cell damage was ameliorated; these results indicate th...
Yating Cheng1, Wenlong Shi1, Xue Xiao2, Qirong Zhang2, Qihao Zhang1, Zhijian Su1, Qi Xiang1,2* and Yadong Huang1,2
...one of the most abundant proteins in humans and plays an essential role in cell maintenance and organization. Collagen has a unique triple-helix structure composed of three polypeptides, and hydroxylation of proline residues is vital for the stability of this triple-helix. Prolyl-4-hydroxylase (P4H) is an enzyme with an α2β2 tetramer arrangement that functions to post-translationally hydroxylate proline residues in the collagen chain. The α su...
Wiqar Ahmad1*, Farmanullah Khan2, Muhammad Sharif2 and Muhammad Jamal Khan2
...tistically similar crude protein content. Compared to the control, INM significantly (p<0.05) improved the wheat and lentil yield by 128 and 87%, respectively, and the crude protein by 17%. Yield improved by 13% for wheat in intercrop over the wheat after maize and by 46% for lentil after maize over the lentil in intercrop. The INM treatment showed 94% higher OM, 10% reduced bulk density (ρb) and 12, 20 and...
Sajida Sabahat1, Asif Nadeem1,*, Maryam Javed1, Muhammad Yasir Zahoor1, Abu Saeed Hashmi1, Ghulam Yasein2 and Ghulam Abbas1 
...egulation. IGF-1 control protein metabolism and is extremely conserved region amongst species. IGF-1 have not been studied before in camel. The DNA samples of Marecha camel were collected from the Camel Breeding and Research Station at Rakhmani Bhakkar, Pakistan. Four polymorphic sites were detected in the IGF-1 gene. A significant finding was the occurrence of a T→C polymorphism in exon 5 that causes a substitution of an amino acid from Cysteine t...
Memis Ozdemir
...d the expression of milk protein genes. It has been seen many studies about Prl/RsaI polymorphism found in the exon 3 or exon 4 region of bovine prolactin gene in the literature. The aim of this study was to determine whether the DNA sequence of the Prl gene exon 3 or exon 4 in cattle breeds has the RsaI polymorphic digestion site. As a result of the study, it has been seen that the Prl/RsaI specificpolymorphic site is on exo...

Aamir Saleem1, Arshad Mahmood Malik2*, Najam Ul Hassan1 and Imtiaz A. Qamar

...and dry weight and crude protein) and meteorological data regarding rain fall, temperature, pan evaporation, sunshine and wind speed for interpreting results along with their statistical analysis as fixing legume with grass has improved the forage quality. Overall, these results has suggested that grass-legume mixtures can improve livestock and pasture productivity, sustainability and as well as to fix atmospheric nitrogen and this may improve soil N status al...

Muhammad Naeem Khan* and Asad Jan 

...usmn;0.83 %) followed by protein (30.26±0.72 %) while crude fibers were found least in amount (1.43±0.53 %). Among different minerals, reasonable amount of calcium (3268±0.53 μg/g), potassium (2873±0.71 μg/g), sodium (591±0.23 μg/g) and iron (223 ± 0.46 μg/g) were found while no cadmium and chromium was detected. MCE and EAF displayed considerable antibacterial activity against Xanthomonas campestris and Ps...
Ali Mujtaba Shah1,2,3, Ali Raza Shah3, Muhammad Farooque Hassan2, Muhammad Yousif2, Zhisheng Wang1*
...ostrum, i.e. fat, protein, immunoglobulin, lactose, oligosaccharide, vitamins, minerals, growth factors and nucleotides and its benefits to health of animals.
...
Hafiz Muhammad Tahir*, Palwasha Jabeen, Chand Raza, Shaukat Ali
...h other. Spidroin is the protein found in spider silk while silkworm silk is made up of an inner core of fibroin and outer layer of sericin protein. After the removal of sericin, silk is non-immunogenic and non-allergic. It is a renowned biomaterial due to its biocompatible nature. Silk proteins have been found to possess antibacterial properties and application in culturing tissues includ...
Mehwish Faheem1*, Maleeha Rafeeq1, Aisha Majeed1 and Saba Khaliq2
...yp1a1 and heat shock proteins mRNA level was evaluated using real time qPCR. Results revealed that exposure to bisphenol A caused decrease expression of cyp1a1 in a concentration dependent manner. Exposure to graded concentrations of bisphenol-A resulted in significant increase in mRNA expression of heat shock proteins (hsp70 and hsp90). In the light of present results, expression of cyp1a1 or...
Peng Chen1,2, Zuhao Huang3,Chaoying Zhu1, Yuqing Han1, Zhifeng Xu1
Guanglong Sun1, Zhen Zhang1, Dongqin Zhao4, Gang Ge1 and Luzhang Ruan1*
... GC. The start codons in protein-coding genes (PCGs) included ATG, GTG, ATT, ATC and ATA, while its stop codons included TAA, TAG, AGG, AGA and the incomplete cipher T. In PCGs, the highest frequency of codon was CTA (Leu). The highest frequency of amino acids was Leu, whereas the lowest was Cys. In phylogenetic analyses, Gruiformes included Grui and Ralli, and Charadriformes included Charadrii, Lari and Scolopaci. The genus Porzana was closest to Po...
 

Aftab Shaukat1,2,*, Tauseef ur Rehman3, Rizwan Shukat4, Shahid Ali Rajput5, 

Shadab Shaukat6, Muhammad Ahsan Naeem2,5,8, Mubashar Hassan2,5, Tabassam Fatima2,5
Fayyaz Ahmad1, Muhammad Usman Saleem7, Fatima Arooj1, Ashar Mehfooz2 and Anas Sarwar Qureshi2
...0 g and 500 g with crude protein 17.5 % and metabolizable energy 2.9 Mcal/kg was offered to does for one month prior and post breeding season (15 September-30 October). Does were weighed at the start of breeding season T2 (BW=29.18±0.21kg) and T1 (BW=28.93±0.53kg), respectively. All the does were sent for grazing of jantar fodder for four hours daily and were sheltered during the rest time in different pens with separate fee...
Jam Nazeer Ahmad1,2*,Mujahid Manzoor1, Zubair Aslamand  Samina Jam Nazeer Ahmad1, 2
...P450 gene and associated protein in dsRNA treated population. The application of ds RNA specific for CYP450 also reduced insecticide resistance in R. ferruginous. The developmental parameters were highly affected in RPW treated with dsRNA as compared to control samples treated with water or dsGFP. These results support the RNAi application as a suitable tool for the management of insecticide resistance and control of R. ferruginous.
...
Sumaira Abbas1, Muhammad Sultan Haider2,*, Fatima Kafayet1, Sana Ashraf2, Atifa Masood3 and Moazma Batool4
...s nitrogenous diets (30% protein) were offered to Carassius auratus juvenile having body weight 20±7.54g in powder form for 92 days. Weight gain, length gain and FCR were calculated fortnightly. At completion of feeding trial, color intensity and pigment concentration was measured in Carassius auratus skin. Statistical analysis of results showed non-significant differences (P<0.05) among all treatments in weight gain and FCR. Maximum co...
Hüseyin Erdem* and Ibrahim Cihangir Okuyucu
...fat dry matter (NDM) and protein percentages were measured for colostrum produced at 2, 24, 48 and 72 h after birth. The specific gravity of colostrum (colostrum quality) was determined using a colostrometer. The effects of DPL, ADMY, parity and calving season on the specific gravity of colostrum (colostrum quality) were found to be significant at the 2nd h after birth. Colostrum quality of cows with ADMY low (Group 1) and high (Group 2) were found ...
Nazir Ahmad Khan1,*, Mudassir Alam1, Rafiullah khan1, Kamran Khan2 and Sadeeq ur Rahman3
...ility.
...
Asima Rani1,*, Syed Kashif Nawaz2 and Muhammad Arshad3
...omain-containing-adaptor-protein gene in malaria susceptibility and clinical outcomes upon P. falciparum and P. vivax exposure. Blood samples of 228 malaria patients and 226 healthy controls were selected from the local population. Malarial samples were divided in to complicated malaria (N=89) and mild malaria (N=139) groups according to WHO criteria. Malarial groups were further divided into P. vivax and P. falciparum groups based ...

Awais Ahmed Khan1*, Zafar Iqbal1 and Muhammad Atiq2 

...OD activity (8.4 U/min g protein), SOD (6.96 U/ min g protein) and TPC (3.21 mg GAE/ 100g of sample) as compared to control where POD (1.13 U/min g protein), SOD (1.46 U/ min g protein), and TPC (1.14 mg GAE/ 100g of sample). Amount of hydrogen peroxide (H2O2), the signaling molecule was also significantly increased (30.33 mmol/ mg FW) and catalase (CAT)...
Huanxin Zhang1,2, Hongshuo Tang3, Jun Chen1, Yu Zang1,2, Xuexi Tang1,2,* and Ying Wang1,2,*
...e evolutionary conserved protein and have contributed to the understanding of the host defense processes against infection. Researches have been performed on the evolution in many species, but the evolutionary characteristics of African hunting dog TLR genes are scared. The available genome sequence of African hunting dog offers us the way to examine the innate immunity of this endangered carnivore. 10 TLR genes (TLR1-10) were initially identified from the Afr...
Bibi Nazia Murtaza1, Mazhar Saeed Chaudry2, Shamaila Inayat Nadeem1, Muhammad Shahid Nadeem3 and Abdul Rauf Shakoori4,*
...cascade activation. PTEN protein is involved in the negative regulation of PI3K pathway. Mutations in upstream kinases, growth factor receptors or intrinsic members of cascades can lead to induce or promote cancers. Number of somatic mutations in several genes, majority of which are involved in chromatin modification and transcriptional regulation, have been reported in NHL. G468R and G468A mutations in BRAF gene have been reported in NHL, BRAF is a mem...
Muhammad Muneeb1, Muhammad Ayub1, Sher Bahadar Khan2,*, Amjad Sohail1, Farkhanda Jabeen1, Mumtaz Ali Khan3, Amjad Khan4, Kashif Prince3, Asghar Khan5 and Irshad Ahmad6
...gar (17.92%) and maximum protein content was found in samples taken from Warsak Road (25.40%) followed by Hashnagri (24.24%). In sensory analysis the maximum mean score of judges for color, Flavor, Texture and overall acceptability were observed in Board Bazaar (7.97) followed by University Town (7.89) and the minimum values were given to the samples taken from Hashtnagri (7.57). Hence it was concluded that the samples taken from Hashtnagri and Chowk Yadgaar w...
Hafrijal Syandri1*, Ainul Mardiah2, Azrita3 and Netti Aryani4

 

...eed containing 29% crude protein and gross energy of 3,340.50 kkal/kg of feed and cultured for 90 days. The physicochemical parameters of water were always at satisfactory levels for fish culture throughout the experiments except for NH3-N (0.05 mg/L) and NO2-N (0.02 mg/L): water temperatures ranged from 27.5 to 30.5 °C, DO 4.3 to 5.6 mg/L, pH 6.56 to 6.96, alkalinity 50.65 to 52.25 mg/L, and hardness 6.65 to 66.85 mg/L. Survival was...
Sajida Rasool1, Saba Irshad1*, Neelam Saba1, Mehak Fiaz1Muhammad Sajid Hussain2, MuhammadWajid Hussain3 and Peter Nürnberg2

 

...ion. BICD2 is an adaptor protein which regulates the cellular trafficking of cargo molecules crucial for motor neuron growth and maturation. In present study, a Pakistani family of HSP penetrating in autosomal recessive pattern was ascertained. Patients presented spasticity and stiffness of upper and lower limbs, severe microcephaly, dysphagia, no speech, hearing loss and seizures. Genome wide linkage analysis and whole exome sequencing revealed a novel homozy...
Doulat Khan1, Hamayun Khan1, Nazir Ahmad2, Muhammad Tarique Tunio3, Muhammad Tahir2, Muhammad Saleem Khan2 and Rifat Ullah Khan1*
...regnancy Associated Glycoproteins (PAGs) in peripheral blood for early pregnancy identification in cattle, buffalo, goats and sheep. A total of 120 blood were taken from jugular vein of different breeds of cattle (Achai, Achai x Jersey, Holstein Friesian and Jersey), buffalo (Nilli Ravi, Aza Kheli and non-descript), goats (Beetal, Teddy and non-descript) and sheep (Bulkhi, Karri and non-descript). In cattle, the average sensitivity, specificity, false pregnanc...
Anam Tariq, Alina Gul, Majida Atta Muhammad, Samia Falak and Naeem Rashid*
...roduction of recombinant protein in the cytoplasm which secreted gradually to the extracellular culture medium. Determination of the N-terminal amino acid sequence of the recombinant protein, in the extracellular medium, revealed that the 19 amino acid signal peptide was cleaved between Ala19 and Gly20. It seems probable that the signal peptide of TK0522 can be used for secretion of other recombinant
Tong Feng, Zilu Zhang, Minghao Qu, Chan Luo, Laiba Shafique, Qingyou Liu and Kuiqing Cui*
...t species. The goat MC1R protein has a molecular mass of 34.65 ku, an isoelectric point of 8.70, which is weakly alkaline, and contains seven transmembrane domains typical of cell membrane receptor proteins. Sequencing analysis of the black, brown and white different color MC1R genes of Nubian goats revealed that there are three SNPs in the gene sequence, which are 219, 712 and 1160, respectively. The C/T mutation did not ca...

Anand Kushwaha, Amit Kumar, Aparna Madhavan, Durga Goswami, Golmei Poulinlu and Gnanavel Venkatesan* 

...e available, recombinant protein based diagnostic assays namely ELISA is safer and robust to handle large sample size and also to minimize labor/time. However, the genus Capripoxvirus encodes putative 147 proteins in their genome, among which some of them are reported as potential immunogenic candidate genes. Selection and use of such candidate immunogenic proteins from an array of genes l...

Nosheen Noor Elahi1, Muhammad Shafique1, Muhammad Imtiaz2, Umer Farooq3* and Muhammad Rashid1 

... having high quantity of proteins. In the present study, four varieties (CM44, CM91, CM98 and CM2000) were grown in the presence and absence of PGPR inoculated media and nitrogen in different salinity levels (20, 50, 100, 200 and 300mM NaCl). The biomass production of the varieties CM91 and CM98 increased at 20-100mM NaCl concentrations but drastically decreased at higher levels. While in varieties CM44 and CM2000 a gradual decrease of biomass with increasing ...
Saara Ahmad1,*, Iftikhar Ahmed2, Saida Haider3, Zehra Batool4, Laraib Liaquat3, Fatima Ahmed5, Asra Khan1, Tahira Perveen3, Mirza Jawad ul Hasnain6, Saima Khaliq7 and Saad Bilal Ahmed8
...F-α) and alpha-fetoprotein (AFP) were estimated before and after the administration of different meals. After the experiment, the liver samples were weighed and histopathologically evaluated using a knodell score to assess portal hypertension and liver damage. Animals fed with commercial chicken meat and feed for six weeks showed development of inflammation, necrosis, apoptosis and cirrhosis on histopathological examination of the liver, and had raised p...
Muhammad Afzal1, Mahroze Fatima2, Aasma Qamar1, Muhammad Farhan1 and Syed Zakir Hussain Shah3,*
...t;0.05) dry mater, crude protein, crude fat, and crude ash contents in the muscles and whole body of juveniles in response to CA and PHY supplementations were observed. Again, dietary acidification with CA also improved (p<0.05) the whole-body mineralization. Moreover, PHY pretreatment also resulted in higher (p<0.05) mineral deposition in the body as compared to control group. Both supplements interacted positively (p<0.05) to en...
Peng Peng1,3, Xiaopeng Tang2*, Dun Deng3, and Rejun Fang1*
... of GM as an alternative protein resource in meat duck diets. Firstly, the chemical composition, dry matter (DM) digestibility, metabolic energy (ME) were determined. Secondly, a total of four hundred eighty 15-day-old Shuanggui-tou meat ducks were divided into 4 treatments, 1) Control group (0% GM in the diet), 2) 3% GM group (3% GM in the diet), 3) 6% GM group (6% GM in the diet), and 4) 9% GM group (9% GM in the diet). All groups had 8 replicates and 1...
Tian-Yi Zhao1, Zi-Qing Liu2, Shu-Fei Ma3, Bo-Yang1, Fan-Fan Guo1 and Ming-Hua Duan1*

 

... changes of amyloid beta protein (Aβ)-induced AD. In vitro assays (MTT and flow cytometry) were applied to detect the effect of biatractylolide on PC12 cell proliferation, growth inhibition rate and apoptosis. In order to assess the spatial learning and memory abilities of AD rats, Morris water maze model was applied in vivo, and the activity of the NF-κB signaling pathway and concentrations of TNF-α, IL-6, and IL-1β were measured. The re...
Derya Kocamaz* and Elif Oruc
...), glutathione (GSH) and protein carbonil (PCO) increased in comparison to the control. After the recovery period, EROD, GST, malondialdehyde, estradiol/testosterone levels were found to be lower than the control. In the pesticide mixture group, the activity of antioxidant enzymes was highest and the level of hormones was lowered. The group of the mixture pesticide showed the highest lipid peroxidation and protein carbonylat...
Asim Faraz1,*, Abdul Waheed1, Riaz Hussain Mirza1, Muhammad Shahid Nabeel2 and Hafiz Muhammad Ishaq1
... gross composition (fat, protein, lactose, SNF and total solids percentages being 4.26, 3.62, 4.84, 9.02 and 13.28, respectively), Barela milk appears particularly rich compared to literature data. A long term monitoring, notably throughout the lactation, could be a good opportunity to assess the potential of this breed at national level.
...
Saeed Murtaza1, Abdul Sattar1*, Nasim Ahmad1, Muhammad Ijaz2Maqsood Akhtar3 and Muhammad Shahzad4
...results showed that fat, protein, lactose, freezing point, SNF and solids were significantly higher (P<0.05) in group-2 and group-3 as compared to group-1 except density and pH which remained non-significant (P>0.05) in all groups. On the basis of result, it may be concluded that oxytocin had no effect on uterine involution and progesterone; however, it had some role to affect the normal composition of milk in postpartum involution interval.
...

Asmaa A. Darwish 

... 0.05) increase in total protein, globulin, liver enzymatic activities, kidney function tests, total lipids, triglycerides, MMP-2 and MMP-9 concentrations was depicted in the three diseased groups. On the contrary, the total cholesterol, HDL-cholesterol, LDL-cholesterol, minerals, electrolytes, trace elements and total antioxidants capacity concentrations significantly (P< 0.05) decreased in the three diseased groups. Both of MMP-2 and MMP-9 yielded a sensi...

Shazia Mansoor1, Muhammad Sohail2*, Saima Aslam3 and Muhammad Nauman ul Islam4 

Mehtap Bayir*
...ative fugu Sod1 and Sod2 proteins and their orthologs from teleost fish and tetrapods. Phylogenetic clustering was seen between sod genes in fugu and their orthologs. Finally, highly conserved gene synteny was determined between fugu sod genes and their orthologs from teleost fish and human.
...
Boxin Dou, Ying Liu*, Yumeng Liu, Lili Fan, Yongqiang Ma, and Yanguo Shi
...c hydrolysis of RB crude protein purified by ultrafiltration, size exclusion chromatography and RP-HPLC. Using consecutive chromatographic techniques successively, the acidic hydrolysates of RB proteins were fractionated and the new ACE inhibitory triplet was isolated and identified. The amino acid sequence of the ACEI was identified as Ile-Thr-Leu or Leu-Thr-Ile. In vitro, ACE inhibition assays showed that the IC
Asad Ali Khaskheli1*, Gulfam Ali Mughal1, Muhammad Ibrahim Khaskheli2, Gul Bahar Khaskheli3, Allah Jurio Khaskheli2 and Arshad Ali Khaskheli1
...h), ether extract, crude protein, crude fiber, nitrogen free extract and total carbohydrate contents) were included. Comprehensive survey indicated year round availability of 19 different vegetations at study areas whereby dry matter contents in Calligonum polygonoides (93.63%) recorded significantly high, and in Trifolium alexandrinum it was low, while moisture content appeared vice versa to dry matter. Organic matter contents in Senegalia se...
Housh Muhammad Solangi1, Javaid Ali Gadahi1*, Mansoor Tariq2, Bachal Bhutto1Zubair Ahmed Laghari1, Jamila Soomro3, Taufeeq Ahhmed Khosa1 and Abdullah G Arijo1
...i>H. contortus crude proteins (HcCP). Protein profile of HcCP was checked by SDS PAGE and immunogenic proteins were recognized by the antisera produced by using the HcCP as antigen. Infective stage of the H. contortus (L3) was used for the challenge infection. Protein band pattern ranging from 10 to 170 kDa was observed and
Seval Dernekbasi* and Emin Karatas
...0.05). The highest crude protein, lipid and ash contents were determined in the FO/SFO group (p>0.05). Experimental diets containing vegetable oil (CO and SFO) and vegetable oil blend (CSFO) had significantly higher concentrations of n-6 fatty acids, predominantly in the form of linoleic (LA, 18:2n-6c) and oleic acid (OA, 18:1n-9c), while n-3 fatty acids were present in significantly higher concentrations in the FO group. The fatty acid composition of rainb...
Savas Atasever*, Ali Vaiz Garipoglu and Huseyin Erdem
...lk composition (fat (F), protein (P), lactose (L)), density (D), freezing point (FP), somatic cell count (SCC) and daily milk yield (DMY) according to the different feeding applications (grazing (G), silage usage (S), compound feed usage (C), number of milking cow (NMC), calf suckling period (CSP)). Average F (3.144±1.931%), P (3.022±0.448%), L (4.475±0.669%) and logSCC (5.386±0.529) values were within acceptable ranges. The present...
Larysa Kladnytska1, Anatoliy Mazurkevych1, Natalia Bezdieniezhnykh2Oleg Melnyc1, Sergiy Velychko3, Mykola Malyuk1, Vasyl Danilov1Yuriy Kharkevych1 and Magdalena Gryzinska4*
...cytoplasmic and membrane proteins on dog stem cells from fat tissue at the IVth and Xth passages was examined by immunohistochemical method using monoclonal antibodies. Determination the index of proliferationdogs adipose-derived stem cells (DADSCs) on IVth and Xth passages. Established that DADSCs contains multipotent stem cells, that are characterized by an almost homogenous fibroblast-like cells оn the IVth<...
Jing Zhang1,2, Xin Wang2, Yun Zhao2, Yongcheng Jin2, Yongfeng Zhou2, Junmei Wang2, Yurong Fu2, Rui Wang2, Ruihua Li2, Hengtong Fang2 and Hao Yu2,*
...generating islet-derived protein 3 gamma (Reg3γ), and tumor necrosis factor (TNF) were significantly downregulated. The mRNA expression levels of mucosal β-defensin, regenerating islet-derived protein 3 alpha (Reg3a), regenerating islet-derived protein 3 beta (Reg3β) and secretory immunoglobulin A (sIgA) levels were significantly increased. The interleukin-1beta (IL-1β...
Qaisra Siddique1, Sajid Abdullah1, Huma Naz2*, Khalid Abbas1, Laiba Shafique3

 

... (GST) activityand total protein contents (TPCs) in tissues viz. brain, gills, kidney, heart, muscle and liver of Labeo rohita kept under sub-lethal dose (4.13 µgL-1) of chlorpyrifos. Fish was kept under chlorpyrifos stress for two months and samples were collected on weekly basis. It was noted that GST level varied significantly with duration. The GST level was raised in first 28 days after that it was dropped off up to 56-day. The tre...
Waqas Ahmad Shams1*, Gauhar Rehman1, Khurshaid Khan1, Ibrar Ahmad1, Saima Bibi1, Saif Ul Islam2, Dawood Safi1, Saba Gul Ayaz1
...sh water is a source for proteins having immense importance and its use as a food is not hidden from anyone. Its use by the traditional healers and animal therapists as a healthy calcium supplement and in healing of other injuries is also proven. In the present study, the diversity and abundance of crabs from Buner district of Khyber Pakhtunkhwa Pakistan were looked over, over a period of three years extending from June 2013 till June 2016, collected at differ...
Masroor Ellahi Babar*
...n the expression of milk protein. It stabilizes the milk micelle and gene 5’ flanking region which works valuably in transcription regulation. Current study illustrates that Kappa-casein gene 5︠ flanking region in Dromedary camel of Pakistan is highly polymorphic and it is phylogeneticaly linked with other mammals. The analyses of the sequence of 5︠ flanking region in various breeds reveals the presence of different polymorphic regions includes cyste...

Jie Yang

...stern blot, the mRNA and protein expression were detected, respectively. Cellular apoptosis were examined by flow cytometry and Western blots was applied to assess the cleaved caspase-3, -8, -9, and cleaved poly-ADP-ribose polymerase. Protein expression of extracellular-regulated kinase were detected. Finally, data analysed statistically to determine significantly differences among groups. Results showed that breakpoint clus...

Asad Ullah1*, Umar Sadique2, Sultan Ayaz1, Muhammad Subhan Qureshi2 and Farhan Anwar Khan

...om already PPD (purified protein derivatives) tested lactating animals aseptically. The data obtained were finally analyzed statistically using chi squared test. The Mycobacterium was identified through ZN staining, culture and PCR. Out of 1608 milk samples, 60 (3.73%) were found positive for acid fast bacteria through ZN staining whereas the prevalence of Mycobacterium bovis was confirmed in 65 (4.04%) and 85 (5.29%) isolates through culture and PCR respectiv...
Asim Faraz1*, Abdul Waheed1, Annamaria Passantino2, Ayman Balla Mustafa3, Nasir Ali Tauqir4, Naeem Ullah Khan5, Muhammad Shahid Nabeel6
...ric diets with different protein levels as 18% (G1) and 22% (G2). Regarding roughage proportion lucerne and gram crop residues were fed. Daily feeding allowance was offered as 3% body weight. Water was provided twice a day. In blood-biochemical analyses, level of Hb (hemoglobin) concentration (P<0.05) was found to be significantly different as 16.4±0.14 and 16.8±0.09 (g/dL) with G1 and G2, respectively. The concentration levels of cholesterol,...
Asim Faraz1*, Abdul Waheed1, Muhammad Mudasser Nazir2, Aneela Hameed3, Nasir Ali Tauqir4, Riaz Hussain Mirza1, Hafiz Muhammad Ishaq1, Rana Muhammad Bilal5
...k composition especially protein, fat, lactose and mineral concentration are influenced by exogenous OT administration. It affects the cell maintenance and mammary metabolism along with its proven physiological role in the milk ejection reflex. OT effects are not manifested through effects on cell remodeling. Observed effects of OT administration on reproductive anomalies are anestrous, the development of corpus-luteum cysts, follicular ovarian cysts, delayed ...

Saira Bano, Muhammad Naeem* and Samrah Masud 

...) fed at different crude protein (CP) levels ratios i.e., 15%, 20% and 25% CP. Fish were first collected, acclimatized, kept in triplicate aquaria under controlled conditions in three groups (T1, T2 and T3) and then 5 fish were selected from each treatment at the end of 12 weeks of feeding trial from January to April, 2018, during which fish were fed at the rate of 4% of their body weight. The blood variants were studied like Lymphocytes (LYM), Monocytes (MON)...

Anila Kousar, Muhammad Naeem* and Samrah Masud 

...uence of three different protein diets (T1=15%, T2 = 20% and T3 = 25% crude protein) on the proximate composition of Genetically Improved Farmed Tilapia (GIFT). It is a developed strain of Nile tilapia (Oreochromis niloticus). In the whole wet body weight of GIFT, the mean percentages for water, fat, ash, protein and organic content were observed as 79.13, 3.74, 2.75, 14.43 and 18.12 (T1,1...

Rabia Iqbal, Muhammad Naeem*, Samrah Masud and Abir Ishtiaq 

...ing them at three graded protein feeds (15%CP, 20%CP, 25%CP). Eighteen days old fry of hybrid (L. rohita ♀ and C. catla ♂) of 0.12±0.08 average weight(g) and length(cm) 1.63±0.21 were acclimatized and shifted in hapas (8x6x3 ft.), fed at the rate of 5% of their wet body weight. Ten samples from each hapa were randomly selected at the end of three months (90 days trial) for body composition analysis. Mean percent water, ash, fat and
Daniel Masood1, Noor Khan1*, Khalid Javed Iqbal2, Sadaf Dogar1, Abdul Hanan1, Sadia Nazir1, Sheeza Bano1, Azra Anwar2, Sameul A.M. Martin3  and Chris J. Secombes3
...heaper alternative plant protein moringa meal (Moringa oleifera) on growth and body composition of Labeo rohita fingerlings. L. rohita (average weight 190.25±00g) were stocked randomly in glass aquaria for a 90 day feeding trial. Fish were fed twice daily with four different iso-nitrogenous diets at a feeding level of 3% of total biomass. The diets contained 26% crude protein in which moringa meal...
Yan Xu1, Jia Zhou1, Guangfu Lv2, Yuexin Liu1, Xintong Zhao1, Xin Li1, Doudan Ye2, Xiaobo Qu1,* and Xiaowei Huang1*
...nd Bcl-2 expression. The protein levels of TGF-β/ Smad / ERK signaling pathway were detected by Western blot. We found that PAP significantly increased cell viability after DOX-induced injury, reduced LDH, CK-MB levels, up-regulated Bcl-2 expression and down-regulated Bax expression levels. In addition, PAP can delay cell G2/M phase arrest, reduce apoptosis, significantly reduce TGF-β1 protein levels and...
Ke Zhang1, Shuai Liu2, Qiu Chen1, Yu Wang1, Li Liu1, Bingjie Li1, Kai Ma1, Xiaoya Wei1, Aijun Li3 and Junyan Li2*
...were selected to prepare protein samples. Some of them were used for 2-DE, and the others were used to immunize mice to collect tick antiserum for WB. Then, 2-DE followed by WB and MALDI-TOF was carried out to screen and identify tick antigens. We identified 19 protein spots representing 12 ORFs: 4 from ticks and 8 from cattle. Among the the 4 ORFs, Tropomyosin, Elongation factor 1-alpha (EF-1α) and
Ambrin1*, Ghulam Dastagir1, Jehan Bakht2 and Muhammad Adil1
...o acids, reducing sugar, proteins, triterpenoids, gums and mucilages, fats, steroids, phenols and phytosterol.
...
Hui-Ying Chen1,2*, Ping-Chuan Yin1,2, Ya-Nan Lu1,2, Hai-Yun Li1,2*and Yang Shan3
...nalysis. Additionally, a protein-protein interaction network (PPI) was constructed and block analysis was performed using STRING and Cytoscape databases. A total of 248 genes were identified, of which 84 were downregulated and 164 were upregulated. Functional and pathway enrichment analyses indicated that upregulated genes were significantly involved in pyrimidine metabolism, glyoxylic acid metabolism and dicarboxylic acid m...
Yuhong Li1, Dongxue Wu1, Xue Wang1, Mi Zhang1, Hanyu Zhu1, Zhe Shi1 and Fumin Feng1,2*
...line group, the mRNA and protein levels of NF-κB and TNF-α in the H group showed an increasing trend, and p-NF-κB and p-IκB also showed an increasing trend. However, these indicators increased first and then slightly decreased in the R, Z and HRZ groups. Among them, the significant changes in the indicators of the HRZ group were earlier than those of other drug groups and the changes were most obvious. The mRNA and
Shaista Abbas1,Imtiaz Rabbani1, Hafsa Zaneb2, M. Shahbaz Yousaf1, Saima Ashraf2, Abid Hussain Shahzad3, M. Afzal Rashid4 and Habib Rehman1,*
...eriod. Serum urea, total proteins, albumin, globulin, albumin to globulin ratio, triiodothyronine, aspartate aminotransferase and alanine aminotransferase remained unchanged amongst the groups during the transition period. In conclusion, dietary yeast supplementation has resulted in better DMI and has a potential to improve the ability of Beetal goats to counteract the metabolic stress imposed by the transition period.
...
Fermín López-Uriostegui1, Jesus T. Ponce-Palafox2*, Fabiola Lango-Reynoso1, María R. Castañeda-Chávez1, Itzel Galaviz-Villa1, Sergio Castillo-Vargasmachuca2 and Arturo Ruiz Luna3
...ial shrimp feed with 35% protein, 12% lipid) daily at a ratio of 10% body weight, twice a day (10:00 and 18:00 h). The optimal growth intervals were from 26 to 29°C and from 3 to 11‰ of salinity, and survival was at 23 to 29°C and 0 to 5‰. The greatest effect of the temperature-salinity interaction was on the upper extremes of response. The analysis of response surfaces showed that the final weight and weight gain increased as temperature...
Arifa Savanur1,*, Tallat Naz1,2, Tayyaba Hamid1,3, Syed Abid Ali4, Mian Jahangir1,3 and Muhammad Abdul Azeem4
...s on the non-contractile proteins of Uromastix smooth muscle.
...
Tehreem Usman1, Sajid Abdullah1, Huma Naz2*, Khalid Abbas1, Laiba Shafique3 and Qaisra Siddique1
...(CAT) activity and total protein contents (TPC) in Ctenopharyngodon idella under binary mixtures of insecticides viz. endosulfan(ES)+chlorpyrifos(CPF) and endosulfan(ES)+bifenthrin (BIF). The fish behaviour was observed from both treated and control groups. Fish under exposure of insecticides mixtures exhibit abnormal behaviour and tried to jump out from water, come to surface and gulp air, showed increased opercular movement and erratic movements, hype...

Hassan Boulahyaoui1,2*, Sanaa Alaoui Amine1,3, Marouane Melloul4, Farida Hilali5, Elmostafa El-Fahime1,3, Saad Mrani1,2 and Nadia Touil1,5* 

...ions of the outer capsid proteins VP8* were compared with vaccine and field strains. Here we show that the VP4 gene of the P[14] strains detected in this study exhibited close identity with zoonotic Moroccan goat and bovine strains. The amino acid sequences of the antigenic regions inside VP8* proteins showed high conservation between the amino acid sequences of human and animal strains bearing P[14]

Nasrullah1*, Ahmad Nawaz Khoso1, Jamila Soomro2, Ilahi Bakhash Marghazani1, Masood-ul-Haq Kakar1, Abdul Hameed Baloch1, Sarfaraz Ahmed Brohi1 and Muhammad Asif Arain1* 

...tter intake (DMI), crude protein (CP) natural detergent fiber (NDF) and nutrient detergent fiber (NDF) were recorded significantly similar (P<0.05) in both species. Furthermore, digestibility of DM was observed similarly among two species while, digestibility of CP was recorded higher on millet fodder compare to other fodders. The digestibility of various nutrients such as CP, NDF and ADF were significantly higher (P<0.05) in sheep compared to goat. Dail...

Hafiz Muhammad Imran Javed* and Mushtaq Ahmed 

...son of three-dimensional protein structures. The N gene ORF was 1578 nucleotide long with a single open reading frame encoding 526 amino acids. Similarly, the ORF of F gene was 1641 nucleotide long which encoded 547 amino acids. Upon phylogenetic analysis of the country isolates with the vaccine strains, it was revealed that isolates were clustered within lineage IV (Asian Lineage) closer to Indian isolates. On the other hand, a number of substitutions were ob...

Ehsan-Ul-Haque1, Akbar Hayat1*, Muhammad Asim1, Sajjad Hussain2, Muhammad Shakeel Hanif3, Muhammad Zubair1, Muhammad Abdullah Jamil1 and Faheem Khadija1 

... (10.75 and 9.83), crude protein, crude fat and in DPPH activity respectively. The study depict that incorporation of salts to wax in substitution to the fungicide is an effective application to control postharvest citrus fruit decay with perks of safety and convenience. 

...

Parsa Riaz and Muhammad Naeem*

Digestive Enzymes Activity with Gut Morphometric Parameter of Carnivorous Fish Wallago attu (Siluridae, Siluriformes)
...ritional value, and high protein content in its flesh, Carnivorous in nature. Descriptive data of the studied traits included total body weight, total body length, gut weight, gut length, condition factor, standard length in Wallago attu. Fish body weight showed positive Pearson’s correlation with total length, gut weight, standard length and amylase enzyme. Fulton’s factor showed positive correlation with fish ZI, lipase and protease. ZI showed po...

Tanveer Sultan1, Anwaar Ahmed1, Aqsa Qayyum2*, Amer Mumtaz2 and Naeem Khalid

...o 3.80±0.04). The protein (8.93±0.03) and fat contents (3.01±0.06) were significantly higher in supplemented pasta having 50% buckwheat. However, it negatively influenced the cooking quality parameters (cooking time, loss of solids). The sensory scores emphasized that pasta with 30 % buckwheat supplementation was more appealing for taste, color and texture. The study postulated that buckwheat could be used as a potential source of gluten-f...
Sumaira, Ali Mujtaba Shah*, Ghulam Asghar Solangi, Ifra Anwar, Qudratullah Kalwar 
... carbohydrates, lactose, protein, minerals, nutrients and catalysts. A total of 20 % milk is obtained from different species including sheep, ass, horse, yak, goat, bison and camel while the 80 % milk is produced by cows. Milk of camel plays an essential part in the diet of human. Additionally, camel milk comprises numerous fatty acids and enzymes. Hence camel milk has many beneficial effects, such as antiviral, antibacterial, anti-diabetic, anti-carcinogenic ...

 Muhammad Shahzad1, Arif Iqbal Umar1, Syed Hamad Shirazi1, Muhammad Tariq Pervez2*, Zakir Khan1, Waqas Yousaf1

HCDP: HEPATITIS C DATA BANK OF PAKISTAN
...quitination sites in the protein sequences, motif/signature sub-sequences pattern, visual appearance of protein/nucleotide sequences for analysis of different sites, visual representation of multiple sequence alignments using colour code along with motif finding/conserved region in the sequence and analysing of graphical structure of phylogenetic tree. With the help of Format converter/Fasta generator tool use...

Muhammad Usama Hameed*, Zulfiqar Ali Gurmani, Sajjad Khan and Allah Bakhsh 

...(110-120 cm), high crude protein (36.23% over check variety S-2000), thick stem (14.86% more than check variety S-2000) and higher leaf area per plant (21.55% over check variety S-2000). The variety is drought tolerant may be grown in semiarid and arid areas having minimum rainfall up to 300 mm, highly lodging-resistant, late-maturing i.e. stay green till mid May, having up to 12 % crude protein and having green fodder poten...

Haiyan Yang1, Hongxia Liu1, Wenlong Wu1*, Weilin Li2 and Lianfei Lyu

...photosynthetic pigments, protein, soluble sugar, hydrogen peroxide (H2O2), malondialdehyde (MDA), ascorbate (AsA) and reduced glutathione (GSH), activities of superoxide dismutase (SOD) and peroxidase (POD) in leaves of ‘Hull Thornless’ were investigated. In the treatment group, water stress significantly increased EL, and the accumulation of photosynthetic pigments, protein, soluble sugar, H2O2 and MDA. After re...
Magbolah Salem Helal Alzahrani
...ed decrease in serum lipoprotein HDL, LDL, VLDL fraction levels, indicating liver damage. Rats given CCl4 and fed on 5% M. chamomilla showed the most significant increase in organ weight as compared to all levels of treatment suggesting that M. chamomilla can reduce liver damage. Rats given CCl4 then fed on a combination of all levels of M. chamomilla showed a decrease of AST, ALT and ALP enzyme levels in the serum, s...

Olga Mikhailovna Blinnikova1*, Vadim Anatolyevich Babushkin1, Lyudmila Gennadievna Eliseeva2 and Galina Severyanovna Usova3

Modeling a Formulation and Assessment of the Consumer Properties of the Special Purpose Starch Drink
... body to produce its own protein. Drinking kissel is a perspective product type for enrichment the CCR (Central Chernosem Region’s) fruit and berry’s by collagen and natural physiologically active agents. At the same time the new types of drinking kissel useful to health, in assortment are which confirms the feasibility of updating the range due to enriched drinking kissels. Drinking of one glass of kissel covers the body daily need for ascorbic ac...

Mazhar Abbas1*, Kishwar Jam1, Rashid Iqbal Khan1, Muhammad Zafar-ul-Hye2, Tariq Rafique3 and Zahid Mahmood

...e activity (64.42 U mg-1 protein), peroxidase activity (1.90 µmol min-1 g-1 protein), catalase activity (37.81 nmol-1 g-1 protein) and protein (6.28 mg g-1 fresh weight) contents. These commercial plant products based on amino acids enriched macro and micronutrients as well as acetyl-salicylic acid combined with ascorbic acid can be used carefully ...
Mahak Fatima1, Memoona Syed1, Rabia Zeeshan2, Farah Rauf Shakoori3, Naveed Shahzad4, Moazzam Ali1 and Zeeshan Mutahir1*
...siRNA transfection, MTH1 protein was knockdown to approximately 77% in the transfected sample and resulted in a 1.75-fold increase in sensitivity of MCF7-R cells to gemcitabine. Moreover, higher expression of p21 protein was also observed in transfected MCF7-R cells that may indicate induced cell death. This study highlights the effect of MTH1 gene silencing in drug-resistant cancer cells as a mean to improve combined...
Maryam Yousaf1, Naveed Shahzad2, Zeeshan Mutahir1 and Moazzam Ali1*
...ession of MRP-1 mRNA and protein in comparison with PC-3/Wt cells. MRP-1 was found distributed between intracellular and cell surface pools in PC-3/Res cells and was capable of drug efflux as shown by doxorubicin and epirubicin efflux assays. Moreover, qRT-PCR and Western blot analysis showed that PC-3/Res cells also had significantly up-regulated expression of Rab21. To study the effect of Rab21 on MRP-1 mediated multidrug resistance, siRNA mediated knockdown...
Ayesha Noreen1, Amina Elahi1, Dilara Abbas Bukhari2 and Abdul Rehman1*

 

...+ as cofactor. The protein profile of B. cereus 3.1S, showed two bands of approximately 14 and 70 kDa, which had their possible role in arsenite oxidation. This was confirmed by transforming E. coli DH5α with plasmid DNA of B. cereus 3.1S. This arsenite resistant bacterial strain oxidized 76 and 86.5% As3+ from the original industrial wastewater after 3 and 6 days of incubation, respectively. This bacterially treated...
Feng-Mei Yang1, Rui Li2, Xiu-Xue Hu3, Yong Liang4, Bo Gao3* and Wei Chen3*
...in and senescence marker protein-30 (SMP30) after normal human skin fibroblasts (NHSFs) irradiated by different UVB doses as well as durations, thus unveiling mechanisms underlying HSF senescence induced by Ultraviolet B (UVB). NHSFs treated under different doses (100, 200, 300 mJ/cm2) of UVB with different durations (1, 2, 3 days) were case group, while those without UVB irradiation were control group. Expressions of gene/p...
Zengwen Huang1,2, WuReliHazi Hazihan2*, Baheti Bodai2, Kadyken Rizabek3, Nuralieva Ulzhan3, Omarova Karlygash4, Juan Zhang1 and Yaling Gu1*
... to approximately 40 KDa protein. Q-PCR analysis showed that the plasmid pGenesil 10-3p-siRNA could interfere with the expression of INHα in granulosa cells to an efficiency of 83%, which was also confirmed through western Blot assay.This study successfully constructed the eukaryotic expression plasmid pGenesil 10-3p-siRNA, and confirmed that the plasmid interfered significantly with the expression of INHα gene in YM sheep. Our current findings can...
Yan Zhou1,2, Hai Xia Han1,2, Qiu Xia Lei1,2, Jin Bo Gao1,2, Wei Liu1,2, Fu Wei Li1,2, Jie Liu1,2 and Ding Guo Cao1,2*
...l;">Very low density lipoprotein receptor (VLDLR) is of vital importance for egg production in mediating the synthesis of yolk protein precursors. To better understand the effects of VLDLR on reproduction in chickens, the haplotypes and diplotypes based on three genetic mutations (NC_006127.2:g.8467G>A, NC_006127.2:g.12321G>A and NC_006127.2:g.13876A>G) were constructed, and the associations of diplotypes with repro...
Ishrat Perveen1, Yasar Saleem2 and Javed Iqbal Qazi3* 
...ic amines (HCAs) in high proteinaceous food specifically in cooked meats is a point of great concern for the health risk factor of Pakistani community. Ready-to-eat (RTE) chicken kabab samples of four commercially available brands (K, S, D and B) were analysed for the simultaneous determination of HCAs i.e. 2-amino-3-methyl-imidazo[4,5-f] quinoline (IQ), 2-amino-3,8-dimethylimidazo [4,5-f] quinoxaline (MeIQx) and 2-amino-1-methyl-6-phenyli...

Muhammad Jawad1*, Shahid Riaz Malik1, Rana Muhammad Atif2, Haris Ahmed2 and Muhammad Shahzad Afzal3

Species Identification of Gram Wilt Complex through ITS Region by PCR-RFLP Analysis
...me that serve as dietary protein source for poor farmers in the developing countries. Yield and production severely challenged by biotic stresses. Wilt complex is the major biotic factor that contribute significantly in yield loss. Wilt complex is caused by various pathogens, including diverse type of Fusarium species. Molecular approach is a useful technique for the identification of wilt complex pathogens. The study conducted to identify the polygenetic asso...

Rabab Rafaqat1, Habib Ahmed Rathore1, Tariq Masud2, Imran Hayat1* and Imtiaz Hussain1

Determination of Different Chemical Constituents of Fruit, Leaves and Oil of Olea cuspidata (Wild Olive) Grown at Rawalakot, Azad Jammu and Kashmir
...tent, crude fibre, crude protein, total oil, ash content and nitrogen free extract of fruit and leaves were studied. Extracts of wild olive fruit and leaves were made in four different solvents (ethanol, methanol, acetone and water). Total phenolic content (TPC) and total flavonoid content (TFC) of fruit and leaves extracts in these solvents were determined. Oil was extracted from wild olive fruit by the process of solvent extraction and was studied for physic...
Huma Abbas1, Muhammad Azhar Iqbal2, Muhammad Kamran3, Muhammad Umar Shahbaz3*, Haseeb Ullah Kamber1, Nazir Javed1, Muhammad Junaid1, Hira Abbas4 and Muhammad Ehetisham ul Haq3
Evaluation of Advanced Mung Bean Germplasm against Cercospora Leaf Spot and its In-vitro Management by Different Fungicides
...riod legume and poor man protein source along with carbohydrates and vitamins. Cercospora Leaf Spot is a devastating threat to the crop caused by Cercospora canescens, affects the whole crop and 95% yield losses may be attributed in severe conditions. To manage the diseases through tolerant germplasm and with environmentally safe fungicides is a cost-effective approach. The present study was aimed to find the resistant germplasm against the disease and to eval...

Khan Sher1*, Muhammad Subhan1, Muhammad Nisar2, Ali Hazrat2, Zahid Fazal1, Gul Rahim2, Imran Ahmad1, Riaz ul Haq1 and Shamia Bibi1

Genetic Diversity in Common Beans (Phaseolus vulgarus L.) Collected from Different Ecological Zones of Malakand Division (A Part of the Sino Japanese Region of Pakistan)
...g, high productivity and protein significance as compared to other parts of the world, which could be utilized for evolving better quality and high yielding cultivars of P. vulgarus.

...
Asim Faraz*
...ol, triglycerides, total protein, albumin, calcium and phosphorus were found to be significantly different higher in IMS compared to SIMS and EMS. The levels of urea, creatinine and glucose were found to be varied (P>0.05) among groups. Regarding hair mineral status Ca, Mg, Cu, Zn, Fe and Mn concentrations were found to be significantly different (P<0.05) among calf groups in IMS, SIMS and EMS.
...

Dalal H. Sary and Rama T. Rashad*

A Comparative Study on the Impact of Compost, Humate, and Silicate on the Nutritional Characteristics of Calcareous Soil Cultivated by Soybean
... significant increase of protein and total N (~77.07%) followed by K-Si (~60.67%) then K-H (~ 17.69%). However, compost and K-Si have almost decreased the concentration (mg kg-1) of Cu, Fe, Mn, Zn, and Si in soybean seeds significantly by increasing the application rate from 50 to 100 %. Potassium silicate was the most effective Si-source in this study due to its content of readily soluble Si in soil solution. Silicon uptake can partially control the availabil...

Muhammad Nauman, Unsar Naeem-Ullah*, Mehreen Hanif, Hafsah Ghaffar, Muhammad Shahid and Syed Haroon Masood Bokhari

Management of Tribolium castaneum (Herbst) and Rhyzopertha dominica (Fabricius) by using Microwave Oven
...ins have rich sources of proteins, fibers and minerals. This cereal crop has maximum proportion in daily basic diet of human in Pakistan. Disinfestation of wheat grains by using microwaves can be safe option than chemical control. Therefore, in this study a digital microwave oven of 50 Hz is used to determine the mortality of Tribolium castaneum (Herbst) and Rhyzopertha dominica (Fabricius) adults. Grain samples of 20 g in each petri dish were infested with bo...
MA Liman1, QI Yongxiao1, Wang Wenji2* and Zhong Qianyi3*
...resulted in reduced Vegf protein expression. Our study suggested that G-Rh2 may exert anti-angiogenic activity by downregulation of Vegf in zebrafish embryos, thus indicating its role as a potential therapeutic agent against cancer.
...

Syeda Farzana Bibi* and Siraj ud Din

Unraveling the Bioherbicidal Potential, Elemental Analysis and Nutritional Evaluation of Crataeva adansonii Dc Leaf and Bark
...ntages of carbohydrates, proteins, fats, fiber, ash, and moisture. The bioherbicidal potential of the proposed plant was evaluated through the Lemna minor model of phytotoxicity. C. adansonii is a source of several essential macro and micronutrients. A nutritional value analysis of this plant offers its use as a food source. Bioherbicidal/phytotoxic activity revealed significant results in the form of dose-dependent inhibition of frond growth. Ethanolic extrac...
Kui Zhang1,2, Ping Geng1, Sher Khan Panhwar3, Khadim Hussain Memon4 and Zuozhi Chen1,2,*
... the provision of animal protein, employment solutions, and foreign-exchange earnings through exports. However, stock assessments are available for few of the commercial marine fish species in Pakistani waters. Most commercial fish species lack assessments of maximum sustainable yield (MSY) and allowable catch, a situation that hinders effective fisheries management. A Catch–MSY model based on statistical catch data and prior information on population pa...

Kecheng Zhu1,2,3, Peiying He1, Baosuo Liu1,2,3, Huayang Guo1,2,3, Nan Zhang1,2,3, Liang Guo1,2,3, Shigui Jiang1,2,3 and Dianchang Zhang1,2,3,* 

...muscle-specific membrane protein that is essential for myoblast fusion. Myomaker is regulated by myoblast determination protein (MyoD), a muscle-specific basic helix-loop-helix (bHLH) transcription factor in higher vertebrates. However, the transcriptional regulatory mechanism of the myomaker gene has not been explored in marine fishes. In the present study, molecular cloning, bioinformatic analysis and transcriptiona...

Fan Sigang1, Guo Yihui1* and Xu Youhou2

...KEGG pathways related to protein glycosylation, fatty acid biosynthetic processes, hydrolase activity, and AMPK were enriched in the ovary, whereas those related to male organ formation and spermiogenesis were enriched in the testis. The glycosphingolipid biosynthesis pathway was identified for the first time in a mollusc testis.The present study provides the first transcriptomic analysis of C. nobilis, which will help clarify the molecular mechanisms o...

Asim Faraz1*, Abdul Waheed1, Ayman Balla Mustafa2, Nasir Ali Tauqir3, Riaz Hussain Mirza1, Hafiz Muhammad Ishaq1, Rana Muhammad Bilal4 and Muhammad Shahid Nabeel5

..., respectively. The fat, protein, lactose, SNF and total solids percentage was found to be 4.44, 4.40; 3.42, 3.38; 4.82, 4.76; 8.96, 8.93 and 13.38; 13.33, respectively under EMS and SIMS. The results could be used for future intensive camel production in Pakistan.
...
Yujun Zhao and Jianping Fan*
...ed factors Bcl-2 and Bax protein and the activities of Caspase-3 and Caspase-8 in colon cancer SW480 cells were studied. Compared with the control group without medication, the proliferation inhibition rate of cells processed with Kanglaite injection (10, 20 and 40 μL/mL) significantly increased (p <0.05), the apoptosis rate increased (p <0.05), the expression of Bcl-2 protein decreased (p <0...
Yahui Wang1, Ling Ren1, Yishen Xing1, Xin Hu1, 2, Qian Li1, Lingyang Xu1, Junya Li1* and Lupei Zhang1*
...ects of bone morphogenic protein 4 (BMP4) and rosiglitazone during differentiation were studied. Comparing with control group, progenitor cells treated with BMP4 or rosiglitazone accumulated more intracellular lipid. Furthermore, the mRNA expression level of adipocyte-specific genes also increased significantly in BMP4 or rosiglitazone treated cells. The result indicated that BMP4 and rosiglitazone could promote adipogenesis and be applied in adipogenic differ...

Mahmoud Mohamed Ahmed Youssef* and Suzan Abd-Elazeim Hassabo

The Role of Genetic Engineering in Management of Plant Parasitic Nematodes with Emphasis on Root-Knot Nematodes: A Review
...industrial production of proteins and peptides to manage root-knot nematode. Mi gene resistance in tomato plants has been utilized to manage M. incognita and M. javanica. Also, protoplast fusion between Pseudomonas fluorescens and P. aeruginosa to manage M. incognita was utilized. Many genes expressed in nematode feeding cells or the regulatory regions that control these genes have been isolated. Transproteins toxic to diffe...
Inga Kowalewska-Łuczak1 and Ewa Czerniawska-Piątkowska2,*
...y the highest content of protein and the lowest content of fat in milk. On the other hand, for the SAA2 c.114G>A polymorphism, it was shown that cows with GA genotype were characterized by the lowest calving interval (P≤0.05). In summary, the information contained in th...
Syed Zakir Hussain Shah1*, Muhammad Afzal2, Mahroze Fatima3Syed Makhdoom Hussain4 and Tanveer Ahmed5
...re contained 37.6% crude protein and 4.72 kcal/g gross energy. Results showed improved (p<0.05) dry matter, crude protein, crude fat and gross energy digestibility by fingerlings when fed PHY sprayed diet. Similarly, CA addition in the diet resulted in increased (p<0.05) digestibility of these nutrients. Also, the minerals digestibility was significantly (p<0.05) affected by top spraying of phyt...
Xuya Zhou1, Ying Liu1, Deqin Xu1, Jie Bao1, Yaru Cao2 and Yong Jin3*
...tern blot to explore the protein expression levels of COX-2 and cytochrome P450 (CYP) 4A1. The expression of CYP4A1 was detected by immunohistochemistry. Enzyme-linked immunosorbent assay (Elisa) was used to detect the prostaglandin E2 (PGE-2), 20-Hydroxyeicosatetraenoic acid (20-HETE), endothelin 1 (ET-1) and B-type natriuretic peptide (BNP) in blood serum of diabetes complicating arthritis rats. Blood pressure was measured by a noninvasive caudal artery bloo...

Muhammad Jahanzaib1*, Nazakat Nawaz1, Muhammad Arshad1, Shehzadi Saima4, Muhammad Suhaib2, Muzammil Husain3, Haris Khurshid1 and Shahid Ali Khan1

Effect of Temporal Application of Gypsum on Mineral Uptake and Economically Important Morphometric Traits in Groundnut (Arachis hypogea L) under Rain-fed Conditions
...dnut is a good source of protein, edible oil, and vitamins. A gradual decline in groundnut yield has been reportedly subjected to various agro-climatic conditions and soil fertility problems. In this study, various regimes of gypsum application and its effect on groundnut yield, morphometric parameters, and minerals (Ca, K, P) concentration in root and shoot have been examined. A newly released Pothowar groundnut variety (Variety name) was grown in 3 replicati...

Luqman* and Zahid Hussain

Impact of Tillage Tools and Weeding Regimes on Nutritive Values of Maize Grains
...e grains including crude protein content, fat content, ash content and dry matter content of the maize grains. The results showed 13% protein content, 5.8 % fat content, 0.93 % ash content and 89.6 % dry matter content in the maize grains, which were the higher values achieved in plots treated with mouldboard plough, while in the weeding regimes the crude protein content, fat content, ash ...

Muhammad Luqman1*, Roshan Hussain1, Muhammad Yaseen1, Muhammad Umer Mehmood1, Ijaz Asghar2 and Usman Saleem1

Comparative Analysis of Dietary Intake Patterns of Rural and Urban Communities of Southern Punjab, Pakistan
...f the communities prefer proteins with fats and sugar commodities. In lunch rural community is much attracted towards carbohydrates and dairy products, while urban community prefers wheat bread with fruits and vegetables. Fruits, dry fruits and legumes are a best source of attaining maximum micro and macro nutrients. In comparison to this rural community of the study area perceived that vegetables and fruits are rich in macro and micro nutrients. Keeping in vi...
Q. Sun1, Q. Liu1, R. Di1, Y. Wang1, S. Gan2, S. Liu2, X. Wang1, W. Hu1, X. Cao1, Zh. Pan1, X. Guo1, Y. Yang3, H.E. Rushdi4* and M. Chu1*
...>THRSP) is a crucial protein for cellular de novo lipogenesis. THRSP gene encodes a nuclear protein which regulates fatty acid synthesis in lipogenic tissues. Identification of single nucleotide polymorphisms (SNPs) of sheep THRSP gene and their association with fat deposition were investigated using Altay and White Suffolk sheep. In addition, the messenger RNA expression profiling of THRSP in fat-ta...
Muhammad Shafiq1,2,*,Rajwali Khan1, Ilyas Ali3, Sadeeq Ur Rahman4, Saif Ullah3Shah Jan Mohammad2, Mohammad Jan2 and Jinhu Huang2
...erum IgG and serum total protein concentration (b) colostrum immunoglobulin level and (c) their respective calves’ serum immunoglobulin and serum total protein concentration. Three breeds of cattle were observed: Jersey, Holstein Friesian (HF) and local Pakistani cow breed Achai. To assess serum IgG, sodium sulphite precipitation technique was used while IgG in colostrum were determined using digital Brix refrac...

Ambreen Akhtar Saddozai1, Amer Mumtaz2, Naseem Rauf1, Saeeda Raza2, Nouman Rashid Siddiqui2, Muhammad Naeem Safdar2, Sahar Shibli2, Muhammad Suhail Ibrahim3*, Muhammad Akhtar4 and Muhammad Saad Rehan5

Preparation and Quality Evaluation of Soymilk Carrot Blend
...eing potential source of protein was used as a carrier of pro- vitamin A. Carrot powder was blended in soya milk at three different concentrations levels 2%, 4% and 6% and packed in sterilized bottles. The product was kept at two different temperatures (ambient and refrigerated temperature) for 14 days to assess its shelf life. During the storage period the samples were analyzed for different chemical parameters total soluble solids, pH, total carotenoids,
Ahmad Sadiq1, Muzafar Shah2*, Habib Ullah1, Irfan Ali1, Amir Alam3
Navid Jalil1 and Muhammad Khan3
...nts with low density lipoprotein (LDL), high density lipoprotein (HDL) and body mass index (BMI) were found to be significantly lower (p > 0.05) than normal or control. Gender-based analysis has shown that HbA1c, RBS, DBP and SBP in male patients have significantly higher (p<0.05) than female. But in female patients the TC, TG and BMI are insignificantly higher (p<0.05) compared to male. High density lipo
Shikang Deng1,2, Yan Jin2, Jing Xu2, Xiufang Zhu2, Pinghai Hu2, Jiao Li2, Li Zhang2 and Jianzhong Tang2,*
...ta;1, cyclinD1, and CDK4 protein in each group of cells; and real-time polymerase chain reaction was used to detect the expression levels of TGF-β1, cyclinD1, and CDK4 mRNA in each group of cells. The results showed that after 5-FU intervention, the proliferation of bile duct scar fibroblasts was inhibited, and the expressions of TGF-β1, cyclinD1, CDK4 mRNA and protein in the cells were down-regulated (P<0.05), ...

Muhammad Shahid1*, Unsar Naeem-Ullah1, Waheed S. Khan2, Shafqat Saeed1 and Kashif Razzaq3

Application of Nanotechnology for Insect Pests Management: A Review
...ant extracts, fungi, and protein. This review article climaxes the latest mileposts accomplished for the production and imminent perspective of nanoparticles for the controlling of insect pests. 

...
Vijay Lal and Muhammad Naeem*
...ash 6.72%, fat 3.45% and protein 16.62% in the whole wet weight of body of T. jarbua. % water represented correlation with highly significant value (P<0.001) with protein, ash, fat and organic constituents in wet weight. Fish body weight represented highly significant (P<0.001) positive relation to all the studied body constituents in log transformed data. Total length also represented highly-significant positiv...

Junaid Ahmad1*, Shazma Anwar1, Anwar Ali Shad2, Fazal Yazdan Saleem Marwat3, Hamida Bibi4, Farhan Ahmad1, Wajia Noor5 and Bibi Sadia5

Yield and Nutritional Status of Mungbean as Influenced by Molybdenum and Phosphorus
...-1 molybdenum while more protein content (21.91 %), carbohydrates (60.36 %), nitrogen content in grain (3.76 %) and straw (1.10 %), phosphorus uptake in grain (0.380 %) and straw (0.186 %) was achieved with molybdenum applied at rate of 2.5 kg ha‑1. Whereas in case of phosphorus use maximum  seed yield (810.88 kg ha‑1) and harvest index (26.92 %) was observed with 60 kg ha‑1 P application while highest protein con...
Xiaopeng Tang1,*, Lei Chen1, Kangning Xiong1, Dun Deng2 and Peng Peng2,*
... presents an alternative protein resource to meet ever-increasing demands of feed ingredients in poultry production sectors.  
...
Abdul Hafeez1*, Akhtar Nawaz Khan2 and Zahid Ullah3
... molecules including DNA/proteins and diseased human cells can be detected by a variety of micro and nanoscale devices and systems. Unfortunately, these biomedical applications suffer from huge amount of data. That is, the data generated by such systems is so large that a typical computer workstation cannot handle it in real-time. Traditional approaches rely on unloading raw data to off line storage and suffer from the trade-off of an insufficiently rigorous s...
Abdul Nabi Jatt1,2*
...orum-quenching (QQ) AiiA protein. The present study, for the first time provides evidence that the QS system via AHL molecules involved in regulating the production of two different forms of an extracellular cellulase enzyme, i.e., exoglucanase and endoglucanase in marine snow associated bacterium C. freundii<...
Faheem Ahmed Khan1*, Sarzamin Khan2, Qurat-ul-Ain3, Saqib Ishaq1Muhammad Salman1, Abdul Rehman1, Ikram Ullah4, Kalsoom5 and Johar Jamil5
...tion of non-conventional proteins utilizing the available cheap sources. The indigenous Saccharomyces cerevisiae were isolated from different fruit samples, identified by conventional polymerase chain reaction (PCR) and were characterized for production of single cell microbial protein (SCMP). Out of 60 different fruit samples, a total number of confirmed S. cerevisiae isolates were 1, 2 and 1 from orange (C...
Mashal Malik and Mudassar Nawaz Khan*
 
...itionally rich source of proteins and fats. It is grown in many countries of world including US, China, Brazil and India. Pakistan grows soybean on a very limited land owing to lack of farmers interest and government attention. Soybean lines; B24G14, B23G5, B20G16, B21G2, B21G9, B6G23, B23G16 and B29G11 were grown for one month and analyzed for morphological and molecular variations. In order to analyze genetic varia...
Naveed Akhtar1*, Muhammad Fiaz Khan1*, Sadia Tabassum1
Munawar Saleem Ahmad2 and Khan Dil Badshah3
...s, cholesterol, urea and protein level decreased, whereas in the glucose level increased in all treated groups. In histopathology, dose dependent lesion and alterations in gills, liver, brain, kidney, intestine and muscles related with oxidative stress damage was observed. Genotoxicity increased with increase in time and concentration of cypermethrin. Cypermethrin is therefore extremly harmful to aquatic life.
...
Muhammad Rashid, Mahmood Ahmad Sajid, Nosheen Noor Elahi, Sibgha Noreen and Kausar Hussain Shah*
 
...tions. The total soluble proteins, proline, glycinebetaine and phenolic contents were improved in all three wheat varieties under drought stress. The variety Pu19 was exhibited a higher level of proline, glycine betaine and phenolic contents were. Similarly, hydrogen peroxide (H2O2) and malondialdehyde (MDA) were improved in all three wheat varieties but this increase was relatively lower in variety F23. The superoxide dismutase (SOD), pe...
Muneer Abbas1*, Dilbar Hussain2, Muhammad Saleem2, Abdul Ghaffar2Sohail Abbas3, Niaz Hussain1 and Abdul Ghaffar1
... A=sanitation, B=MAT, C= protein based baits, D= plant extracts and E= A+B+C+D were used during 2015-16. Data of % infested fallen fruits, total flies/trap, total flies captured/year, % fruit punctures, pupal population, % fruit infestation and market value of fruits was collected at regular intervals. Results indicated that when all the components were applied in a combined way they gave significant reduction of fruit losses. As a result of continuous sanitat...
Muhammad Naeem1,2, Nasir Rajput1,2, Sher Ali3, Asmatullah Kaka2, Dildar Hussain Kalhoro2, Mehvish Rajput2 and Tian Wang1,*
... TRS-II, while the crude protein (CP) were higher and acid detergent lignin (ADL) were lower (P<0.05) in AH than other groups. The concentration of acetate, butyrate and iso-butyrate were almost similar in TRS-II, AH and CWR; valeric and iso-valericwere lower (P<0.05) in CWR and TRS-I than AH and TRS-II, while the propionate and total VFA were higher in AH but similar in CWR and treated rice straw. The in vitro degradibility of DM, O...
Iram Liaqat1*, Tahir Hussain1,2, Aisha Waheed Qurashi3, Gulbeena Saleem2Asia Bibi4, Muhammad Fiaz Qamar5,ShaukatAli1 and Ikram-ul-Haq6 
...rypsin, chymotrypsin and proteinase k against S. Gallinarum. We observed that S. Gallinarum has strong biofilm forming ability as observed by dark black colonies on congo red medium. Quantification assays such as test tubes revealed significantly (p<0.001) strong biofilm after 5 days with significantly increased planktonic cells (after 3 days) and increased loosely bound cells (after 5 days). Similarly, air liquid interface coverslip indicated...
Qiang Tang1 and Qianli Tang2*
...evels of Ang-1 and Tie-2 proteins in skin tissue decreased (both p<0.001). Compared with model group, thickness of epidermis, dermis and collagen fibers, and expression levels of Ang-1 and Tie-2 proteins in skin tissue in isoliquiritin group increased (all p<0.001), and inflammatory factors TNF-α, IL-6 and IL-1β contents and expression level of Ang-2 protein ...
Junyan Bai*, Zhihao Dong, Youbing Yang, Ziheng Li, Xiaoning Lu and Huirong Gong
...P<0.05). Crude protein contents in forelegs, hind leg and back were remarkably higher than that in waist (P<0.05). The crude fat content of the waist was significantly higher than that of other parts (P<0.05). To sum up, due to low shearing force, meat quality of hind leg was tender just with slightly low crude fat content; crude fat content of waist was high, so flavor of waist was good. The correlation coefficients of flesh colo...
Sheza Shehzadi1, Mohammad Umar Farooq2*, Rukhsana Kausar1, Ijaz Ali1*, Muhammad Arshad Ullah3 and Maqbool Shahbaz4
...imate analysis including protein content, crude fiber, ether extract, and total digestible nutrients. Significant results were obtained by applying ANOVA test on the data retrieved. All three factors (BP, CC and CS) showed maximum results after 60 days of growth. The result indicated that after the 60 days interval the animal unit per month gave the maximum fodder (7.0667 AU/M/Ha) that proposed to be grazed for large ruminants and then 21 small ruminants on th...
Sadaqat Khan1,Saleem Ullah1* and Muhammad Sajid2
... ash, crude fiber, crude protein, crude fat ranged from 92.082 to 92.317, 3.097 to 3.85, 4.9133 to 5.2717, 5.0133 to 5.2867, 1.08 to 1.24, 0.0236 to 1.9567 g/100g and that of fruits with lesser values were also affected significantly (P<0.05). From the present study it was concluded that Se applied in the form of sodium selenite in irrigation and foliar spray considerably affected the physical parameter of tomato hybrid Salar F1, followed by proximate compo...
Yuanyuan Zhang1*, Liping Song1, Hui Guo2, Jun Wu1, Xiaoli Wang1 and Fangbin Yao1
...Nrf2 mRNA level and Nrf2 protein level in the liver nucleus, and those of the P5 group were highest. Overall, the results indicated that appropriate dietary curcumin supplementation could enhance the growth (especially 60 and 120 mg kg-1 curcumin per feed) of common carp and effectively protect the liver against CCl4 induced injury (especially 120 mg kg-1 curcumin per feed) in fish.
...
Sadaf Javaria1, Anum Marwat1, Muhammad Nadeem2, Mehwish Zerlasht1, Aiman Kareem3, Iqra Rubab1 and Masooma Munir4*
...solids (TSS), vitamin C, protein, iron and magnesium were investigated. Results of sensory evaluation showed that all the samples were in an acceptable range. However, Mix fruit leather with 50 % apple puree and 50% peach puree was liked the most by the panelists.
...
Salman Ali1*, Ayaz Ali2, Riaz Ali Rind2, Majid Ali3, Zulfiqar Ali Mastoi2, Shagufta Naz3, Muhammad Shakir3, Rashid Ahmed Qaim Khani1
...ty 1.78%, pH value 6.26, protein 24.07%, fat 3.76%. Whereas, the fried fish resulted moisture 62.16%, titratable acidity 1.39%, pH value 5.96, protein 21.11%, fat 5.93%. The fish grilled resulted in moisture 60.19%, titratable acidity 1.32%, pH value 5.89, protein 20.28%, and fat 4.13%. According to the sensory evaluation the result of microwave method were found significantly high than ot...
Yongyun Zhang1, 2, Xinyang Fan1, Fangting Zhou1, Weizhen Li3, Yina Ouyang1,4 and Yongwang Miao1*
...tudy, and accordingly, 6 protein variants and 2 synonymous variants of αS1-CN were inferred and named. The variants A, B’, B’’, C, E and F were observed only in river buffalo, whereas variant D was found only in swamp buffalo. The variant B was shared by both types of buffalo with high frequencies. The buffalo variants determined here did not exist in Bos genus. In addition, 9 amino acid differential sites of

 Muhammad Ajmal1, Saima Mustafa1, Fizza Ibrahim Bajwa1, Cheng Zhou2, Guangdong Wen2, Soe Lwin Myint2, Syed Irfan Raza3, Ihtasham Bukhari4, Mubashir Hassan5, Muhammad Faisal6 and Furhan Iqbal1*

...mature termiation of the protein after 23 amino acid residues (p.P144LfsX23), resulting in a truncated HR protein with 166 amino acid residues. The mutation followed Mendalian pattern of inheritance as all the patients are homozygous for the mutation while parents were heterozygous and unaffected siblings from both families were either heterozygous for the reported mutations or they lacked this mutation.
...
Saad A. Moussa1, Mohammed Ahmed Mahmoud Abdullah2*, Mahmoud Saied1, Mustafa Saleh1, Mohamed A. Soliman2 and Ali Mahmoud Zanaty2
...g for the partial fusion protein, The eight NDVs isolates of velogenic genotype VII and contain the unique cleavage site motif 112RRQKRF117 with high relation to very virulent NDV Chinese strain Chicken /China/SDWF07/2011 strain with nucleotide identity percentage (99.3% -100%). The main causative agent of recent ND outbreaks in vaccinated broiler flocks in Menofia governorate, Egypt was found to belong to very virulent genotype VII. This strain was geneticall...
Hafiz Tassawar Abbas1*, Tamoor Khan1, Ghulam Khaliq2, Muhammad Aqeel Sarwar3, Muhammad Rashid4, Intazar Ali5, Muhammad Abuzar Jaffar2, Ghulam Ali Bugti6 and Muhammad Waseem4
 

...s a rich source of plant protein. A number of diseases attack chickpea crop but wilt disease is the principle one. In mineral contents i.e. nitrogen, phosphorus, potassium, calcium, magnesium, sodium, zinc, iron and copper were decreased in chickpea plants affected with wilt disease. Leaves of three resistant and susceptible (un-inoculated and inoculated) chickpea lines/varieties were tested to find out their ionic status...
Sohail Akbar1*, Muhammad Shafiq2, Muhammad Yaqoob2, Muhammad Farooq Iqbal2, Kashif Ishaq2, Muhammad Kamran2, Shazia Shamas3, Arbab Sikander4 and Muhammad Hashim5
 
 
...es along with the bypass protein. So there is need of nutrition based management of animals in proper way.
...
Aylin Celile Oluk1*, Ugur Serbester2, Murat Reis Akkaya3 and Oya Berkay Karaca4
...6.50% fat and 4.80-5.10% protein. The lactose content did not differ significantly between milk samples from the two locations (3.90-4.20%). Total unsaturated fatty acid levels were significantly higher than total saturated fatty acid contents, irrespective of the lactation period (p<0.05). Milk from Hatay was high in saturated fatty acids, aromatic hydrocarbons and benzaldehydes, i.e. 4.50 g 100 g-1, 6.80-4.65 mg 100g-1 and 0.28-0.70 ...
Simeen Mansoor, Jabeen Farheen* and Meher Hassan
 

...rmal;">The specific proteins induced by sublethal-temperature are molecular chaperons that positively regulate plant growth and development that govern acclimation in plants but little has been known under lethal-temperature stress. Thus, the impact of induction of thermotolerance by sublethal-temperature (40 °C), 100 µM indoleacetic acid (IAA), and 100 µM gibberellic acid (GA
Suwati Suwati1, ErniRomansyah1,*, Syarifudin Syarifudin1, Yahya Jani2, Agus Heri Purnomo3
Damat Damat4 and Erkata Yandri5,6
...onsists of carbohydrate, protein, fat, fiber and ash, vitamin, and beta-carotene. Right drying methods are needed to preserve the quality of dried seaweed. This study aims to compare the trend of weight reduction in seaweed during drying by natural and cabinet methods. The methods were used experimentally in the field and laboratory. And the data were analyzed using simple linear regression to formulate a trend of reduction in the weight of seaweed while dryin...

Saad A. Moussa1, Ahmed F. Afify1*, Suzan Salah2 and Ayman Hamed3

...targeted to nucleocapsid protein gene (N-gene) was carried out followed by phylogenetic analysis. Positive samples were isolated on Vero cell culture and identified by TEM and immune-peroxidase technique. Betacoronavirus 1 was detected by ELISA in 6 out of 20 fecal samples (30%), PCR detected 4 out of 6 ELISA positive samples at specific M.W. band of 236 bp by electrophoresis, and one sample was sequenced and submitted on Genbank with acc.no. MW173144, further...

Masood Sadiq Butt1, Sadia Aslam1,2, Rizwan Shukat1,*, Syed Qamar Abbas1, Muhammad Issa Khan1, Shadab Shaukat3 and Muhammad Shahid4

...an appreciable amount of proteins, enzymes and fats. It was considered as garbage of no financial value and disposed of without any attempt of recovery. The aim of this study was to optimize the hydrolysis conditions for production of protein hydrolysate with enhanced functionality. Minced rohu (Labeo rohita) waste mainly comprising of head, tail, fins and skin was considered as raw material to prepare
Muhammad Farhan Qadir1, Xin-Yu Han1, Meng-li Qiao1, Ying Wang1, Ding Zhang1, Yu-hai Bi1,2, Ali Raza Jahejo1,Qian-qian Cheng1 and Wen-xia Tian1,*
...n blot analysis of COX-2 protein expression further supported the mRNA results. Moreover, this was first study indicating the expression levels of PG-related genes in the H9N2 infected chicken’s erythrocytes. This study may provide a new biomarker to detect H9N2 in chickens. Future studies are in process to know the morphological features, and to evaluate the mechanism exhibited by erythrocytes in response to H9N2 with new experimental evidence in chicke...
Aysha Riaz* and Said Wahab
...rich in nutrients namely proteins, fibers and minerals. Keeping in view the nutritional importance of moringa leaves powder, the present study was carried out to investigate the effect of moringa leaves enrichment on the overall quality of whole wheat flour biscuits. Composite flours were made by incorporating moringa leaves powder in different ratios (2, 4, 6, 8 and 10%) in whole wheat flour. Biscuits were prepared from the composite flours and were analyzed ...
Muhammad Farooq1*, Allah Rakha2,Jawad Ul Hassan2, Iftikhar Ahmed Solangi1, A. Shakoor3, Muhammad Bakhtiar4, Muhammad Noman Khan5,Shoaib Khan5, Ibrar Ahmad6, Shabir Ahmed7 andWang Yunyang1*
 

...owder on moisture, crude protein crude fat and nitrogen free extract of muffin were non-significant and effect on ash and crude fiber were significant when 0%, 10%, 20%, 30% and 40% mushroom powder based muffin were prepared. The effect of mushroom powder supplementations on loaf weight of muffin was significant and resulted in gradual decrease. However, the effect on loaf volume of muffins was non-significant. The effects of mushroom powder on texture and col...
Tanay Dineshkumar Shah
 

...hey are a rich source of protein and fiber and have very low calories and low cholesterol. Days are not far when mushrooms will be a regular alternative to vegetables for many vegetarians. India is having a favorable environmental condition to grow mushrooms. Hence various varieties of mushrooms are grown in different regions of India. However, the per capita consumption of mushroom in India is very less as compared to other countries though mushroom has many ...

Safdar Hussain1, Muhammad Naeem Mushtaq5, Ali Bakhsh3, Muhammad Mudassar Maqbool1, Muhammad Sarwar1, Muhammad Jan4*, Muhammad Abdul Qayyum2 and Arif Husain2

...ht yield index (92.21%), protein contents (17.37 mg g-1), leaf water contents (72.65 %), soil moisture contents (14.40 %). Comparing the genotypic performance Aas-2011 performed well as compared to Faisalabd-2008 and TD-1 wheat genotype.

...

M. Javed Iqbal1, Rizwan Shukat1, Muhammad Farooq2*, Iftikhar Ahmed Solangi2, Naila Ilyas3, Rahman Ullah4, A. Shakoor5, Muhammad Bakhtiar6 and Faraz Ahmed7 

...ent concentration of soy protein (0%, 4%, 8% and 12%) as foaming agent and Carboxyl methylcellulose (0.5%) as foam stabilizer and these were dried in hot air tray drier at different temperatures (55°C, 65°C and 75°C) with 3mm sheet thickness of onion foams. Effect of different concentration of foaming agent and drying temperature was studied on moisture loss drying rate of onion paste. Increase in concentration of foaming agent significantly increa...

Ali Zaman1, Nabila Roohi1 and Muhammad Irfan2*

...(LPS) and outer membrane protein (OMP) on Nili Ravi buffaloes. Prepubertal Nili Ravi female buffaloes (N=18) of 10-12 months age in good health condition were divided into five treatment groups (n=3 each) and a control group (n=3). Treatment groups’ animals were exposed to P. multocida bacterial culture and its immunogens, i.e., LPS (oral and intravenous) and OMP (oral and subcutaneous). Animals were analyzed for the development of clinical signs, hemato...

Arshad Mehmood Khattak1, Saleem Ullah1*, Farida Anjum2, Hamid U. Shah1 and Sahib Alam1

...er (6.60) in KK-2, Crude protein in Chattan (7.87) while Crude fat (2.22) was high in KK-1. Among the edible parts, Moisture (85.54) and Ash (3.54) were high in Green grains while Crude fiber (6.38), Crude protein (8.29) and Crude fat (1.99) were maximum in Tender leaves. Mineral (mgKg-1) content of the cultivars showed that Na (38.3), Pb (0.30) and Cu (0.09) were high in Sheenghar, Cr (0.36), Ni (0.92) in KK-2, Fe (0.29) in...
Tai-hua Jin1, An-gang Lou2,Jiu-xiu Ji1, Cheng-dou Cui2, Long-zheng Yu2 andLi-zeng Guan1*
...t the GH mRNA and protein level in pituitary cells of Yanbian yellow cattle could be significantly decreased by adding miR-1468 mimics (P<0.01), while these were significantly increased by adding miR-1468 inhibitor (P<0.05). The results of bioinformatics analysis and double luciferase reporter gene system validation showed that miR-1468 targeted 3’UTR of cAMP responsive element binding protein

Manzoor Hussain Memon1, Khalid Khan2, Anjum Parvez3, Sarfaraz Ahmed Shaikh4, Khan Mir Khan2, Guo Xiangyu5*, Mohammad Nasrullah6 and Saima Liaqat7

...or sources that fulfills protein and vitamin need of human body. Because of increased urbanization and change in human eating habits the global demand of meat has been increasing. At present, in Pakistan, poultry consumption is the key source of the general masses to get the mandatory protein and nutrients. The foremost impact of the poultry industry is to boost up nutrients value and provide an inexpensive and economical so...
Asim Faraz1*, Abdul Waheed1, Hafiz Muhammad Ishaq1 and  Muhammad Shahid Nabeel2 
...ric diets with different protein levels viz: one group with 18% CP and other group with 22% CP. Daily feeding allowance (@ 3% body weight) was calculated and adjusted according to fortnightly live weights. Water was provided twice a day. Daily weight gain was 953±50 and 996±40 g/d with 18% and 22% levels of protein ration, respectively while average DMI of concentrate, fodder and crop residues was 2.93±0...
Li Shengqing1,2,3, Zhang Xiyun2,3, Liu Shengcai2,3, Hu Guoyuan2, Fan Yuxia2,Liu Huaixin2, Wang Tingting2 and Zhang Yanming1*
...ly. The nucleic acid and protein sequences of the toxin exhibits 99% homology with those of a known type D botulinum neurotoxin gene, and the composition of the functional domain of the toxin is consistent with that of type D botulinum neurotoxin. For plateau pikas and plateau zokors, the LD50 values of intragastrically administered type D botulinum toxin is 6810 and 5840 MLD/kg weight, respectively, and those of orally administered type D botulinum...
Hesham Saeed1*, Manal Abdel-Fattah1, Ahmad Eldoksh1, Farid S. Ataya2 and Manal Shalaby3
...owed a 564-bp encoding a protein of 187 amino acids with a predicted molecular weight of 21 kDa. Basic local alignment search tool (BLAST) sequence analysis revealed that C. dromedarius IFNα gene shares high sequence identity with IFNα genes of other species, including C. ferus, Vicugna pacos, and Homo sapiens. Expression of C. dromedarius IFNα cDNA in Escherichia coli revealed a fusion
Xiujun Yao1, Haofeng Wang 2, Ligong Zhang3, Jingzhang Wu4 and Lijun Wang1*
...intervention, 24-h urine protein quantity, serum levels of IL-6, IFN-γ, and TNF-α ,kidney ROS and MDA levels, relative content of TGF-β1 and CTGF in TGP group were lower than that in model group (P <0.05); serum levels of IL-2 and CTLA-4,SOD levels in TGP group were higher than that in model group (P <0.05).These results indicated that TGP could reduce urinary protein quantity, inhibit inflammatory res...

Syed Muhammad Aun Naqvi1, Sara Tahir1, Tanveer Ahmed2*, Huma Naz3, Amara Gilani4, Atif Liaqat5

...d higher levels of crude protein and lipid percentage compared with W1 and W2. Highest ash (percentage) was measured in the gills of the weight group W3 as compared to W1 and W2. Generally, total carbohydrates are determined by the difference of the entire proximate body composition indices, and in this study, it was found that the liver contains maximum carbohydrates (percentage) relative to other sections of the body examined. Weight group W3 was found to ha...

Attaullah Jan1*, Saleem Khan2, Iftikhar Alam1, Farzeen Khan3 and Muhammad Farooq4*

...relation between age and protein and energy intake, and weight and energy and protein, showed that protein energy intake increased with increasing age and weight. Overall, both stunting and underweight were more common in girls than boys. Girls in general, had poor nutrient intake compared to boys, girls were therefore more likely to suffer from under-nutrition compared to boys.

...
Yawang Sun, Yongjiang Wu, Jingbo Chen, Zili Wang, Juncai Chen, You Yang and Guozhong Dong*
...complementation group D2 protein and Fanconi Anemia complementation group L had significantly higher gene expression at 100 ng/mL LPS level. The protein expression of phosphorylated histone 2AX showed a linear rise in the range of LPS levels from 0 to 12.5 ng/mL, then significantly declined at 100 ng/mL LPS level. Oxidative stress and oxidative damage to protein and DNA were induced by LPS...
Amreen Zahra1, Mushtaq A. Saleem1*, Hasnain Javed2, Muhammad Azmat Ullah Khan3, Muhammad Naveed1 and Abdul Rauf Shakoori4
...e of SNPs in the Gag-Pol proteins by molecular modeling approaches. Mutational analysis in our study revealed S61A, S61M, S61Y, S61G, S61Q and M90L as the most hypervirulent mutations. This induces a selection pressure and a rate of increased virulency on Gag-Pol cleavage sites. These results significantly highlight the fact that the identified SNPs possibly contribute towards a positive selection pressure contributing to the identification of novel mutations ...

Rabia Iqbal and Muhammad Naeem *

...ng levels of plant based protein diets (15%, 20%, and 25% crude protein) prepared from cheaper plant proteins, to keep minimum use of fish meal, on growth performance, survival and production of hybrid fry (Labeo rohita♀ x Catla catla ♂). The hybrid fry of mean 1.05±0.08 g body weight and 4.36±0.40 cm mean length were acclimatized and transferred to 8 X 6 X 3 ft. hapas. F...

Muhammad Ibrahim Kubar1, Fahad Nazir Khoso1*, Imran Khatri1, Niaz Hussain Khuhro2 and Arfan Ahmed Gilal1

Barış Bayraklı

...reeds densely, the crude protein (%13.52) rate was found to be the lowest compared to other months. In September, the crude fat rate (1.07%) was found to be the lowest, and in August, moisture was the highest. Among the essential amino acids (EAA) determined during the study, lysine reached the highest value each month followed by leucine and isoleucine, respectively. On the other hand, among the non-essential amino acids (NEAA), aspartic acid and glutamic aci...
Shuang Yang1,2, Huiting Zhao3, Xuewen Zhang2, Kai Xu1, Lina Guo1, Yali Du1 and Yusuo Jiang1,*
...uding 37 odorant-binding proteins, 35 chemosensory proteins, 33 olfactory receptors, 14 ionotropic receptors and 2 sensory neuron membrane proteins. The expression patterns of these genes were determined using the estimated fragments per kilobase of transcript per million fragments mapped. Among the 114 DEGs, 66 were expressed exclusively in the female antennae, whereas the remaining were ...

Arshad Khan1, Mohammad Ihsan1, Mohammad Nisar1, Ali Hazrat1*, Murad Ali3, Rashid Ul-Haq3, Khalid Khan2, Karishma Gul1 and Shah Faisal1 

...es of total seed storage protein resulted in a total of 18 polymorphic bands. Total genetic diversity on the basis of total seed storage protein analysis was 17.5%. In Band, the 14 total genetic diversity was (0.60%) followed by Band 16 (0.58%) and Band 17 (0.55%). Similarly, Band 3 showed diversity, while Band 8, 4 and 5 indicated 0.45, 0.38 and 0.35%, respectively. A cluster dendrogram tree was constructed which was divide...

Abdul Hameed1*, Ihtsham Ul Haq Padda1 and Abdul Salam2

...eholds were deficient in protein, with 58% in urban and 44% in rural areas. Micronutrient deficiency analysis shows that 22% of the survey households in Punjab, 30% in Sindh, 11% in KP, and 37% in Balochistan are suffering from iron deficiency. Besides, 57% of households in Balochistan, 56% in Sindh, 35% in Punjab, and 26% in KP experience deficiency of zinc. The vulnerability analysis of the survey data found 12% of the households at the national level to be ...

Saddar Faheem1,2, Hameeda Kalhoro1, Naeem Tariq Narejo1*, Muhammad Hanif Chandio3, Memon Samina4, Shahnaz Rashid5 and Ghulam Abbas5*

... serum constituents like protein, cholesterol and glucose were also assessed and it was reported that serum glucose was found more in male than female fish, while in male protein and cholesterol were high in female in summer. In winter season, female fish showed low level of cholesterol, though protein and glucose remained high. Based on the serum biochemical constituent data, it was concl...
Rahma Mohamed, Sara Nader, Dalia Hamza and Maha A. Sabry*
...hile capsular associated protein (CAP59) gene identified alone or associated with LAC1 gene in the other 2 C. gattii isolates. This study underlines a potential association of those fungi with human disease in Egypt. In order to strengthen existing therapeutic and control approaches, further analyses of the main risk factors and the other virulence of these pathogens should be further considered.
...

Sami Ul Haq1, Abid Hussain1*, Umair Riaz2, Muhammad Baqir Hussain1, Adnan Fareed1, Nabeel Ahmad Ikram3 and Fahim Nawaz3

...fur for oil contents and protein synthesis. A field trial was conducted to evaluate the effects of S application, alone or in combination with Compost containing sulfur-oxidizing bacteria (SOB), on the yield and growth of sunflower. Sulfur was applied as individual treatments (25, 50, 75 kg ha-1) and in combination with Compost (750 kg ha-1). The results showed a considerable increase in plant height (67.60%), chlorophyll b content (92.10%), stomatal conductan...

Ahmed A. Kheder

... amplify ~497bp for coat protein gene in RNA 2, the amplified product was confirmed with direct sequences. Phylogenetic analysis results indicated that SLRSV-Eg isolate under study (acc. no. MT648777.1), showed 65.9 – 99.5% nucleotide similarity with available homologous sequences from other crops. Reverse-transcription loop-mediated isothermal amplification (RT-LAMP) assay which is one of the most promising molecular diagnostic techniques was applied. T...

Syed Muhammad Sulaiman, Nazir Ahmad and Nazir Ahmad Khan*

...rom 6.01 to 7.90%, crude protein (CP) from 8.71 to 12.40% and crude fat (CFat) from 1.02 to 3.26%. The neutral detergent fibre (NDF) from 43.2 to 44.7%. The IVDMD varied from 48.4 to 58.9% and IVGP varied from 110 to 172 mL/g organic matter. Among the five wheat cultivars Bakhtawar-92 had maximum DM yield (2747 kg/ha), proportion of leaves (45%), CP (12.4%), IVDMD (58.9%) and IVGP (172 mL/g organic matter), and minimum portion of stem (55%) and NDF (43.2%), an...
Ying Yang 1,2,3, Tietao Zhang 1,2,3, Min Rong 1,2,3, JiaPing Xu 1,2,3 and Xiumei Xing 1,2,3*
...ulated with 32% of crude protein and increasing bean oil contents were fed to eight groups of mink. It were fed containing approximately 3, 6, 9, 12, 15, 18, 21 or 24% bean oil in the complete dry power respectively. Mink were voluntary feed intake was found to be dependent upon dietary energy content. Body weights were regulated by energy intake tended to increase at first and then decreased as the energy level was increased. The growth rate and voluntary fee...
Ala’audin Hakami,1AusamaA Yousif,2* Mohamed Zaki,3 Mahmoud Ismail,4,5 Ahmed Al-Ali,5 Abdu-Rahman Al-Ankari5 
.... A replicase-associated protein (Rep) gene-specific PCR was used to
amplify a 603 bp region of the viral genome. PBFDV was detected in
31.6% of clinical cases (3.5% of samples). Two positive samples were
collected during 2008, three during 2009, and one during 2010. Positive
samples were from clinical cases. Negative samples tested positive for bird
rDNA. In positive cases, feathers not blood, consis...

Hala K. Abdelmegeed 1, Eman M. Abohatab 1, Khattab,O. M. 1 , Salem, S.A.H. 1 , Arafa, A. 2, Nashwa M. Helmy 3

...ve for FMD non structure proteins( NSP) antibodies which indicated the natural infection. ELISA kit used for FMDV antigen detection for the epithelial suspension from 42 field samples collected from various geographic locations 10 governorates are ( El-Sharkia,Giza, Port Said, Assuit, Suize, Kafre El-Shake, Qina, Al-Gahrbia, Domiatte and Alexandria) Serotyping and molecular characterization by polymerase chain reaction PCR for (31) samples as FMD Serotype O , ...

Nashwa M. Helmy1 and Ahmed S. A.2

...es of FMDV nonstructural proteins (NSPs) are
useful in providing evidence of previous or current viral replication in the host,
irrespective of vaccination status. NSPs, unlike structural proteins are highly conserved
and therefore are not serotype specific and as a consequence, the detection of these
antibodies is not serotype restricted. The current study aimed on detection o...

Serag eldeen Sultana, M.W Abdel azeemb, Nahla Mohamed Eldamranyc

...it coated with AIV nucleoprotein and hemagglutination inhibition (HI) test against H5 and H9 antigens. The overall results using both ELISA and HI tests revealed that the prevalence of AIV antibodies was 12.6% (18/143). The seropositive samples represented 5/143 and 15/108 for ELISA and HI, respectively. The detection of both H5 and H9 antibodies in (4) samples indicated that co-infection may occur, while (10) samples were only containing H9 antibodies and (1)...

Aya El-Turkey1, A. K. El-Attar1, A. E. Aboulata1, B. Othman2 and K. A. El-dougdoug2

...-2 was isolated and Glycoprotein D (HSV-2gD) subunit was amplified using specific PCR primers.PCR product was molecularly cloned in t E.coli cells using PCR2.1/TOPO/ TA cloning vector. HSV-2gD fragment was liberated from 1 μg recombinant plasmid by using the restriction endonuclease EcoRI. HSV-2gD was successfully sub-cloned into binary plant expression vector PBI-121. HSV-2gD subunit-containing binary vector PBI 121 were transformed into Agrobacterium tumi...

K.A. El-Dougdoug1, A.R. Sofy2, A.A. Mousa2 and E.E. Refaey2

...concentration. Expressed protein
was differed in leaves of potato cultivars. Since PVY infection unexpectedly increased in
(Anabel, Sisi, Lady Balfor, Nicola and Execusa) or decrease of total protein in (Hermes and
Spunta). The potato cultivars (healthy and infected) varied in number and density of protein
bands. As well as specific bands wit...
Amro A. Farrag1; Ahmed K. El-Attar1; Om-Hashem M. El-Banna2; Ibrahim A. I.2; H. M. Mazyad 1 
...on-significant. The coat protein gene of
SLCV was PCR amplified from infected common bean plants. SLCV-CP was cloned in
pJET cloning vector and directly sequenced. The sequence alignment and phylogenetic
analysis showed a relatively high diversity among the three different isolates that the
identity ranged from 89 to 94%.
...

Amel, S.M. Abo-Senna1; M.A. Nasr-Eldin2; B.A. Othman3 and A.A. Megahed4

...in the nuclear inclusion protein b (NIb) coding region of the virus genome. The cytopathological effects of ZYMV on the infected cells were completely chloroplasts destruction, and deformation of vascular bundles. The effect of late ZYMV infection decreased fresh weight and yield of squash plants.

...

Amira A. Mazyad1; A. A. Kheder1; Ahmed K. El-Attar1; W. Amer.2; Mahasen, H. Ismail.2; Amal, A.F.1

...cific for the viral coat protein gene as a tool for molecular diagnosis. The PCR detection was confirmed with direct DNA sequencing and phylogenetic analysis for the coat protein gene. Further insurance of SLRSV infection was performed using light microscopy which showed presence of amorphous inclusion bodies, electron microscopy and chemical analysis.

...

AdlyAbd-Alla1,2, MahaNada3, Francois Cousserans1, and Max Bergoin1

...capsids showed two major proteins of 31 and 32 kDa
and a minor 78 kDa protein. Infection of third instar nymphs by feeding on contaminated food
induced similar disease symptoms and bioassay experiment confirmed virus concentration
response mortality. Injection of a purified virus suspension to third instar larvae of Galleria
melonella and Spodopteralittoralis failed to induce a...

Aly M. Abdel-Salam1 and Samah A. Mokbel2

...primer pair for the coat protein (CP) gene of Ilarvirus amplified products
similar to those produced from peach and apricot isolates of NRSV-infecting stone
fruits. Dot blotting immuno-binding assay (DBIA) showed positive reaction between
NRSV-infected apple sap and an Egyptian antiserum for NRSV. Purified preparation
from infected leaves, using the electro-elution technique yielded nucleo

Magdy, Mariam1 ; Abou ElHassan D.G. 2 ; and Salem, S.A.H 3

...tection of Non-Structral protein of FMDV by priocheck
test. Five hundred sera were collected from vaccinated cattle and buffalo from five Egyptian
governorates (Two governorates represent Delta region: El-Gharbia – Kafr El Sheikh , Two
governorates represent upper Egypt: El-Fayoum – El-Menya , and one governorate represents
central : El-Giza). The sera collected from diseased and apparent healthy anim...
Abd El-Hamid, M.I1, Seham, A.El-Zeedy1, El-Sanousi, A.A2, Reda, I.M2, Nehal, S. Saleh1, Abbas, A.M1
...ses on The envelope glycoprotein D of EHV-1 (EHV-1gD) due to its essential role in virus infectivity and its function in entry of virus into cells and is considered as one of the most potent inducers of virus-neutralizing antibody among the spectrum of EHV-1 proteins .A wave of Abortions has been recorded in El Zahraa stud for Arabian Horses ,collected samples were either aborted fetal tissues either Lung and livers as well ...

Abd El-Hamid, M.I1; Seham, A. ElZeedy1; El-Sanousi A.A2, Reda, I.M2, Nehal, S. Saleh1., Abbas, A.M1

...hraa/2014 using the glycoprotein D of EVH-1 due to its role in virus infectivity and its function in entry of virus into cells and is considered as one of the most potent inducers of virus-neutralizing antibody among the spectrum of EHV-1 proteins based on sequence analysis and multiple alignment revealed single nucleotide substitution at the base pair number 121 from the start codon which give lead to single Amino Acid Subs...

A. A. Rezk1,3, K. A. Alhudaib2 and A. M. Soliman2,3

...de sequence for the coat protein (CP) gene was carried out and submitted in GenBank under accession number JN083790. The phylogenetic tree showed that there are two big clusters and the identity between them 90%. The isolated CYSDV in this study is located in the second cluster with the isolates from Sudan, Iran and the other isolate from Saudi Arabia. The analysis showed that the highest nucleotide identities were 100% with other isolates that isolated from S...

Sahar A. Youssef1; Manal A. El-Shazly1,2; Azza G.Farag1,3; Eman A. Khattab1,2

...he partial RNA3 movement protein product from PNRSV infected rose directly cloned using the TA cloning system. Nucleotide sequencing revealed the clones to be portion of PNRSV genome. These results indicate that the virus in rose is an isolate of PNRSV from Taif, KSA.

...

Manar F. Seioudy1, Magda M. Sayed1, Ahmed A. El-Sanousi2 and M. A. Shalaby2

...cation of fragments of N-protein. All batches are also subjected to sterility tests for detection of bovine viral diarrhea virus as possible extraneous virus contaminant using RT-PCR and detection of mycoplasma as possible bacterial contaminant using PCR technique. All of the four batches were positive when tested using specific primers and they were free from BVDV or mycoplasma contamination. Results in this study showed that molecular techniques could be use...

Amany Adel1, Abdelsatar Arafa1, Hussein A. Hussein2 and Ahmed El-Sanousi 2

...ions 80 to 84 in the NS1 protein along all Egyptian isolates under study. Ala149, which is a pathogeneicity marker for interferon antagonism was found in the studied indicating capability of these viruses to transmit between different avian species. PL motif ESEV was found in 6 isolates from chicken and ducks circulating in such population whereas 17 viruses have ESKV similar to those reported in human in 2006. Based on NS1 sequence analysis of the H5N1 Egypti...

Radwa M. Shafie 1 and Soha S. M. Mostafa2

...sh and dry weight. Algal proteins were identified by the protein profile pattern using SDS-PAGE method. The contents of alkaloids, phenols and terpenoids in both algal filtrates and biomass were determined.

...

Lala Rukh1, Muhammad Nadeem1, Tusneem Kausar1, Mian Anjum Murtaza1, Muhammad Luqman2*, Muhammad Bilal Shahid1 and Amal Shaukat3

...der (by product) and soy protein isolate in date paste. Date bars were formulated after ingredients optimization and were analyzed for physico-chemical, in-vitro starch and protein digestibility, antioxidants and microbial count. Results showed that date bars are rich source of protein, fiber, carbohydrates and fat with good digestibility properties. Date pit powder and soy

Nashwa M. Helmy1, Ahmed S. Ahmed2, and Zeinab3 Y. Mohamed

...while the level of total protein, albumin and calcium showed significant decrease and non-significant reaction in creatinine and non-organic phosphorus in infected cattle. The results of antioxidant both malondialdehyde (MDA) and catalase enzyme (CAT) showed significant increase while level of gloutathion (GSH), total antioxidant capacity (TAC) and gloutathion peroxidas (GPX) showed significant decrease in infected cattle. Conclusion: Sero-survey, conventional...

Aly M. Abdel-Salam

...was used to amplify coat protein genes for the two viruses using specific primers. DAS-ELISA and immuno-blotting were used for evaluating the induced antisera. Results: Antisera for CYSDV and CVYV were produced efficiently and used for virus diagnosis through DAS-ELISA, DBIA, and TBIA. RT-PCR confirmed the nature of the two viruses. However mixed infection was noticed for CVYV and CVYV upon using duplex RT-PCR. Conclusion: Mixed infection with WTV is common an...

Ehab M. El-Nahas1, Hemat S. El-Sayed2, Sawsan S. El-Basuni3, Gabr F. El-Bagoury1

...nd 69 (Valine) of the S1 proteins from H120 and M41.The cross-neutralization test revealed antigenic relatedness of Egypt/Qal/014p with Massachusetts serotypes. The commercial H120 vaccine conferred partial protection against proventriculitis induced by Egypt/Qal/014p. Conclusion: IBV strains exhibiting proventriculitis were found co-circulating in broiler chickens in Egypt and optimum control of IBV in Egypt require preparation of vaccine from indigenous isol...

Salama M. El-Saghir1, 2

...e virus coat
protein using antiserum for PVS and the specific primer 5’TGGCGAACACCGAGCAAATG3’ (sense)
and 5’ATGATCGAGTCCAAGGGCACTG3’ (antisense).
Results: A specific antiserum for PVS detected PVS in commercial potato plants with I-ELISA and
DBIA. Further, IC RT-PCR confirmed the presence of PVS in Egypt for the second time; yielding 187
bp of the virus coat

Ayman S. El-Habbaa 1, Gabr F. El-Bagoury1, Samar F. El-Adaway2, and Susan S. El-Mahdy2

... inhibition (HI) test. F protein encoding gene of NDV was amplified using Reverse Transcription-Polymerase Chain Reaction (RT-PCR) then subjected for nucleotide and amino acid sequence detection. Results: NDV Giza 2014 isolate and NDV Qualubiya 2014 were characterized as velogenic and lentogenic strains, respectively using Mean Death Time (MDT), Intracerebral Pathogenicity Index (ICPI) and studying amino acid motif of the F protein

Shimaa M. Mansour, Reham M. ElBakrey, Ahmed Orabi, Haytham Ali, Amal A. Eid

...ence within ARV- sigma C protein revealed 7/18 positive samples. All positive samples (7/18)
were successfully isolated on specific pathogen free embryonated chicken eggs (SPF-ECE). Additional
RT-PCR testing and re-isolation of ARV from ECEs of a breeder flock of a history of uneven growth
and/or arthritis revealed ARV infection in six (6/60) examined ECEs.
Conclusion: These results indicated the incrimination of...
Ruqayya Bint Khalid1, Asif Nadeem1,2*, Maryam Javed1, Muhammad Zubair Shabbir3 and Masroor Ellahi Babar4
... is second most abundant protein of cow’s milk. β-caseingene is highly polymorphic. A1 and A2 are the frequently occurred variants. A1 is recognized as potential cause of several human diseases. It is important to evaluate the A1/A2 β-casein status in milk. Current study was conducted to molecular characterize the exonic regions of β-casein gene and to explore the status of A1/A2 β-casein type in Cholistani cattle breed of Pakistan. B...
Saira Gul1,2, Sohail Ahmed2*, Tahir Usman1*, Khalid Khan3, Sultan Ayaz1, Saleha Gul4 and Nawab Ali5
...ively. Two major surface protein genes (MSP1a and MSP4) sequence were compared with cattle isolates from different origins. Phylogenetic analysis of local isolates showed a close homology with the isolates from Australia, Brazil, Turkey and Japan. It was found that aged, exotic and crossbreed cattle were more susceptible to A. marginale infection in summer season compared to the younger and indigenous cattle breeds, respectively ...

Akram I. Aboelkhair1, Ayman H. El-Deeb2, Momtaz A. Shahin1 and Hussein A. Hussein2

...of LSDV with PCR using G-protein-coupled chemokine receptor (G-PCR)
gene primer revealed positive result for LSDV, So classical Isolation of LSDV was started by
inoculation of nodules on Chorioallantoic membrane (CAM) 9-11 day old SPF eggs, then adaptation
on Madin-Derby bovine kidney cell line ( MDBK ); confirmation of LSD isolated virus was done by
using Electron microscopy (EM) on suspension of cell culture pa...
Nagwa K. Meselhy1, Mohamed A. Abo El-khair1, Basem M. Ahmed2, Sherif A. El-Soally3,
Abdelhamid M. Fares1, Mohamed A. Nayel1 and Hussein A. Hussein2
...ment of
glycoprotein B gene (ORF 33), followed by sequencing and phylogenetic analysis.
Results: The study revealed that 19% of our samples were positive to EHV-1 and phylogenetic
analysis showed that the Egyptian EHV-1 isolates were more than 99% similarity to European
abortogenic isolates (EHV-1 strains: Army 183 and Suffolk/48/2013). Indeed, the analysis reports that
these viruses are circulating i...
Allam A. Megahed, Badawi A. Othman, Samar S. El Masry, Abeer A. Faiesal and Mohamed A. Nasr Eldin
...s
using coat protein gene specific primers with an expected amplicon of 520 bp. Electron Microscopy
examination revealed that, the viral particles were slightly flexuous rod shape with about 680 x 13 nm
in size. Ultrastructure analysis showed different degrees of chloroplast degradation in PVM-infected
potato leaf tissues.
Conclusion: Occurrence of PVM was detected and confirmed in commercial potato s...

Ahmed K. El-Attar1, Samah A. Mokbel1 and Om-Hashem M. EL-Banna2

...rformed for the AMV coat protein (CP) gene. An amplicon of the
predicted size (∼666 bp) derived from O. basilicum isolate was purified and cloned in E.Coli
into pCR®4-TOPO vector before proceeding to DNA sequencing and the alignment of
sequences.
Results: Electron microscope examination of negatively stained preparations from
symptomatic basil leaves revealed viral particles have a bacilliform...

Ahmed M. Soliman

...rs designed for the coat protein gene of CMV were used to detect the virus. RT-PCR products (657 bp) of coat protein gene of CMV were cloned and then sequenced.
Results: CMV was isolated from four vegetable crops (cucumber, tomato, pepper and watermelon) using ELISA and RT-PCR assays and the coat protein gene of the four isolates were submitted to GenBank. The CMV isolates show...

Samah A. Mokbel, Eman A. Ahmed, Hanan F. El-Kammar, Ahmed A. Kheder

...m. Detection of the coat protein gene of
CMV in infected leaves has been done by reverse transcriptase-polymerase chain reaction (RT-PCR),
and the appearance of 678 bp bands confirmed the expected size of such gene. Light and transmission
electron microscopy were used to study the cytological and histological changes that occurred in the
leaves of the sugar beet plant by the pathogen, as well as, to determine som...

Anila Kousar, Muhammad Naeem*, Samrah Masud, Abir Ishtiaq, Zara Naeem and Rabia Iqbal

... effect of three dietary protein feeds (15% CP, 20%CP, 25%CP) composed of plant protein ingredients, on elemental concentration in Genetically Improved Farmed Tilapia (GIFT) fingerlings, a developed strain of Nile tilapia (Oreochromis niloticus). Feed preparation criteria was based on cost effectiveness and local availability of cheaper plant protein feed ingredients. Ten specimens were ra...
Ramazan Erdogan1*, Mikail Tel2, Vedat Cinar2 and Ragip Pala2
...FAS), zinc-α2-glycoprotein (ZAG), adipose triglyceride lipase (ATGL), glucose transporter-4 (GLUT-4) and insulin receptor substrate-1 (IRS-1) in adipose tissue of rats fed on zinc picolinate supplement diet. A total of 42 male 8-week-old Wistar albino rats were randomly divided into 6 groups, each of seven; Control (C), Zinc picolinate (ZP), Chronic exercise (CE), Chronic exercise+Zin picolinate (CE+ZP), Acute exercise (AE), Acute exercise+Zinc picolinat...

Ibadullah Jan1*, Iqbal Munir2, Inamullah Khan3, Syed Muhammad Suhail4 and Aqib Iqbal2

... against multiple target proteins. It must also be screened for long-term toxicological and side effects to further investigate its safety profile.

...
Song Jiang1,2,3, Xianbin Mo1,2, Falin Zhou2,3, Jianhua Huang2,3, Qibin Yang2,3, Lishi Yang2,3 and Shigui Jiang2,3*
...tary levels of fish meal protein on body weight and survival of Penaeus monodon families. In this study, 5400 P. monodon from 36 families were mixed cultureed with two kinds of different dietary levels of fish meal protein (Diet A and Diet B) for 56 days to analyze the genetic parameters of body weight and survival traits, as well as the interaction effect of genotype and environment. The results showed that th...

 Yongmin Li1,2, Huabin Zhang1, Xiaoyou Wu1, Dongwei Li 2, Peng Yan1 and Xiaobing Wu1*

...sed twelve mitochondrial protein-coding genes of the newly sequenced and other reported species to assess phylogenetic relationships of Ranoidea. Phylogenetic analyses using maximum likelihood (ML) and Bayesian inference (BI) methods supported the sister-group relationship between ((Rhacophoridae + Mantellidae) + Ranidae) and Dicroglossidae. Within Rhacophoridae, two species of the genus Rhacophorus (R. schlegelii and R. dennysi) were clus...
Bingjie Zhou1, Hitesh Bhagavanbhai Mangukiya1, Siva Bharath Merugu1, Fakhar-un-Nisa Yunus1, Yuchen Fan1, Zhenghua Wu1,* and Dawei Li1,2,*
...ed gene belonging to the protein disulfide isomerase (PDI) gene family. AGR2 exists in both intracellular and secreted form, it is overexpressed in many types of cancer cells and also detected in extracellular space of solid tumor interstitial fluids. The intracellular AGR2 is critical in protein folding while secreted AGR2 function as a paracrine signal promoting tumor microenvironment formation. Beside cancer progression a...

Ahmed Ali Moryani1, Nasir Rajput1*, Muhammad Naeem1, Atta Hussain Shah1 and Hidayatullah Soomro2

... the percentage of crude protein and fat contents as compared to control and other groups. Histomorphological examination of liver of broiler chicken supplemented with Compound-I and Compound-II in the coccidiosis challenged broiler chickens showed few pathological changes as compared to control (coccidiosis induced and without supplementation) group. In conclusion, supplementation of herbs mixture (Group E and F) at the dose 2ml/L to the coccidiosis challenge...
Guan-bao Ning1, Sheng Niu1, Yue-jian Li1,2, Xiao-xiao Lu1,3, Shi-xiong Yang1,  Ali-Raza Jahejo1, Ding Zhang1, Wei-fang Hao4, Wen-wei Gao1, Yu-jun Zhao1, Jian-hui Li1, Fang Yan1, Rong-kun Gao1, Yu-hai Bi1,5, Wen-xia Tian1* and Ling-xia Han6*
...thway, mitogen-activated protein kinases (MAPK) signaling pathway, Janus kinase/signal transducers and activators of transcription (JAK-STAT) signaling pathway were involved in the response to MDV infection. The expression levels of all most differentially expressed genes (DEGs) in these four pathways were upregulated significantly at 14 and 22 dpi, indicating that the immune responses of erythrocytes were induced by MDV. This study may help to elucidate the m...
Asma Chaudhary1, Qurat-ul-Ain Ahmad1, Afia Muhammad Akram1, Mehwish Iqtedar2 and Javed Iqbal Qazi3,*
...c isolate enhanced total proteins, total lipids, DNA contents in G2, G3, average weight, weight gain in G1, G3 than both control groups and specific growth rate in G2. On the contrary carbohydrate contents were found to be decreased significantly in all experimental groups. Henceforth, it has been concluded that on the basis of survival data and body profile, Sphingomonas sp. AsCh--P3 could be used successfully as probiotic bacterium against the fish pa...

Jie Gao1, Guannan Wang1, Chuang Zhou1, Megan Price2, Jinnan Ma1, Xiaohong Sun1, Benping Chen3, Xiuyue Zhang2 and Bisong Yue1*

... A+T content (52.7%), 13 protein-coding genes (PCGs), 22 tRNAs genes, 2 rRNA genes, a control region (CR) and a non-coding region (NC). We found strong support for F. cinereiceps being placed within Sylviidae (superfamily Sylvioidea)and for babblers being separated into two families, Sylviidae and Timaliidae, with four subfamilies within Timaliidae. This is one of many taxonomic arrangements for babblers and there is likely to be continuous debate until...
Wenjuan Yan1, Qunlan Zhou2, Bo Liu2,3*, Cunxin Sun2, Huimin Zhang3 and Changyou Song2
...itrogenous (40.54% crude protein) and isolipid (6.16% crude lipid) diets with different I. cicadae levels (0, 100, 200, 400, and 800 mg Kg-1). Results revealed that I. cicadae significantly increased specific growth ratio (SGR) and protein efficiency ratio (PER), while decreased feed intake (FI) and feed conversion ratio (FCR). Meanwhile, I. cicadae significantly increased plasma ALT activity,...
Nabila Kousar1, Tanzeela Riaz2, Anum Feroz1, Abdul Rauf Shakoori3 and Farah Rauf Shakoori1*
...ycogen, trehalose, total proteins, soluble proteins, free amino acids and total lipids contents of 4th instars larva of most resistant GUW and least resistant LAB-S populations at exposure to LC20. Among the biochemical parameters glucose, soluble proteins and FAA contents were found to be elevated significantly whereas the concentration of total
Muhammad Mobashar1, Qazi Aqeel1, Muhammad Tahir Khan1, Assar Ali Shah2*, Ahmed A.A. Abdel-Wareth3, Salman Khan4, Nazir Ahmad1, Sami Ullah1 and  Haq Amanullah5
...dry matter intake, crude protein intake and organic matter intake (g/day) were significantly (P<0.05) affected in treatment groups. In-vivo nutrient digestibility, dry matter, organic matter, crude protein, crude fat, nitrogen-free extract (NFE), ash were significantly higher (P<0.05) in treatment groups, while in in-sacco degradability the DM and OM degradability at different time intervals (2h, 4h, 8h, ...
Arshad Khan1, Mohammad Ihsan1, Ali Hazrat1*, Mohammad Nisar1, Muhammad Laiq1, Maryam Bibi1, Nasir Ali2, Ulfat Naz1, Muhammad Zakria1, Nausheen Nazir3, Adam Khan4 and Muhammad Asif Nawaz5
...y, in total seed storage proteins, a total of 13 polypeptides bond were found with the total genetic diversity of (0.68%) found  in band 1, while in band 2, the variation was 0.63%. A cluster dendogram was constructed for total seed storage proteins and divided 7 sub clusters, where CA1 and CA69 were found the most diverse genotypes. The main aim of this study was to explore morphological variation in order to generate ...
Arbab Zubair Ahmad1, Farman Ullah1, Hayat Badshah2, Muhammad Shehzad Khan1* and Bashir Ahmad1
...dult moth emergence with protein and strong negative between development time and moisture content and carbohydrate was observed. Wheat proved to be suitable as host with high bio-chemical contents for mass rearing of S. cerealella that provide maximum moths in short duration and their eggs yield more of T. chilonis, thus recommended for production system of T. chilonis.

...
Kai Jin1,2,3, Chen Chen 1,2,3, Xinyu Sun1,2,3, Caiye Zhu1,2,3, Mahmoud F. Ahmed1,2,3,4, Qisheng Zuo1,2,3, Jiuzhou Song4 and Bichun Li1,2,3*
...hen the target genes and protein expression level in F2 transgenic mice, as well as fat content in F1 and F2 transgenic mice muscle were examined. Successful transgenic goats generation was identified by testicular injection. The results showed a developmental time specific SCD1 expression in the goat mammary gland tissue and muscular tissue. The rate of positive expression of exogenic gene and exogenic
Tanzeela Riaz1, Farah Rauf Shakoori2*, Syed Shahid Ali2 and Mushtaq Ahmad Saleem1
...lues. In case of soluble proteins, an elevation was observed which was followed by a decline after 72 h. Similarly, free amino acid contents showed increasing trend in both larval instars of tested populations throughout the exposure period with the exception of the 4th larval instars of susceptible population which decreased after 72 h. The concentration of glucose showed significant increase in 6th larval instars of both populations at ...
Zhengyi Fu1,2,3,4, Rui Yang2,3,4, Zhenhua Ma2,3,4*, Mingyang Han2,3,4 and Yifu Wang2,3,4
...of different dietary non-protein energy sources on growth performance, somatic parameters, histology and digestive enzymatic activity of barramundi (Lates calcarifer). Fish were fed ioso engery diets (18 kJ/g) with two types of non-protein energy sources in the experimental groups and a regular diet was used as the control. The feeding trial lasted for 56 days. Results from the present study indicate that, except...
Ewa Czerniawska-Piątkowska1, Iwona Szatkowska1, Daniel Zaborski2*, Wilhelm Grzesiak2, Sara Tabor-Osińska1, Małgorzata Wasielewska1Witold S. Proskura1, Wojciech Kruszyński3 and Edward Pawlina3
...s in milk yield, fat and protein percentage were found in the second lactation. In HO, significant differences in milk fat content and yield were observed in the third lactation. No significant differences were found for RW. The bioinformatic analysis allowed us to infer that transcription factors other than the ZFP217 protein bind to the sites located outside the C>T substitution. Further studies are required to elucidat...
Iram Liaqat1,*, Safdar Ali Mirza2, Sumera Sajjad3, Shaukat Ali1,*, Muhammad Faiz Qamar4 and Ikram Ul Haq5
...iated motility. Type III protein secretion systems of several gram-negative bacterial pathogens use flagella to invade foreign surfaces, host tissues and substrates. Flagellar biosynthesis and function in Salmonella typhimurium isregulated by >50 genes. Bioinformatics analysis of flagellar assembly in S. typhimurium identified several conserved structural elements. In this study, FliI a flagellar protein req...

Asim Faraz1*, Abdul Waheed1, Nasir Ali Tauqir2 and Muhammad Shahid Nabeel3 

...in rut-camels. The total protein, urea and creatinine concentrations varied non-significantly among animals. While the calcium and phosphorus concentration (P<0.05) was found to be 9.88±1.16, 4.77±0.8 and 9.06±1.18, 4.06±0.9 mg/dl respectively in August and February, lower in rut-camels. Such biochemical investigations are evident of the importance of serum bio-gram which has pronounced effect on sexual behavior and may be used f...

Jo Ik-Hwan1, Choi Kwang-Won1, Muhammad Yaqoob2 and Muhammad Fiaz3*

...all manure levels. Crude protein (CP) yield of triticale hairy vetch and pea mixtures was not different (P>0.05) across all manure levels. Yield of total digestible nutrients (TDN) was highest at 150 kg N/ha in triticale sole monocrop, followed by 100, 50 and 0 kg N/ha levels. The overall TDN yield in triticale vetch mixture with 100 kg N/ha was higher (P<0.05) than control and not different (P>0.05) from 50 and 150 kg N/ha levels. However, TDN yield ...
Yanhong Hu* and Linkai Cui
...doplasmic reticulum (ER) proteins. Comparative analysis of the prediction results showed EpFAR was localized to the ER membrane. These results, combined with the localization of other FARs, suggested the importance of ER as a related subcellular site of white wax biosynthesis.
...
Mengke Wang1, Shucheng Huang2, Cai Zhang1*, Haizhou Gong1
Shunan Cuan1, Shuaishuai Wang1, Qi Shao1, Wenhao Xu1, Sudan Meng1
Pengfei Li1, Yuqin Wang1 and Zijun Yang1
...5), the content of total protein (TP), albumin (ALB) and globulin (GLB) (p<0.05). Furthermore, supplementation of MAG increased the activity of total superoxide dismutase (T-SOD) (p<0.05), slightly increased the activities of total antioxidant capacity (T-AOC) (p>0.05) and catalase (CAT) (p>0.05). And the concentrations of malondialdehyde (MDA) were reduced in MAG groups, yet the differences were not significant (p>0.05). Notably, Liver weight, ...
Zhengyi Fu1,2,3,4, Rui Yang1,2,3, Shengjie Zhou1,2,3, Zhenhua Ma1,2,3* and Gang Yu1,2,3*
...d in L grade. Heat shock protein has no obvious rule in body length grade. L grade pro-inflammatory cytokines were up-regulated, but anti-inflammatory cytokines were down-regulated and inflammatory markers were up-regulated, indicating an obvious inflammatory response. The expression levels of S and M grade anti-inflammatory and proinflammatory cytokines was more balanced. This study provides the basis for finding the relationship between size heterogeneity an...
Li Ma1 *, Xu Han1, Bo Yang2 and Chunhua Zhou3
...of p16, p53, p21 and Bax protein was reduced significantly in the drug-treated cells and the expression level of Bcl-2 protein increased significantly. Taken together, kaempferol can inhibit cell apoptosis by protecting the oxidative damage in HUVECs, possibility by reducing p16, p53, p21 and Bax protein expression and increasing the Bcl-2 protein expres...
Ayman Balla Mustafa1, Abdalla Elgenaidi1, Aldukali Alkeskas1, Asim Faraz2,*, Ahmed Eisa Elhag3, Mohanad Bashari4 and Bernard Faye5
...stpartum. The total fat, protein, lactose, solid non-fat (SNF) and density percentages were determined by automatic milk analyzer device (lactoscan Model-90, Europe). Results elucidated that there was no significant difference of lactose and fat content between two groups throughout experiment period. Where the significant difference (P˂0.05) of protein, SNF and density contents of milk were detected during lactation stages...

Nasir Mahmood Cheema1*, Ghulam Shabbir2 and Nazakat Nawaz3

... acid, palmitic acid and protein but indicated no difference significantly (p>0.05) in oleic acid and ricin oleic acid. Among cultivars, DS-30 showed maximum oil content (49.356 %) and ricin oleic acid (87.978%). The most important component of castor oil the ricin oleic acid% was found highest by sowing date 15th July in all the varieties while highest oil content was also obtained with sowing date 15 July. The present research is the first report on oil c...
Diana Rachmawati1*, Johannes Hutabarat1, Olga Anne2, Roy Hendroko Setyobudi3 and Tita Elfitasari1
...mentation in the diet on protein digestibility, the efficiency of diet utilization, growth, and activities of digesting enzymes of E. fuscoguttatus. The sampled fish has an average weight of 4.24 g ± 0.023 g per fish. Diet used in the study contained 45 % protein with the supplementation of various amounts of B. subtilis varying in (0, 2.5, 5, 7.5, 10, and 12.5) % per kg of diet as A, B, C, D, E, and F t...
Ahmad Wahyudi1*, Sujono Sujono2, Listiari Hendraningsih2, Ari Prima2, Zane Vincēviča-Gaile3 and 
Ivar Zekker4
... shown to increase crude protein content and improve feed efficiency. However, its addition in Total Mix Ration (TMR) and also TMR silage on calves’ growth performance is yet to be elaborated. Therefore, the effect urea addition on TMR and its silage on performance of Friesian Holstein (FH) male calves were evaluated. The calves (n = 27; 5 mo to 7 mo, mo = month old) were divided into three groups, each group consisted of nine calves, based on age: 5 mo ...

Muhammad Dawood1,2, Naeem Sarwar2, Muhammad Umer Chattha1, Imran Khan1, Muhammad Bilal Chattha3*, Faiz Hussain4, Muhammad Mahmood Iqbal5, Muhammad Akram4, Hammad Husnain5, Muhammad Shahid5, Mussarrat Hussain6 and Muhammad Umair Hassan1

...eld (5.40 t ha-1), grain protein contents (12.54 %) and grain fiber contents (4.15 %) followed by Ujala-2015 and Punjab-2011 and Fsd-2008, however, cultivar, SH-2002 and Auqab-2000 performed poorly in terms of yield and quality. These results suggested that wheat cultivars i.e. Galaxy-2013, Ujala-2015, Punjab-2011 can grow successfully under Faisalabad conditions for getting good yield and quality. Moreover, these cultivars can also be used in future breeding ...

Muhammad Nauman1, Iftikhar Ali3, Nazir Ahmad1,2*, Fazli Ahad1 and Touheed Iqbal4

...recorded on oil content, protein content, oleic acid, glucosinolates, erucic acid, and linolenic acid. Significant genetic differences were observed for all the traits studied. Among parental lines, C-88 performed better for protein content (20.48%) and erucic acid content (50.31%), C-89 for oleic acid (36.15%), and linolenic acid content (10.18%). Among F2 populations, C-95 × C-93, C-88 × C-95, C-97 × C-95...
Aneela Hameed1, Faqir Muhammad Anjum2, Zia ur Rehman3, Saeed Akhtar1, Asim Faraz4*, Majid Hussain1 and Amir Ismail1
...stages. Decrease in fat, protein, lactose, solids not fat and total solids contents and increase in ash contents were noted in oxytocin administreted milk. Minerals’ analysis of the milk samples were conducted and it was found that lactation stages have significant effect on minerals composition i.e. macro minerals (Na, Cl, K, Ca, Mg and P) and micro minerals (Zn and Cu) in milk. Oxytocin administration showed significant effect on milk minerals during v...
Dong-Min Hou1, Ting Jia2, Chun-yan Liu1, Zheng-Kun Wang1 and Wan-Long Zhu1*
...xpressions of uncoupling protein 1 (UCP1) and Cd137, and the relative expressions of PR domain containing 16 (PRDM16), bone morphogenetic proteins 7 (BMP7), peroxisome proliferator-activated receptor α (PPARα), cyclooxygenase 2 (COX-2) and peroxisome proliferator-activated receptor coactivator 1α (PGC-1α) of WAT were measured. The results showed that body mass, food intake and RMR were decreased in
Anwar Khan1, Fareeha Nosheen2,4, Bushra Tabassum2*, Olawale Samuel Adeyinka2, Khurram Shehzad3, Naila Shahid2, Arif Muhammad Khan4 and Idrees Ahmad Nasir2
..."font-size: small;">Coat protein gene of potato virus X is a structural protein that plays a vital role in viral transmission and pathogenesis. RNA interference or post transcriptional gene silencing is a regulatory conserved mechanism that uses small interfering RNAs to control the expression of desired gene by inhibiting mRNA transcription. The present study aims to investigate the potential role of different siRNAs in dow...
Rizwana Sultan1, Asim Aslam1, Muhammad Yasin Tipu1, Habib ur Rehman2, Saba Usman1, Ahsan Anjum1,*, Muhammad Saeed Imran1, Muhammad Usman3 and Muhammad Zahid Iqbal3
...nine transaminase, total protein, total albumin, globulin, triglycerides and cholesterol values. Histopathological examination demonstrated degenerative changes, necrosis haemorrhages, and sloughing off epithelial cells of broad folds of caeca, mild lymphoplasmacytic infiltration in the periportal area of the liver and mild depletion of lymphocyte in the bursa of Fabricius. The seven clades of avian Eimeria species strongly support that E. nec...
Muhammad Javed Iqbal1,*, Muhammad Afzal1, Khalid Abbas1 and Muhammad Shahid2
...d the effects of dietary protein to energy (P/E) ratios on the nutrients and minerals digestibility of Labeo rohita fingerlings. Twelve experiment diets containing four protein levels (24, 26, 28, and 30 %) at three dietary energy levels (2400, 2700, and 3000 kcal/kg) with P/E ratios from 80.00 to 125.00 mg / kcal were evaluated. Ea...

 Song Jiang1,2, Xianbin Mo1,2, Falin Zhou2,3, Jianhua Huang2,3, Qibin Yang2,3, Lishi Yang2,3 and Shigui Jiang2,3*

...effects of two fish meal protein level diets (Diet A and Diet B) on the growth and survival rates of 36 families of Penaeus monodon. The results showed that significant differences were observed in the weight gain of different P. monodon families fed with the same diet(P<0.05). The AGR (absolute weight gain rate) of the fastest weight gain families was 97.16% and 95.46% higher than that of the slowest weight gain families fed with Diet A and Diet B, respect...
Ou-Mei Hao1*, Xue-Feng Wang1, Zhi-Jun Yue1, Chun-Hong Nan1,Yan Yu1,Tong Zhang2,Yu-Feng Liu3 and Xue Zhao1
...expression of surfactant protein A (SP-A), B7 homolog 3 protein (B7-H3), interleukin (IL)-12 and IL-13. The expression levels of B7-H3 and IL-13 were upregulated after MPP infection in the mouse model (P<0.05), while the expressions of SP-A and IL-12 were significantly decreased (P<0.05). After five days of therapy, the protein and mRNA expression levels of B7-H3 and IL-13 decreased,...

Sheikh Muhammad Azam1,2 and Muhammad Naeem1*

...mposition of water, ash, protein and lipids. Basic purpose of the present work was to avow nutritious status of Scomberoides commersonnianus. Therefore, current study analysis was performed to analyze body composition of the studied fish. A total of 73 specimens of S. commersonnianus having different size, ranged 94.5 to 1183g of body weight and 20.5 to 56.9 cm in total length were randomly chosen from Arabian Sea Karachi, Sindh, Pakistan for analysis of proxi...
Zhiyuan Sun1, 3, Xuhui Zhang2,*, Xian Li3, Yanping Huang3, Shiyan Sui3, Weifeng Liu3, Guochao Ni3, Xiaozhou Xu1, Jianbo Yang1, Xue Lian1 and Hui Jia1
...and T-NOS, iNOS and cNOS proteins (P =0.002, P =0.028 and P =0.003, respectively) and increased serum tumor necrosis factor alpha (TNF-α) concentration (P <0.01), but ACTH treatment has no significant effect on them. Neither ACTH nor LPS treatment had any significant effect on levels of pulmonary SOD, CAT and MDA secretion, as well as expression of IL-6, TNF-α, IL-10, COX-2 and TLR4 mRNAs (P >0.05). Pulmonar...

Mst. Deloara Begum1, Md. Muniruzzaman1, Md. Salauddin2* and Md. Mostafizer Rahman1

...ry rich source of animal proteins. The soft tissues of fish and aquatic environment are extremely susceptible to microbial contamination. In this research a total of 79 samples were collected from different local market. In which 54 samples were from dried fish and 25 from cooked fish samples. In this research there were 18 different types of dried fish and 6 types of cooked fish were used as a sample. Laboratory work was done by different bacteriological labo...
Vishal Ambidi 1,3, Sanjeev Bantewad2, Suraj Prasad Mishra1, Anupama Hingane1 and Jagdish Jaba1*
... the biochemical factors protein, sugar content in pigeonpea seeds exhibited significant positive correlation with correlation coffecient (r) being (0.710**, 0.843**), respectively with percent pod damage by pod borer complex. Whereas, total phenols, tannins, total flavonoids present in seeds showed significant negative correlation with correlation coffecient (r) being (-0.729**, - 0.650**, -0.783**), respectively with percent pod damage by pod borer complex. ...
Muhammad Hamza Tariq1, Mahjabeen Akram2 and Yasir Sharif3*
...Protein (S-protein). The present study aimed to investigate the phytochemicals as potential inhibitors of the binding domain of S protein so that the binding of COVID-19 with ACE2 receptors could be restrained. For this purpose, the library of 2113 phytochemicals was docked against the binding domain of the S-protein. Top ten compounds with maximum binding affinity to the act...
Nida Sadaqat1, Abdul Wajid2, Quratul Ain2, Muhammad Zia Akbar2Farkhanda Manzoor4, Muhammad Sarwar Khan1, Nasir Ali3,  Masroor Ellahi Babar3 and Tanveer Hussain3*
...t-encoded cellular-prion protein (PrPc) in the central nervous system (CNS) and in some peripheral tissues in sheep and goats. Scrapie resistant/susceptibility have been associated with the presence of PRNP gene polymorphisms. We analyzed the polymorphisms in PRNP gene sequences in 49 wild Punjab urial (Ovis vignei punjabiensis). Four novel amino acids polymorphisms (p.Q149E, p.Q155E, p.Y228L and p.L253F) were detected in...
Nasir Ali Tauqir1, Asim Faraz2*, Muhammad Arif1, Abdul Rehman1Imtiaz Hussain1, Abdul Waheed2, Gabriele Marino3 and Michela Pugliese3

 

...ncentrations (% of crude protein) were formulated and represented as high essential amino acids (HEAA), medium essential amino acids (MEAA) and low essential amino acids (LEAA) concentrations, respectively. The study lasted for 100 days; first ten days were given for the adaptation to new diets while every six days after every month of the remaining period served as collection periods. The intake (% body weight) of dry matter (DM), crude ...
Ho-Seong Cho1 and Yeonsu Oh2,*
...noembryonic antigen, fetoprotein and hepatocyte paraffin-1. Taken together, the tumor was diagnosed as cholangiocarcinoma. This is the first case report of a cholangiocarcinoma in the puma.
...
Nasir Ali Tauqir1, Asim Faraz2*, Annamaria Passantino3, Muhammad Asif Shahzad1, Rana Muhammad Bilal4, Adeel Tahir1, Hafiz Muhammad Ishaq2 and Abdul Waheed2
...ensable source of animal protein and it is speculated that the demand of animal protein will be increased by 60-70% in 2050 for human consumption and much of this share will come from developing nations. This research was executed to find out the nutritional influence of corn steep liquor and enzose mixture as a non-conventional protein ingredient in day old broiler chicks. For this purpos...
Junli Liu1, Tongfang Yang2 and Lisheng Wu3*
...c protease 3 (Caspase-3) protein expression in U2OS cells were detected by western blot, thiazole blue (MTT) and plate cloning experiments to determine cell survival and colony formation, flow cytometry to measure apoptosis, and quantitative real-time polymerase chain reaction (qRT-PCR) to assay LINC00857 and miR-340 expression. Bioinformatics and dual luciferase reports analyzed the targeting relationship between LINC00857 and miR-340. Cells were transfected ...

Rasool Bux Kalhoro1, Ghulam Mustafa Laghari2*, Ghulam Hyder Jamro2 and Muhammad Ibrahim Keerio2

...mportant oilseed andrich protein crop throughout the world.A two- years (2007-2008) fieldtrail was carried out to improve the soybean production under integrated agronomic practices.A three replicated experimental design was conducted, which consisted of three different seed rates (60, 75 and 90 kg ha-1) and row spacings (30cm, 45cm, and 60cm). The results exhibited higher plant 55.24cm and 55.14cm at 45 cm row spacing under the interaction of seed rate 60 and...

Syeda Shazia Bokhari, Aisha Waheed Qurashi*, Roheela Yasmeen*, Fouzia Yasmeen, Nabeela Nayab, Uzma Rafi

Iqra Mobeen1*, Rabia Arif1*,Maimoona Ilyas1, Siu Fai Lee2 and Muhammad Saleem1
...nal differences in their protein products.
...

Ayesha Muzamil, Hafiz Muhammad Tahir, Shaukat Ali, Iram Liaqat, Aamir Ali, Muhammad Summer

...ines are diverse form of proteins that act pro- and anti-inflammatory cytokines. The main component of immunity is IL-1. IL-6 cytokine play its role in regulation of metabolic reactions. The activity of various leukocytes is suppressed by IL-4 and IL-10 (anti-inflammatory cytokines) that triggers the production of pro-inflammatory cytokines. This review paper provides an overview of inflammation, its associated factors, causes and treatment and role of cytokin...
Longjun Guo*, Jiaqi Teng, Juan Wang and Yukun Chen
...spinal fluid τ (Tau) protein expression in leukoaraiosis patients. Inpatients who attended the Department of Neurology of our hospital from January 2018 to December 2018 were selected as study subjects, with 58 patients with leukoarais as the experimental group, and 60 patients without leukoarais in the same period as the control group. ELISA was used to detect τ (Tau) protein expression level in the cerebrospinal fl...
Jhan Zeb1*, Saiqa Tufail1, Nausheen Saboohi1, Zafar Samuel2, Asher Azeem3, Yaseen Amir4 and Sehrish Akram5
...luation of optimum lipid/protein level in pelleted diets for Labeo rohita (Initial weight; 2.87±0.01g). Four pelleted diets varying in their lipid/protein levels i.e. 7.5/25, 9.5/25, 7.5/30 and 9.5/30% were formulated and hand fed for 90 days to four groups of 10 fish each. Results of the present study showed that L. rohita attained significantly higher ...
Abdullah Abdo Albegali1, Tayyaba Aftab1, Atiq-ur-Rehman1*, Amir Rashid1 and Mayada Mohammad1,2
...erides, high density lipoprotein, low density lipoprotein, very low density lipoprotein, asparate aminotransferase and alkaline aminotransferase. The plant maintains the level of HDL to a normal range. It is concluded from the study that the plant may be supportive treatment in combating hyperlipidaemias.
...

Sadarman1, Agung Irawan2, Muhammad Ridla3, Anuraga Jayanegara3*, Nahrowi3, Roni Ridwan4, Ahmad Sofyan5, Hendra Herdian5, I Nyoman Guna Darma5, Teguh Wahyono6, Dewi Febrina1, Rakhmad Perkasa Harahap7, Rizki Amalia Nurfitriani8, Danung Nur Adli9 

...afe additives to improve protein utilization in ruminants. This study aimed to investigate the effect of tannins extracted from acacia and chestnut on the degradation kinetics of ensiled and non-ensiled soy sauce residue (SSR) in sacco. Two fistulated beef cattle (425±25 kg) fed a diet consisting of 80% Pennisetum purpureum and 20% concentrate was used to incubate the SSR samples (ensiled and non-ensiled) using a 6×11 cm standard nylon bag. Each S...
Weihao Chen1, 2, Zhilong Tian1, Lin Ma1, Shangquan Gan3, Wei Sun2, 4* and Mingxing Chu1*
...ted that the CRY and PER proteins may function in the circadian rhythm either as a complex or as individual, Therefore, we concluded that circadian rhythmicity may regulate the estrous mode of rams via clock genes within transcription/translation feedback/feedforward loops. This is the first study to systematically analyze the expression patterns of clock genes in rams.
...

Aftab Ahmad Sheikh1, Khalil Ahmed1*, Belqees Akhter1, Ghulam Qadir1, Muhammad Qaisar Nawaz1, Hafeezullah Rafa1, Abdul Wakeel1, Abdul Manan Saeed2

... (NFE), crude fat, crude protein, crude fiber, phosphorus, and calcium contents were envaulted at the physiological maturity of crop, four months after the sowing of crop. Results revealed that water salinity adversely affected the quantitative and qualitative attributes of sorghum crop and negative effects were more pronounced with higher level of salinity ECiw (10 dS m-1). Irrigation with higher level of salinity ECiw (10 dS m-1) decresed the plant height (9...
Ardi Prasetio1*, Christina Maria Sri Lestari2, Sutaryo Sutaryo2, Manar Fayiz Mousa Atoum3,4Muhammad Zahoor5, Asma Nisar6 and Muhannad Illayan Massadeh7
...al (SBM), as the primary protein source in rabbit ration, has some disadvantages. Protein value in Black Soldier Fly Larvae -BSFL (Hermetia illucens Linnaeus, 1758) is equal to SBM and better in the amino acid profile. However, the chitin contained in BSLF may cause subclinical inflammation by blood parameter detection. Thus, this study investigated the BSLF substitution effect on rabbit blood traits. This study was p...

Faryal Malik, Mudassar Nawaz Khan* and Israr-ud-Din

...g stress to 2.32 unit/mg protein at the end recovery period. SOD activity was increased from 2.27 to 3.15 unit/mg protein and POD from 1.71 to 2.39 unit/mg protein. The enzyme activities in Siran revealed the same trend as observed in Atta Habib. Recovery capacity was least in Ghanemat-e-IBGE. The results suggest that the tested three wheat varieties suffered oxidative stress due to floodi...

Dewi Ratih Ayu Daning1,2, L.M. Yusiati1, C. Hanim1, B.P. Widyobroto1*

...ct (P>0.05) microbial protein but 120 µL dose of galangal EO significantly decrease the microbial protein. At the genus level, galangal EO increases the abundance of Succinivibrio when added cineole showed a higher relative abundance than the controls. Methane production is positively correlated with the relative abundance of Prevotella, dry matter degradability, and propionate. As such, the addition of ga...

Sudip Debnath1, Dipta Sundar Sarker1, Pankaj Kundu1, Md. Shahin Parvez1, Shaikh Tareq Arafat1, Roshmon Thomas Mathew2, Yousef A Alkhamis2,3, Md Moshiur Rahman1, Sheikh Mustafizur Rahman1* 

...rvival, growth, and body protein content of swordtail in triplicates. Swordtail juveniles (initial weight: 0.46±0.03 g and length: 3.28±0.30 cm) were randomly stocked in glass aquaria feeding ad libitum two times a day. After four weeks of feeding trial, survival of swordtail juveniles was high (≥ 90%) in all treatments and remained unaffected by the dietary treatments (P > 0.05). Differences in growth performance were realized in terms of ...

Ahmed M. Elbaz*, Engy F. Zaki, Morsy A. S. 

...s a source of energy and protein on performance, blood metabolite, and meat quality in broiler chickens. A total of four hundred and eighty 1-day-old Ross 308 chicks were randomly divided into four experimental groups: Control (CON), 5% of quinoa seeds (QS5), 10% of quinoa seeds (QS10), and 15% of quinoa seeds (QS15) groups. Results indicated that increasing inclusion levels of QS improved body weight gain, feed conversion ratio, and crude
Tabinda Urooj1,*, Bushra Wasim1, Shamim Mushtaq2, Syed Nudrat Nawaid Shah1, Lubna Faisal3, Moazzam Ali2, Nabeela Rasheed1 and Syed Faizan Ali Rizvi4

Rehman Shahzad1, Saba Irshad1* and Faisal Amin2

... Influenza viral surface protein neuraminidase enhances both virus replication and its release from host cells. In this study we isolated nineteen H9N2 viruses from infected birds of various farms from Punjab, Pakistan. Neuraminidase gene of these viruses was amplified using RT-PCR and sequenced to perform mutational analysis. Phylogenetic analysis revealed that B2 sub-lineage is endemic in the country as all isolated H9N2 strains belongs to this clade of G-1 ...

Ho Shi Hui1, Eng-Keng Seow2, Nurul Huda1* 

...ffects on duck egg white protein that influenced the physicochemical properties of egg white. Hence, ultrasound treatment for 40 minutes was suggested to produce duck egg white with better physicochemical properties.

Keywords | Duck egg, Egg white, Physicochemical properties, Ultrasound, Foaming  

...

K.M. Injarul Haque, Sharmeen Islam*, Md. Rokibul Islam Khan, Md. Ruhul Amin 

...siling period. The crude protein (CP), metabolizable energy (ME), and organic matter digestibility (OMD) were improved (p<0.05) but dry matter (DM), crude fiber (CF), ether extract (EE), and ash were declined (p<0.05) in all the treatments (T1, T2, and T3) compared to control T0. In the consideration of results among all the treatments, T2 and T3 up to 28 days were desirable for the preparation of silage. To sum up, rumen content can be utilized in rice ...

Rehman Shahzad1, Saba Irshad1*, Malik Saddique Mehmood1 and Faisal Amin2

...C terminal region of NEP protein is conserved while C terminal region of effector domain (ED) of NSI protein exhibit mutations. These mutations are enhancing the total hydrophobicity of the molecules. Hydrophobicity was calculated by using Kyte and Doolittle method. High hydrophobicity of NS1 protein is also posing a potential for H9N2 virus to adapt in host, which might be contributing to...

Yan Jiang1,2, Xia Tao3,4 and Hongxia Chen5,6*

...on indices such as urine protein quantification (Upro), blood creatinine (Scr), urea nitrogen (BUN)), serum albumin (ALB), nephrin, and BAFF levels before treatment, 3 months after treatment, and 6 months after treatment were compared between the 2 groups. Results showed that after treatment, the total effective rate of the study group was 93.48% higher than that of the control group 76.09% (P<0.05). The clinical symptom scores of the two groups were lower ...

Tintin Rostini1*, Irwan Zakir1, Danang Biyatmoko2 

...y, organic matter, crude protein, NDF, ADF, daily body weight gain, feed conversion, and blood metabolism. Furthermore, the data obtained were analyzed using analysis of variance while differences between treatments were further analyzed with Duncan’s test. The results showed that yeast + curcuma (TR3) supplementation had a significant performance by increasing consumption, dry matter digestibility, organic matter, crude protein<...
Lin Ye, Jie-Lan Jiang*, Jia Xu, Rui-Ting Liu, Yin-Qiu Tian, Qing-Qing Zang, Jia-Yi Cao and Ming-Guang Mao*
...wed that TrCLCN5-deduced protein was a type III transmembrane protein and lacked a typical signal peptide. Conserved Domain analysis revealed that there was a Voltage_CLC domain and two CBS domains located in the TrCLCN5 deduced protein. qPCR analysis showed that TrCLCN5 was highly expressed in the intestine, kidney and liver, and up-regulated in gills under low-salinity stress in 3h to 6h...

Chunjie Song1, Shangquan Gan2 and Xiaoyun Shen1,3*

... of potassium (K), total protein (TP), albumin (ALB), globulin (GLB), and total antioxidant capacity (T-AOC) in the 3 drug delivery groups were extremely significantly higher (P<0.01) than that of control group, but there were no remarkable differences between the 3 drug delivery groups. The serum catalase (CAT) activity in the high-dose group was extremely significantly higher (P<0.01) than that in the low-dose group, gentamicin sulfate group, and contr...

Keqiang Wei1*, Yue Wei2 and Changxia Song1

...strong staining of these proteins in hepatopancreatic cells was observed. The synchronous expression of p38 and its phosphorylated form (p-p38) was mainly present in B- and R- cells, and their MOD values were 0.0055±0.0038 and 0.0046±0.0027, respectively. As its downstream transcription factors, both RelA (p65) and Nrf2 were widely distributed in the cytoplasm of B- and R- cells, but RelA (p65) showed a relatively higher MOD level compared to Nrf...

Mohammad Hussain Haidary1, Rozanaliza Radzi1*, Muhammad Waseem Aslam1, Seng Fong Lau1, Farina Mustaffa Kamal2, Ahmad Rasul Radzali1 

...findings. Elevated total proteins (96.5%) and hyperglobulinaemia (96.5%) were remarkable findings in biochemistry results. Thrombocytopenia was prominent and found in 70.9% of cats. Treatment options were varied; 39% (22/57) of the cats showed no signs of FCGS with various medical combination treatments based on owner observation, while 33% (19/57) succumbed to death. Partial and full mouth dental extraction was applied in 16/57 (28%) cats and result exhibite...

Zheng Tan*, Li Li, Yuxin Song, Meirong Tian and Fan Jia

...igh sensitive c-reactive protein in patients with CHD were observed and analyzed. The levels of serum endothelin, brain natriuretic peptide and high-sensitivity c-reactive protein were significantly higher in AMI group compared to UAP group, SAP group and the control group, p<0.05. The level of indicators in the UAP group was higher than that in the SAP group and the control group, p<0.05. Compared with the control gro...

Sameh Abdel-Moez Ahmed Amer1*, Mohamed Abdel-Aziz Kutkat1, Mohamed Mahmoud Abdel-Baki1, Asmaa Mahmoud Maatouq1, Omnia Mohamed Kutkat2, Hagar Magdy Ahmed1, Khaled Mohamed El-Bayoumi1 

...motive 112RRQKRF117 at F protein cleavage site. Furthermore, all isolates were clustered together with NDV genotype VII.1.1 (former GVIId) in a high similarity with previously reported strains from Egypt since 2012 till now, as well as with other neighboring and geographically close countries. In conclusion, the recent NDV outbreaks have been likely caused by the distinctive genotype VII.1.1 which seems to be the predominant strain circulated in Egypt. So as t...

Tran Thi Bich Ngoc1,2, Ninh Thi Huyen1,2, Nguyen Cong Oanh2, Pham Kim Dang2* 

...l tract digestibility of protein, organic matter, neutral detergent fiber, and phosphorus than those fed CONT diet. A significant decrease in ammonia (NH3) and hydrogen sulfide (H2S) concentrations were observed in diets with PROB or ORAC or PROR, with lower values for PROR diet. In conclusion, in grower-finisher pigs, dietary supplementation of either PROB or ORAC as a single product or their combination had improvements in performance parameters, nutrient di...

Jarmuji Jarmuji1,3, Lili Warly2*, Mardiati Zain2, Khasrad Khasrad2

...orm flour as a source of protein as a substitute for rice bran. The treatments were arranged as follow: P0= OPF + concentrate + 10% commercial sakura block, P1 = OPF + concentrate + 6% sakura block plus, P2 = OPF + concentrate + 8% sakura block plus, P3 = OPF+ concentrate + 10 % sakura block plus, P4 = OPF + concentrate + 12% sakura block plus, P5 = OPF+ concentrate + 14% sakura block plus. Supplementation of sakura block plus in OPF was able to increase rumen...
Indah Prihartini1*, Miftachi Ari2, Manar Fayiz Mousa Atoum3,4, Akhis Soleh Ismail1 and  Listiari Hendraningsih1
... efficiency of microbial protein synthesis using in vitro residual gas production and the optimal lignolitic probiotic in rice straw. The materials used were rice straw IR 64 cultivar and lignolitic TPG probiotic. The method used was Randomized Complete Block Design (RCBD) with four levels of treatments and three groups. In addition, a further test was conducted using Duncan’s multiple range due to a significant difference. The treatments were rice straw...

Lin Huang1, Ling Mai2, Keyan Zhong1 and Xinjun Chen3*

...opaei fatty acid-binding protein (SeFABP) and obtain its recombinant protein, the basic physio-biochemistry characteristics, signal peptides, antigen epitopes, transmembrane domains, secondary and tertiary structures, multi sequence alignment and molecular evolutionary tree of SeFABP were predicted and analyzed. On this basis, SeFABP was whole-genome synthesized and cloned into prokaryotic expression vector. The recombinant ...

Lanjie Li1, Jingjing Zhang2, Ruiyan Zhang2, Ning Zhang2, Zixiang Wei2, Guiqin Liu1,*, Riaz Hussain Pasha3, Muhammad Akram Khan4 and Saif-Ur-Rehman5

...e of hydrolysis (DH) and protein recovery (PR) were evaluated, and the chemical composition, antioxidant activity, and molecular weight distribution of oligopeptides in hydrolysates were studied. The optimum enzymatic hydrolysis conditions were identified at 5.96 pH, 0.7% enzyme-substrate ratio, 55ºC temperature and 3 h time. Under these optimum conditions, DH of 25.4%, PR of 95% was obtained. Moreover, hydrolysates were rich in oligopeptides, especially ...
Syed Makhdoom Hussain1,*, Hina Gohar1, Muhammad Asrar1, Muhammad Mudassar Shahzad2, Azhar Rasul1, Majid Hussain3, Muhammad Zubair ul Hassan Arsalan1, Nisar Ahmad4 and Aqsa Sharif1
...imate composition (crude protein, crude fat, ash, moisture and carbohydrates) were noted in fish group fed on 400mg/kg of polyphenols in diet. Hence supplementation of polyphenols at 400mg/kg was found to be optimum for better hematology, minerals absorption and carcass composition of common carp.

...
Damat Damat1*, Roy Hendroko Setyobudi2, Juris Burlakovs3, Zane Vincēviča-Gaile4
Devi Dwi Siskawardani1, Rista Anggriani1 and Anas Tain5
...tent, ash, carbohydrate, protein, fat, antioxidant activity, fiber content, water absorption index, color intensity, and sensory evaluation. The data were analyzed by ANOVA and continued according to Duncan’s multiple range test. The results showed that all formulas of analog rice produced from arrowroot starch, with the addition of seaweed pulp and spices, fulfill the chemical and physical properties of paddy rice requirements according to Indonesian Na...

Noura El-Shahat Attia1*, Abd El-Khalek Ramadan El-Sheikh1, Mohamed Omia Siam2 

...s), serum glucose, total proteins and serum Zn were significantly decreased. Moreover, while copper (Cu) and iron (Fe) were significantly increased (p<0.05). All diseased dogs were treated with Zn sulphate @10mg/kg orally and daily for 14 days, and the treated dogs revealed a marked improvement in clinical signs and other different hematological and biochemical parameters.

Keywords | Dogs, Zn deficiency, Dermatosis, Skin affection 

...

Jing Fu

...ific AT sequence binding protein 2 (SATB2 Group) and Cytokeratin 20 (CK20 Group) in mucinous ovarian tumors and their correlation with tumor pathological classification and prognostic outcome. One hundred and sixty cases of ovarian mucinous tumors diagnosed from January 2018 and January 2020 were selected. They were divided into four groups: mucinous cystadenocarcinoma group (age 62.78±7.92, n=53), borderline mucinous cystadenocarcinoma group (age 63.82...

Zhang Dong-jie1, He Xin-miao1,2, Wang Wen-tao1,2 and Liu Di1,2*

...nes encoding zinc finger proteins. Additional genes associated with myokinesis and lipid metabolism were also identified as under selection. Only SNARE (soluble N-ethylmaleimide-sensitive factor attachment protein receptors) interactions in the vesicular transport pathway were identified as under selection (P=0.0029). This study describes the genomic framework of the Min pig and identifies signatures of selection. These resu...

Wafaa M.A. Ghoneem, Reham R. El-Tanany and Adel E.M. Mahmoud*

...ssed as digestible crude protein. And there were insignificant (P<0.05) differences between G1 and G2 in the digestibility (%) of OM, CP, ADF, and TDN values. While the highest nutrients digestibility and nutritive value were recorded in G3 (2% zeolite addition) Rumen parameters were in the normal range and with insignificant (P<0.05) differences among groups. The pH values tended to increase but concentrations of ruminal NH3-N and TVFA tended to decreas...

Junaid Ahmad1*, Shazma Anwar1, Anwar Ali Shad2, Sher Shah Souri1, Bibi Amina3, Wajia Noor4, Abidullah1 and Muhammad Adil1

...d an important source of protein for a vast majority of the country and an important place in order to mitigate the protein requirements of increasing population. Mungbean has more protein contents and better digestibility than any other pulse crop. A field study was carried out at Agronomy Research Farm, The University of Agriculture, Peshawar in summer season 2018 with objectives to find...

Hong Yin*, Dan Yang, Ji-Jie Liu, Jing-Wei Ding and Dan-Dan Cui

...reasing high density lipoprotein (HDL) level in serum. The superoxide dismutase (SOD), glutathione peroxidase (GPx) activities and malondialdehyde (MDA) level were significantly increased in liver tissues with β-CM-7 treated. β-CM-7 decreased the fatty acid synthase (FAS) level significantly. The results suggest that β-CM-7 can change the dyslipidemia which is induced by aging. The mechanisms of the regulating effects likely tend to pass through...

A.H. Alqhtani1, A.S. Alharthi1, N.J. Siddiqi2, S. Zargar2 and A.M. Abudabos1*

...rs. However, total serum protein, gamma glutamyl transferase (GGT) and alkaline phosphatase (ALP) showed no significant differences between the groups. Thus, it can be concluded that probiotic, prebiotic and symbiotic in feed may cause some degree of liver damage as indicated by the release of AST and ALT in the serum.

...

Sana Khalid1,2*, Muhammad Zia-ur-Rehman2,3, Usman Hameed2,4, Shabnum Shaheen1, Muhammad Naveed Shahid5, Khajista Jabeen1, Farah Khan1, Muhammad Saleem Haider1

...tify;">Gemini virus coat protein (CP) is an important element of vector specificity and mandatory for insect transmission as well regardless of the type of gemini virus. This study was planned to conduct virus acquisition and transmission experiments using screen cages in an insectary for the period of one month. For this purpose non-viruliferous whiteflies (B cryptic species) were reared and used to acquire the viruses for 48-72 h from the agroinfiltered symp...

Kanakuntla Sandhyarani*, Dhoppalapudi Madhuri, Yadala Ravikumar 

...ium (>2%), high crude protein (> 30%), Hypovitaminosis A, Hypervitaminosis D3, dehydration, high sodium carbonate, Copper sulfate, mycotoxins in feed causes renal failure leads to gout. The managemental practices involves high brooding temperature thereby reducing the water intake and hence increasing chances of development of gout. In addition, products used on a routine basis and result into toxicity includes antibiotics, anticoccidials, manufactured c...

Muhammad Amin1*, Masarrat Yousuf1 and Naveed Ahmad2

... and 48 h and then total protein was estimated in the brain, gills and muscle tissues. Significant (p< 0.005- 0.00) decreased in total protein was noted in response to all the pesticides as compared to control group and a slight increase was also noted during 48 h as compared to 24 h. The level of total protein was decreased for pesticides in order of chlorpyrifos>malathion> lambd...

Shakila Mumtaz1, Khalid Javed1, Muhammad Dawood1*, Muhammad Imran2, Asad Ali1 and Nazia Ramzan1

...nd ration fed. Different proteins can be found in milk. Beta-caseins are thought to be more important because some serious health-related issues in humans have been reported with the consumption of A1 milk (mutated casein variant). This study was planned to investigate the polymorphism in the beta-casein gene (CSN2) in Sahiwal (40), American Holstein Friesian (40) and the crossbred (Sahiwal × HF) (50). PCR-RFLP and conformational sequencing were performe...

Jie He* and Ren Yang

...ced (P < 0.05), Bcl-2 protein expression was increased (P < 0.05), Bax protein and caspase-3 protein expression was decreased (P < 0.05). In conclusion, propofol and vitexin could up-regulate expression of Bcl-2 protein, down-regulate expression of Bax and caspase-3 protein, inhibit cell apoptosis, reduce live...

Qaisra Siddique1*, Sajid Abdullah1, Huma Naz2, Khalid Abbas1, Laiba Shafique1 and Qingyou Liu3

...(GST) activity and total protein contents in various tissues (gills, hepatic, renal, brain, muscle and cardiac) of Labeo rohita was determined. Fish was exposed for 60-day and sampling was done after 7-day. Results showed that the GST activity was considerably increased in L. rohita as compared to control. The GST activity was enhanced in various tissues (hepatic, brain, cardiac, gills, renal and muscle) of CPF treated fish as compared to control group. Compar...

Nuzhat Naseem, Sajid Abdullah and Sana Aziz*

...increased the crude ash, protein and fat significantly in proximate composition of whole-body of the fish and hence, improved the meat quality of Labeo rohita fingerlings.

...

Fatma Desouki Mohammed Abdallah

...urces for human feeding (protein source) then, statistical analysis of animal characteristics is of great importance. The objective of this paper was to explain and apply an important statistical method called principle component analysis to extract new carcass trait components of Japanese quail from old variables. The idea of this method is that it forms a new variable (linear combinations of them) by reduction the dimension of the data for a large number of ...
Alshimaa A. Hassanien1*, Asmaa Osama Tolba2, Asmaa A. A. Hussein3, Walaa M. Elsherif4
...tural agents of cow milk proteins such as casein and α-lactalbumin on S. aureus isolates of chicken and beef meat and human. Bacteriological culture and PCR were used for S. aureus detection in 150 meat products (50 grilled chickens, 50 grilled beef kofta, and 50 cooked beef meat) as well as 92 food handlers. 23S rRNA gene sequencing was done. Disk diffusion method was used for antimicrobial resistance detection, while the impact of casein and α-la...

Mohamed Saeed M. Hassan¹, Hitham Abdel-Saeed1*, Kawkab Abd El Aziz Ahmed2, Ossama Mohamed Abdou1 

...and 3 (P≤0.01). Total protein decreased significantly in sub-groups 1and 3(P≤0.001), sub-group 4 (P≤0.01) and sub-group 2 (P≤0.05). All results were in comparison with apparently healthy group records. Etiopathological identification of canine anemia in the light of hematobiochemical status is helpful for further investigations and therapeutic protocol decisions.

Keywords | Anemia, Dogs, Etiopathologies, Hematology, Biochemistry. 

...

Heba El-Zahar*, Zeinab Abd El-Rahman, Abbas El-Naggar 

...evaluation of C-reactive proteins (CRP), haptoglobin and fecal calprotectin concentration as prognostic markers in dogs with IBD. After a detailed clinical, laboratory and ultrasonographic examination 21 IBD dogs with symptoms of chronic gastrointestinal diseases were chosen for the study. In addition to 11 healthy dogs served as control group. In comparison to controls, hematological analysis revealed significant variations (p<0.05) in total leukocyte coun...

Naila Shahzadi1, Hafiz Muhammad Tahir1*, Shaukat Ali1, Muhammad Farooq Bhatti2, Azizullah1, Shafaat Yar Khan3, Abdul Khaliq4

...ous nutrients like Amway protein, honey, bovine milk, sericin, probiotics (Bacillus cereus, B. subtilis, B. amyloliquefaciens, B. licheniformis, Lactobacillus casei, Saccharomyces cerevisiae and Spirulina), vitamins (C and E), royal jelly, ascorbic acid, cowpea seed powder, AgNPs, secondary metabolites (phenols flavonoids, phenolic amino acids and proline) and white hen’s egg at different larval instars. Economic parameters (pupal weight, shell ratio (%)...

Muhammad Hanif Khan1, Syed Muhammad Suhail2, Hayaz uddin1, Aitbar Khan3, Rashid Ahmed Magsi3, Rajwali Khan2*, Iftikhar Ahmed2, Asim Ijaz2 and Khalid Khan2

...ion produced higher milk protein (3.43±0.04%). Higher (P<0.05) total milk solid not fat (SNF) content was recorded for animals fed with 20g yeast culture ration. Daily feed intake was significantly (P<0.001) different among groups, highest mean daily feed intake of 38.74±3.36 kg/day was found in group C. Economically ration having 40g YC produce 145.04 liter more milk, worth (145.04 X 70 = Rs.10152.8/-) than control group, while extra cost ...
Hanan A. Abo-State*, Mosaad M. El-Monairy, Yasser A. Hamouda, Hussein M.A. Hassan
...t contained 30.36% crude protein and 3879 kcal kg-1 gross energy with different levels of PSO (0.0 (control), 25%, 50% and 75% from the source of vegetable oil that was added to the basal diet). Fish (300 male) were distributed randomly into four groups (4 groups x 3 replicate x 25 fish of each). All groups were fed diets twice a day during the trial period (56 day) at 5% of body weight for the first two weeks thereafter at 4% for the last period. The results ...

Sana Shakoor, Tahir Rehman Samiullah, Naila Shahid, Abdul Qayyum Rao*, Aneela Yasmeen, Sana Tahir, Ayesha Latif, Saira Azam, Ahmad Ali Shahid and Tayyab Husnain

...s. The specificity of HA protein produced from E. coli was confirmed through an antibody-antigen reaction on the nitrocellulose membrane. The appearance of 67 KDa protein on the nitrocellulose membrane confirmed its specificity. The intraperitoneal immunization of mice with HA protein along with enhancer (ferund adjuvants) was done and produced antibodies in serum was detected by immunodot...

Fan Da1,3, Zheng-Yong Wen1,2*, Xiao-Dong Wang4 and Yu Luo5

...gn: justify;">Uncoupling protein-2 (UCP2), an important member of the inner mitochondrial membrane protein families, plays pivotal roles in energy expenditure, fatty acid metabolism and ROS emission in mammals. In contrast to mammals, the roles of this protein are still rarely known in fish. Here, we first identified the ucp2 gene in yellow catfish (Pelteobagrus vachelli) and investigated ...

Safaa M. Barghash1*, Amani A. Hafez2

... AST, ALP, and the total protein compared to control values. T. evansi developed protection against both vaccines with increases in α-TNF, γ-IFN, IL12, and IL6 levels, and lower in IL-10 levels. The differences in cytokine levels against the two vaccines pointed to a significant role in the immunosuppression of T. evansi on vaccines confirmed by severe changes in the lung by different degrees. We concluded T. evansi spoils vaccines and produces poo...

Amal Hamad1, Ashraf M. Abu-Seida2*, Faisal A. Torad2, Nahed S. Thabet3, Shabaan M. Gadallah1

...s, serum levels of total protein (TP), albumin, urea, creatinine, creatinine clearance and serum enzymatic activities of alanine transaminase (ALT) and aspartate transaminase (AST) along the whole experiment. Meloxicam induced no sedation, no behavioral changes, insignificant increase in heart rate, significant increase in systolic, diastolic and mean blood pressure and significant increase in respiratory rate after 15 and 30 minutes. In conclusion, meloxicam ...

Ly Thi Thu Lan1, Nguyen Thi Anh Thu1, Lam Thai Hung2, Nguyen Thi Hong Nhan3, Le Thanh Phuong4, Nguyen Trong Ngu3* 

Muhammad F Tajol Ariffin1, Chai M Hian1, Muhammad Z Sukiman1, Mohd F Ghazali1, Siti M Zainal Ariffin2* 

...to determine acute phase protein (APP) and its association with somatic cell count (SCC) during experimentally induced subclinical mastitis in goats. Thirty lactating goats were divided into two groups (n=15 per group) challenged either by intramammary infusion of 1 x 103 cfu/mL Staphylococcus aureus (S. aureus) or phosphate-buffered saline (control). The haptoglobin (Hp), serum amyloid A (SAA) and α1-acid glycoprotein...

Nazakat Nawaz1, Nasir Mahmood Cheema2*, Malik Muhammad Yousaf3, Muhammad Jahanzaib1, Mubashir Ahmad Khan1 and Muhammad Munir4

... cm, oil content 53% and protein content 28%. It was also evaluated under natural field condition to check its potential and tolerance against fungal disease and insects. The subject line is rated as moderately resistant to fungal attack. At the same time, it is 10 to 15 days earlier than check varieties i.e. BARD-479 and Golden. PG-1090 has been approved by concerned authorities as a new variety with the name NARC-2019 for cultivation in rain-fed as well as i...

Yaruq Jabeen1, Nida Ansari1, Haroon Rasheed1, Muhammad Asif Rasheed1,*, Muhammad Awais2, Muhammad Ibrahim1, Sumaira Kanwal1, Aqsa Khalid3, Manzoor Ahmad Zahid4 and Farrukh Jamil1,*

...cking of a ligand into a protein by seven steps. For docking analysis of several ligands, AutoDock Vina is a time-consuming tool. In order to make AutoDock Vina more efficient and smart way, a platform has been developed in this study. It is designated “Let’s Dock”. By using this platform, we can perform a docking analysis of several ligands into a protein with AutoDock Vina by just submitting ligands and <...

Ji Xu, Zhonghua Liu, Zhenhai Cui and Wenhai Zhao*

...of Bax, cleaved-caspase3 protein were significantly increased (P <0.05), the protein level of Bcl-2 was significantly reduced (P <0.05), and the expression level of miR-99a was significantly reduced (P <0.05). After GSTT treatment, the levels of inflammatory factors IL-6, TNF-α, and IFN-γ were significantly reduced (P <0.05), the apoptosis rate was significantly reduced (P <0.05), and the

Sheng Dong1*, Ning Li2, Jiawei Zhang2 and Ting Wang2

...8, GRP94, and Caspase 12 protein expressions. We found that DS enhanced the proliferation of high glucose-induced podocytes (P<0.05), increased the number of clones formed (P<0.05), reduced the apoptosis rate and GRP78, GRP94, Caspase 12 protein levels (P<0.05), and increased Nephrin protein level (P<0.05). High glucose-induced podocytes had increased KCNQ1OT1 expression level ...

Hamdy Abdala Elnagar*, Wael Mohamed Wafa, Moataz Ibrahim Badwy, Abdelaziz Mustafa Sakr 

...etween blood plasma (BP) proteins and seminal plasma (SP) proteins in low and high fertile buffalo-bulls. Also, the relationship between protein profile in BP of adult bulls and bull calves were studied. Blood samples were taken from 3 calves (128.33±7.58 kg and ageing 6 mo.) and 10 bulls (400±37.5 kg and 24-25 months of age) and semen samples from bulls. Semen was collected ...

Taiwo Oladoye Akande*, Dayo Johnson Ogunyemi, Priscilla Funmilola Okunlola, Emmanuel Owolabi, Odetayo Olakanmi 

...rol, and low-density lipoprotein (LDL) were lower (P<0.05) in groups fed with PFAs. All the PFAs significantly increased the HDL above the value obtained in control. No mortality was recorded throughout the experimentation period. It was concluded that the three PFAs and their mixture used in this study improved the performance, nutrient utilization, and carcass traits of broilers. The overall benefits accrued in birds fed with the blend of the PFAs. While ...

Ejaz Ali and Nageen Hussain*

...t encodes a gap junction protein involved in the homeostasis of the inner ear by recycling potassium ion. This research aimed to find out mutations in the GJB2 gene and its protein structure. Both control and patient samples were collected from Gilgit-Baltistan for DNA isolation and PCR was done by using a specific primer while sequencing was done by Sanger sequencing. Mutations were detected by Mutation Surveyor and BLAST. ...

A. Samy1*, H.M.A. Hassan1, Fatma T.F. Abd-El Ghany2, Shama H. Morsy2 

...significantly meat crude protein (P<0.05) while, decreasing moisture and fat levels. Digestibility coefficients of CP, CF, and EE, as well as the nutritive values of TDN, DCP, and DE, were considerably improved (P<0.05), although DM, OM, and NFE digestibility was unaffected in all treatments. Considerably, Addition of curcumin or garlic extract boosted final weight, weight gain, and feed efficiency compared to the control group. Dietary treatments were s...

Mohamed Mohamady Ghanem1*, Yassine Mahmoud Abdelraoof1, Abdelghany Hefnawy Abdelghany2, Eman Abdelhamid El-Ebissy3, Ahmed Ragab Askar4,5, Attia Ahmed Eissa6  

...albumin, globulin, total protein, A/G ratio, Na, Cl, Ca, P and Mg. Examination of ruminal fluid showed a significant increase (P < 0.05) in SAT, MBRT, and a significant decrease (P < 0.05) in ruminal pH, protozoal count and activity. Ultrasonographically, there was significant increase (P < 0.05) in ruminal wall thickness, reticular wall thickness, and small intestine diameter. The content of abomasum and small intestine appeared more echoic. Treatmen...

Nuraini Nuraini*, Mirzah Mirzah, Yuliaty Shafan Nur, Harnentis Harnentis 

...roliferates and has high protein but contains high fiber. Therefore, fermentation with lignocellulolytic fungi was carried out to improve the nutritional quality of Azolla microphylla. This research has 2 phases. Phase 1, determination of the best types of lignocellulolytic fungi on the nutrient quality of fermented Azolla microphylla. This study used an experimental method with a Completely Randomized Design (CRD). The treatments were the types of fungi, name...

Hosny Kesba1, Ashraf Suloma2, Samy Sayed3*, Abdullah Abdel-Rahman1 and Shaimaa Diab1

...tent regarding the total protein, total amino acids, and total carbohydrates in both tested soil types. These results suggest that aquaculture effluents from tilapia production could be utilized to manage M. incognita in different soil types.

...

Majid Hussain1, Syed Makhdoom Hussain2, Razia Iqbal3, M. Mudassar Shahzad4,*, Syed Zakir Hussain Shah3, Afia Muhammad Akram4, Nisar Ahmad5 and Muhammad Zubair ul Hassan Arsalan2

... 5%). Maximum body crude protein and crude fat contents were observed in C. mrigala fed 2 % and 3% CA supplemented diets, respectively. Moreover, fingerlings fed CA acidified diets showed significant improvement (p< 0.05) in hematological parameters compared to control diet. Comparison of treatments showed maximum values of RBCs (2.83×106mm-3), WBCs (7.76×103mm-3), PLT (65.96), Hb (8.47 g/100ml), PCV (24.51 %), and MCV (187.11 fl) in fingerlings...

Min Li1, Shiwu Deng2*, Yiqian Peng3 and Hong Li2

...JNK, Caspase-12 and CHOP protein in MIRI + DEX group decreased significantly (P<0.05), while the expression of GRP78 increased (P<0.05). It is concluded DEX can alleviate mitochondrial damage induced by ischemia reperfusion, inhibit excessive endoplasmic reticulum and improve myocardial function.

...

Muhammad Idrees1, Bashir Ahmad2, Muhammad Waqas1, Syed Muhammad Mukarram Shah3 and Saad Ahmad Khan4

...lecule inhibitors of the proteins encoded by the drug resistant genes, i.e., katG, gyrA, pncA and rpoB of Mycobacterium tuberculosis (M. tuberculosis), were identified using computational methods. In the ligand base pharmacophore, an already reported four ligands for the four proteins encoded by the resistant genes of M. tuberculosis were selected for the generation of pharmacophores. The validated pharmacophores model of al...

Roshana Mukhtar1, Shaheen Shahzad1*, Sajid Rashid2, Maryam Rozi2, Madiha Rasheed3, Imran Afzal4 and Pakeeza Arzoo Shaiq5

...f pathogenic mutation on protein structure. In-silico analysis and comparison between UROSL237P and UROSWT 3-dimensional structures revealed remarkable changes in the binding site of Urogen (3-[7, 12, 18-tris (2-carboxyethyl)-3, 8, 13, 17-tetrakis (carboxymethyl) 5, 10, 15, 20, 21, 22, 23, 24-octahydroporphyrin-2-yl] propanoic acid) due to narrowing of domain-I and domain-II (18.46-12.17Å) of UROSL237P as compared to UROSWT. This suggests that UROS L237P...

Muhammad Altaf1* Arshad Mahmood Abbasi2, Muhammad Shoaib Amjad3, Sadia Naseer1 and Muhammad Umair4

...ll RNA viruses and has 4 proteins i.e. envelope, spike, nucleocapsid and membrane. Coronaviruses are classified into 4 genera: Alphacoronavirus, Betacoronavirus, Gammacoronavirus and Deltacoronavirus. Betacoronavirus most probably originated from bats and the virus may have jumped to avian species and evolved as Deltacoronavirus group. The avian coronaviruses jumped among other avian species, giving rise to Gammacoronavirus from Deltacoronavirus, while Betacor...

Jabbar Khan1, Mehwish Jehan1, Zeeshan Mutahir2, Muhammad Rafi1, Muhammad Ismail1, Aamer Abbas1 and Jabbar Tanveer3

... concentrations of total protein, cholesterol, albumin and glucose were found significantly higher in Damani breed than control group, indicating that Damani breed had comparatively better adaptive capabilities in preparing the internal physiology and metabolic processes in response to heat-stress environmental conditions. Hence, vitamin E, in combination with Se improved the physiological and biochemical profile of blood in Damani goat.

...

Xiaopeng Tang1*, Kangning Xiong1 and Rejun Fang2*

...n of glutamine transport protein Na+-dependent neutral amino acid transporter (ASCT2) and protein expression of ASCT2 were measured. The results showed that LPS significantly (P<0.05) decreased the gene and protein expression of ASCT2 in IPEC-J2 cells. EGF significantly (P<0.05) promoted the gene and protein expression of ASCT2. EGF plus LPS group ...

Ahmed M. Darwish1*, Hassan R. Darwish1, Dalia M. Mabrouk1, Mohamed A. Abdelhafez1, Ahmed M. Abdel-Salam2, Ibrahim E. Mohamed3, Ibrahim M. Farag1 

...l of hydrogen (pH), fat, protein, lactose, and solid not fat (SNF) were determined by biochemical methods in all milk samples. Different genotypes of β-LG and LEP genes were detected by single-strand conformation polymorphism (SSCP-PCR), and then validated by sequence analysis. The results of SSCP-PCR showed a monomorphic pattern for the β-LG gene and a polymorphic pattern for the LEP gene. The sequence analysis showed that the β-LG gene has one...

Xian Zhang1, Erjiang Lin1, Shizhe Hong1 and Zhengjie Zhu2*

...beta; and β-catenin proteins; and flow cytometry was used to detect cell apoptosis rate and mortality rate. SSAT was successfully transferred into prostate cancer LNCaP cells. Compared to the blank cell group and the blank vector group, the expression of Akt, GSK-3β and β-catenin proteins in the SSAT transfection group was significantly down-regulated (P <0.05), the cell proliferation was significantly inhi...

Arab Khan Lund1*, Atta Hussain Shah2, Gul Bahar Khaskheli2, Mool Chand Malhi3, Ahmed Sultan Jatoi4, Abdul Samad Mangsi5 and Asad Ali Khaskheli6

..., non-casein (NCN), whey protein nitrogen (WPN) and whey protein denaturation (WPD) were significantly (p<0.05) varied at different heat treatments in contrast to control (T0). The variation was also observed in conductivity, refractive index, moisture, fat, protein and lactose content, however, it was non-significant (p>0.05). Results are concluded that the nitrogen fractions marked...

Aml M. Ragab1*, Maha R. Basyoni1, Enas A.I. Khoris2, Nadia A. Abd Elghany3 

...inine with reduced total protein, albumin, globulin, and albumin: globulin ratio. While in the treated group, reversible changes occurred.

Keywords | B. cereus, Enterotoxigenic genes, PCR, Phylogenetic tree, Fish 

...

Alaa Jaheen*, Noha Salem, Mohamed El-sherif 

...antioxidant changes, and protein and lipid profiles in horses suffering from equine eczema. Thirty (30) horses were included in this study (20 males, 10 females), classified into the healthy control group (n = 10) and the equine eczema group (n = 20). All horses were subjected to a complete physical examination. Blood samples were collected for hematological profile and estimation of serum concentration of total antioxidant capacity (TAC), malondialdehyde (MDA...

Ibrahim Samir Abd El-Hamid1*, Wafaa Adel Abd Fouda1, Hesham Attia Shedeed1, Safaa Ali Mostafa1, Ahmed Mohamed Elbaz2, Salah Abo Bakr2, Baliegh Hamdy Mosa1, Ali Saber Morsy1, Amal Mohamed Hasan1, Khamis Refaay Emam3 

...esults showed that total protein (TP) and globulin (GLO) concentrations increased (P<0.05) in treatment groups compared with control. Levels of albumin (ALB) and aspartate aminotransferase (AST) decreased (P<0.05) in Tr2 compared with Tr3 or Tr1. While alanine aminotransferases (ALT) and creatinine (CRA) concentrations decreased in treated groups compared with control. Value of total antioxidant capacity (TAC) increased (P<0.05) in treaded groups com...

El-Kholy KH1*, Tag El-Din H1, Seham NE Seleem1, Eman Hussein2 AM El-Shhat2 

...ntrations of serum total protein and their fractions (albumin and globulin) and all lipid profile were insignificant affects by in-ovo different SV solutions, times of eggs dipping and their interaction. The best values of body weight gain, feed conversion ratio and performance index were recorded in that group dipping eggs at 0.05% SV followed by groups dipping at 0.15 or 0.10 % SV throughout the experimental period. According to the results, it can be conclu...

Ouedraogo Oumar1,2, Tianhoun Denté Fidèle2,4*, Séré Modou3, Kaboré Adama2, Tamboura H. Hamidou2 and Belem Adrien Marie Gaston4

...derable losses in animal protein, the financial losses linked to the seizure of organs affected by tuberculosis were evaluated at 206,949.968 CFA francs for butchers without any compensation during the same period. The study shows that tuberculosis exists in the cattle population of the urban commune of Koudougou, and that these animals must therefore be properly inspected to protect human health.

...

Rasha Ali Taha Hamza1, Atef Saad Osheba1, Hassan Mohamed Sobhy2, Sahar Hussein Abdalla Hekal2* 

...e an excellent source of protein but unfortunately it vulnerable to lipid oxidation and many pathogens, which carry the risk for human health. The aim of this work is to determine the antioxidant and antimicrobial activities as well as total phenolic and flavonoids contents in both water and ethanolic extracts of galangal and sumac extracts. Also, the effect of previous extracts on quality attributes of beef burger was evaluated. The ethanolic extracts of both...

Muhammad Asif1*, Ahmad Ali Shahid1,2 and Nasir Ahmad3

...ibiting potential. Crude protein extract was also prepared to observe the inhibitory effect of G. lucidum against A. solani. The results for interaction of mycelia of G. lucidum with pathogen A. solani reveal that G. lucidum is an efficient biocontrol agent to reduce the disease incidence. Crude protein extract was also found beneficial to control the pathogen. The results for minimum inhibitory concentration (MIC) of crude ...

Eman Alsayed Hammad and Atef Mohamed El-Sagheer

...ice (pH, TSS, vitamin C, protein, carbohydrates, and fatty acids). Treatments of Marjoram emulsion oil, Chitosan, and Vermicompost recorded the best increase percentages after the chemical nematicide, compared to control. It could be concluded that, the use of tested eco-friendly agents in the control strategies resulted from an effective alternative strategy in the suppression of the root-knot nematode and other plant-parasitic nematodes.

...

Mirtneh Akalu1,2*, Takele Abayneh2, Esayas Gelaye2, Behailu Tefera2, Teferi Degefa2, Vemulapati Bhadra Murthy1 

...vealed approximately ten protein bands ranging from 25 to 104 kDa. Hemagglutination inhibition (HI) assay confirmed that the immune response was significantly increased in both single-dose and booster-dose immunized groups as compared to calves in the control group. Calves in booster-dose group reach its peak geometric mean (GM) log10 HI antibody titer (3.46 ± 0.06) at the 42nd day. Whereas calves in the single-dose immunized group reach the peak GM 1og...
Mubasshir Sohail*, Qadeer Ahmed Soomro, Raza Muhammad, Muhammad Usman Asif and Imran Rauf
... was detected from crude proteins using substrate-agar plate assay and laterally confirmed by endoglucanase assay. Enzyme activity measured using the glucose standard curve was 725 U/ml after acetone precipitation. Thermal stability and optimum temperature were found to be 60°C for maximum activity. Likewise, enzyme was found more stable at 6.0 pH. Various mono and divalent cations were studied against the cellulolytic activity exhibited significant enhanc...

Aiman Al Mufarji, Abd El-Nasser Ahmed Mohammed* 

... include plasma glucose, proteins, liver and kidney functions and minerals values. The results indicated that organic M. oleifera leaves contain protein (28.28%), carbohydrate (47.82%), fat (7.57) and fiber (28.35%). In addition, fatty acid profiles were saturated fatty acids (3.76%), unsaturated fatty acids (3.79), monounsaturated fatty acids (2.39%), polyunsaturated fatty acids (0.76%) and trans fatty acids (0.64%). Upon s...

Qiong Xiang1, Jing-Jing Li1, Qian Zhang1,3, Rong-Bo Tian1 and Xian-Hui Li1,2*

... the expression of SSTR2 protein in DRGs after injecting Carrageenan, the inflammation-induced reagent into the mouse left-hind paw(Ipsilateral-side). Compared with the SSTR2 in normal right -hind paw(contralateral-side) DRGs. The variation of SSTR2 protein expression is fast, because about 15 min after injection the significant up-regulated expression of the SSTR2 proteins are found in in...

Wei Cui1, Yanwei Du1, Lijuan Jiang1, Yan Wei1, Yuguo Li1, Wenfeng Zhang1* and Ling Zhang2*

...tosis were detected. The protein expression levels were detected by western blot. Rats with type 2 diabetes mellitus were fed high-fat-sugar diet and low dose of streptozotocin for 4 weeks to observe the body weight, fasting blood glucose, etc. The pathological changes of hippocampal CA1 region were observed through hematoxylin-eosin staining, and the expression of related proteins was detected. The results showed that, afte...
Yuechen Li1, Yumo Li1, Xuefeng Zhuang1, Guangfu Lv2, Xiaowei Huang1, Zhe Lin1, Yuchen Wang1* and He Lin1*
...gnificantly improved the protein expressions of Nrf2, HO-1 and NOQ1 in the brain tissues of aging mice, which was detected by western blotting. In conclusion, OR treatment improved behavioral disorders and brain damage in the aging mice, suggesting that OR has the potential to be a new anti-aging drug candidate.

...

Momotaz Khanom*, Sheikh Mustafizur Rahman, Muhammad Yousuf Ali, Md. Shahin Parvez, Al-Hasan Antu, Md. Nazmul Ahsan 

...had significantly higher protein content than the other treatments (p<0.05). Water quality parameters remained optimum throughout the experimental period. The feeds used in treatments did not show any deleterious effect on survival. Physiologically, FF led to significantly higher amylase activity in comparison to other feeds, while protease activity was comparable among the feeds except for DT. The results suggest that formulated feed can be used as a poten...

Shorouk Aladdin Helmy1, Hossam Mahrous Ebeid2*, Mohamed Ahmed Hanafy1, Adel Eid Mohamed Mahmoud1, Reham Roshdy Ali El-tanany1 

... %) with three different protein sources, (soybeans, sunflowers, or cottonseed meals) on a dry matter basis. All rations were incubated in a rumen culture medium collected from sheep in a 3 (sources of clay), 4 (levels of clay), and 3 (protein sources) factorial design. All rations were prepared to be iso-nitrogenous. The results illustrated that humic acid addition had made a significant difference on the amount of degradab...

Zhongxi Zhang1, Ping Zou2*, Jingfang Zhang1, Yujuan Zeng1 and Yujie Tang1

...ood-brain barrier marker protein expression in rats with acute basilar artery occlusion. Sprague Dawley rats (n=180) were randomly divided into 6 groups, 30 in each group, which were sham operation group, model group, and intravenous thrombolysis for 0, 2, 4, and 6h groups. The rats were scored by Zea-Longa method. The effects of intravenous thrombolysis on brain injury and blood-brain barrier were detected by TTC staining. The expressions of ICAM-1 and MMP9 m...

Tao Ren1, Guiqiu Cao2, Xiao Han3, Feng Tan1, Qiaoli Chen4, Shicheng Yang5 and Haiyan Zhang6*

...CK-MB), high-density lipoprotein (HDL), lactate dehydrogenase (LDH), creatine, troponin-T (TRT), cholesterol, C - reactive protein (CRP), and concentration of mitochondrial enzymes viz., Ca2+, Na+ and K+ ions were estimated in blood. Heart tissue was also isolated for caspase-3 activity. Our result showed that naringenin pretreatment significantly increased cardiac dysfunction via scavenged free radicals and a reduction of i...

Amjed Ali1, Muhammad Tayyab1*, Abu Saeed Hashmi2, Asif Nadeem3, Shumaila Hanif4, Sehrish Firyal1, Shagufta Saeed1, Ali Raza Awan1 and Muhammad Wasim1

...xpression of recombinant protein was examined in BL21 CodonPlus (DE3) cells. SDS-PAGE confirmed the size of recombinant protein as 34 kDa. Recombinant β-lactamase was produced optimally when the BL21 CodonPlus (DE3) cells were induced with 0.6 mM IPTG with a post induction time of 5h at 37 °C. The characterization studies demonstrated the maximal enzyme activity at 37 °C in 50 mM sodium phosphate buffer pH 7. Th...

Weam Mohamed Baher*, Gamilat A. El said 

...source of animal-derived protein, essential amino acids, vitamins, and minerals. This study was taken to investigate the hygienic status of chicken meat including breast and thigh collected from rural and urban localities in Egypt. Evaluation of the hygienic status of chicken meat was done via estimation of total bacterial count (TBC), most probable number (MPN) of coliforms, total staphylococcus count (TSC), and total mold count (TMC). An experimental trial f...

I Gusti Lanang Oka Cakra1*, Anak Agung Ngurah Badung Sarmuda Dinata2,  I Gede Mahardika1,  I Gusti  Nyoman Gde Bidura1

...F) in the concentrate on protein balance, blood metabolic profile, and body composition of Etawah crossbreed goats. A total of 20 goats with an average initial body weight of 18.22 ± 3.09 kg were used in the study with a randomized block design consisting of 4 treatments and 5 replications. The four treatments tested were as follows: A: elephant grass + concentrate A (without HLF); B: treatment A + concentrate B (with 5% HLF); C: treatment A + concentra...
Tri Eko Susilorini1*, Ahmad Furqon2, Wike Andre Septian1, Desinta Wulandari3, Suyadi Suyadi3
...is one of the major milk proteins approximately 80-83% of total protein. The CSN3 gene has been broadly studied due to its important influence on the milk properties. Senduro goat is local breeds in Indonesia that provide milk. This study was aimed to analyse CSN3 gene polymorphism and its association with milk production and composition on Senduro goat. A total of 42 lactating Senduro goat were used in study from parity 1 t...
Paulus Klau Tahuk*, Oktovianus R. Nahak T.B., Gerson F. Bira, Adrianus Manek, Donatus Manek, Tobias Y. Purnama, Emanuel Bubun, Bergias Subay
...contained standard crude protein and high energy (11% CP and 72% TDN), T2 ration which contained medium protein and high energy (13% CP and 72% TDN); and T3 ration which contained high protein and high energy (15% CP and 72% TDN). The level of Gliricidia sepium leaves in each treatment ration was also different, where T1 contained 10% of, T2 contained 20% of Gliricidia sepium leaves, and T...

Soliman Mohammed Soliman1*, Mohsen Mahmoud Shoukry2, Ahmed Mohammed El-Okazy1, Ahmed Mahmoud El-Morsy1, Mahmoud Mohammed Soliman1

...al is the most important protein source used to fodder mixtures. However, more than 60% of the protein is degradable in the rumen. Several attempts have been made to reduce protein degradation. This experiment was carried out to investigate the effects of different supplementation levels of pomegranate peel (PP) on the in situ degradation of soybean meal (SBM) by using three ruminally cann...

Hye-myoung, Jang 1,3, Ju-Hyeun, Kim3, Garam Park1, Yoon Dong Choi4, Sun-Eui Kim1,5, Gwang Joo Jeon1,2* 

...myloid (Aβ) and tau-protein (τ-protein) formed in the brain tissues. Under the hypothesis of obesity inducing potential dementia, mice were fed with high-fat energy diet to gain excessive weight. The experimental groups in this study are 1) high-fat diet fed only (control) and 2) high-fat diet fed with AE added (AE group). After the experiment was terminated, they were slaughtered and brains were obtained. Throughou...
Manatsanun Nopparatmaitree1*, Pornpan Saenphoom1, Sittichai Bunlue1, Silchai Washiraomornlert1, Warangkana Kitpipit2,3,4, Soranot Chotnipat1
..., crude fiber, and crude protein (p<0.05). The supplementation of TABP combined with probiotics increased the lactic acid bacteria, Enterococcus sp., and volatile fatty acids (p < 0.05) and decreased Salmonella spp. and Escherichia coli in the cecum of different treatment to control groups (p < 0.05). In addition, TABP combined with probiotics supplementation increased the villus height, villus surface area, and the depth of the crypt of Lieberkü...
Mohammad Belal Shaker1, Waleed Rizk El-Ghareeb2,3*, Marwa Magdy Seliem4, Wageh Sobhy Darwish3, Bassam Abdulla Alhawas2, Ahmed E. Tharwat3
...s, high biological value protein, minerals, and vitamins. However, crustaceans are regarded as potential sources for the transmission of foodborne pathogens. Aeromonas spp. is one of the opportunistic microorganisms, that normally inhabits aquatic environments such as fresh, and marine water bodies. Aeromonas spp. might cause food-borne gastroenteritis that might be complicated to cause septicemia, meningitis, endocarditis, and osteomyelitis with high mortalit...
Ade Djulardi1*, Robi Amizar2, Tigor Sanjaya1
...lementation at different protein levels on the performance of laying quail. This study used 240 heads of laying Japanese quail (Coturnix coturnix japonica) aged 42 days with 10% egg production in the layer phase aged 6-9 weeks. This study used an experimental method with a completely randomized design (CRD) in a 3x2 factorial with four replications. Each replication consisted of 10 laying quails. The first factor is expired milk powder supplementation with thr...

Hany M.R. Elsherif1, Ahmed Orabi2, Hussein M.A. Hassan3, Ahmed Samy3*

... to broiler diets, total protein, globulin, albumin/globulin, T3, T4, and total antioxidant capacity levels were dramatically increased, while alanine aminotransferase (ALT), aspartate aminotransferase (AST), and urea levels remained not affected. Adding SF, SA, or SP to broiler diets significantly improved immunological state (P<0.05) via enhancing avian influenza (H5) and Newcastle disease (ND) titers. Accordingly, OAS’s as natural feed additives co...

Abd El-Moniem Ali S. Mahgoub, Ahmed Mohamed Abd El-Hafeez, Mahmoud Yassin Mohamed*, Al-Moataz Bellah Mahfouz Shaarawy, Mohamed Ibrahim Nassar

...alue of digestible crude protein (P < 0.0001), ruminal pH, and NH3-N values. Total dry matter intake tended insignificantly decrease with increasing levels from sesban hay. Final body weight, average daily gain, growth rate, and body weight gain did not affect by sesban supplementation. Supplementation of sesban hay improved feed conversion to digestible crude protein (P < 0.002). The replacement of clover hay 10, 20, ...
Ahmed Mohamed Elmahdy1*, Naglaa Mohammed Alkalamawy2
...also the levels of total protein, Albumin and Globulin were quantitated also the histo-pathological examination of the liver, kidneys were done. Results showed that the administration of O.M. extract restored the severely disrupted liver and kidney functions caused by ivermectin’s unfavorable effect to almost normal levels as well as the co-administration of O.M. extract significantly reduced the histopathological effect of ivermectin on the liver and ki...

Avijite Sarker, Sharmeen Islam, S.M. Ariful Islam, Md. Rokibul Islam Khan*, Md Mukhlesur Rahman 

...re reduced and the crude protein (CP), ether extract (EE), ash, ME, OMD were elevated significantly with MFW and ensiling time (P<0.05). Comparing the parameters, T2 and T3 were preferable to prepare silages as cattle feed. Finally, it can be summed up that market fish waste is a valuable resource for the preservation of rice straw which provides farmers with cheap and environmentally friendly cattle feed.

Keywords | Environmental pollution, Silage,...

Rubaijaniza Abigaba1,4*, Pharaoh C. Sianangama1, Progress H. Nyanga2, Edwell S. Mwaanga3, Wilson N.M. Mwenya1
...ded to reduce the animal protein deficit. This study aimed to assess the socio-demographic characteristics, awareness levels and attitudes of male and female traditional pig farmers toward reproductive biotechnology application. A cross-sectional descriptive survey was employed to obtain sex-disaggregated data from 622 respondents using a semi-structured questionnaire. Descriptive statistics including frequencies, mean, and standard error of the mean as well a...

Muneeza Zafar1,2,3, Fazli Rabbi Awan2,*, Munazza Raza Mirza3,*, Sumaira Nishat2,4, Sajid Ali Rajput5 and Imran Riaz Malik1,*

...-align: justify;">Apolipoprotein B (APOB) is the major part of low density lipoprotein (LDL), with two major isoforms: APOB100 and APOB48 found in the human body. Both isoforms are involved in the formation and transport of chylomicron and LDL-cholesterol. Point mutations in APOB may lead to change in protein stereochemistry, which may result in premature coronary artery disease, familial ...

Ghulam Abbas1*, Muhammad Arshad1, Muhammad Saeed2*; Safdar Imran3, Ashgar Ali Kamboh4, Duraid KA Al-Taey5, Muhammad Asad Aslam1, Muhammad Saeed Imran6, Muhammad Ashraf3, Muhammad Asif7, Abdul Jabbar Tanveer8, Razia Abdul Majid Qureshi9, Maria Arshad1, Hussain Ahmed Khan Niazi1, Muhammad Tariq10, Sikandar Abbas1 

...e the uptake of digested proteins and important minerals. The advantages of using OA as feed additives greatly outweigh their disadvantages like decreased palatability. Organic acids can increase egg productivity and enhance the egg quality in layers. In broiler, use of OA is associated with improved weight of birds and feed conversion ratio. Dietary OA showed 1.85-8.48% increase in the FCR of chicken. Lactic acid fed 0.3 g/kg diet reduced Escherichia coli and...

Junaid Ali1, Muhammad Nawaz2, Muhammad Ilyas3, Muhammad Umer Chattha1, Imran Khan1, Muhammad Bilal Chattha4*, Muhammad Arshad5, Muhammad Akram6, Mina Kharal7, Ehsan Ullah1, Muhammad Talha Aslam1, Fareeha Athar1, Ayesha Mustafa1 and Muhammad Umair Hassan1

... quantity of mineral and protein. Sowing methods and irrigation application are an important agronomic consideration to get maximum production of lentil crop. Therefore, this study was conducted in RCBD with a two-factor split plot to determine the impact of various levels of irrigation and sowing methods on the growth and yield of lentil. Crop was sown by three sowing methods; flat, bed and ridge and with four different irrigations levels; I1: one irrigation,...

Abdul Majid1*, Farah Naz1, Nasrullah Laghari1, Sanaullah Abbasi1, Sham Lal2 and Safdar Ujjan3

...oice of solvents for the proteins functionality is remained a challenge for biochemical applications, hence there is always a need to understand the effects of solvents on secondary structural conformation. Biophysical investigations about the changes in secondary structure conformation of lysozymes were performed with CDS using them in water and buffer. Membrane bilayer mimics were prepared from dimyristoylphosphatidylcholine (DMPC) through rehydration method...

Nur Prabewi , Supriyanto, Budi Purwo Widiarso* 

...ess value, and protein instability upon heating, thus it needs special treatment. Marination is a flavored liquid that serves as the ingredients of the meat marinated, and is usually used to improve the yield and shelf-life of meat. The research aims to study the effect of herbal marination on the quality characteristics of broiler meat. The variables measured including antioxidants, protein

Muhammad Zeeshan Nadeem1, Muhammad Farrukh Saleem1*, Muhammad Ashfaq Wahid1 and Muhammad Anwar ul Haq2

.... Likewise, fodder crude proteins, crude fiber contents, ash contents and ether extractable fat were increased prominently by CaCl2 over the other priming agents. Among the cultivars, Sargodha Bajra 2011 performed better than other cultivars it showed better adaptability for more pearl millet fodder yield and quality. Therefore, seed priming with CaCl2 can be used to increase pearl millet fodder yield and quality to overcome the fodder scarcity under semi-arid...

Adimabua Mike Moemeka1, Ufuoma Godstime Sorhue1*, Sylvanus Ikenna Omeje2, Lawrence Bratte2, Raphael Onainor1, Okpara Oghenesuvwe2 

...ct (NFE) and lower crude protein content in boiled red sweet potato meal than in the maize. Nutrient digestibility was significantly different (P<0.05) among treatments. The average total weight gain ranged from 13.22kg in T2 to 17.18kg in T1 followed closely by 16.44kg in T3. There were significant differences (P<0.05) among the treatments for all the performance characteristics studied, except average daily weight gain and feed conversion rate. Average...

Muhammad Bakhtiar1*, Fayaz Ali Niaz2, Asim Muhammad2, Mamoona Munir3, Wajiha Seerat4, Sadiqullah Khan5, Ghulam Yaseen6, Muhammad Noman Khan7 and Asma Bibi8

...1 treated plots, maximum protein content, glucosinolate content, and erucic acid (percent) as well as grain yield was recorded, except oil contents which was higher at 20 kg N ha-1 plots, while on other hand S application, whereas Sulfur applied @ 40 kg ha-1 produced maximum Grain yield, oil content, protein content, Glucosinolate contents and erucic acid. It was determined that applying N @ 120 to 160 kg ha-1 in association...

Marwa Ragab Saeed Abdallah, Hussein Mohamed Hussein Mohamed, Mohamed Mohamed Talaat Emara, Mai Atef Mohamed

...dy was to apply the whey protein isolate/beeswax (WPI/BW) as an edible coating to improve the quality and extend the shelf life of sliced pastirma stored under either aerobic or vacuum packaging. Pastirma was produced, sliced, and then allocated to four groups; the first group was aerobically packed and used as control, the second group was vacuum packed, while the third and fourth groups were coated with WPI/BW then packed in either polyethylene or vacuum bag...

Syeda Rubab Zaidi* and Safdar Ali Mirza

...ods were used along with protein estimation. The purified fraction was then subjected to enzymatic characterization to find its thermal stability, effect of pH and selected chemical compounds. Other significant experimental findings were; optimum incubation period was 7 days, inoculum size was 3 discs of 0.5 cm, CuSO4 as inducer improved production, laccase activity of crude extract i.e. 10.89U/ml increased to 15.07U/ml with purification of the enzyme, the pur...

Nkana Kontchiachou J. Gwladys1, Kouamo Justin2, Vemo Bertin Narcisse3*, Mweugang Ngouopo Nathalie4, Wang-Baa Temoa Christophe1, Awantu Christian Funwi1, Semi Yam Alphonsius1, Kenne Noubissie Christèle5, Tendonkeng Fernand5

... concentrations of total proteins, globulins and HDL increased at 0.50% green anise supplementation, referring to the control diet, nevertheless, the difference was significant (p<0.05) just for globulins concentration. Meanwhile, the concentrations of albumin, total cholesterol, triglycerides, glucose, creatinine, urea, ALAT and ASAT were comparable (p>0.05) among rations. The histological sections of the liver and kidney showed that their structures we...

Teguh Wahyono1,2*, Wahidin Teguh Sasongko3, Wijaya Murti Indriatama4, Setiawan Martono5, Slamet Widodo3, Widhi Kurniawan6, Muhamad Nasir Rofiq7

...ing did not affect crude protein (CP), ether extract (EE), neutral detergent fibre (NDF), acid detergent fibre (ADF), hemicellulose, cellulose, or non-fibre carbohydrate (NFC) content. Samurai 1 sorghum silage had the lowest NDF and ADF, both in non-wilted and wilted materials (P < 0.05). The interaction of wilting and different variety had a significant impact on NDF (P < 0.05), ADF, OM, and CP (P < 0.01). Wilting treatment had no significant impact ...

Amal Ramadan Fawy1, Hussein Yousef Ahmed2, El-Sayed S.E. Shabana3, Mohamed Abdelfattah Maky4*

...eef burger had a greater protein than other groups as well as being the best in terms of quality. Furthermore, six beef burger formulations with different amounts of beef fat and vegetable oils were prepared and stored at 4 ± 1°C for 21 days. Analysis of samples showed that fat content was significantly lowered in F1 and F2 (beef fat partially replaced by olive and rice bran oils, respectively) than in control (100% beef fat). In addition to, aerobi...

Xing Lu1, Mahmoud A.O. Dawood2, Fan Wu1, Hua Wen1, Wei Liu1, Juan Tian1, Ming Jiang1, Li-Juan Yu1, Xiang Li3, Ning Xu3 and Hong-Wei Liang1*

...n at 400 mg kg-1. Muscle protein content was significantly increased when turtles were fed diets with 200 or 400 mg kg-1 L-carnitine (P < 0.05). The serum biochemical indices analysis revealed that dietary L-carnitine at 400 mg kg-1 had markedly reduced triglyceride (TG) concentration (P < 0.05). The elevated expression of hepatic igf1 gene at the transcriptional level was positively correlated with dietary L-carnitine levels on the growth performance of...

Yasmin M. M. Mahmoud* 

... concentrations of total protein, albumin and globulin as well as activity of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were significantly (P<0.05) increased while, glucose, total cholesterol, uric acid and creatinine were significantly decreased (P<0.05) in G1 as compared to unsupplemented group. Kids in G1 group recorded the highest (P<0.05) concentrations of hemoglobin, mean corpuscular volume and mean corpuscular hemoglob...

Aiman Al-Mufarji3, Abd El-Nasser Ahmed Mohammed3*, Rashid Al-Zeidi1, Haitham Al-Masruri2, Al-Hassan Mohammed4

...metabolic profile (total protein and blood urea nitrogen) were measured and evaluated. The ovarian follicular wave dynamics and corpora lutea (CL) development were followed. The results indicated that body weights significantly (P < 0.05) improved in ewes and lambs treated with M. oleifera. M. oleifera supplementation increased significantly (P < 0.05) fat (%) and milk energy (MJ/kg) whereas it lowered solid not-fat and lactose (%). Red blood cells (RBCs...
Aiman Al-Mufarji1, Abd El-Nasser Ahmed Mohammed1*, Haitham Al-Masruri2, Rashid Al-Zeidi3
...icroalgae include “proteins, polysaccharides, lipids, PUFAs, vitamins, pigments and other bioactive compounds”. The microalgae composition varies depending on species and nutrient availability for production. Genetic engineering might be used for production invaluable microalgae compounds. Microalgae consider a promising source of omega-3 fatty acids (n-3 FAs), which have beneficial effects for humans and animals. Knowledge for microalgae effects o...
Basel A. Abokhadra, Samah M. Mosad, Sahar Abd El Rahman*
...ion (PCR) targeting glycoprotein B (gB) gene. Six PCR positive samples were isolated on chorioallantoic membranes (CAMs) of 11 days old Embryonated Chicken Eggs (ECEs) for three blind passages. The CAMs showed thickening and congestion at 1st passage and typical pock lesions appeared at 3rd passage. Indirect immunofluorescent technique (IFT) was used for confirmation of BoHV-1 presence in CAM; the CAM with clear pock lesions showed yellowish-green fluorescence...

Imtiaz Ahmed*, Imran Khan and Zia Ud Din

...quo;. The ash, fiber and protein content increased significantly while the carbohydrate content had significantly lower values (p, for all trends < 0.05) as the ratio of incorporation increased when compared with the control sample (data not shown here). The CWB also showed significantly (P<0.05) higher phenolic and total flavonoids content. Furthermore,CWB showed significantly (P<0.05) higher antioxidant activity, low starch digestibility and low hyd...

A. El-Shemy1*, Hoda M. Mekky2, M. A. Bosila2, A. M. Allam1, Kh. M. Elbayoumi2, M. M. Amer3 

...hip using the partial 3D protein revealed that the isolated Egyptian strains in this study were distant from the vaccine strain used in Egypt. In conclusion, three isolates of DHAV-1 were characterized from the examined duck flocks. Phylogenetic analysis of these isolates revealed the occurrence of differentiation between our field DHAV-1 isolates and the vaccine strain. Therefore, applying an appropriate vaccination program for breeder duck flocks is signific...

Hui Xu1,*, Ronghua Luo1, Yaping Duan1, Mingjia Chen1, Jiaxu Zhou1 and Xiaoli Shao2

...-3), and lung surfactant protein A (SP-A) before and after treatment were evaluated between the two groups. The total effective rate of treatment in the experimental group was higher than that in the control group (P<0.05); the cough relief time and hospitalization time of the experimental group were shorter than those of the control group (P<0.05); after treatment, FEV1%, V-T, FEV1, and FVC in the experimental group were higher than those in the control...
Baila Ahmad1, Muhammad Ammar Khan1*, Zulfiqar Ahmad1, Rana Muhammad Bilal2 and Asghar Ali Kamboh3
... ash, moisture and crude proteins indicated retention of nutritional and market value of the broiler breast. The raw meat samples were not PSE (L* was 52.43±1.6). Thermal processing increased lightness and chroma but decreased redness and hue angle. Furthermore, the 80°C treatment significantly increased product doneness and sensory scores. Finally, the correlation analysis showed that industrial, as well as consumer acceptability were influenced by...

Sameena Gul1, Sayyeda Hira Hassan1, Amara Maryam1, Hafiz Abdullah Shakir1, Muhammad Khan*1, Muhammad Irfan2, Farah Rauf Shakoori1 and Javed Iqbal Qazi1

...nd cell cycle regulatory proteins. Clinical studies demonstrated that EGCG treatment of different type of cancers has synergistic effect in combination treatment with other common clinical drugs (cisplatin, taxol, doxorubicin and vinblastine) by modulating chemotherapy response to cancer cells as compared to clinical drugs alone. This review enlightens the possible mechanisms by which EGCG overcome chemo-resistance and recover efficacy of many clinical drugs i...

Xiaowei Huang1, Jinji Wang1, Zhun Yu2, Minghua Duan1* and Zhe Lin1*

... of irradiation, and the protein expression levels of TGF-β1, phosphorylated (p-)Smad2, p-Smad2, p-Smad1, p-Smad5 and BMP7 in kidney were detected by western blotting. In the results, compared with the model group, NOS, NO and MDA contents were decreased in the middle and high dose groups while SOD contents were increased in low, middle and high dose groups. The levels of TGF-β, p-Smad2 and p-Smad3 were increased in low, middle and high dose groups w...

Xiaojing Liu and Zhongxin Li*

...(VEGF) and matrix metalloproteinase (MMP-) 9 protein expression in kidney tissues, in order to reveal the mechanism of TSG. After 12 weeks of administration, compared with those in the DN modeling group, 24 h urine protein, serum creatinine (Scr), blood urea nitrogen (BUN), blood uric acid (UA), alanine aminotransferase (ALT) and aspartate aminotransferase (AST) significantly reduced in ra...

Khalid Khan1*, Ahmed Farhan Saeed2, Sanam Wagma Khattak3 and Saima Liaqat4

...s the foremost source of protein and nutrients for the general masses. The prime impact of the poultry industry is to provide an inexpensive and economical source of meat with high nutrients value to the masses. Keeping in view, the significance and need of dietary protein and it is easy availability, the study has underlined the key determinants of adoption of improved poultry practices and technology in the poultry industr...

Dede Kardaya*, Dewi Wahyuni, Elis Dihansih 

...ality (moisture content, protein, fat, ash, and phosphorus) parameters. Data were subjected to an analysis of variance and a Duncan’s multiple range test. Results revealed that meat cooking loss and fat content were significantly lowered (P<0.05) in ducks treated with treatment rations. No significant differences were found in other physical and chemical quality parameters. It was concluded that supplementation of 2, 4, and 6% AGLM reduced cooking los...

Mostafa El-Sebelgy1*, Hanafy Madbouly2, Sabry Tamam2, Nagwa Ata1, Kawther Zaher1

 

...e used along with RefSeq proteins and primers for multiple sequence alignment. Multiple extrinsic proteins [NS1, NS3 and VP3 of African Horse Sickness Virus (AHSV) and NS3 of Equine Encephalosis Virus (EEV)] were detected and at the same time, integration events were examined in this study. This research work entails unpredicted integration of foreign non-BTV viral proteins (NS1, NS3 and V...

Syed Wajahat Husain Jaafry1* and Amber Fatima2

...on via volatile signals, protein interaction and cues. 

...

Taufiq Bachtiar1, Muftia Hanani2, Anisiyah2, Winda Puspitasari2, Wahidin Teguh Sasongko3, Teguh Wahyono4*

...e. Organic matter, crude protein, ether extract, and non-fiber carbohydrate content in soil with pH 5.4 ranged between 91.94–94.67, 27.78–38.20, 13.99–22.78, and 16.31–33.82% DM, respectively. Meanwhile, in soil pH of 4.0, ranges were 92.24–94.80, 23.07–39.99, 14.88–22.82, and 12.69–38.20% DM, respectively. The Deja 2 genotype had the highest (p < 0.01) IVDMD value (84.07 %) in pH 5.4 soil. However, in pH 4.0 ...
Gamilat A. Elsaid1, Weam Mohamed Baher1*, Eman Shukry1, Abeer E. Abd El. Ghafar2, Marwa Shalaby1
...rt of the human needs of protein, vitamins, and minerals. This study aimed at estimation of most probable number (MPN) of coliforms and E. coli and investigation of the prevalence of shiga toxin producing E. coli in kareish cheese collected from grocery stores and street vendors at Mansoura city, Egypt. In addition, molecular confirmation, and detection of shiga toxin coding genes (stx1, and stx2) in the recovered E. coli isolates was done using PCR. Moreover,...

Xiaoguang Su1,*, Yanjun Gao2, Yanling Wang1 and Yaohui Ma2

...ls of Ki-67, PCNA, Bcl-2 protein were significantly reduced (P <0.05), and the level of Bax protein was significantly increased (P <0.05), the expression level of miR-128-3p was increased significantly (P <0.05), the expression levels of EPHB2 mRNA and protein levels were decreased significantly (P <0.05). After overexpression of miR-128-3p or inhibition of EPHB2, the cell viab...

Liyun Chang1, Aiju Liu2, Jianshuang Zhang3, Yingbin Chen1 and Zhiyong Liu4*

...to express a recombinant protein (SAG2), identified using SDS-PAGE and Western blot analysis. The purified protein was then used as a coating antigen to establish an indirect ELISA method for detecting the T. gondii antibody in pet cats, whose reaction conditions were optimized. The SAG2 gene was successfully cloned into a pET-21a (+) prokaryotic expression vector, and the recombinant plasmid pET-21a-SAG2 was obtained. The s...

Ehab A. Fouad1*, Khaled A. Abd El-Razik2 , Eman H. Abdel-Rahman3

...nbound were inspected of protein concentration. In the crude antigen, there were two bands with molecular weights of 73 and 64 KDa, compared to ten bands with molecular weights ranging from 209 to 24 KDa. The isolated fraction showed diagnostic properties of S. aureus mastitis using indirect ELISA with 100% sensitivity and 95 % specificity. The fraction validity lasted for more than one year of storage at -20 ºC. The current study introduces effective way...

Zhaojun Wang1, Yang Zhou2 and Xinghua Song3*

...lower, and matrix metalloproteinases content was also significantly reduced (P<0.05). IL-1β, IL-6 and TNF-α in the observation group were respectively 8.07±3.13 ng/mL, 9.31±6.83 ng/mL and 7.72±1.86 pg/mL, with MMP-3 and MMP-9 contents at 29.42±6.74 and 20.23±5.24, showing significantly superior improvement compared with the control group and indicating statistically significant difference (P<0.05). The incide...

Hairul Islam M. Ibrahim1,2, Abdalla A. Sayed1,3, Abdel Naser A. Ahmed4,5 and Emad A. Ahmed*1,6

...in oligodendrocyte glyco-protein (MOG) challenged PCB treated cells were estimated using flow cytometry and ELISA kits. Apoptotic and neuronal markers were evaluated using quantitative real time PCR and protein blots. Results showed that PCB inhibited the infiltration of inflammatory cells and improved the myelin protective proteins. It also positively regulated the antioxidants and apopto...

Omnia Mohamed Khattab1*, Hala Kamel Abdelmegeed2, Mohamed Mahmoud Mashaly1, Mervat Hamdy1*, Naglaa Hagag1, Ayman Hamed3, Hanan Aly Fahmy3, Essam Ibrahim4, Momtaz Abdelhady Shahein2, Elsayyad Mohamed Ahmed2

...positive. The virus glycoprotein B (gB) fragment (580pb) was amplified in selected isolates using the nested PCR (n-PCR), sanger sequencing of gB from three isolates with phylogenetic analysis reveals the full identity between the Egyptian isolates from the outbreaks and other EHV-4 strains available in databases proving wide distance with other EHV-8 and EHV-1. The study recommends rt-PCR as a screening test for the tentative diagnosis of EHV-4 in epidemiolog...

Eman A. Al-Shahari1,2, Eman R. ElBealy3, Abdelhalim A. Alkhazendar4 and Abeer A. Alm-Eldeen4*

...ression of pro-apoptotic proteins p53 and bax and increase the antioxidant defense of hepatocytes in aged male rats.

...
Afifa Yaqub1, Mehroze Amin1, Qindeel Fatima1, Rabail Hassan Toor1,3, Saira Aftab1 and Abdul Rauf Shakoori1,2*
...subunit of AMP-activated protein kinase (AMPKα2), RNA polymerase II transcription elongation factor (ELL2), and pro-apoptotic Bcl-2 homology 3-only protein (BIM) in MCF-7 breast cancer and normal human embryonic kidney HEK-293 cell lines were studied in response to treatment with different concentrations of UNC0642. Inhibition of G9a expression was observed in a dose-dependent manner in both cell lines with increasing ...

Xiangli Dong1,2, Shilin Mikhail Borisovich2, Jiji Li1,*, Jianyu He1, Zeqin Fu1, Yingying Ye1, Julia N. Lukina3, Olga V. Apalikova4 and Jianshe Zhang1

...e, we performed membrane protein analysis and epitope analysis to select MRC1 and MRC2 protein fragments suitable for antibody production. We then PCR amplified L.c-MRC1 and L.c-MRC2 and cloned them into prokaryotic protein expression vectors (MRC1 (1044bp)-pET32A and MRC2 (993bp)-pET32A). We performed SDS-PAGE analysis of the expressed L.c-MRC1 and L.c-MRC2 protei...
Zahra Naz1,2, Fouzia Ismat1, Muhammad Saleem2, Mazhar Iqbal1, Aamir Shehzad1 and Moazur Rahman1,2*
...justify;">The matrix (M) protein is the most abundant structural protein in Newcastle disease virus (NDV), the causative agent of Newcastle disease (ND) in chickens. Owing to its highly conserved nature among NDV strains and also due to its pivotal role in the viral life cycle, the M protein can be employed as a promising diagnostic antigen for reliable detection of NDV infection in chicke...

Qi Zhuo, Yuanchun Yao, Meisongzhu Yang*, Jinhua Chen and Miao Tian

...of miR-216b-5p and HDAC8 protein expression in tissue samples; reverse transcription quantitative PCR (RT-qPCR) real-time analysis of miR-216b-5p, HDAC8 mRNA expression in cell lines; MTT detection of cell proliferation; wound healing test and transwell assay were used to evaluate the ability of breast cancer cells to metastasize and invade; colony formation test was conducted to detect the effect of HDAC8 on the cells. We found that the expression of miR-216b...

Abdulkhaliq A. Al-Janabi1*, Mohammad S. Alsalami1, Arkan B. Mohammed1, Abdulkhaliq A.R. Al-Douri2 

...cerides, low-density lipoproteins and the aspartate aminotransferase (AST) and alanine transaminase (ALT), were significantly decreased in both Omega-3 treated groups compared to the control. In conclusion, the supplement with Omega-3 (150 and 300 µl) induced the growth rate, and liver enzymes, and reduced their lipid profiles, suggesting it would be a beneficial dietary supplement for rabbits.

Keywords | Omega-3, Polyunsaturated fatty acids, Die...

Sarzamin Khan1, Abdul Jabbar Tanweer2, Rafiullah1, Ibrahimullah1, Ghulam Abbas3*, Jabbar Khan4, Muhammad Saeed Imran5, Asghar Ali Kamboh6 

...reased demand for animal protein and high cost as well as shortage of conventional feed ingredients has driven the dire need to search for alternative protein and energy sources to be incorporated in poultry feed. Insects may be one of the alternative feed source which can be used as a good quality, low-cost and sustainable ingredients of poultry feed. Therefore, the present experiment was designed to explore the effect of d...

Haitham Al Masruri1, Rashid Al Zeidi2, Aiman Al Mufarji3, Abd El-Nasser Ahmed Mohammed3, Ahmed Al-Madani4, Al-Hassan Mohammed5* 

...cal constituents such as proteins, essential fatty acids, vitamins, and beta-carotene. The M. oleifera composition varies depending on nutrient availability for production, species, and lifespan of trees. Extracts of leaves and seeds were used for the production of invaluable compounds. Knowledge of M. oleifera impacts on productive, reproductive, and therapeutic performances is more fragmentary and the present review is compiled and discussed owing to the imp...

Nuraini Nuraini*, Yuliaty Shafan Nur, Ade Djulardi, Robi Amizar, Yesi Chwenta Sari

...rnative source of animal protein. This research aims to study the effect of the Tenebrio molitor caterpillar in concentrate and tofu dregs growth media on nutrient content and determine the Tmc effect in the diet on the production of laying quail. The study was divided into two stages of research. Phase 1 of the laboratory experiment determined the composition of the concentrate and tofu dregs media on the nutrient content of Tenebrio molitor. This study metho...

Tertia Delia Nova1*, Yulia Yelita2, Rizky Machicula1

...d ingredient for fibrous protein sources. In addition, it contains several minerals, xanthophyll pigments and -carotene which are important nutrients for ducks. However, the practical use of this plant has not been fully studied. This experimental study used a Randomized Block Design with a Split Plot pattern. The ducks were divided into three groups. Each group is further classified into three weight classes. The variables observed were the number of erythroc...
Abdulaziz A. Alaqil1*, Mohammed I. Buhaya2
...h nutritive value animal protein foods sources consumed all over the world. Recently, with the increasing of health-conscious there is a growing interest in producing and consuming functional foods especially for individuals suffering from chronic diseases. The current study aimed to investigate the effect of dietary linseed oil (LO) inclusion, as enriched-source of omega-3 polyunsaturated fatty acids, on egg production performance and egg yolk cholesterol con...

Razaq Adekunle Animashahun1*, Gbenga Emmanuel Onibi2, Samuel Olanrewaju Aro2, Oghenerobor Benjamin Akpor3, Funmilayo Abimbola Okeniyi1, Olayinka Olubunmi Alabi1, Michael Babatunde Falana1, Ayoola John Shoyombo1, Samuel Oyewale Olawoye1 

...eriod. The highest crude protein (CP), ether extract (EE), ash, and lowest crude fiber (CF) in fermented cassava stumps were obtained at 192 hours of fermentation with the following values CP 7.45%, EE 9.81% and ash 7.01%. A similar trend was also observed for mineral enhancement and anti-nutrient degradation. Conclusively, this study showed that solid-state fermentation using Aspergillus niger (ATCC 16404) strain can effectively enhance the nutritive value of...

Asim Faraz1*, Nasir Ali Tauqir2, Abdul Waheed1, Hafiz Muhammad Ishaq1, Syeda Maryam Hussain3, Riaz Hussain Mirza1, Rana Muhammad Bilal2, Muhammad Arslan Akbar4 and  Muhammad Shahid Nabeel5 

...ol, triglycerides, total protein, urea and creatinine concentrations were analyzed on haematology and biochemistry analyzer. The mean Hb concentration (P<0.05) was found to be 14.77±0.76 and 14.16±0.97 g/dl in non-breeding and breeding males, respectively. The hematological values of RBC, WBC and PCV were found to be varied (P<0.05) as higher in non-breeding animals, while the biochemical indices including cholesterol, triglycerides and tot...

Gudeta Nepir Gurmu, Tade Bitima Mulisa, Alemu Lenco Gemechu, Kegna Gadisa Amena and Gemechu Nedi Terfa*

...us crops that is rich in protein and essential amino acids. A field experiment was conducted during the 2019 cropping season consisting of eight (Bursa, Burkitu, Adi, Herena, Hortu, Letu, T/shaman, and Weyib) improved field pea varietiesand one local variety at west Showa zone Oromia region to identify high yielding varieties. The experiment was carried out using a randomized complete block design with two replications at Babich, Goda Hora, Chelia Rafiso Aleng...

Anara Ryskeldina, Indira Iskakova, Nurgul Sarina , Alexander Shevtsov , Laura Syzdykova, Alexander Shustov, Yerlan Ramankulov, Marat Kuibagarov* 

...regnancy-associated glycoprotein 1 (boPAG1) antigen. The aim of this work was to produce a recombinant boPAG1 antigen and obtain monoclonal antibodies (mAbs) against boPAG1. We have obtained the boPAG1 cDNA and are reporting its nucleotide sequence. Bacterial expression of a portion of the natural gene encoding a mature form of boPAG1 failed. But a fusion protein made up of E. coli thioredoxin and boPAG1 was efficiently expr...

Fatin Khalil*, Harinath Yapati, Zainab Al Blallam, Ronia Jose 

...r, dry ewes’ total protein and hemoglobin levels are significantly greater (P<0.05) than other types of sheep, according to a biochemical investigation. The results showed that the physiological, biochemical, hematology analysis and production performance of Naeemi sheep were affected by the seasons and stage of production and growth.

Keywords | Naeemi sheep, Seasonal effect, Intensive management, Reproductive performance, Baseline data. ...

Iram Amin1,2*, Shazia Rafique1, Nadeem Ahmed1, Muhammad Shahid1, Samia Afzal1, Tahir Rehman Samiullah1, Mohsin Ahmed Khan1 and Muhammad Idrees1,3

... HDAg, which is the only protein of HDV of the local isolate is the primary objective of the study. This antigenic recombinant HDAg protein can be useful for both vaccine development and as a diagnostic marker of HDV. After determination of HDAg antigenic region of HDV and its amplification, the fragment was cloned in bacterial expression vector. The expression of recombinant protein was c...

Amoon Danial1, Shahan Azeem1*, Sohail Raza1 and Muhammad Hassan Mushtaq2

...tect antibodies for glycoprotein E of BoHV-1. Of 126 sampled goats 13 (10.3%) were seropositive for BoHV-1. The odds ratio analyses indicated that both the history of abortion and respiratory disease as well as being a male goat and accompanying cattle were significant risk factors for BoHV-1 infection in goats, however, age (> 2 years), was not a significant risk factor. To our knowledge this is first study in Pakistan investigating the role of goats in th...

Zayed M.A1, M.F. Shehata1, I.M. Ismail1, Mona Mohammady1, M.A. Radwan2*  

...o G1 and G2 groups. Meat protein % was higher (p <0.05) in G3 than G1 group. Meat of the G3 group was less (p <0.05) tender than other two groups. The ultrasound Longissimus dorsi muscle area (ULDMA) and ultrasound fat thickness have a positive significant (p <0.05) correlation with carcass back fat and carcass Longissimus dorsi muscle area. The hot carcass weight could be predicted using the ULDMA and slaughter body weight, where the model R2 reached...

Al-Hassan M. Mostafa1*, Gehan Mohammed Sayed2 

..., malondialdehyde (MDA), protein carbonyl (PC), Catalase, reduced glutathione (GSH) and superoxide dismutase (SOD). Garlic and coriander treated goats showed significant reduction of FEC as compared with control positive ones. Treated goats exhibit no changes in total peroxides while there were non significant changes of PC, MDA, Catalase and SOD, in contrast there was an obvious increase of GSH. Histopathologically, Abomasum tissue restored completely normal ...

Rijumoni Daimari, Silistina Narzari, Jatin Sarmah* 

...7-9.85%, ash 0.16-0.92%, protein 6.85-22.36%, carbohydrate 10.18-24.65% and calorie 124.31-198.16 k/cal/100g. Among the samples the maximum protein, carbohydrate and calorie were found in liver. Most numbers of the essential amino acids was found in spleen with lysine contributing the largest amount. Fat content was maximum in large intestine, similarly the saturated fatty acid content too was found highest in large intesti...

Paulus Klau Tahuk*, Oktovianus Rafael Nahak, Gerson Frans Bira 

...ontaining fish meal as a protein source on the performance of fattened male Bali cattle. Cattle used were 15 heads, in the age range of 2 – 2.5 years with an initial body weight range of 158.333±31.565 - 195.333±22.189 kg. Cattle were divided into three ration treatment, where each treatment group consisted of 5 cattle. Ration formulations of T1, T2 and T3 contained fish meal levels of 4%, 8% and 12%, respectively. The observed research var...

Nurdan Urvaylioglu1*, Ogunc Meral1, Serkan Sayiner2, Ulvi Reha Fidanci1 and Arif Altintas1

...nt efficacy. Acute-phase proteins have not yet been adequately studied and clinically used in dairy animals, routinely diagnostic and prognostic, but they are used in human medicine for these purposes.

...

Muhammad Ikram Ullah

...the effect on the mutant protein. A novel missense mutation c. 2710A>T; p.904Tyr>Ser was detected, and co-segregation analysis was established in the complex neurological family. The pymol analysis detected the loss of hydrogen bonding between Thr at 904 with Arg at 916 in mutant MAN2B1. It is concluded that a novel mutation is identified in MAN2B1 associated with a complex neurological disease. The results indicate huge heterogeneity in the Pakistani po...

Shakeel Ahmad1*, Humaira Wasila2, Juweria Abid3, Nazir Muhammad4 and Hazrat Usman5 

... carbohydrates, fats and protein contents of milk products. Atomic absorption spectroscopy and flame photometry were used for mineral analysis. Total phenolic compounds were evaluated by the Folin-Ciocalteu method. The aluminum chloride colorimetric method was used for evaluating total flavonoids contents. Antioxidant activity was assessed by the DPPH method. The results showed that moisture was high in Buttermilk (92.15±0.13 g/100g), ash and

Wael Mohamed Wafa1*, Mohammed Mahmoud Hegazy1, Mohamed Mohamed El-said Ibrahim1, Hamdy Abdala El-Nagar1, Rehab Fawzy Ismail2 

...ell volume, plasma total proteins, globulin, glucose, total cholesterol, total lipids, and triglycerides increased (P<0.05), while those of urea-N, creatinine, and aspartate and alanine transaminases decreased (P<0.05) in GG and PFG compared with CG. Ages at puberty, 1st service, and conception were earlier (P<0.05) in GG and PFG than in CG. Pregnancy rate was the highest in GG (100%), followed by PFG (83.3%), and the lowest in CG (66.7%) within a se...

Hossam Mahrous Ebeid1, Ahmed Abdelkader Aboamer1*, Amgad Ahmed Abu Elella2, Ibrahim Mohamed Khattab3, Osama Hefny Matloup1, Fatma Ibrahim Hadhoud1  

...p>Moringa seed cake is a protein-rich source that can be utilized as a feed supplement or a cheaper protein feed ingredient. This study aimed to: (1) assess the ruminal degradation features of machine-dehulled moringa seed cake (DMSC); and (2) examine the effect of supplementing lactating Damascus goats’ diets with DMSC on milk production. Three cannulated rams (50.60± 3.05 kg, body weight) were used to assess t...

Jiangbo Shao1, Donglai Zhu2, Shengqiang Zou1, Guohong Ge1 and Ju Huang1*

...in heat stress response, protein folding as well as metabolism and biosynthesis of amino acid. SOX9 correlated with HSPA1B were negative to the progression in hepatocellular carcinoma patients. These results suggest that SOX9 participated in hepatocellular carcinoma progression through targeted regulation of HSPA1B that might provide novel insights in hepatocellular carcinoma therapy.

...

Zahin Anjum1*, Mubashra Tarana1, Shaista Ali1, Faryal Yousaf1, Amina Rahat1 and Sumbla Yousaf2

...d Mg), moisture content, protein, lipids and ash were carried out. The samples were obtained from five different sites of the University Campus, Peshawar- Pakistan. The Atomic Absorption Spectrometry was employed for determination of Cu, Zn, Pb, Ni, Ca and Mg. Furthermore, a spectrophotometer was also used for the purpose of phosphorus (P). However, the analysis of sodium (Na) and potassium (K) content was done through a flame photometer. It was observed that ...

Nuraini Nuraini*, Yuliaty Shafan Nur, Ade Djulardi, Robi Amizar, Yesi Chwenta Sari 

...ernative feed option for protein sources. This research includes 2 phases. Phase 1. Effect of different medium compositions on the production and nutritional content of Tenebrio molitor larvae. Phase 2. Effect of Tenebrio molitor larvae in the diet on broiler performance. Phase 1 used a completely randomized experimental design (CRD) with six treatments and three replications. The treatment variations were treatments A (100% Concentrate), B (100% Chicken Manur...

Zheng-Yong Wen1, 2*, Chuan-Jie Qin1,2, Bin Li1,2, Rui Li1,2 and Xiao-Tao Shi3*

...at predicted to encode a protein of 172 amino acids. Multiple Leptins alignment showed that four a-helix domains and two cysteine residues were conserved in vertebrates. Three-dimensional (3D) structure modeling revealed that pvLeptin was highly conserved with that of other tetrapods. Genetic synteny analysis revealed that lepB had specifically lost in siluriformes teleosts. Phylogenetic analysis showed that fish lineage contained two clades of leptinA and lep...

Ekechukwu Esther1, Ohanu Chinenye1, Ossai Nelson1*, Elijah Okwuonu1, Hinmikaiye Funmilayo1, Ngene Innocent1, Andong Felix1, Ikegbunam Clara2, Echude Daniel1, Ekeh Felicia1 and Odo Gregory1

...oup. The diets contained protein, fibre, ash, fat and sugar /energy. Feed efficiency increased in the rats fed on 30% and 50% C. cajan. Crude protein digestibility decreased (P< 0.05) with increased levels of C. cajan. The values of plasma total protein, albumin, Albumin/Globulin ratio, glucose, total cholesterol and urea nitrogen revealed non- significant changes among the groups that ...

Hayrettin Çayiroglu1*, Füsun Coskun1, Hüseyin Çayan1, Ayse Gül Filik2 and Ahmet Sahin1

...e, total cholesterol and protein levels were not affected while serum triglyceride level and prolactin hormone level increased by fenugreek seed supplementation (P<0.05). Fenugreek seed supplementation did not affect milk organoleptic properties such as smell, taste and appearance. To conclude, fenugreek seed in lactating goats can be used as natural supplement to increase milk yield since fenugreek seed had no effect on sensory properties of milk.

...

Jiahua Peng1,2, Shiyao Hua3* and Qian Wu4

...KKβ and NF-κB protein expression. The results of fasting blood glucose and serum insulin test showed that DHEA could significantly reduce fasting blood glucose and insulin levels and improve insulin sensitivity index, and the effect was more obvious in the high-dose group. The above results indicated that DHEA could regulate the intestinal microbial level of rats, and further regulate the sugar metabolism process of rats by increasing the serum estr...

Hanaa H.A. Gomaa1*, Dalia Y.Z. Amin1, Mona A. Ismail1 and Khalid A. El-Dougdoug2

...orchards. The viral Coat protein gene structure resembles that of members of the genus Trichovirusin the family Flexiviridae. In this study, the virus isolated from fig plants belongs to the genus Trichovirus in the family Flexiviridae.

...

S. M. Ashraful Karim1, Md. Shohel Al Faruk2* 

...osphorus, Glucose, Total protein, BUN, and Serum creatinine. The Urine sample was taken also for determination of Urine pH, Specific gravity, Proteinuria, and Glucose. Ultrasonography was performed to check the condition of the kidney. Increased levels of BUN, Serum creatinine, Proteinuria, and thickened cortex of the kidney confirmed that the cat was suffering from CKD. The diagnosis and ...

Rani Winardi Wulan Sari1, Novirman Jamarun2*, Suyitman3, Khasrad4, Elihasridas2, James Hellyward5, Gusri Yanti1 

...r, organic matter, crude protein, acid detergent fiber (ADF), neutral detergent fiber (NDF), cellulose, and hemicellulose of 62.82%;65.69%;66.17%;50.67%; 57.22%; 55.84%; 63.27%. VFA and NH3 is 156.20%;9.84%. The methane gas production in P3 was lowest 20.57 ml/gr DM. This research concludes that P3 (40% hay mangrove leaves + 60% native grass) had the best resulted effect on nutrient and fiber in vitro digestibility, rumen fluid characteristic, and gas producti...

Saydat Saad Abd El-Megeed1, Walaa Yehia El-Sayed1*, Tarek Khamis2 

... 1, hedgehog-interacting protein (Hhip-1), smoothened (SMO), glioma-associated oncogene homolog 1 (GLI1), and extracellular signal-regulated kinases 1 (ERK1). On the other hand, there was a significant upregulation in the mRNA expression of peroxisome proliferator-activated receptor (PPAR) –γ, insulin-like growth factor 1 (IGF1), PPAR-α, glucagon-like peptide 1 (GLP-1) in pancreatic homogenate, and peroxisome proliferator-activated receptor g...

Jie Li, Gaofu Wang, Xiaoyan Sun, Lin Fu, Peng Zhou* and Hangxing Ren*

...ies of the gene-encoding protein, and analyzed the different expression level in goat tissue. The result showed that the coding region of goat KITL gene was 825-bp long and encoded 274 amino acids. The goat KITL amino acid sequence had high homology with this molecule in other mammalian species. And the KITL gene was extensively expressed at 0-, 12-, and 24-month-old goat tissue. Moreover, the mRNA and protein of KITL were i...

Tlou Grace Manyelo1,2, Nthabiseng Amenda Sebola1, Jones Wilfred Ng’ambi2, Monnye Mabelebele1* 

Man Wang1 and Fengmei Yang2*

...ssions of TOP2A gene and protein in tumor tissues were higher than those in normal tissues, and the differences were statistically significant (P<0.05); TOP2A gene expression was positively correlated with immune cells infiltration (P<0.05); the overall survival, disease-free survival and survival probability of patients with high expression of TOP2A gene were lower than those with low expression of TOP2A gene (P<0.05). In clinical specimens, the expr...

Hira Jabbin1, Muhammad Arshad1*, Naunain Mehmood1, Wardah Hassan1, Syed Zakir Hussain Shah2 and Farzana Siddique3

...acity, water extractable proteins, salt extractable proteins, thiobarbituric acid reactive substances (TBARS) and sensory quality of mori fillets. The results indicated that chitosan coatings were effective in controlling pH, water loss, TBARS production, retention of water extractable proteins and salt extractable proteins in fish fillets. The sensory a...

Sherif Abdelghany1, Hossam Mahrous Ebeid2*, Ahmed Abdelkader Aboamer2, Mohamed Ali Radwan1, Rania Agamy1 

...udy showed a lower Fat : protein ratio than the optimal ratio. Milk urea nitrogen (MUN) was significantly different (P < 0.05) between the two districts, was (P < 0.05) higher than standard level in both districts. The MUN levels in cattle and buffalo milk were higher in the Nile Valley district than the Newly Reclaimed (23.66 and 22.76 mg/dl, respectively). The cost of producing one kg of milk was higher (P < 0.05) on the Newly Reclaimed district. Co...

Humera Manzoor1,2,5 Norbert Brüggemann2,3, Hafiz Muhammad Jafar Hussain1, Tobias Bäumer2, Frauke Hinrichs2, Muhammad Wajid4, Alexander Münchau2, Katja Lohmann2* and Sadaf Naz1*

... variants on the encoded protein, and their frequencies in public databases. Sanger sequencing was performed to explore the segregation of the variant with the phenotype. All patients had congenital limb contractures. These included camptodactyly of hands and feet, ptosis, adducted thumb and clubfoot morphology. A novel homozygous missense variant in ECEL1 c.2051A>G, p.(Tyr684Cys) was identified in all three patients. The variant was absent from the DNA of ...

Muhammad Shuaib1*, Abdul Hafeez1, Naila Chand1 and Muhammad Tahir2

...f dry matter (DM), crude protein (CP), crude fiber (CF), and fat were recorded higher in the control group during all the three phases. It is concluded that the different levels of soybean hull in the basal diet resulted in lower production performance and nutrient digestibility than the control group.

...

Hemat A. Abdel Magied*, Heba H. Habib, Amany H. Waly, Ahmed Fadl, Sayed M. Shalash 

... and either on low crude protein (CP) and low metabolizable energy (ME) were studied on growth performance, carcass characteristics and meat quality of Arbor Acres broiler chickens. Two experiments were conducted in current study; experiments 1 (EXP1) evaluated the effects of PE and/or P supplementation to standard corn-soybean broiler diet (STD). while experiment 2 (EXP2) examined the PEP supplemented to different levels of low CP (low 10 or 15 %) and low ME ...

Noha M. Abd El-Azeem*, Hemat A. Abdel Magied, Mervat N. Ghazal, Nehad A. Ramadan, Enayat H. Abo El-Azayem, Y. S. Hussein, Heba H. Habib 

...ficant increase in total protein, globulin, total antioxidant capacity (TAO), glutathione peroxidase (GPx) and superoxide dismutase (SOD), with significant improve in A/G ratio and decrease malondialdehyde (MDA) in the treated groups in compared to the control group. In conclusion, turmeric, MOS and Biostrong supplements had a beneficial effect as natural antioxidant additives, especially the mixture among them, by protecting against oxidative stress factors c...

Irshad Ahmad1,2*

...e are reasonably rich in proteins, lipids, carbohydrates, vitamins, minerals, pigments, etc., which are essential for not only sustaining fish health but also its unique array of bioactive compounds can improve coloration and quality of fillet. The aim of this review is to provide an update of the current knowledge of microalgae as a supplement or feed additive to substitute FM and FO in aquafeeds. This review will provide a platform to highlight the potential...
Jie Wu1,2, Xiang-long Lu1,2, Wen-dan Wang1,2, Tian-you Wu1,2, Xing-yi Zhang1,2 and Yan-jing Su1,2*
...tudy was to compare milk protein, amino acid and free fatty acid content among two kinds of milk with different foaming properties, used in coffee. For the milk protein, a significant difference between milk types was found in β-lactoglobulin (β-LG) and α-lactalbumin (α-LA), but not in casein content. The content of β-LG and α-LA in milk with the high foaming property of 70-96% (milk C) was s...

Sugiharto Sugiharto*, Ikania Agusetyaningsih, Endang Widiastuti, Hanny Indrat Wahyuni, Turrini Yudiarti, Tri Agus Sartono 

...while alleviating muscle protein catabolism in high-density pens from days 15 to 28.

Keywords | Broiler, Chitosan, Germinated seed, High stocking density, Stress 

...

Istna Mangisah1*, Heni Rizqiati2, Nyoman Suthama1 

...tinal bacterial balance, protein digestibility, and growth performance of broilers, but it did not affect the relative weight of digestive tract segment and immune organs of broilers.

Keywords | Broiler growth, Digestive tract, Feed additive, Intestinal bacteria, Lymphoid organ  

...

Reda Hassan*, Bahaa Abou-shehema, Sherif Zayed, Micheal Gorgy, Shama Morsy, El-Sayed Abu El-Hassan, Mahmoud El-Gbaly, Hanaa Basuony, Ebtehal Hassan 

...lood cells (SRBC), total protein, albumin values in broilers serum compared with ngative control. Aflatoxins supplementation significantly (P<0.05) increased malondialdehyde values in liver and significantly (P<0.05) diminished the reduced glutathione (GSH), glutathione S- transferase (GST). In addition to, dissemination of aflatoxin residue in broilers liver was detected. Nevertheless, dietary addition of HSCAS and SC, in separate and combined forms, al...

Antonius1,3, Anuraga Jayanegara2*, Komang Gede Wiryawan2, Simon Petrus Ginting3, Anjas Asmara Samsudin4, Elizabeth Wina5 

...r, organic matter, crude protein, crude fiber and crude fat. The T1 and T2 treatments resulted higher (P<0.05) average daily gain of 52.87% and 48.05% than that of control, respectively. The mutton tenderness level of T1 increased from tough scale in the control treatment to quite tender. In conclusion, gambir leaf extract addition did not negatively affect palatability and nutrient intake, increased average daily gain for Boerka goats, increased tenderness...
Humaira Gul1*, Muhammad Junaid Yousaf1*, Fawad Ali1, Mamoona Rauf1, Farhad Ali2 and Iqthedar Ali3
...s, fruits, plant height, proteins, and chlorophylls were significantly (P<0.05) increased in sandy soil proportion whereas in soil analysis moisture, hygroscopic water, pH, cation exchange capacity (CEC), chlorides, organic matter were significantly (P<0.05) increased for the soily soil in same proportion that is of sandy soil. This reveals that Barley should be grown in sandy soil for its better growth and productivity. The least growth parameters were ...

Lopamudra Samantaray*, Yashaswi Nayak 

...-balanced sole source of protein in terms of nutrition. Concerns over the extensive use of Antibiotic Growth Promoters (AGPs), which may have driven consumer demand for antibiotic-free animal yield, have necessitated research towards a safer natural alternative, such as the use of phytobiotic essential oils (EOs). The purpose of this study was to determine the effect of phytobiotic EOs on laying hen performance, physical characteristics, and egg cholesterol co...

Pham Tan Nha*, Le Thu Thuy  

... feed addition and crude protein level on the performance of local chickens in the south of Vietnam. It was (3*2*3 factorial) with 2 factors. Factor fermentation: Yeast-fermented maize (YM), Yeast-fermented broken rice (YR), Probiotic fermented maize (PM). Factor protein level: 20% (CP20) and 16% (CP16). One hundred and eighty Noi chickens at 6 weeks of age (334±9.5 g/bird), and 10 birds per unit (balanced sex) were i...

Ahmed M. El-Waziry1,2*, Saeid M. Basmaeil1, Ibrahim A. Alhidary1, Gamaleldin M. Suliman1,3, Mutassim M. Abdelrahman1, Maged A. Al-Garadi1 

...ing the degradability of protein in the rumen, which increases its by-pass to the small intestine and decreasing the ammonia concentration in the rumen. Moreover, ionophores increase propionic acid in the rumen, which is used as an energy source; hence, ionophores increase muscle growth by enhancing the daily weight gain due to the improved feed conversion rate. Studies indicate the effect of ionophores on the characteristics and quality of the carcass ha...

Ergi Bahrioglu1, Mustafa Hac Isa2, Sibel Cengiz2 and Ertan Ercan2*

...d to given ratios of the protein, carbohydrate and lipid sources provided from the feed materials. The plant-based diet yielded the highest worm density of the study (2220 worms/unit) while the garden soil was used as substrate. In comparison, the fish feed-based diet fed white worms reached a significantly lower density (627 worms/unit) although the optimal nutritional value for the fish diet was ensured. These results showed that the carbohydrate content of ...

Saba Rehman1, Faisal Salih Hayat1, Sadia Norin2, Abdul Aziz1, Siddiq Ur Rahman1* and Noor ul Haq1*

... (SARS-CoV-2). The spike proteins of the novel coronavirus located mostly on the S1 unit result in a higher transmissibility rate and affect the viral virulence and clinical outcome. The spike protein and other non-structural protein mutations in VOCs may lead to escape the approved vaccinations. Here the VOC mutations i.e., OMICRON VARIANT have been discussed in detail, and the therapeuti...
Farah Abid1,2, Mohammad Saleem1,3*, Tahir Maqbool4, Tania Ahmed Shakoori5, Faheem Hadi4, Tahir Muhammad4, Saira Aftab4, Yasir Hassan7 and Shabana Akhtar4,6*
... the index of C-reactive protein, rheumatoid factor and bone and cartilage erosion after treatment with E-AM. Collectively, our findings suggest that E-AM extract might have potential to perform anti-inflammatory and anti-arthritic activity which could have beneficial impact for the patients associated with arthritis.

...

Ghazala Nasreen1, Ali Hussain2, Komal Tayyab1, Muhammad Rashid3 and Sumaira Aslam1*

... levels of total soluble proteins and hepatic enzymes being marker of hepatic injury for all the treatment and control groups. The highest levels of acid phosphatase (ACP, 11.75 ± 0.23 IU L−1), alkaline phosphatase (ALP, 81.50 ± 1.49 IU L−1), aspartate aminotransferase (AST, 30.25 ± 1.62 IU L−1) and superoxide dismutase (SOD, 19.75 ± 1.78 IU L−1) were recorded in the liver samples of the fingerlings of the tr...
Chunlan Shan1, Chaoying Liu1, Qin Lu1, Guowen Fu2, Syed Aftab Hussain Shah3, Rana Waseem Akhtar4, Ru Zhao2, Libo Gao2, Chang Liu2, Shushu Miao2, Hongdan Wang2 and Hong Gao2*

 

...of high molecular weight proteins (HMWPs), encoded by five structural genes, were predicted using bioinformatics tools. These proteins had differences in random curls, α-helix and slight amount of β-sheet. After validation, 10 iron deficient isolates expressed the ferritin HMWPs similar to those of Yersinia. Later on, Kunming mice were infected with E. coli HPI+ and HPI- strains, respectively for the histopatholog...

Amal G. Abdelrahman1, Nabil A. Yassien1, Hussein M.H. Mohamed1, Khaled S. Tolba2, Heba H.S. Abdel-Naeem1* 

...ood affordable source of protein but will also provide economic benefits to the poultry meat industry. Therefore, this study aims to appropriate utilization of this meat to produce less expensive and highly nutritious value-added chicken meat patties. In this context, five groups of spent hen meat patties were formulated as follows: The first and 2nd groups were treated with 5 % and 7 % of kiwi extract, the 3rd and 4th groups were treated with 5 % and 7 % of p...

Doaa H. Assar1, Rasha A. Al Wakeel2, Mahmoud M. El-Maghraby3, Mohammed M. El-Badawy3, Adel A. El-Badawy3, Wael M. Nagy3, Mustafa S. Atta2, Abdel-Khalek E. Abdel Khalek4* 

...reased (P<0.05) total proteins and globulin, while decreased (P<0.05) creatinine, urea, total cholesterol, and triglycerides. Allicin supplementation reduced MDA and increased GSH, SOD, Gxp, catalase, and GPx. Allicin treatment of ewes (0.8 and 1.2 g/kg) increased (P<0.05) LBW and weight gain (total and daily) from birth to weaning, IgG, GSH, SOD, catalase, and GPx, while decreased MDA in blood serum of their lambs. Allicin dietary supplementation (1....

Müge Aliye Hekimoglu and Sırma Sönmez

...he basal diet (55% crude protein+14% oil), the four experimental diets were designed with supplementation of L-carnitine (0, 500, 1000, 2000 mg/kg). They were fed 10% of their weight every day. Sampling was done at the beginning and the final day of the experiment for digestive enzymes (protease, lipase, amylase), weight and length, body colour and survival rate. The image analysis method was used to determine skin colour. The chemical analysis method was used...

Nauman Zaheer Ghumman, Muhammad Ijaz*, Arslan Ahmed, Muhammad Umar Javed, Iqra Muzammil and Ahmed Raza

... the presence of a 78KDa protein band specific for PBP2a protein in MRSA. The comparative risk factor analysis showed significant variation among risk factors associated with S. aureus and MRSA-induced mastitis. The phylogenetic analysis of MRSA mecA gene showed a high resemblance of the study isolates with MRSA isolates of the USA, Turkey, India, Africa, and Brazil. This is the first study regarding molecular characterizati...

Hongfeng Guo

...e kit; the expressions ofprotein kinase B (Akt), Bax and Bcl-2 were detected by Western blot. According to our findings after drug treatment, the body weight and respiratory ventilation of mice returned to normal level compared with the intermittent hypoxia group. Compared with the blank control group, after intermittent hypoxia, the contents of MDA, SOD and PGE in the lower respiratory tract of SD mice were significantly lower than those in the normal air gro...

Mian Shamas Murtaza1,*, Aysha Sameen2, Saima Rafique3, Muhammad Shahbaz1,*, Nabeela Gulzar4, Mian Anjum Murtaza5, Umar Farooq1 and Iram Hafiz6

...chemical (moisture, fat, protein, ash,) characters. Melt-ability and flow-ability showed inverse relationship with levels of inulin. Melt-ability and flow-ability decreased by increasing level and increasing hardness. Yield calculation showed non-significant effect within levels but significant effect as compared with control. The fat substituting property is based on its ability to stabilize the structure of aqueous phase which creates an improved creaminess....

Monu Karki, Amit Kumar and Gnanavel Venkatesan*

...s like chemokine binding protein to GM-CSF and IL-2 inhibiting factors, to virokine like Interleukin-10, shifting the cell cycle phase (Poxviral anaphase-promoting regulator complex) and enhancing nutrients and oxygen supply (vascular endothelial growth factor), ORFV possesses several unique strategies, to fight against host immune environment. Some of the genes have been acquired from the host and some are flowing through the family and genus evolving with th...
W. M. A. El-Nagdi1†, M. M. A.Youssef1, H. Abd-El-Khair1, M. M. M. Abd Elgawadand M. G. Dawood2
...ing phenolic and soluble proteins, respectively. The effects of combined treatments of Pf+Bs and Pf +Bp were recorded for highest contents of photosynthetic pigments than the other treatments either as single or combined treatments.

...

N. Hajra

...en profile comprising of proteins, amino acids protease and proline. Results showed that carbon profile in plant treated with AM fungi have high to low and varied amount of carbohydrates, sucrose, glucose and total soluble sugars in different parts of the plant; amino acids and proline in nitrogen profile found in higher amount in AM treated plants.

...

R. Singh1† and R. Z. Sayyed2

... revealed an increase in protein, nucleic acids (RNA and DNA) and
amylodextrin (hydrolyzed starch) concentration in the infected regions as compared with normal healthy sections.
Protein localization found more pronounced at the sites of infection of M. incognita viz., cortical cells, giant cells,
abnormal xylem, medullary region and nematode body. Active RNA synthesis in infected cortical...

A. M. Korayem1†, M. M. M. Mohamed1 and S. M. El-Ashry2

...eld. Seed contents viz., proteins, carbohydrates, zinc and copper
decreased at severe infestation in the second season, while in the first season quality of seeds was not affected.
...

M. M. A. Youssef1†, Wafaa M. A. El-Nagdi1, and Mona G. Dawood2

...
and soluble proteins in seeds increased at the different treatments compared to those of the untreated check and the
effect, in general, was higher by using the highest rate compared to the lowest one. On the other hand, the contents
of chlorophyll a, chlorophyll b and carotenoids in leaf increased at untreated check compared to those at different
treatments.
...

A. S. A. Saad1, M. B. Al-Kadi1, A. A. A. Deeabes2 and A. M. El-Kholy2

...est suppression in total proteins (10.41 mg/g), total sugars (7.86 mg/g) and reduced sugars (3.09 mg/g) as compared with untreated check. Moreover, citric acid was the most effective treatment which exhibited the highest values of total phenols (0.69 mg/g), total protein (18.08 mg/g), total sugar (17.89 mg/g) and reduced sugar (10.05 mg/g), whereas cattle manure gave the least values of total phenols (0.47 mg/g), total

M. Israr†1, F. Shahina1 and M. Habib2

...al soluble sugars, total protein, total phenols and amino acids. Chlorophyll a, chlorophyll b and carotenoids also decreased in nematode infected plants as compared to control. This study gave the fair report towards nutritional quality because no significant work has been done so far on this aspect in Pakistan.

...

Muhammad Nadeem1*, Aneeta Rehman1, Masooma Munir1*, Hira Fatima2, Faiqa Malik1, Aqsa Iqbal1 and Alaiha Asif3

...that the moisture, crude protein, fat, fiber, ash and NFE contents for treatments ranges from 5.45-7.27%, 4.02-5.25%, 1.77-2.81%, 1.48-2.97%, 1.28-1.93% and 82.69-83.09%, respectively. The microbial analysis of fruit bars showed that mean values of TPC changed gradually from 1.64 to 2.31 log10 CFU / g during 90 days of storage. The mean values for sensory assessment indicated that T1 was preferred over the other treatments in terms of overall acceptability, co...

A.M. Korayem, M.M.M. Mohamed† and S.M. EL-Ashry1

...>22 J2/200 g soil. Total protein and nitrogen element decreased in seeds of infected plants compared with those of
healthy ones.
...
C. Azhagumurugan and M.K. Rajan
...div>
carbohydrate, protein, amino acid, lipid, proline and phenol content after 65 days of treatment. Carbohydrate and
protein were found decreased with increasing inoculum levels of egg-masses and increased with increasing
concentrations of leaf extract treatment and lipid, amino acid, proline and phenol content found increased with
increasing inoculum levels of egg-masses and decre...

W.M.A. El-Nagdi†, M.M.A. Youssef and M.G. Dawood*

...l soluble carbohydrates, proteins, phenolic and carotenoid contents
increased at all tested concentrations as compared to untreated plants, but no any relation among them.
...

Muhammad Iqbal Anjum*, Shahbaz Javaid, Agha Waqar Yunus, Faisal Ashfaq and Javed Iqbal

...r dry matter (DM), crude protein (CP), neutral detergent fibre (NDF) and acid detergent fibre (ADF), among all the groups was similar, however, except ADF, digestibility of DM, CP and NDF was significantly (P<0.05) higher in calves fed TMR with 25% MC and lower in those fed 35% WS based TMR. Cost of feed per kg gain was lowest (Rs 128) in calves fed TMR with 35% MC and it was highest (Rs. 167) in both TMRs with 25% WS and 35% WS, respectively. In conclusion...

Mohsin Shad1, Muhammad Usman2 and Qurratulann Afza Gardner1*

...f, b, Rieske iron-sulfur protein, and subunit IV. Electrons transferred through these complexes are responsible for the pumping of protons across the membrane to produce ATP through ATP synthase. The present review provides the structural comparison of mitochondrial cyt b in ten model organisms targeting archaea, prokaryotes, and eukaryotes, highlighting phylogenetic and mutational analysis. Polymorphism in the mitochondrial cyt b gene helps in studying the bi...

Ronny A.V. Tuturoong1*, Sony A. E. Moningkey1 and Nova L.I.M. Ogi2

... efficiency of microbial protein synthesis were analyzed. The highest dry matter digestibility (DMD), organic matter digestibility (OMD), neutral detergent fiber digestibility (NDFD), NH3 concentration and efficiency of microbial protein synthesis (ESPM) were found in T2 group (64.04%, 65.05%, 60.63%, 189.36 mg.L-1, and 24.10 gr N.kg-1. BOTR-1, respectively). While the highest ADF was found in the T3 group (56.37%). The stud...

Sri Setyaningrum*, Dini Julia Sari Siregar, Tengku Gilang Pradana  

...carcass percentage, meat protein content and lactic acid bacteria. The treatment decreased (p<0.05) of feed conversion ratio (FCR), meat fat content, meat cholesterol and total coliform in the ileum and caecum. The treatments of CGLp were not affected (p> 0.05) of feed intake, immune organs, hematological and pH in the ileum and caecum. In conclusion, the CGLp treatments improve the performance, carcass, and gut microflora of broiler chickens.

Ke...

Ulvi Fitri Handayani1, Wizna2, Irfan Suliansyah3, Yose Rizal2, Maria Endo Mahata2*
...rted in the blood by lipoproteins. Therefore, that is important to know the effect of giving processed tomatoes wastes (PTW) on laying hens to lipid profile of blood serum consist of cholesterol total, triglycerides, LDL (Low Density Lipoprotein), and HDL (High Density Lipoprotein). Two hundred laying hens of the Lohman Brown were healthy, had no physical defects, weighed 1600-1800 g, and ...
Abdelwahab Mohammed Abdelwahab1,2*, Ahmed Almadani1, Ibrahim Almehsen1
...e a comparable effect in protein and energy productive values compared to the control diet versus lower values (p<0.05) of 66.0% and 100.0%% biofloc diets. Furthermore, the biofloc diets (66.0 and 100.0%) almost decreased in all the recorded parameters compared to biofloc (33.0%) and control diets except body fat content and flesh color. Therefore, it might be concluded that feeding biofloc up to 33.0% could be promising in feed utilization, growth performa...
Farid S. Nassar1,2, Abdulaziz M. Alsahlawi3, Ahmed O. Abbas1,2*, Abdulaziz A. Alaqil1, Nancy N. Kamel4, Abdelwahab M. Abdelwahab1,5
...d inexpensive sources of protein and energy in poultry nutrition. The current study was conducted to explore the possible impact of soybean-corn replacement with various levels of black soldier fly larvae Hermetia illucens (BSFL) meal on egg production, egg quality, physiological aspects and economic efficiency of laying hens. The study employed 270 commercial layers, 40-wk-old, that belonged to the W-36 Hy-Line chickens. The layers were randomly designated in...
Farid S. Nassar1,2, Abdulaziz M. Alsahlawi3, Mohammad A. Al-Mahaish4, Ahmed O. Abbas1,2*, Abdulaziz A. Alaqil1, Nancy N. Kamel5
... broilers, such as total protein, albumin, globulin, triiodothyronine hormone, triglycerides, and cholesterol profile concentrations in the serum were significantly (p < 0.05) improved by increasing the level of MWM into broiler diets up to 6%. In contrast, some traits of carcass composition and meat quality as well as physiological parameters deteriorated when adding higher levels of the MWM (8-10%) to the diets, compared to the control. Economically, ther...
Shaker Al-Suwaiegh
... determination of plasma proteins, glucose, liver enzymes and minerals parameters. The results indicated that Azolla pinnata contain protein (32.83%), crude fiber (13.6%), ether extract (1.17%) and ash (3.89%). Upon feeding, replacement diet with 20.0% Azolla pinnata caused significant increase in feed efficiency and body weight gain. In addition, the plasma metabolites (total protein, glo...

Aiman Al-Mufarji, Shaker Al-Suwaiegh, Abd El-Nasser Mohammed*

...plasma parameters (total protein, albumin, globulin, glucose, urea, and minerals) of ewes and lambs. It could be concluded that M. oleifera leaves supplementation to pregnant ewes from eight weeks prepartum to eight weeks postpartum might be ameliorative for both productive and reproductive performances of ewes through modulating thermo-tolerance responses, blood and plasma parameters in subtropics.
 
Keywords | Moringa oleifera, G...

Roni Pazla1, Novirman Jamarun1*, Elihasridas1, Arief1, Gusri Yanti2, Zaitul Ikhlas2

...iversifolia) as a forage protein source in Kacang goat rations. Avocado waste to optimize rumen bioprocessing. This research aimed to obtain good performance from Kacang goats through appropriate ration formulation based on fermented forage (sugarcane shoots and tithonia) with avocado waste. This formulation is expected to minimize the use of concentrate in the ration. This study used 16 male Kacang goats aged one year, which consisted of four groups based on ...

Kainat Bibi1*, Sajjad Khan1, Zulfiqar Ali Gurmani1, Fahad Karim Awan1 and Sajid Ali2 

... more 13.67 % more crude protein and 2.41 % more crude fiber fat were recorded in organically grown wheat. Therefore, for high quality and environment safe production of wheat, organic fertilizer may be applied at recommended rates (compost 12 t ha-1, poultry manure 6 t ha-1 and farmyard manure (12.5 t ha-1).

...

Yuli Retnani1*, Heri Ahmad Sukria1, Indah Wijayanti1, Didid Diapari1, Muhammad Dimas Erlangga1, M Fatahillah Ibsyah1, Taryati1, Nisa Nurmilati Barkah1,3, Novia Qomariyah2,3

...on the dry matter, crude protein, and crude fat intake and was able to increase final body weights and feed efficiency compared to sheep fed with conventional feed. Processing of agricultural waste into silage and wafers can improve the performance of local sheep so that agricultural waste has great potential to be used as animal feed. 

...

Faustin Dokui1*, Frédéric M. Houndonougbo1, Service G. Djidda1, Venant P. Houndonougbo1, Edith Gangbedji1, Gwladys Menon Agbo2, Sedjro Ludolphe Dedome2, Séverin Babatoundé1, Soumanou Seibou Toleba1, Christophe A.A.M. Chrysostome1 

... fed stone rich in crude protein and molasses, was higher compared to the other groups during the dry season and higher than the intake of the treatment group fed with salt-poor stone during the experiment period. Cows in the LS2 treatment group produced much more milk during the dry season than the other treatment groups. Cows in the LS3 treatment group fed with stone low in salt produced much more milk from the fifth week to the end of the trial than the oth...

Jie Chen, Qinghua Qiu, Yanjiao Li, Xianghui Zhao, Lanjiao Xu, Xiaowen Xiong, Qingqi Wen, Mingren Qu and Kehui Ouyang*

..., microtubule-associated protein 1A/1B-light chain 3 (LC-3) and lipolysis protein i.e., hormone-sensitive lipase (HSL) expression in visceral pre-adipocytes were higher than that in subcutaneous pre-adipocytes, but adipogenesis transcriptional factors such as sterol regulatory element-binding protein 1c (SREBP-1c) and peroxisome proliferator-activated receptor-gamma (PPAR-γ) were low...
Aadil Sultan, Mohsin Ahmad Khan*, Nadeem Ahmed, Muhammad Hassan, Rashid Bhatti, Hafsa Naeem, Muhammad Islam Khan, Saad Tahir,  Samia Afzal* and Ahmad Ali Shahid
...tic factors that enhance protein production. One of those genetic factors is gene dosage, which can be increased by increasing the vector copy number. However, increased number of expression vector poses some metabolic burdens on bacterial cells. The current study provides gene multimerization strategy as an alternate way to amplify the gene dosage and explores its effect on the expression of human epidermal growth factor (hEGF) by constructing three types of ...

Ghada A. Ibrahim1*, Mohamed Sayed Helal1, Nahed Abd Elhafeeze Kamoura2, Mohamed Samir3,4, Amira Mohamed Mazid5, Mohamed F.M. Farag6

... leucogram picture total proteins, globulins, urea, creatinine levels were significantly increased in klebsiella-infected animals. An alarming increase in MDR and ESBL klebsiella bovine infections necessitates a controlled use of antibiotics in cattle farms and warrants sustainable monitoring of antibiotic emergence events and further studies for their genetic phenotypic interrelation. Moreover, the haemato-biochemical alterations in the klebsiella infected ca...

Asmaa A. Darwish*, Mona A. Mahmoud, Adel M. El-Kattan 

... increased matrix metalloproteinases activity, T/HDL/LDL-hypocholesterolemia, and decreased minerals, electrolytes, and trace elements concentrations and these changes were more prominent in goat than in sheep. While, the diseased ewes suffered from higher degrees of leukocytosis, total hyperproteinemia, hypoglycemia, increased kidney function tests, and oxidative stress than the diseased does. Total antioxidant capacity (TA...

Sadaf Aman1, Fouzia Tabssum2, Ali Hussain3, Shamsa Jabeen1 and Javed Iqbal Qazi1*

...d higher values of crude protein. No negative change was observed in the histological parameters of the liver and intestinal tissues for the fishes fed with plant based feeds added with probiotics. Conclusively, fish production can be enhanced with the addition of probiotics in the feed derived from plants.

...

Zongliang Li1, Rongxin Ma2,*, Yan Wei1 and Jianghua Zuo3

...t group (P<0.05). The protein expression of bFGF and IL-6 in the combined treatment group was lower than that in the conventional treatment group (P<0.05). The conventional treatment group 30 (75.00%) had a lower tumor growth rate (P<0.05) than the combination treatment group (92.50%), and the combined treatment group 32 (80.00%) had a significantly reduced tumor depth compared with the conventional treatment group 21 (52.50%). There was no difference...

Lihang Wang, Qiling Chen, Tingsheng Lu, Shudan Yao, Xingwei Pu and Chunshan Luo*

...he P38AMPK/Smad2 pathway proteins (phosphorylated p -P38MAPK and Samd2) were notably higher in the model versus the control and the sham, while MH and MH+MPS could patently down-regulate p-P38MAPK and Samd2 protein levels. To conclude, MH+MPS is available to refrain the activation of P38AMPK/Smad2 signal, hence repressing cell apoptosis after SCI, reducing secondary SCI, and benefiting the recovery of nerve function.

...

Athhar Manabi Diansyah1, Muhammad Yusuf2*, Abdul Latief Toleng2, Muhammad Ihsan Andi Dagong2, Tulus Maulana3, Hasrin4, Abdullah Baharun5 

...the confirmation profile protein of seminal plasma. The conception rate from artificial insemination was used to determine the fertility rate (AI). This investigation revealed that the quality of the sperms from Bali-polled bulls and Bali-horned bulls did not substantially change after thawing (p > 0.05). However, sperm acrosome integrity was considerably (p < 0.05) higher in Bali-polled bulls than in Bali-horned bulls. In the profiling

Ambrin Rajput1* and Mehrunisa Memon2

... of straw (509 kg ha-1), protein (22%), leaves P (0.46 %) content, P uptake (11.49 kg ha-1) and P utilization efficiency (10.3 %) were noted by P application with N and K applied treatment. However, the lowest values were recorded where no P was applied. The highest yield had 100% increase in mungbean yield with combined nutrient application of N:P: K (15:75:15 kg ha-1) compared the control plot through this study. Increasing the P application levels from 100 ...

Chun Ik Lim, Hyeon Kwon Kim, Kang Nyeong Heo, Are Sun You, Hyo Jun Choo* 

...5) increased serum total protein (TP) level. Aspartate amino transferase (AST), cholesterol (CHOL), and triglyceride (TG) concentrations were significantly (P < 0.05) decreased in the FGP2.0 group than in the CON group. Serum IL-2 level was significantly (P < 0.05) higher in the FGP2.0 group than in the CON group, although IL-6 level showed no significant difference. These findings suggest that dietary supplementation of FGP as a feed additive might impr...
 
 MUHAMMAD MUNEEB SOHAIL1, FATIMA AMEER2, GUR CHARN SINGH2, MUHAMMAD ZAID1* 
...ions of high-density lipoprotein cholesterol (HDL) but high concentrations of other plasma lipids. This study reanalyzes the relation between plasma lipids and various anthropometric parameters. In this cross-sectional type of study, the participants (n=53) were recruited for the study. Participants were given one-day free health camps and they were anthropometrically measured. Plasma lipid fractions were accordingly determined. Participants suffering from bac...
 
 MUHAMMAD MUDASSAR SHAHZAD1*, FATIMA KHALID1, MEHWISH FAHEEM2, SYED ZAKIR HUSSAIN SHAH3, SANA BASHIR1 & SYED MUHAMMAD KHAN
...rude fat (66%) and crude proteins (73%) was observed in fish at 4 g/kg level of Tau in LSM based diet. Likewise, better absorption of the majority minerals occurred on said level. Our results showed that Tau could be used as a feed additive in linseed meal based diet to confer improved health status and higher growth in common carp at a 4 g/kg level in a plant-based diet. 
...

Caiping Duan

...stern blotting (WB). The protein contents of B-cell lymphoma factor 2 (Bcl-2), apoptosis-related genes Bax and caspase-3 were detected by WB. The contents of lactic dehydrogenase (LDH), creatine kinase (CK), superoxide dismutase (SOD) and malondialdehyde (MDA) were detected by enzyme-linked immunosorbent assay. Results showed that compared with the control group, the low-dose propofol group had increased NO, decreased ET-1 and cTnT contents (P<0.05), and hi...

Ubaida Hussain1,2*, Amtul Jamil Sami1*, Shazia Rafique3*, Muhammad Idrees khan3 and Ahmad Ali Shahid3

...3 and NS5A nonstructural proteins of HCV 3a genotype. Owing to the fact that HCV patients can develop HCC, plant extract has also been tested for cytotoxic activity. Colorimetric analysis was done to determine the vitality of HepG 2 cells for 24 h after treatment with methanolic seed extract and minimum inhibitory concentration was calculated. HepG2 cell were transfected stably to express nonstructural proteins NS3 and NS5A ...
Ayesha Ahsan1, Rabia Arif2*, Samina Nazir1, Muhammad Saleem2 and Memunna G. Shahid1
...phosphorylation of other proteins. In this study, we have amplified PKC and beta tubulin homolog bml gene from six strains and F3 and F4 generations of Sordaria fimicola collected from the Evolution Canyon-1. Sequenced products of 464 bp of tubulin gene and 548 bp for PKC gene were aligned to observe the genetic variations between the eight parental strains of S. fimicola and reference sequence of S. fimicola. Total six polymorphic sites were observed in case ...

Ovirup Bhushan Paul1, Shodipta Sharma Urmi2, Md. Ashraf Ali Biswas3* 

...t population to meet the protein demand is one of the driving factors of increasing global greenhouse gases. The current study aimed to assess the effects of total mixed ration (TMR) and fermented TMR (FTMR) feed on digestibility, total gas production and pH of ruminants. Novel feeding techniques were implemented that combined fermentation to improve digestibility with locally accessible feed supplies using a completely randomized design. TMR feed was produced...

Yuhua Chen1 and Song Lu2*

...d by flow cytometry. The protein expression of PD-1 and CD39 of the mice was analyzed by Western blot. The metabolic rate of CD8 + T was analyzed by fluorescent nutrient stain. Results showed that the mRNA of IL-10, IL-6 and 1L-1β in the electric stimulation group decreased compared with that in the control group (P<0.05). On the 15th and 25th day, the tumor volume of the mice in the electric stimulation group decreased compared with that in the contro...

Lei Jiang, Yi Huang, Runfeng Yang, Xiaohui Jiang* and Hao Yan

...expressions of apoptotic proteins Bax, Bcl-2, cleaved caspase and PAX2 in SKOV3/DDP cells, and the targeted relationship between circ_0009910, miR-455-5p and PAX2 was verified by double luciferase. Our results showed that circ_0009910 and PAX2 genes were significantly up-regulated in SKOV3/DDP cells, and miR-455-5p was significantly down-regulated in SKOV3/DDP cells. circ_0009910 could enhance cisplatin sensitivity of SKOV3/DDP cells. circ_0009910 targeted miR...

Zhe Lin1, Yumo Li1, Yuchen Wang1, Yuechen Li1, Ke Pei1, Guangfu Lv2, He Lin1* and Zhun Yu3*

...OR were screened, and an protein-protein interaction (PPI) network between the target of OR and anti-stress target was constructed using STRING database. Kyoto Encyclopedia of Genes and Genomes (KEGG) was used for analyzing the pathways of target gene. To further verify this, total 96 ICR mice were used, forced swim test and anoxic tolerance test were performed. The effect of OR on levels of monoamine neurotransmitters and p...

Doaa H. Assar1, Rasha A. Al-Wakeel2, Zizy I. Elbialy3, Mahmoud M. El-Maghraby4, Helmy K. Zaghlool5, Adel A. El-Badawy4, Abdel-Khalek E. Abdel-Khalek6*

... volume, and serum total protein, high-density lipoproteins, testosterone, and thyroid hormones (T3 and T4), and significantly decreased activity of aspartate and alanine transaminases (AST and ALT), triglycerides, cholesterol, low-density lipoproteins (LDL), very-LDL, and urea. Semen variables including semen volume, and percentages of sperm motility, livability, and abnormality as well a...

Riko Noviadi, Dwi Desmiyeni Putri, Gusma Gama Maradon*, Agung Adi Candra, Nani Irwani, Gadis Apriani, Made Guntur Candra Adinata, I Made Krisnanda

...cens) can be utilized as protein source feed ingredients. We aimed to analyze the implications of maggot black soldier fly (Hermetia illucens) flour with various processing techniques in broiler rations. This study used a completely randomized design (CRD) with 4 treatments and 5 replications, each replication consisting of 5 broilers. We designed four treatments, P1 = Sundried for 2 days + grinding, P2 = Oven dried at 50°C for 7 h + grinding, P3 = Roastin...

Theresia Nur Indah Koni*, Tri Anggarini Yuniwati Foenay, Stormy Vertygo

...red by dry matter, crude protein content, crude fiber, calcium, phosphorus, NDF, ADF, and lignin. The data obtained were analyzed using Analysis of Variance followed by Duncan Multiple Range Test (DMRT). The result showed that addition of urea, palmyra sap and their mixture had a significant effect (P<0,05) on the value of pH, NH3 and lactic acid. Treatment T2 had the lowest values of pH and NH3 but had highest lactic acid. Additionally, the use of urea, pa...

Fathin Faahimaah Abdul Hamid1, Mohd Farhan Hanif Reduan1*, Jasni Sabri1 , Faez Firdaus Jesse Abdullah2,Mohammed Naji Odhah1, Nur Athirah Binti Abdul Manaf1, Mohd Jefri Norsidin2 , Siti Nor Che Yahya1, Intan Noor Aina Kamaruzaman1, Nur Zul Izzati Mohd Rajdi1 

...hemistry shows the total protein, albumin and globulin are within the range with mild increment in creatine kinase, blood urea nitrogen, and gamma glutaryl transferase however there were increased lactate dehydrogenase levels post-infection with Mannheimia haemolytica (p<0.05). In conclusion, oxytetracycline and flunixin meglumine treatments does not have a great influence on the parameters evaluated in goats experimentally induced with Mannheimia haemolyti...

Siti Fairus Mohamed Yusoff1, Annie Christianus1*, Yuzine Esa1, Muhammad Fadhil Syukri Ismail1, Bashiru Garba2, Nik Siti Zaimah Safiin3, Nur Hamid Hidayahanum4

...pophthalmus. Also, crude protein and docosahexaenoic acid (22:6n-3, DHA) were higher in the hybrid PH×PN and P. nasutus. However, there were no significant differences recorded between the hybrid and its parents for omega-3 (n-3PUFA), total polyunsaturated fatty acids (PUFAs), and eicosapentaenoic acid (C20:5n-3, EPA) and (C22:5n-3, EPA). Likewise, the total essential amino acids (EAAs) was significantly higher in hybrid PH×PN and P. nasutus. In su...
Heavy metals (HMs) are harmful and lethal at negligible levels and non-biodegradable in the typical ecosystem and constitutes animal, human and environmental hazards. They are divided into toxic metals like Lead, Cadmium, Arsenic, etc. and essential elements like copper, zinc, manganese, iron, nickel and chromium. Additionally, could be categorized into two groups based on the natural and anthropogenic sources releasing origins. Population and industrial expansion led to food contamination with HMs. Poisonous metals can be transferred from irrigation water to agricultural soils, agricultural operations, air pollution, animal feed, and packaging materials. Toxic metals are non-biodegradable, non-thermos degradable, and exceedingly stable in the ecosystem; as a result, they quickly build in various foods. Metal pollution of many foods, including agricultural commodities, and animal protein sources such as fish, milk, meat, and eggs, poses a hazard to food safety and security. Toxic metal pollution of irrigation water, agricultural soils, plants, and animals result in their integration into the food chain, posing a health hazard to humans. Most metals are harmful to animals and humans and accumulate in several organs like the skeleton, hepatic tissue, spleen, and renal tissues. Metals have a deleterious impact on the production of plants and animals. As a result, several remediation strategies have become necessary to limit the hazardous HMs pathway into the food chain and the human body. Metal nanoparticles are employed in beneficial applications, although they are associated with specific hazards.
 
Keywords | Food contamination, Heavy metals, Nanoparticles, Pollution sources, Remedy, Soil contamination
... commodities, and animal protein sources such as fish, milk, meat, and eggs, poses a hazard to food safety and security. Toxic metal pollution of irrigation water, agricultural soils, plants, and animals result in their integration into the food chain, posing a health hazard to humans. Most metals are harmful to animals and humans and accumulate in several organs like the skeleton, hepatic tissue, spleen, and renal tissues. Metals have a deleterious impact on ...

Anhar Ibrahim Elhanafy*, Amr Mohamed Mousa, Amaal Mohamed Kamal 

...count, WBCs, serum total protein, albumin and globulin concentrations, as compared to control. Upon treatment, a significant decline in aspartate aminotransferase, alanine aminotransferase, serum total bilirubin, direct bilirubin and in direct bilirubin, serum creatinine, urea content, serum total cholesterol, triglycerides, and low-density lipoprotein, and vice versa regarding the high-density lipo

A. A- E. Abo-Elkhier1, K. S. E. Abdel-Wahab2, M. A. Ali3, M. A-H. El-Sayed4, N.A-K. Saleh5 and A. A. Atef6

...t (P 0.05) (Except total protein and alkaline phosphatase). It was found that 3 anti-HEV IgM. anti-HEV IgG. HEV RNA and HEV Ag positive pregnant women transmitted the virus to their all fetus (100%). While 14 anti-HEV IgG, HEV RNA and HEV Ag positive pregnant women transmitted the virus to 12 (85.7 %) of their fetus and the fetus died and terminated to abortion. However, the 7 anti-HEV IgG positive aborted women did not transmit the infection to their fetus. A...
M. A. Abou El- Nasr1, Kh. A. Dougdoug1, Hayam S. Abdelkader2, and Rehab A.
Dawoud2
...al portion of the capsid protein of PPV. The amplified products were cloned into pGEM-T-Easy vector and hybridized to PPV DNA specific probe labeled with Dig-I 1dUTP. DNA sequencing using fluorescent dideoxy nucleotides showed that the capsid protein region of PPV-EA strain had about 65% sequence homology with other strains of PPV and 45% similarity to the CP or PPV-D strain. A PCR fragment coding for the 43 C-terminal amino...

M. A. Amer1; M. H. El-Hammady2; H. M. Mazyad1; A. A. Shalabyl and F. M. Abo-El-abbas

...d into the Pinpoint Xa-l protein expression vector. The accury of each PCR amplified PVY CP gene was tested by PCR, restriction analysis, and translation. Analysis by in vitro translation using western blotting assay on nitrocellulose membrane using monoclonal antibodies verified that the PVY-CP gene correctly encoded and expressed a protein reacting with PVY antibodies. The CP gene, approximately 32 KDa reacted successfully...

Om-Hashem M. EI-Banna1, M. A. S El-Kady2, E. A Salama1 and Salwa N. Zein2

...n (UTR) between the coat protein and ꞵb gene. It was clear that five bases, and 18 out of 1 16 amino acids were found different. three amino acids insertion, and one amino acid deletion. Little differences were also observed regarding the 5' UTR of RNA γa as six nucleotides were changed. 12 out of 162 amino acids were differed and one amino acid deletion. Gl19 strain cross reacted specifically with the monoclonal antiserum raised against the coat

A.S. Gamal El din1; Sohair I. El-Afifi2; A. S. Sadik 2; Nashwa M. A. Abd El-Mohsen1; and H. M. Abdelmaksoud1

...nt of PVY (N-Egypt) coat protein produced by gene expression technique in E. coli through: (I) Insertion of CP gene isolated by RT-PCR into Pinpoint Xa-l Vector by ligation and propagation after transformation process in E. coli. (2) Isolation of plasmid DNA. then used restriction enzymes Bam HI and Bgl II to identify clones containing inserts. To confirm the fragment inserted of CP gene sequence. PCR was performed using specific primers for PVYN CP gene. (3) ...

Hala A. Amin1; A. Barakat2; A.A. Abou Zeid1

...hnology, a 38-KDa fusion protein containing a complete coat protein (CP) gene or Citrus tristeza virus (CTV) encoded by the expression vector plasmid (Pinpoint™ Xa3, Promega) with a fragment of biotin binding protein (BBP-rCTV-CP) was highly expressed and purified from E. coli cell culture. Antiserum obtained from rabbits after injection with the BBP-rCTV-CP fusion

E. K. Allam.1; B. A. Othman.1; Hayam S. Abdelkader2; and Noher A. Mahmoud2

...ent (321 bp) of the coat protein gene of GFLV was amplified by reverse transcription-polymerase chain reaction (RT-PCR) using two primers specific for the coat protein gene or GFLV. Nucleotide sequences of the RT-PCR products confirmed that these sequences were amplified from the GFLV coat protein gene. A specific GFLV Dig labeled DNA probe was prepared by PCR and detected the GFLV virus i...

Hayam S. Abdelkader1; Gamalat M. Allam1; T. A. Moustafa2; and M. El-Hanunady2

...oth the structural viral proteins nucleoprotein (N) and the envelope glycoproteins GI and G2 and the nonstructural viral proteins NSs and NSm were accumulated to amounts sufficient for detection and cytopathological analysis. Electron micrograph of the virus showed that it is quasi-spherical and its diameter ranges from 80 to 100 nm. The virus caused thi...

Om-Hashem M. El Banaa l, A.A. Abou Zeid2, Fawzia I. Moursy3 and Azza, G. Farag

...ralin which is the major protein of Spiroplasma citri (S. citri Saglio et al), the causal organism of citrus stubborn disease. RecA gene protein is the enzyme primarily responsible for the homologous recombination of chromosomal DNA in bacteria. The Immunocapture- Polymerase Chain Reaction (IC-PCR) technique was applied for detection of S. citri Saglio et al in which the Spiroplasma was captured with the specific polyclonal ...

Asim Faraz1*, Nasir Ali Tauqir2, Hafiz Muhammad Ishaq1, Muhammad Arslan Akbar3, Muhammad Abubakar Sufyan1, Abdul Waheed1, Muhammad Usman Saleem4, Muhammad Shahid Nabeel5, Morteza Bitaraf Sani6, Amal AlKharusi7, Samira Jebahi8 and Ayman Balla Mustafa9

...ere determined including protein, total solids, fat, density, lactose, and solids not fat (SNF). The difference between composition of milk, and yield was found to be significantly (P<0.05) high. Solids not fat (SNF), protein, and total solids in milk were found to be highly significant (P<0.05) in early lactating and non-pregnant females while milk density and lactose were studied to be highly significant in mid-end l...

Muhammad Ismail1, Abu Bakar Muhammad Raza1,2, Zarina Qasim3, Muhammad Zeeshan Majeed1*

... and kill strategy (T2), protein-based bait method (T3), combination of all three methods (T4) and control (T5) were evaluated against B. dorsalis infestation in citrus during 2015 and 2016. Data of percent infested fallen fruits, percent pupae recovered from these fallen fruits, percent adult deformity, percent sex ratio and cost-benefit ratio were recorded. Results showed that when all of the components were used together (T4), fruit damage was significantly...

Yun Zhang*

...g was done to detect the protein expression. Transmission electron microscope analysis revealed that exosomes could be significantly observed in the PE group. The expression of surface markers that included CD63 and CD81 were dramatically upregulated in PE group. The protein level of ET-1 and Ang-II were significantly increased in PE group, and the upregulated ET-1 and Ang-II expression were highly correlated with PE progres...

Xiaoying Liang1,2, Xiaofang Jiang3, Honglin Jia1, Ru Zhang1, Li Gao4* and Qing Yang5*

...d by flow cytometry, the protein expression was detected by enzyme-linked immunosorbent assay, and the gene expression was detected by real-time polymerase chain reaction. In addition, in vitro experiments with Jurkat cells were used to verify the effect of methylase inhibitor 5-Aza-2’-deoxycytidine on the expression of cytokines and genes in the T cells. The expression of Th2 cells, cytokine proteins and genes after a...

Pengliang Xie1, Lufang Zheng2*, Mingxia Dong3, Huaiqiang Zhang1 and Fang Chen1

...iseased group had higher protein expression of IL-6, IL-8, IL-12 and IL-13 than the control group (P<0.05). In detection of protein expression levels of sVEGFR-1 and sVEGFR-2 in patients with different severity levels, diffuse macular edema group had higher protein expression levels of sVEGFR-1 and sVEGFR-2 than the localized macular edema group (P<0.05), and cystoid macular edema gr...
A.l. Abd El-Fattah; A.s. Saclik M.M. El-Kholi; I.A. Åbdcl-Hmnid and M.A. Madkour
...•E strain. a single protein band "ith a size of about 35-37 KDa was obtained after SDS-PAGE analysis of the purified virus preparation. The SCMV-E-RNA was isolated from virus-infected sugarcane tissues and then used as a template for reverse used transcription-polymerase to amplify the coat protein chain reaction (CP) gene (RT-PCR) Of SCMV-E to amplify strain. the ThecDNA ...

Wuritunashun*, Burenbatu, Narenqiqige, Jiuguniang, Eerdunduleng, Shuanglian Wang, Cuiqin Gong, Hashengaowa, Huizhi Jin, Baiwurihan and Chunhaizi

...n the differential serum protein expression of HSP patients. Out of 14 significantly differentially expressed proteins, four proteins immunoglobulin lambda variable 3-27, immunoglobulin kappa variable 3-11, neural cell adhesion molecule L1-like protein, and immunoglobulin heavy variable 3-33 were upregulated, whereas 10 protein

Tarique Ahmed Khokhar1*, Atta Hussain Shah1, Muneer Ahmed Jamali1 and Asghar Ali Kamboh2

...mposition such moisture, protein, fat, ash and glycogen decreased with increasing storage period of chilled, frozen and thawed buffen, chevon and chicken meat samples. Nutritive values of chilled, frozen and thawed buffen sample also decreased with increasing storage period.

...
Mansoor Ayoob1, Atta Hussain Shah1, Zaheer Ahmed Nizamani2, Muhammad Faisal Ayoob2,3*, Deepesh Kumar Bhuptani1,5 and Abdul Sattar Baloch4
...lyzed for moisture, fat, protein, glycogen, peroxide, thiobarbituric acid, total viable count and total coliform count after marination with 0, 10, 20, 30 and 100% concentrations of honey and after 1, 4, 8 and 12 days of storage (4 ̊C). The moisture, fat and protein contents were moderately decreased on the 4, 8 and 12th days of storage in all the groups. The glycogen content showed a significant (P < 0.05) increase amon...

Shaimaa A.Tawfik2,3, EL S.T. Awad1*, Hoda O.Abu Bakr1, Amira M.Gamal-Eldeen4, Esmat Ashour2, Ismail M.Ahmed1  

...CYP3A4, MRP-1, and c-MYC proteins and expression of miRNAs were assayed. Results: Findings indicated that CSO treatment led to a suppression in hepatotoxicity, nephrotoxicity and cardiotoxicity induced by DOX in male albino rats evidenced by a significant enhancement in the activity of ALT, GGT, LDH, AST, also creatinine and uric acid. CSO induced antioxidant activity GSH, CAT and inhibited MDA. Histopathological examination in sections of liver, kidney a...

Muhammad Mohsin Abbas1*, Sajjad Ur Rahman1, Muhammad Abubakar2, Muhammad Imran Arshad1 and Khurram Ashfaq3

...SA), based on structural proteins at the National Veterinary Laboratory (NVL), Islamabad from 10 January 2021 to 09 January 2022. The overall bovine population was carrying maximum seroprevalence of serotype O (28.52%) followed by serotype Asia 1 (23.63%) and serotype A (13.6%) in district Bahawalpur. Majority of the bovine population (50.26%) was detected seropositive for type O of foot and mouth disease virus (FMDv) followed by serotype Asia 1 with (37.17%) ...

Muhammad Asim Bhutta1,2*, Amna Bibi2, Nadia Hussain Ahmad2, Sadia Kanwal2, Zarmeena Amjad1, Hafeez ur Rehman3, Umar Farooq3, Muhammad Nouman Khalid4 and Syeda Fiza Nayab5

...er system components and protein structure. Plants have adapted several protective mechanisms like production of antioxidants, enzymes and carotenoids to face reactive oxygen species and avoid photoinhibition. This article provides overview of molecular mechanisms involved in photoinhibition and its protective elements.

...

Meng Wang, Dongliang Zhou, Huixia Li, Chunqin Wu,Yan Zhao and Houqiang Luo*

... mechanisms to transport proteins synthesized in the cytoplasm to the outer membrane or extracellular environment of the bacterial cell, or directly to other cells. The bacterial secretion system plays an irreplaceable role in this process. Up to now, at least 11 kinds of secretion systems are involved in the pathogenesis role of bacteria, especially the formation of bacterial resistance. Therefore, the study of the bacterial secretion system is of great signi...

Atena Azarniush1, Majid Moghbeli2*, Farshid Kafilzadeh1, Mohammad Kargar1 and Hooshang Jamali1

...nding to the recombinant protein was observed in positive sample. This research demonstrated the efficacy of using B. subtilis as an expression system for the production of IL-11 and it can be used as a candidate for the proteins without post-translational modification.

...

Xiaowei Huang1, Chao Ma1, He Lin1, Yuchen Wang1, Yan Xu1, Guangfu Lv2* and Zhe Lin1*

...rphological changes. The protein levels of glucocorticoid receptor (GR), mineralocorticoid receptor (MR), brain-derived neurotrophic factor (BDNF), trosine kinase B (TrkB) and cyclic adenosine monophosphatec response element binding protein (CREB) in hippocampus were detected by western blotting. The results showed that, OR could significantly reduce the contents of CRH, ACTH and CORT in serum and improve the damage of hippo...

Nitya Salsabila, Djalal Rosyidi, Agus Susilo* 

...nt effect (P>0.05) on protein, ash, and organoleptic quality, could have a very significant effect (<0.01) on water, fat, and carbohydrates, and had a significant effect (P<0.05) on Aw . The best value was obtained by sonication liquid smoke for 20 minutes with Aw content of 0.65, water 40.04%, fat 9.09%, protein 29.14%, ash 0.37%, carbohydrates 21.37%, color 4, 35, texture 4.15, aroma 4.10, and taste 4.20. It can b...

Sahar Ezeldien1,2, Foromo Dramou2, Fatma M. Yousseff3*, Alexander A. Nikishov2, Sergy B Seleznev2

...ed serum levels of total protein and albumin while decreasing glucose level compared to the control group. Eggs of Japanese quail supplemented with chamomile extract showed a higher egg weight, egg length, albumen weight, albumen length, and yolk index. It could be concluded that the chamomile aqueous extract can positively affect the egg quality and productivity of laying Japanese quail. 
 
Keywords | Chamomile, Japanese quai...

Munasik*, Titin Widiyastuti, Caribu Hadi Prayitno

...isture, crude fat, crude protein, crude fiber, NFE, calcium and phosphor, and anti-nutritional phytic acid. The results showed that the fermentation process using red oncom mushrooms enriched with Na-glutamate improved the nutritional level of the cassava-tofu dreg mixture. Although the NFE content decreased, the crude fiber content increased, and the amounts of calcium, phosphorus, and protein significantly increased (P <...

Muhammad Mukhtar1*, Lely Ummi Wakhidah2,Mohammad Zubair Hippy3 

...t and various sources of protein. Thus it is necessary to add a strategy to the previous strategy (strategy) in the development of beef cattle in Gorontalo. Based on the results of the AHP and SWOT above, it can be seen that the implementation of all process models for the beef cattle development policy strategy is the WO strategy. The level of the role of the actor element on the focus element found that the actor who has the biggest role in the development o...

Asmaa A. Darwish*, Adel M. El-Kattan, Mona A. Mahmoud, Mohamed T. Ragab, Amani A. Hafez 

...y cytokines, acute phase proteins (APPs), free radicals, cortisol, growth hormone, and TSH concentrations and a significant (P˂0.05) decline in the anti-inflammatory cytokine, anti-oxidants, insulin, T3, and T4 levels. The iron profile of infected animals was characterized by a significant (P˂0.05) hypoferremia, hyperferritinemia, and hypotransferrinemia. The estimated pro-inflammatory cytokines and APPs yielded high sensitivity and specificity values in bot...

Thekra Fadel Saleh, Omar Younis Altaey*

... showed that acidic glycoprotein was dominant in the villi and crypts, with higher density in the middle portion compared to the proximal and distal portions. The density of glycosaminoglycans was also higher in goblet cells at the basal crypts compared to longitudinal crypts. Immunohistochemical analysis revealed higher levels of lymph follicles and B lymphocytes in the proximal portion compared to the middle and distal portions. The complex architecture sugg...
Nasir Ali Tauqir1*, Asim Faraz2, Abdul Waheed2, Ayman Balla Mustafa3, Irfan Shahzad Sheikh4, Michela Pugliese5 and Shahid Nazir6
...des concentration, total proteins and blood urea nitrogen according to standard procedures. Nutrient intake, nutrient digestion, nitrogen balance, milk production, milk fat, total solids in milk and solid not fat did not show any treatment effect. However, milk protein percentage was the highest (3.42% and 3.41%) in buffaloes fed diets containing 35 and 25 g/d methionine followed by (3.26% and 3.17%) those fed 15 g of methio...

Meltem Kızıl1*, Ali Rişvanlı2, Murat Abay3, Tarık Şafak4, Mehmet Akif Kılınç5, Öznur Yılmaz6, Burak Fatih Yüksel1 and İbrahim Şeker1

...stigation of peptide and protein-structured hormones in biological fluids has become one of the most striking issues. The aim of this study was to determine irisin, asprosin, leptin, adiponectin, and IGF-1 levels in cows and calves after calving according to the mode of delivery. The study was carried out with 20 Holstein cows and 20 calves born from these cows. Blood samples were taken from cows and calves in all groups during birth, after drinking colostrum ...
Umara Amir ud Din1, Waqas Ahmed Khan1*, Khurrum Shahzad1,2, Basharat Ali3, Misbah Hussain1,4 and Fazli Rabbi Awan4
...eatinine, albumin, total protein cholesterol, and liver enzymes (ALP, ALT, and AST) were measured for all subjects. Genotyping for ACE (I/D) polymorphism was done by PCR assay. Statistical analysis showed that subjects with DN had higher (67%) frequency of ID genotypes and the ID genotype carriers also exhibited higher levels of creatinine (6.2±3.9 mg/dL) and urea (99±41 mg/dL). Moreover, logistic regression analysis also indicated that ACE ID ge...

Khalil1*, Dwi Ananta1, Andri Bachtiar2, Hermon3

... but increased the crude protein and reduced the crude fiber content. Feeding the stored rice straw gave no significant effects on cattle performances. The results suggested that wrapping was the most appropriate method to maintain the moisture, and nutrient content of supplemented rice straw during storage.
 
Keywords | Calcined mineral, Physical appearance, Rice straw storage, Supplemented rice straw, Pesisir cattle
...

Mati Ullah1*, Muhammad Rizwan2, Ali Raza3, Xianlin Zhao4, Yanling Sun4, Sarah Gul5, Muhammad Ihtesham Waheed6, Muhammad Nadeem Khan7, Alvina Gul8, Sami Ullah Jan9* and Chao Huang4*

...6.03 to 46.52% while the protein-coding sequences (CDS) were in the range of 2544 to 2888. The pan-genome analysis of the three strains identified a total of 5449 genes with 377 as core genes. The functional characterization by subsystem category distribution analysis revealed “Carbohydrates” is the largest subsystem followed by “protein metabolism” while the biological pathway analysis by the Kyoto e...

Amr N. El-Shahat1*, A.M. Abdul Azeem1 and Mohamed H.M. Abd el Megid2

...cerides, Low-density lipoprotein-cholesterol and very Low-density lipoprotein-cholesterol), tumor necrotic factor-alpha and interleukin-6 as well as reduced activity of hepatic and cardiac enzymes. Also, feeding rats on HCD with BLE enhance the antioxidant status in liver and heart tissues with indicated inhibition of lipid peroxidation by reducing the level of malondialdehyde compared to HCD-fed rats. The results concluded ...

Yufang Liu1,2, Guiling Cao3, Yujing Xie3 and Mingxing Chu1*

...nslational modification, protein turnover, chaperones, energy production and conversion, and transcription process. Pathway analysis in KEGG pathway database of the known genes revealed that the five pathways that most differentially expressed genes involving: GnRH signaling pathway, oxytocin signaling pathway, melanogenesis, thyroid hormone synthesis, and insulin secretion. Online tool was used to predict the function of DEGs, the results showed that the CYP1...

Fadzlin Afiqah A. Samad2, Amirul Faiz Mohd Azmi1, Muhamad Affan Ab Azid1, Hafizin Mu’izz Zalazilah1, Syakirah Zulkifli1, Izreen Edriana Mohd Jasmi1, Muhammad Baqir Irfani Rahimin Affandi1, Mohd Zamri Saad1, Md Zuki Abu Bakar1, Agung Irawan3,7, Adib Norma Respati4, Anuraga Jayanegara5,7, Sadarman Sadarman6,7, Hasliza Abu Hassim1,2,7*. 

...also noticed on the milk protein content of Murrah buffalo in association with increasing FC ratio (P<0.05; R2 = 0.76). In addition, increasing NFC content in the diets also contributed to decrease milk protein content across the breed of buffaloes but without a strong correlation (P<0.05; R2 = 0.149). For milk lactose content, CP intake was the only factor explaining the decreased trend when the level increased (P<...

You-Ming Teng, Wen-Zhou Liu and Li Yang*

...athological changes. The protein and mRNA expression of PPAR-α, CPT-1 as well as PDK-4 were measured by western blot and qRT-PCR. The results showed that pioglitazone could reduced SBP, DBP, MCD, SA, HMI, LVMI as well as myocardial fibrosis and FFA and Ang II levels in serum. Moreover, pioglitazone inhibited the expression of HIF-1α protein and simultaneously enhanced the expressions of PPAR-α, CPT-1 as wel...

Luigi Liotta1, Vincenzo Lopreiato1, Fariborz Asroosh2 and Alireza Seidavi2*

... 15 °C), pH, fat and protein were determined according to the standard methods. Macro and micro elements of milk were analyzed using inductively coupled plasma mass spectrometry. Data were subjected to the two-way ANOVA analysis to determine the significant differences between species/breeds. The acidity, density and fat in Talesh sheep’s milk was higher than milk from other species/breeds (P<0.01). Also, the amount of pro...

Ayesha Anwar, Sadia Aslam and Nauman Khalid*

...f showed highest fat and protein content. There was a significant difference between the pH values of cooked and uncooked patties from different treatments. Increased lipid oxidation content was observed in cooked and uncooked patties containing different concentrations of emulsions, together with non-significant difference in values of water holding capacity and cooking yield among different treatments. A slightly higher scores were obtained for sensory param...

Aneela Ahmed Tagar1*, Mahvish J. Channa2, Kanwal Ahmed Tagar3 and Kaka Kainat4

...in, D-dimer, C- reactive protein, LDH, CBC and troponin). The study reveals the following findings as majority of patients were in age group 37-47 years, male and were married. Moreover, the majority belonged to the medical field. The greater number of the patients were physically active. Only 18.5 % of patients reported co-morbidities such as diabetes in 12.3% with one exceptional case in which Diabetes developed after the occurrence of COVID-19 .The majority...

Abdulaziz A. Alaqil*

...o assess heat shock protein 70 (HSP70) density and glutathione peroxidase (GHS-px) activity, respectively. The general linear model procedure with one-way analysis of variance (GLM-ANOVA) was used to analyze the data. The results showed a significant (P<0.05) increase in the BT, H/L ratio, MDA, and CORT, and over-expression of HSP70 in the hens of LPS group. Also, significant (P<0.05) impairments were perceived in the feed consumption and conversion...

Samin Ullah1, Huma Rizwana1, Abdul Kabir1,2*, Atique Ahmed Behan1, Muhammad Naeem1, Ghulam Shabbir Barham1, Abdul Hafeez Bukero1, Anees ur Rahman1, Naseeb Ullah1 and Shafiq ur Rahman Shah1

...feed intake, total serum protein, and serum antibody IgG levels of group C were also higher than those of groups B and A. The study also found that two calves in group A, one calf in group B, and one calf in group C had health issues such as diarrhea and pneumonia. The findings suggest that providing 4 liters of colostrum to crossbred Holstein Friesian calves within 30 minutes of birth can improve their immunity and health. This study provides evidence for far...

Roy Malindo1, Hosea Abdiel Duto Wicaksono2, Maskur2, Anuraga Jayanegara3, Osfar Sjofjan4, Siti Chuzaemi4* 

...ly 100% of the needs for protein and energy, and 96.5% for dry matter by 2029.  

...
Umer Farooq1,2, Nimra Murtaza2, Abubakar Siddique1, Bilal Saleem1, Obaid Ur Rehman1, Nageen Zahra1, Muhammad Uzair1, Muhammad Naeem Riaz1,3* and Muhammad Ramzan Khan1*
...s which possibly disrupt protein’s structure and function, as well as lead to genetic disease. We performed genome wide reference-based sequence alignment and functional annotation to identify deleterious non-synonymous SNPs (nsSNPs) in cattle breeds of Pakistan. For this purpose, genomic data of four different purpose cattle breeds including Bhagnari, Cholistani, Sahiwal and Red Sindhi was analyzed. Comparison with taurine reference genome ARS-UCD.1.2.9...

Zaki Al-Hasawi1* and Reda Hassanine2

...ean level of serum total protein was significantly lower. Only, significant correlations were found between mean levels of blood biochemical parameters and mean concentrations of Zn, Cd and Pb in the liver of contaminated fishes from the polluted site. Liver of fish from the unpolluted site appeared normal, while that of fish from polluted site appeared abnormal due to sever histopathological alterations.

...

Zaki Al-Hasawi1* and Reda Hassanine2

...ean level of serum total protein was significantly lower. Only, significant correlations were found between mean levels of blood biochemical parameters and mean concentrations of Zn, Cd and Pb in the liver of contaminated fishes from the polluted site. Liver of fish from the unpolluted site appeared normal, while that of fish from polluted site appeared abnormal due to sever histopathological alterations.

...

Qi Zhuo, Yuanchun Yao, Meisongzhu Yang* and Jinhua Chen and Miao Tian

...knowcked out) group. The protein expression and the gene expression were measured using Western blotting and RT-QPCR, respectively. We found that cell proliferation rates in CON, TGT and DGT groups showed that cells were transfected with trangelin gene, the cell proliferation rate died down, significantly lower than that in CON and DGT groups (p<0.05). Cells migration and invasion results in all groups showed that after cells were transfected with trangelin...

Fuji Astuty Auza1*, Sri Purwanti2, Jasmal A. Syamsu2, Asmuddin Natsir2, Rusli Badaruddin1, Deki Zulkarnain1, La Ode Muh. Munadi1 

.... 

...

Dede Kardaya*, Deden Sudrajat, Dewi Wahyuni 

...ing is the high price of protein source feed in tropical regions. Therefore, in this study, we substituted protein sources of the feed with urea which was processed with slow-release technology to avoid urea poisoning. Slow-release urea-impregnated zeolite (UZ) and Indonesia’s natural zeolite (Z) were examined using 24 heads of seven-eight months old of local male lambs (20.12 ± 2.1 kg BW) allotted to four treat...

Rizki Palupi*, Arfan Abrar, Fitri Nova Liya Lubis, Yuni Kurniati, Bianca Ikriza Octa Nadia Putri 

...ility (dry matter, crude protein and crude fiber), hematological status and blood malondialdehyde levels in blood of broiler chickens. Data were analyzed by ANOVA and further tested by Duncan Multiple Range Test (DMRT). The results of this study indicated that the CCI had a significant (P<0.05) effect on nutrient digestibility, hematological status and malondialdehyde levels in blood of broiler chicken. The CCI at a level of 10% in the ration increased hemo...

Walaa I. Mohameden1, Haidy G. Abdel-Rahman2, Ibrahim M. Hegab3* 

....05) increases in plasma proteins, zinc, and copper were recorded, while malondialdehyde, TNF-α, and MMP-9 significantly (P < 0.05) decreased. Furthermore, buffalo calves showed significant ( P < 0.05) increases in both ingestive and locomotor activities, while grooming and lateral recumbency significantly (P < 0.05) declined. Mineral supplementation had a favorable effect on animal skin, health conditions, and antioxidant activity, as well as ...

Lianci He1, Dingxi Bai2, Chenxi Wu2, Yizhu Zhong2, Shi Chen2, Xinru Bao2, Jing Gao2*, Chaoming Hou2*

...d mobility, and mRNA and protein levels of interleukin-1 beta (IL-1β), tumour necrosis factor alpha (TNF-α), transforming growth factor β-activated kinase 1 (TAK1), TAB, IκB kinase (IKKα), IκBα, NF-κBp65 and cyclooxygenase-2 in the serum were measured. Compared with the CON group, the CFS group had decreased weight and decreased activity and mobility (P < 0.05). Compared with the CFS group, the three SXC groups ...

Yakun Ge

... levels of pro-apoptotic proteins Bax, caspase-3 and caspase-9, inhibit the expression level of anti-apoptotic protein Bcl-2 and the epithelial-mesenchymal transition of cancer stem cells, reduce the proliferation ability of cancer stem cells, and increase the apoptosis of cancer stem cells.

...

Amirul Faiz Mohd Azmi1,4,Wan Nur Hanani Wan Roslan1, Athirah Zawani Zulkifli Amin Rashid1, Siti Aisyah Mohd Hafiz Ngoo1, Mohd Hezmee Mohd Noor1, Muhammad Azrolharith Rashid1, Mohd Zamri Saad2, Danung Nur Adli5, Hasliza Abu Hassim1,3* 

...waste. The carcass crude protein and fat were also significantly (p<0.05) better. In conclusion, adding soybean waste into quail diet for up to 30% could be a potential protein source that enhances the growth and improves meat quality of quails.
 

...

Amirul Faiz Mohd Azmi1,4, Hafandi Ahmad1, Norhariani Mohd Nor1, Goh Yong Meng1, Mohd Zamri Saad2, Md Zuki Abu Bakar1, Norafizah Abdul Rahman5,6, Agung Irawan7,9, Anuraga Jayanegara8,9, Hasliza Abu Hassim1,3,9*

 

...h optimum value of crude proteins but low in crude fiber compared to diets B and A. Total volatile fatty acids (TVFA) and their molars proportion, gas production, total fatty acids, total bacteria count, and total protozoa count increased in parallel with the concentrate levels in Diets B and C (P < 0.05) in both breeds. The result also revealed that Murrah cross and Swamp buffaloes showed comparable rumen fermentation patterns when treated with the same di...

Yao Xixi1, Zhou Rui2* and Ma Yinshan3

...f rumen pH, forage crude protein, crude fat, nitrogen free extract, tannic acid and total fatty acid with CLA content in grazing yaks (P<0.05). A significant negative correlation (P<0.05) of crude fiber and crude ash with CLA content in milk of grazing yak was recorded, while no significant correlation (P>0.05) of PUFAs and tvfa with CLA content was observed. This study is helpful to improve the grazing management of alpine grassland and the productio...

Jing Hu1,2,3 and Zhenhua Ma1,2,3*

... h. The high-density lipoprotein cholesterol of C group remained stable at a higher level than the treatment groups. The low-density lipoprotein cholesterol of C group remained stable at a lower level than the treatment groups. The changes of serum ion concentration in hybrid grouper over time can be divided into three categories: change near the level of the C group (Na+, K+), roughly higher than the C group (Cl-, Fe3+, P5+...
Tehreem Fatima1, Jabbar Khan1,*, Hamid Shafiq2, Dost Muhammad3, Muhammad Rafi1 and Shoaib ur Rehman1
...ediated by intracellular proteins, called heat shock proteins (HSPs). Among various known stressors, heat is a major factor that induces the production of HSP70. Keeping in view the very hot conditions of Dera Ismail Khan (D.I. Khan) division where the temperature remains at 45-50°C during the months of June to September, it was hypothesized that heat stress conditions do induce the overexpression of HSPs, especially Hsp...

Umana Niazi, Muhammad Mushtaq*, Mehwish Kanwal and Momina Raheem

...tant source of vegetable protein. In Pakistan, it was grown on area of about 86974 ha with a total production of 100790 tons during 2018-19; almost 89% groundnut area lies in the Punjab province. Average per hectare yield of groundnut, in Pakistan, is near 1200 kg, which is quite low as compared to its potential, which is some 3000 kg. The low productivity of groundnut is attributed to a number of factors, like, rainfall uncertainties, low yielding varieties, ...

Amthal Ahmed Fouad1, Basem Mohamed Ahmed2, Momtaz Abdelhady Shahein1, Hussein Aly Hussein2* 

...luding the standard RABV protein genes in the correct order. Twenty-nine synonymous and five non-synonymous mutations were evident in the protein genes. Deletions and insertions were observed in the intergenic spaces. It was highly similar to Egyptian RABV genomes and clustered within the Africa-4 (AF4) lineage of the cosmopolitan clade. It was submitted to NCBI GenBank under the access number OL314495. Conclusion: The study...

Elihasridas, Mardiati Zain*, Roni Pazla, Simel Sowmen, Qurrata Aini 

...r, organic matter, crude protein, neutral detergent fiber, acid detergent fiber, cellulose, and hemicelluloses in the ammoniated aromatic lemongrass waste samples was evaluated by incubating them on in-vitro media at 39ºC/48 h. The analysis of variance following a 5 x 4 randomized block design was used. The results revealed a significant (P<0.05) increase in the digestibility of ammoniated aromatic lemongrass waste in the rumen. The degradation of amm...

Saddam Hussein Mahmoud* and Shaimaa Nabhan Yassein

...he secretion of aspartyl proteinase 1 (SAP1) gene were used to detect C. albicans virulence with 100% and 80% accuracy, respectively, while Hyphal Wall Protein 1 (HWP1) gene was not detected. It is expected that these C. albicans isolates contained a significant proportion of virulence factors that were linked to pathogenicity and the severity of infection. There findings suggest that poor sanitation and a reduction in goat ...

Novirman Jamarun1, Roni Pazla1*, Arief2, Elihasridas1, Gusri Yanti3, Rani Winardi Wulan Sari4, Zaitul Ikhlas4

...ia as a source of forage protein. This study aims to determine the intake, body weight gain, and digestibility of nutrients of goats fed mangrove leaves and T. diversifolia with different levels. The research employed 16 one-year-old goats and divided them into groups according to their body weight. The concentrate utilized in the study comprised tofu dregs, corn, rice bran, palm kernel cake, minerals, and salt. A randomized block design with four treatments a...

Wizna1, Rusfidra2, Robi Amizar3, Romi Andika1, Muhammad Haikal1, Zurmiati1*

...ntent, dry matter, crude protein, crude fiber, crude fat, calcium, and phosphorus were measured. The dose of B. amyloliquefaciens and fermentation time significantly effect (p<0.05) the total colony count of Bacillus sp. in the fermented product, but there was no interaction. The dose of B. amyloliquefaciens had a significant effect (p<0.05) on the water content, dry matter, crude protein, crude fat, and calcium. In ad...

Muhammad Nasir Bhaya1,2* and Hikmet Keles2

...c dilatation and luminal proteinaceous material in tubuli, congested and hypercellular glomeruli and also inflammatory cells infiltration in the cortical and medullary area in CP group. Significant decrease of pathological lesions was found in CP+EA groups especially in the CP+EA75 group. In immunohistochemical sections, 8-hydroxy-2-deoxyguanosine (8-OHdG) and hypoxia-inducible factor-1 alpha (HIF-1α) revealed less positivity in EA received groups but B-...

Lichun Jiang1,2*, Lan Zhu1, Meiqi Li1, Xinyue Bao1, Zhenkun Zhao2, Haifen Qin2 and Wei Chen3*

...the least, containing 13 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes, and a non-coding control region (CR, D-loop). The overall base composition included 33.37 % A, 29.33 % T, 23.94 % C, and 13.36 % G. According to 13 protein-coding genes and phylogenetic analysis, Elaphodus may have a sister relationship with another deer group Muntiacus and they belong to the monophyletic genus. This study depicted...
Hung Phuc Nguyen1*, Doan Van Thuoc2*, Nguyen Thi Trung Thu1, Huong Tran Thi Mai3, Nguyen Tran Khanh Hoa1, Nguyen Thi Tuyet Nhi1, Nguyen Phuong Thao1, Tran Thi Loan2 and Nguyen Thi Huyen My2
...a main source of dietary protein. A total of 300 fingerling red tilapia with an initial body weight (BW) of 13.7 g were randomly distributed into 15 tanks (20 fish/tank, 3 tanks/dietary treatment) and fed the experimental diets twice daily, for 8 weeks. Results showed that fish fed SR35D and SR50D had significantly lower final BW, weight gain (WG) and specific growth rate (SGR), but higher feed conversion ratio (FCR), than fish fed FMD (P < 0.05). Meanwhile...

Hafiz Muhammad Arsalan1, Amina Arif1 and Muhammad Khalil Ahmad Khan2*

...(NO), advanced oxidation protein product (AOPP), advanced glycation end products (AGE’s) and micronutrients (retinol, ascorbic acid, alpha tocopherol), complete blood count, liver profile, renal profile, lipid profile, serum electrolytes were evaluated in CML and control groups. Our study reported that no significant difference in biochemical profile among treated with Nilotinib or Imatinib tretated groups while in comparision to control group, a marked ...

Mohammad Bani Ismail

...oxidative stress-related proteins NRF2, HO-1, and NQO-1. SPN protects against oxidative stress and inflammation-induced cardiomyopathies, according to our study.

...

Chen Zhao, Lulu Ding, Ying Ye, Congying Kou, Haoran Xiao, Jing Zhu and Jicang Wang*

...vities. Furthermore, the protein expression levels of Beclin1 and P62 were increased in the Cd-treated group. Treatment with Nar can significantly inhibit the increase of P62 protein expression level caused by Cd, indicating that Nar has a certain inhibitory effect on cell autophagy. In general, this study shows that Cd caused oxidative stress and autophagy. Nar can reduce the toxicity of Cd by attenuating oxidative stress a...

Sherein H. Mohamed1, Soad El Naggar2*, Ayman A. Hassan3, Mohamed A.M. Mousa3, Mohamed M. Basyony3, Mohamed F. Sadek3, Mohamed A. A. Ahmed4, Saadia M. Hashem5 

...ity coefficient of crude protein, crude fiber, neutral detergent fiber and acid detergent fiber, nitrogen balance, acetic acid and propionic acid, the aerobic and facultative anaerobic bacteria (Lactobacillus spp.) in all treatment groups.  Concurrently, they showed increase (P<0.05) in total protein, albumin, and globulin, total antioxidant capacity, superoxide dismutase, catalase, glutathione peroxidase, immunoglob...

Sajid Ali1, Ghulam Abbas1, Shahnaz Rashid1, Asma Fatima1*, Abdul Malik1, Dilawer Ali1, Muneer Hussain Bijoro1, Ushra Batool Hashmi1, Rumaisa Abdul Rahim1, Shahid Hussain2, Kashif Ali3, Jabbar Memon4 and Javeria Khourshid1

...1775) by using different protein-containing diet i.e., soybean meal and fishmeal. The dietary efficacy was monitored in seawater earthen ponds designated into four nylon meshed hapa (3.7×9.5×9.5 feet) for 60 days. Juveniles (35.75±3.2g) were collected with the help of cast net from Sakro creek and transferred into the earthen fish ponds located at Garho, Thatta, Sindh. Juveniles were acclimatized for more than two weeks (15 days) to the expe...

Imbang Dwi Rahayu1, Ali Mahmud1*, Wahyu Widodo1, Adi Sutanto1, Apriliana Devi Anggraini1, Devi Dwi Siskawardani2, Wisnu Nurcahyo3, Tri Untari3

...t;0.05) the total plasma protein (TPP), globulin, cholesterol, high-density lipoprotein (HDL), aspartate aminotransferase (AST), and all parameters of the blood profile. However, the herbs’ addition significantly (p<0.05) affected albumin, triglycerides (TG), low-density lipoprotein (LDL), alanine aminotransferase (ALT), and malondialdehyde (MDA). Adding herbs through drinking wat...

Mudawamah Mudawamah1*, Sumartono Sumartono1, G. Ciptadi2, E. Susanto3, Y. Hartoyo4, L. Affandhy5,6

...s, morphology, and total protein of the single and twin ewe sheep and their crosses. The research method was a field study with quantitative and laboratory analysis, with statistical analysis using ANOVA and LSD with SPSS Statistic 9 software. The research design used descriptive with total sample of 60 heads (morphometry and physiological status) and 24 heads (total protein).  There are three breeds of sheep: Sapudi, D...
Sri Rahayu*, Muhaimin Rifa’i and Widodo 
... I-TASSER and human GDF9 protein sequences obtained from UniProt. We also analyzed GDF9 gene expression levels using GENEVESTIGATOR. Furthermore, we identified the proteins that interact with GDF9 using the Biological General Repository for Interaction Datasets and investigated their network formation using the STRING database. Finally, we performed a pathway analysis for GDF9 using the Kyoto Encyclopedia of Genes and Genome...

Xiaowei Huang, Yajie Wang, Jia Zhou, Junxiu Liu, Zhe Lin and Ruili Li*

...ificantly decreased. The protein expression levels of TLR4 and Nuclear factor-κB (NF-κB) p65 in kidney were significantly decreased. HandE staining on renal showed that SBG groups had a certain protective effect on renal injury, especially the high-dose group. In conclusion, SBG may improve hematopoietic function and improve vascular endothelial injury in AA model rats by regulating TLR4/NF-κB signaling pathway.

...

Azza M. El-Kattawy1, Tarek Abou Zed1, Randa Megahed1 and Mohammed El-Magd2*

...ression of matrix metalloproteinase-3 (MMP3), transforming growth factor beta (TGFβ), and oxidized-LDL receptor (OLR1), 4) upregulated the expression of the anti-inflammatory gene IL10, 5) reduced the levels of the oxidative markers [lipid peroxide marker malondialdehyde (MDA) and nitric oxide (NO)], 6) increased the levels of antioxidant markers [reduced glutathione (GSH) and superoxide dismutase (SOD)]. These findings conclude that administration of Sim...

Wei Wang1, Meifeng Zhou2, Yuebo Liang1, Fan Zhang1, Zhong Wu3, Shaowei Mo4* and Yi Qing Wang1*

...spectively. The mRNA and protein level of YAP was significantly increased in the tumor tissues of HER2-positive breast cancer patients. Consistently, the expression of YAP and TAZ were both dramatically upregulated in SK-BR-3-TR cells. The cell viability was increased, while cell apoptosis was inhibited in SK-BR-3-TS cells compared with SK-BR-3-TS. The depletion of YAP by si-YAP reversed the YAP/TAZ expression, cell viability and cell apoptosis in SK-BR-3-TR c...

Abdullah Naser1*, Nirwana1, Sri Wulan1, Zaenal1, Mustafa1, Effendy2 

...ey can be used as animal protein feed to replace soybean meal (SBM) in animal feed. This study aimed to study the effect of substituting soybean meal with fermented kapok seeds on the growth performance and digestibility of sheep reared in stalls with either palm leaf roofs or galvanized iron roofs. This study used a 2 x 5 split plot pattern randomized block design and was replicated three times. Livestock was grouped based on body weight. The main plots are t...

Fahad A. Al-Abbasi1*, Abdullah Samer Habib1, Vikas Kumar2 and Firoz Anwar1

...ated level of C-reactive protein was observed in two of human samples, which reflected some internal inflammation without any clinical symptoms. This is fore thought to evaluate the conditions in which these livestock are grown and processed for import and the need to reset the standards for workers with periodic health checkups.

...

Mohammed A. El-Sayed1*, Mahmoud H Hatab2, Heba AEM Assi3, Nashaat S Ibrahim2, Hisham M Saleh2, Waheed AA Sayed2, Birgit A Rumpold4 

... sustainable alternative protein source for feed. The effect of black soldier fly (Hermetia illucens) meal on growth performance, heat stress-responses (HS) and heat shock protein (HSP70) gene transcription in gendered Japanese quail was assessed. The quails were fed on three different diets containing 100% soybean meal (diet A), 50% soybean and 50% H. illucens meal (diet B) and 100% H. illucens meal (diet C)....
Burarah Arooj1, Zeeshan Mutahir1, Moazzam Ali1, Mohsina Akhter2, Malik Siddique Mahmood1, Arslan Hamid3 and Mahjabeen Saleem1*
...y the recombinant 52 kDa protein. Purified chitinase showed optimum activity at 60°C and pH 5.5 with colloidal chitin breakdown. Enzyme showed stable residual activity within pH range of 4.5–6.5 and >70% thermal stability upto 60°C for 2.5 h. The activity of chitinase increased in the presence of Mn+2, SDS, and methanol. Chitinase has Km and Vmax values of 2.287 mg/ml and 6.784 µM/min, respectively, towards colloidal chitin. The

Mahmoud Abdelhady Metwally1*, Mona Abdelftah Ali1, Farouk Abdelmohdy1, Mohamed Kassab1, Tarek Kamal Abouzed2 and Khalil Fathy Abou-Easa1

...ed p53 and lowered Bcl-2 protein levels. In addition, ELISA findings showed decreased toll-like receptor 4 (TLR4) concentration. Taken together, our findings highlight the potent therapeutic function of BMMSCs-CM in suppressing HepG2 cancerous cells across multiple platforms, including proliferation, apoptosis, cell cycle, and oncogene expression. Furthermore, our findings suggest that the Notch and TLR4/NF-kB signaling pathways may be targets of BMMSCs-CM for...

Momina Raheem1, Muhammad Fiaz2*, Muhammad Mushtaq1, Umana Niazi1, Evelyn Saba3 and Mansoor Abdullah3

...y, lactose, minerals and protein were increased (P<0.05) with increasing rate of dietary supplementation of CRS except fat percentage. In case of blood parameters, effect of dietary supplementation of CRS was found variable. It is concluded that 25 g/d CRS is an optimum dietary supplementation level a month before and two months after lambing for adequate weight gain and milk quality in terms of all constituents except fat percent in Salt Range ewes as rape...

Haiyan Nan, Ran Feng, Guiling Zhang and Jingqin Liu*

...used to detect the FGF23 protein and mRNA expression results of this study showed that in the left pop artery, the inner diameter of the T2DM group was smaller than that of the control group (P<0.05), while the peak flow velocity, blood flow and spectral width of the T2DM group were higher than those of the control group (P<0.05). In the left and right dorsal foot arteries, the inner diameter and blood flow of the T2DM group were lower than those of the ...

Sehrish Ishtiaq1, Mahroze Fatima1*, Syed Zakir Hussain Shah2, Noor Khan3, Muhammad Bilal4, Maryam2 and Sobia Nisa1

...plementation. Whole body protein content increased (p < 0.05) slightly with Ca and P supplementation. However, moisture, fat and ash contents remained unaffected (p > 0.05). Dietary Ca and P supplementation improved (p < 0.05) the protein and fat digestibility in silver carp. Ca and P contents showed significant increase (p < 0.05) with increasing Ca and P levels in the whole body, bones and scales, achieving the...

Saad Tahir, Nadeem Ahmed*, Mohsin Ahmad Khan, Muhammad Akram, Rabia Abbas and Kausar Malik

...bolytic and fibrinolytic protein (47kDa), naturally produced by beta-hemolytic streptococci. Purified SK is used for many blood circulatory complications, i.e., myocardial infarction, ischemic stroke and pulmonary embolism. In this study, human albumin fusion technology has been developed to increase the half-life in-vivo and also invoke less immune response. We designed codon-optimized HSA-SK fusion gene, integrated into -pPICZaB vector, cloned and transferre...

Ayoola J. Shoyombo1, Ake A. Moses1, Comfort I. Ukim2, Mustapha A. Popoola2, Olayinka O. Alabi1, Noah C. Edozie1, Faith Ogbor1, Jacob Kuusu1, Ekemini M. Okon3* 

...he increasing demand for protein in developing regions. The effect of seasonal variation on reproductive endocrinology was examined in a group of West African Dwarf (WAD) does and bucks. Throughout the study, the animals were kept in the same environment. The results showed that most hormones in the does were nominally superior during the wet season compared to the dry season, while progesterone and luteinizing hormones were significantly (p<0.05) higher du...
Akram Ali Baloch1*, Adeel Ahmad2, Kaleem U. Kakar3, Sara Naudhani1, Samiullah Khan1, Agha Muhammad Raza3, Imrana Niaz Sultan1, Humaira Zahid4, Saadullah3 and Shakeela Daud1*
...t encodes 395 amino acid protein called Malin comprising a zinc finger of the Ring-type in the N-terminal half and 6 NHL-repeat domains in C-terminal. In this study, four families were enrolled from Balochistan including two or more epileptic individuals aged between 10-24 years. Blood samples were collected and DNA extraction was performed by inorganic method. DNA was amplified by polymerase chain reaction and subsequently sequenced to confirm any genetic var...

Fatimah A. Al-Saeed 

...ver, the levels of total protein, albumin and CAT were statistically declined. The O. oleaster leaves’ extract could nearly normalize those blood parameters for protection against Cd toxicity. It might be concluded from this study that the protective effect of O. oleaster leaves extract against Cd toxicity may be attributed to its antioxidant activities.
 

...

Yunilas1*, Muheri Indra Aja Nasution2, Edhy Mirwandhono1, Adi Fathul Qohar3 

...onal content, especially protein, used as a source of animal feed. However, in the prepupal phase (BSFP) there is chitin which is a limiting factor in livestock rations because the bodies of poultry and monogastric livestock cannot digest it. Chitin is found in the BSF exoskeleton which is bound to proteins, minerals, and pigments, so it is necessary to do processing to reduce the chitin content first by fermentation using o...

H.A. El-Nagar1, A.M. El-Hais2, M.S. Mandouh2, W.M. Wafa1*, A.H. ABD El-Aziz, K.A. Attia4 

...gG, IgM, and IgA), total protein, albumin, globulin, glucose, total lipids, total cholesterol, and total antioxidant capacity in blood serum, and RBCs, WBCs, Hb, and PCV increased (P<0.05) in treated than in the control calves, being the highest with the combination treatment. Urea-N and creatinine concentrations, and AST and ALT activities decreased (P<0.05) in treated compared with the control calves, with the lowest values for the combination treatmen...

Di Zhou1, Qingmeng Long1*, Rong Yang1, Xiaoshan Tan1, Jun Li1, Mingyan Tang1, Zhonghai Zhao3, Ye Ao2, Zhinan Zhou1 and Changxue Chen1

...he genes were related to protein binding, catalytic activity and cell proliferation. Moreover, these DEGs were enriched in the categories of signal transduction, reproductive system, endocrine system and cancer-related pathways and linked the cGMP-PKG, cAMP, TGFβ and mTOR signaling pathways to reproductive performance. We verified these results using qRT-PCR for 9 up-regulated (AMH, CYP19A1, FOXL2, FSHR, GATA4, INHBA, LHB, LHX9 and ZP3) and 9 down-regulat...

Wei Fang1,2,3, Jiawei Hong1,2,3,4, Zhengyi Fu1,2,3, Jing Hu1,2,3, Gang Yu1,2,3, Zhenhua Ma1,2,3* and Humin Zong5*

...nslational modification, protein turnover, chaperones, intracellular trafficking, secretion, vesicular transport, transcription, amino acid transport and metabolism; KEGG analysis showed that DEGs was mainly related to cardiac muscle contraction, renin-angiotensin system, adrenergic signaling in cardiomyocytes, oxidative phosphorylation; The distribution types of SSR sites and their characteristic analysis results showed that the most important repeat type was...

Zhipeng Song1,2, Jialiang Xin1,3, Xiaoli Wei1,2, Abula Zulipiya1,3, Kadier Kedireya1,2 and Xinmin Mao1,3*

...he expression of retinal proteins was detected by tissue immunofluorescence and immunohistochemical staining. The mRNA level of VEGF was detected by RT-qPCR. In the in vitro experiments, cell viability was detected by CCK-8 reagent. The expression of related proteins was detected by western blot. We found that marein can effectively reduce triglycerides (TG), total cholesterol (TC), low-density lipop...

Asmaa A Darwish* 

...y cytokines, acute phase proteins, free radicals, globulin, triglycerides, kidney function tests, and liver enzymes concentrations and a significant (P<0.05) decrease in IL-10, antioxidants, total protein, albumin, glucose, total lipids, cholesterol, minerals, electrolytes, and trace elements concentrations. The DG hemogram clarified a significant (P<0.05) microcytic hypochromic anemia accompanied by neutrophilic leuk...

Mustafa M. Khalaf*, Rana A. Salih 

...athione (GSH), and total protein (TP) level was substantially reduced in the control group. Studies have demonstrated quercetin’s capacity to decrease cyclophosphamide’s effects on (MDA, ALT, ALP, TP, and AST) while increasing GSH. Also, quercetin significantly affects body weight for their group and mixed group with cyclophosphamide. The results demonstrated quercetin’s capacity to lessen the cyclophosphamide-induced changes in MDA, ALT...
ZAMARA MASOOD1, FAROOQ SALEEM1, SARFRAZ AHMAD2, TALHA JAMSHAID3, IMRAN WAHEED4,
MUHAMMAD AZEEM1, UMAR FAROOQ GOHAR5 & HAFIZ MUHAMMAD ARSALAN6, 7*
...s, steroids,
proteins, and amino acids, fixed fats and oils in all fractions. Floral
extracts were found to contain highest total phenolic contents (64 to 73
mg GAE/g), whereas leaves n-hexane fraction exhibited maximum DPPH
potential (70 %). All the extracts showed promising antimicrobial activity
in terms of zone of inhibition against selected bacterial strains, both Gram
positive and Gr...

SHEHLA AKBAR*, SAIQA ISHTIAQ*, KHALID HUSSAIN, ANS MUNIR & SAIRA REHMAN

...h (14.69μg/ml), total protein (14.34μg/ml), total amino
acids(28.43μg/ml), total lipids (3.67 μg/ml), total glycosaponins (14.95%),
total alkaloids (24.67%), total polyphenolics (28.40%) and total flavonoids
(5.67%) were found in given plant samples. were found in the samples.
Haemolytic and DNA protection studies of Misopates orontium were also
performed. Solar protection factor was calcu...
FARZANA SIDDIQUE*1, NAZIMA FIRDOSE2, MUHAMMAD ARSHAD2, WARDAH HASSAN2
& SHAFAAT YAR KHAN2
...ns all required building proteins, bone
forming minerals and fats. Milk is contaminated with pesticides and
consumption of contaminated milk, meat and dairy products is the cause
of high level of pesticides in the human body. Milk is a good source of
dissolving pesticide residues which are fat soluble. Present study was
designed keeping in view the nutritional importance of milk and its
co...

SHEZA AYAZ KHILJI1* ZAHOOR AHMAD SAJID2 & SONIA GHULAM BARI1

...fects of heavy metals on proteins, chlorophyll content and growth of Eichhornia crassipes L. in different concentrations of industrial effluents of district Shiekhupura. Eichhornia crassipes was grown for 15, 30 and 45 days in different concentrations of the industrial effluents (5, 10, 15, 20 and 100%) prepared with tap water. All physico-chemical parameters in the different concentrations of the industrial effluents were recorded. The values of these paramet...

ZAHOOR AHMAD SAJID1* & SHEZA AYAZ KHILJI2

...t, dry weight, amount of protein and antioxidant enzymes. The higher levels of NaCl (100-200 mM) in this investigation drastically suppressed the growth of plants of Suaeda fruticosa L. in the form of stunted growth. The overall increase in antioxidant enzyme activities during this study seems to be their scavenging role by neutralizing the reactive oxygen species produced during salt stress episode. It is therefore, suggested from the results of this research...

Muhammad Ashfaq ur Rahman1*, Saleem Khan1, Aurang Zeb1, Zia ud Din1 and Zafar Iqbal3 

...ts in the ‘caloric protein’ group represented the highest mean weight increase, at 2.9 Kg, increasing from 53.46 to 54.71 Kg in 3-months PI and from 54.71 to 56.33 Kg in 6-months PI, respectively. Weight gains in the nutrition therapy group were statistically significant at both 3 and 6 months PI. Patients in the control group either maintained or lost weight, with an average loss of 3.29 kilograms (7.1 pounds). In conclusion, pTB patients benefite...
Fariha Javaid1*, Zahoor Qadir Samra1, Madeeha Shahzad Lodhi1,2, Aroosha Hussain1 and Gulnaz Pervaiz1
.../mg, respectively. Total protein content was 660 mg, 810 mg, and 865 mg from leaf, peel, and stem samples. The percentage yield of BRM was determined in the range of 60 to 93 % from these waste parts of the plant. This study achieved 4, 6, and 7-fold purification for leaf, peel, and stem BRM, respectively. This study showed positive results for utilizing affinity-purified BRM enzyme in the laundry and detergent industry due to its stability in different deterg...

Jyotsana Shakkarpude1*, Aditya Mishra2, Deepika D. Caesar2, R.K. Sharma3, Anand Kumar Jain2, Sanju Mandal2, Rajesh Kumar Vandre4, Danveer S. Yadav5, Bhavna Ahirwar6 and C.P. Solanki6

...as it repairs heat shock proteins. The present study was aimed to investigate the effect of dietary betaine on heat and metabolic stress during lactation in Murrah buffaloes (Bubalus bubalis). For this purpose, a total of 18 postpartum Murrah buffaloes were randomly divided into control, low betaine and high betaine groups supplemented with betaine @ 50 g/animal/day and 100 g/animal/day respectively from day 5 postpartum and was continued up to 4 months postpa...
Saad Ibrahim Al-Sultan1, Mariam H.E. Khedr2, Ahmed S. Abdelaziz3, Mostafa M. Abdelhafeez4, Tamer Mohamed Gad5, Sabry Mohamed El-Bahr6,7*, Sherief Abdel-Raheem1,8 and Hesham A. Khalifa3
...s rich in animal-derived protein in particular countries such as Egypt and Saudi Arabia. Camel meat and offal supplies humans with part of their needs from essential amino acids, minerals, vitamins, and polyunsaturated fatty acids. Toxic metals such as lead (Pb), cadmium (Cd), arsenic (As), and mercury (Hg) are of no-known physiological importance. The objectives of the present study were to quantitatively estimate the residual levels of Pb, Cd, As, and Hg in ...

Lu Liu1, Xiang Zhao2, Yue Qin2, Tianxiang Gao3 and Tianyan Yang3*

...ius litulon contained 13 protein-coding genes (PCGs), two ribosomal RNA (rRNA) genes, and 22 transfer RNA (tRNA) genes. The total length of the mitochondrial genome of L. litulon was 16,430 bp, and the overall base composition of the mitochondrial genome was 26.96% A, 30.13% C, 17.58% G and 25.33% T. Our sequence is consistent with the mitogenome (NCBI accession number AP004413) named Lophiomus setigerus, indicating that the latter might be a misidentif...

Al Salihi karima Akool1* , Almas. M. Al-Bayati2, Iman Mousa Khaleel3  

...lays important source of protein, vitamins and other nanocomponents. The camel’s daily milk production shows a variation in milking frequency, which is affected by environments, feeding, stage of lactation, breed, species and diseases of the udder . Moreover, she-camels also shows fluctuating in the lactation length from 9 to 18 months. This study intends to investigate the macro and microscopical features of local Arabian she-camel’s productive ...

Muhammad Mudassar Shahzad1*, Tehreem Shabbir1, Syed Makhdoom Hussain2, Fatima Yasin1, Humayoun Huma Maqbool1, Aasia Karim3

... Thus, the production of protein-rich aquatic food is high on the agenda. Feed accounts for 60% of total expenditure in aquaculture. This study was designed to examine the optimal inclusion level of barley meal (BM), competitive plant proteins, as a fishmeal replacer in the formulation of diets, to evaluate its effects on the carcass composition, immunity, and mineral absorption in common carp. Six experimental diets using B...

Slamet Widodo1*, Mohammad Ikhsan Shiddieqy1, Teguh Wahyono2, Yeni Widiawati1, Zultinur Muttaqin1

...in this study were crude protein (CP), neutral detergent fiber (NDF), acid detergent fiber (ADF), lignin, fat, minerals, dry matter digestibility with pepsine (DMdPeps), organic matter digestibility with pepsine (OMdPeps), nitrogen digestibility with pepsin (NdPepsin), gas production.   The results showed that CP, NDF, and ADF   had the highest variability among the nutrients. A total of 27 significant (p<0.05) among nutrient content, di...

Maria Endo Mahata*, Yose Rizal, Zurmiati, Sepri Reski

...ganic matter (OM), crude protein (CP), ash, salt, and alginate contents. The results revealed a significant (p<0.05) impact on OM, CP, ash, salt, and alginate contents but did not significantly affect DM. Immersing P. australis in flowing water for 4 h is the optimal duration for decreasing salt content up to 97.62% while increasing CP and alginate levels proportionally. Immersion treatment in flowing water maintained the DM, OM, and ash contents.

Mervat M. Fath- Allah, Amal A. Ahmed, Hala A. Amin

... used to amplify the polyprotein region of members of Potyviridae. The RTPCR
revealed 335 bp amplified products with only infected plant samples corresponding to viruses
BYMV, CVMV, PVY, WMV and ZYMV, and according to virus symptoms and ELISA results. The
nucleotide sequence analysis of the polyprotein gene of PVY-ME2 (the present Egyptian isolate)
showed 98% homology with the PVY-isolate strain N...

Nguyen Thi Thu Hien1, Dong Huu Rin2, Nguyen Xuan Hoa1, Le Viet Tuan Khanh2, Phung Thang Long1*, Dinh Thi Bich Lan1

...ing M. hyopneumoniae P36 protein, express this protein in E. coli BL21(DE3), and evaluate its antigenicity as a base for further studies to against M. hyopneumoniae. The gene encoding M. hyopneumoniae P36 protein isolated from DNA of fresh lung tissue samples from PEP infected pigs was cloned into pGEM®-T Easy vector for sequencing, and then was inserted into pET28a vector to express t...

Hamdy Abdala El-Nagar1, Abdelaziz Mohamed Elhais2, Ayman Hassan Abd El-Aziz3, Wael Mohamed Wafa1, Mohamed Sobhy Elsayed Farrag2, Moataz Ibrahim Badawy1, Safaa Elsayed Salah Atia2

...cells, hemoglobin, total proteins and their fractions, total lipids, total cholesterol, and glucose, and the lowest urea and creatinine levels (P<0.05). Plasma immunoglobulins (IgG, IgA, and IgM) and total antioxidant capacity increased to the maximal values, while AST and ALT activities decreased to the minimum values in G4. Feeding Friesian calves on milk supplied with propolis (5 g) plus thyme oil (2 ml) per calf during the suckling period can improve gr...

Nur Saptahidhayat1, Claude Mona Airin1, Yanuartono1, Dyah Ayu Widiasih1, Soedarmanto Indarjulianto1*, Sri Handayani Irianingsih2, Meta Iqomah3

...oved the quality of milk protein, milk fat, lactose, solid non-fat, and total solid. 
 
Keywords | Dairy cows, Foot and mouth disease, Milk production, Milk quality
...

Al-Moataz Bellah Mahfouz Shaarawy1, Wael Mohamed Wafa1*, Ashraf Ali Mehany1, Reda Abdel Samee Ahmed Rezk2, Shereen Kamal Genena1, Mohamed Hamada El-Sawy1 

...while TSH, T3, T4, total protein, glucose, cholesterol, Ca, P, Na, and K, ALP activity, and milk yield significantly decreased (P<0.05, 0.01 and 0.001) in summer than in spring in Friesian and crossbred cows. In summer season, Friesian cows showed significant increase (P<0.05, 0.01 and 0.001) in RR, PR, creatinine, K, ALT and AST, while T3, T4, glucose and milk yield showed significant reduction (P<0.05, 0.01 and 0.001) as compared to crossbred cows. ...

I Nyoman Sumerta Miwada1*, I Nyoman Sutarpa Sutama1, Agus Susilo2

...t significantly affected protein and ash content (p<0.05). In the color aspect, the L* and a* values ​​significantly decreased (p<0.05), but the b* values ​​significantly increased. Texture profile analysis showed a significant increase in hardness, guminess, cohesiveness, springiness, and chewiness (p<0.05). The antioxidant capacity of cheese (mg/L Gallic Acid Equivalent Antioxidant Capacity (GAEAC)) significantly increased, namely 33.60 &plu...

Hermawan Setyo Widodo1,2*, Tridjoko Wisnu Murti1, Ali Agus1, Ambar Pertiwiningrum1

...then quantified the milk proteins from 34 PE, 57 SA, and 15 SP does. The study found the A allele was predominate followed by F and N on PE and SA. However, the SP goat only has A and F alleles in equal frequency, and the E allele was only found on SA. The AF genotype predominated on all breeds in almost half of its population, thus, the most diverse was SA. The Hardy-Weinberg disequilibrium of PE and SA indicated the influence of the breeding program. The gen...

Raed Hussein Salih Rabee1, Yahya Sabah Abdulameer1, Walla Farhan Obed1, Noor R Abady1, Adnan Mansour Jasim1*, Firas Hussein Albawi1, Mohammed Jasim Jawad2, Ahmed Samir Abukhomra3

... 3A4 (CYP3A4) and P-glycoprotein (P-gp) an enzyme responsible for the metabolism of antibiotics. Additionally, berberine demonstrated antibacterial effects against E. coli, as well as anti-inflammatory and antioxidant properties. Furthermore, histopathological examination of the intestinal broiler received BBR showed improvements and restore tissue near to normal.
 
Keywords | Enerofloxacin, Berberine, E. coli, Antibiotic residues,...

Irfan Safdar Durrani*, Noreen Asim and Ammar Sohail

...>Germins and Germin-like proteins (GLPs) are the ubiquitous family of plant proteins that belong to the cupin superfamily and have been reported to play a major role in plant defense against pathogens attacks and different abiotic stresses. Current research deals with the study of cis-regulatory elements located in the promoter region of OsGLP12-3 gene of Nipponbare and newly sequenced Oryza sativa L. cultivar Dilrosh-97 usi...

Naeem Tariq Narejo1*, Muhammad Hanif Chandio2, Faheem Saddar3, Majida Parveen Narejo4, Bushra Ainy Dars5, Hafeez ur Rehman Narejo6, Athar Mustafa Laghari2, Shafiq ur Rehman Shaikh3, Shahnaz Rashid7 and Ghulam Abbas7

...te the impact of dietary protein concentration on survival and growth efficiency of monosex tilapia, Oreochromis niloticus which were maintained in aquarium during the period of April-June 2020. Three diets were prepared by using locally available ingredients (wheat and rice bran, powder of mustard oil cakes, whole wheat flour etc.) to have varying levels of crude protein, specifically 35%, 40%, and 45%. The aeration provide...

Abir Ishtiaq1*, Abdul Ghaffar2, Maria Younas1, Tasveer Ishtiaq1, Zara Naeem3 and Muhammad Naeem4*

...an percentage for water, protein, fat and ash was found 74.70±0.76%, 16.92±0.66%, 4.60±0.16% and 3.78±0.12%, respectively, in H. nobilis. Highly significant (P<0.001) positive correlation was observed between fish size (weight and total length) and various body constituents of the fish. Positive allometry for all the studied constituents was found except for log total water content which represented negative allometric pattern wi...
Zahir Muhammad1, Muhammad Zubair Anjum1*, Shamim Akhter1, Muhammad Irfan1, Saira Amin1, Yousaf Jamal1, Sharjeel khalid2 and Shakira Ghazanfar2
...al diets each (30% crude protein supplemented with either T1-L. plantarum1×108 cfu), T2-(P. pentosaceus 1×108 cfu), T3-(L. plantarum and P. pentosaceus1×108 cfu) or (T0-(No probiotics) for 60 days in a triplicate manner (n=10/replicate/aquarium of 1 ft3). Growth performance was assessed by final weight (FW) weight gain (WG), average daily weight gain (AWG), specific growth rate (SGR, %), percent % weight gain (% WG), and feed conversion ratio...

Kristina Morkūnienė*, Rūta Insodaitė, Laimutis Kučinskas, Renata Bižienė 

...id sequence of the Mblk1 protein leading to higher brain functions in bees. In this study, we aimed to test the contribution of three Mblk-1 gene polymorphisms to the resistance to V. destructor mites. This case–control study involved 117 DNA samples that were genotyped for three single nucleotide polymorphisms (SNP) using the real-time polymerase chain reaction method. Statistical analysis was performed with SPSS Statistics 20 and PLINK software. SNP at...

Ghani Khan1, Saeed Ahmed Soomro1, Abdul Kabir2, Abdullah Iqbal3*,Naik Muhammad Marri 4, Syed Ahmad khan5, Muhammad Roidar Khan6 , Anees ur Rehman1, Muhammad Zakir Khan7 

..., specific gravity, ash, protein, total solids, fats, lactose, and moisture content. The results showed that oxytocin treatment significantly decreased pH levels in milk from the first lactation, while specific gravity did not differ significantly between the control and oxytocin-treated groups. Total solids, ash, and protein concentration were significantly higher in the oxytocin group, while lactose concentration significa...

Zain Ali1, Amjed Ali1, Bilal Ahmad Khan1*, Muhammad Ather Nadeem1, Muhammad Asif1, Adnan Ashraf1, Muhammad Ehsan Safdar1, Iram Inayat2, Aneela Nijabat3 and Rameez Hussain3,4

...ke pH, moisture content, protein content, fat content and ash contents. The moisture contents of both the samples and combined silage had not much difference among them, but the protein content, fat content and the pH of the combined silage had remarkable difference among them. The Syngenta-8711 + sunflower and Monsanto-6142 + sunflower varieties were best and had maximum mean values for most of quality parameters, (Fat cont...

Yanmei Wang1,2, Haoyun Li1, Lijuan Han1 and Wenkui Wang1*

...factor (MIF) and related protein and gene expressions in its downstream signal pathways need to be studied to explore the mechanism of MIF participating in PH. In this study, 4-5 weeks broilers with clinical PH were collected as experimental (PH) group, while the healthy broilers were taken as control group. The related mRNA expression levels were determined by qRT-PCR. The protein expressions and distributions were detected...

Faiza Naeem1, Muhammad Farooq Sabar1, Muhammad Usman Ghani2,*, Qurat Ul Ain1 and Qurat-ul-Ain Zafar1

...anking of genes based on protein interactions and centrality-lethality hypothesis representing that knockdown of influential node and edge leads toward the development of the disease. This ranking allows identification of the influential protein for the targeted drug discovery and therapies. An extensive study of published articles was conducted to enlist asthma-associated genes reported significant (P-value < 0.05) in th...

Ghusoon Hasan Jadaan1*, Khalisa K. Khudair2 

... (TAG), high-density lipoprotein (HDL)-c, low-density lipoprotein (LDL)-c, very low-density lipoprotein (VLDL)-c concentrations, tumor necrosis factor-alpha (TNF-), and interleukin 10 (IL-10) concentrations. The results revealed the development of signs of incitement such as increased TC and reduced IL-10, decreased HDL-C, and increased TC, TAG, VLDL-C, and LDL-C, along with an increase in...

Sara H. Zughayyar*, Amer H. Gyad 

...ides, while steroids and proteins were absent. The extract displayed antidiarrheal activity comparable to loperamide, showing a significant reduction in intestinal content volume and weight (P≤0.05). In conclusion, the ethanolic extract of Prosopis farcta L. fruits demonstrated promising antidiarrheal activity, potentially due to the phytochemical constituents identified, warranting further research for clinical applications. 

...

Agha Mushtaque Ahmed1*, Ali Zachi Abdul Qadeer Alhilifi2, Fahad Nazir Khoso1, Muhammad Ibrahim Kubar1, Tehniyat Naz Shah3 and Touseef Ahmed1

Hafsa Saeed, Soumble Zulfiqar, Abeedha Tu-Allah Khan and Abdul Rauf Shakoori*

...ressed and purified ZntR protein showed binding with zntA promoter. Increased transcripts of zntR in the presence of metal ions revealed its metal inducible nature. The molecular dynamics simulation and protein-metal ion docking studies of the K. pneumoniae ZntR protein are being reported for the first time.

...

Ying Chen1, Chao-Zheng Li2, Zhun Yu3, Jia Zhou4, Yan Xu4, Zhe Lin4, He Lin4* and Xiao-Wei Huang4*

...) was used to detect the protein expression levels of nuclear factor erythroid 2-related factor 2 (Nrf2), heme oxygenase-1 (HO-1), and NADH quinone oxidoreductase 1 (NQO1) in rat myocardial tissue. In the results, ECG showed that the MIRI model was successfully established; VAP can significantly reduce the activities of LDH, CK-MB in serum of rats, increase the activities of SOD, GSH-Px, CAT in myocardial tissue, reduce the activity of MDA in myocardial tissue...

Khansa Jamil1, Muhammad Ramzan Khan1, Asad Jan2 and Ghulam Muhammad Ali1

...) kcal/mol with targeted protein. Hence the study revealed that bioactive compounds derived from the Caralluma tuberculata plant pose highly antibacterial activity and might be used to synthesize the antibacterial drug.

...

Shu-Zhi Qin, Wen-Pei Ling, Mei-Fang Yin, Chun-Yu Luo and Cheng-Guo Zhao*

...tify;">Mitogen-activated protein kinases (MAPK) is an important signal pathway involved in cardiomyocyte injury. To investigate the protective effect of paeoniflorin (PF) on hypoxia reoxygenation (H/R) injury and its effect on MAPK signal pathway to reveal the mechanism of PF against myocardial ischemia-reperfusion injury, in this study, the H/R model of H9C2 cells was established by hypoxia for 3 h and reoxygenation for 3 h. H9C2 cells were divided into 4 gro...
Xiao-Wei Huang1,2, Mei-Li Liu1, Jin-Ji Wang1, Yue-Xin Liu3, Zhe Lin1, Chun-Shu Rong4* and Ji-Xiang Ren4*
...etected using ELISA. The protein expression levels of phosphoinositide 3-kinase (PI3K), protein kinase B (Akt) and mammalian target of rapamycin (mTOR) in the hippocampus were detected through western blotting. In the results, VAP contained 17 kinds of AA, including 7 essential AA, with a content of 394.08 g/kg, the total AA content was 831.55 g/kg. In the OFT, the PIR, VAPH and VAPL groups showed significant decreases in sl...

Nguyen Huu Van1*, Nguyen Thi Mui1, Dinh Van Dung1, Van Ngoc Phong1, Tran Ngoc Long1, Le Tran Hoan1, Le Duc Thao1, Vo Thi Minh Tam1, Ngo Mau Dung1, Bui Van Loi1, Nguyen Xuan Ba1, Ton Nu Minh Thi2, Nishino Naoki2

... the animals where crude protein (CP) digestibility increased as concentrate level increased, whereas digestibility of neutral detergent fiber (NDF) decreased. There were no significant differences in pH values, ammonia and VFA concentrations in rumen fluid between treatments before and 4h after feeding. The pH values remained in critical rumen pH range of 6.0-7.0 for optimum microbial growth and nutrient utilization. Hence, this study demonstrated that increa...

Abida Mushtaque1, Ali Ahmad Sheikh1, Aamir Ghafoor1*, Wasim Shehzad2 and Nadeem Ahmad3

... types of outer membrane proteins (OMP’s) which assist in interaction with host cells. The outer membrane protein H (OmpH) of Pasteurella multocida B:2 is a major transmembrane porin that can be used as a subunit vaccine and development of diagnostic kit against hemorrhagic septicemia (HS) because of its immunogenic nature. Pasteurella multocida has economic importance because of endemic and epizootic diseases in domes...
Qingsen Ran1,2, Manjing Li3, Jiayin Han3, Lifang Wang3, Han Wang3,4, Shaobo Liu5* and Yanping Wang1*
Mahmoud M. Bayoumi
...encodes the target viral protein, with no infection hazard or even nucleic acid integration. Furthermore, mRNA vaccines can stimulate both specific cellular and humoral immunity in a short time scale to combat a life-threatening or emerging viral disease. This review will comprehensively cover the recent advances in mRNA vaccine production, the delivery methods, and the essential compositions added to the mRNA vaccines to enhance efficacy and stability. This i...
Moustafa A. Zaghloul1*, Mohamed F. Azooz1, Saleh E. Ali1*, Heba M. Soliman1, Maha M. Sayed1, Mohamed H. Kafafy2 and Alaa R. Morsy1
... RPO30, P32 and EEV glycoprotein genes of Lumpy Skin Disease Virus (LSDV) recent isolates in Egypt, as well as to use artificial intelligence to predict the immunogenic landscape of circulating lumpy skin disease in the Egyptian cattle dairy sector, which will lead to universal blueprints for multiepitope lumpy skin disease vaccine designs. A total of 40 skin nodule samples were collected from clinically affected cattle to detect LSDV using PCR targeting GPCR,...
Hanaa H.A. Gomaa1*, Dalia Y.A. Amin1, Mona A. Ismail1, Basma Hamdy2, Khaled A. El-Dougdoug3
...quired resistance; total proteins, salicylic acid, phenol, proline, oxidative enzyme activities (polyphenol oxidase and superoxide dismutase) and virological assessments were assayed. Reduction in the disease severity of treated foliar ChNPs and BM fig plants was recorded. Systemic acquired resistance was detected related to Chlorophyll a and b and carotenoid, Phenol, Proline, salicylic acid and oxidative enzymes con...

Oghenebrorhie M. Oghenochuko1,4*, Olubukola T. Adenubi3, Olusola L. Ajayi3, Fakilahyel M. Mshelbwala3, Johnny O. Olukunle3, Samson A. Rahman3 and Godfrey N.O. Ezeri2

...of carbohydrate (7.82%), protein (4.48%), crude fiber (1.68%), iron (0.5mg/l), magnesium (210mg/l), flavonoids (0.46%), saponins (0.28%), tannins (0.95%). PCV, Hb, RBC and WBC were increased in all treatments but values were higher in bath treatment for RBC (3.0×1012/L), PCV (32.7%), Hb (10.7%). MCV, MCH and MCHC showed similar trend. Similar trends as in RBC and WBC were observed in total proteins. Liver and kidney fu...

Taidong Wang1, Xiaowei Huang1, Jian Huang2, Guangfu Lv3 and Zhe Lin1*

...e3, COX2 and TNF-α protein expression levels in hypothalamus (P<0.01 or P<0.05), and low-dose group significantly increased BCL2 protein expression levels (P<0.01). It was found that SR can significantly inhibit lipopolysaccharide-induced fever in rats with elevated body temperature, reduce serum TNF-α, IL-1β and IL-6 levels, reduce the hypothalamus COX2, caspase3 and Bax pr...

Franciscus Rudi Prasetyo Hantoro1,2,*, Dwi Sunarti1, Turrini Yudiarti1, Sri Sumarsih1, Rini Nurhayati2 

...ocking density and crude protein levels on blood parameters, bacterial populations, immune organs, antioxidant status, and growth performance in Sentul Selection (SenSi) 1 Agrinak chickens. Treatments consisted of three stocking densities (10, 14, and 18 birds/m2) and three levels of crude protein (14, 16, and 18%) factorially (3×3) which were arranged in nine treatments and four replications. Treatment and data collec...

Lijiao Wang1, Haibin Chen2*, Hongyan Yu1, Zexian Fu3 and Jianjun Zhao2*

...e endothelial PAS domain protein 1 (EPAS-1) gene in renal cell carcinoma (RCC), adjacent tissue and metastatic lymph node tissue. For this study, 110 cases of RCC tissue and corresponding adjacent tissue and 40 cases of metastatic lymph node tissue were selected. Western blot and immunohistochemical methods were used to detect the expression of EPAS-1 in the three groups. The expression of EPAS-1 and the clinicopathology of RCC were further analysed. To examin...

Rizki Dwi Setiawan1, Zurmiati2, Wizna2, Ridho Kurniawan Rusli2, Ade Trisna3, Surya Aulia4 

...the moisture, ash, crude protein, and crude fat content of the meat. Administration of probiotics (Bacillus subtilis FNCC 0059) up to 53 × 1012 CFU/mL affected the lightness and water-holding capacity of bayang duck meat.  

...

Roheela Yasmeen1,3* , Faheem Hafeez1 , Umme Ammara1 , Rubab Younas1 , Sibtain Ahmad2 , Zulfiqar Ali3, Zaheer Ahmad Nasir4 

... due to cheap sources of proteins and it is also considered as the center of various organic and inorganic emissions. The current study was designed to see the release of different metals from the poultry farms. Air samples both from indoor and outdoor along with the litter and feed samples of ten poultry houses were collected from the outskirts of Lahore, Punjab, Pakistan. Poultry farms were varied in feed and grouped into three categories: Group A (using Fee...

Turrini Yudiarti*, Sugiharto Sugiharto, Endang Widiastuti, Hanny Indrat Wahyuni, Tri Agus Sartono, Maulana Hamonangan Nasution

...cholesterol value, total protein, MCHC, Coliform population in ileum and weight of heart also bursa of fabricius, whereas could reduce MCV, coliform population in caecum, and weight of pancreatic also caecum and no effect on broiler performance. The conclusion is supplementation of fermented product of the fungus Monascus purpureus as a feed additive that applied on boiler can improve the physiological parameters, intestinal microbial population and internal o...

Ghusoon Hasan Jadaan1*, Khalisa K. Khudair2 

...oxidant capacity(TAO-C), protein carbonyl(PC), reactive oxygen species (ROS), and gamma-glutamyl transferase concentration(GGT). The results indicated that 200 mg/kg of SiO2 - NPs orally for 4 weeks contributed to a substantial drop in serum TAC-O, an increase in MDA, GGT, PC, and ROS concentration, and attenuation of silica’s oxidative stress status, CP NPs (T3) or SiO2 NPs (T2) administered orally to female rats for four weeks constitutes a case of oxi...
Omaima Khamiss
...neously: In addition to' protein profiles by SDS-PAGE, TEM electron microscopy ultrathin sections and hybridization dot blots, gel transfer to follow the probable mechanism especially with the high percentage of genome homology that was over 66% with one of five tested restriction enzymes. These observations suggest an important possible role for recombination in the early evolution and biological characteristics of these two viruses.
...
El-Dougdoug. K.A.1, Mervat, M. Fath Alah2, Reham A. Hassen3,Rehab A . Dawoud2
...dogenous salicylic acid, protein content, chlorophyll contents and peroxidase and polyphenol oxidase activities as well as increasing in growth parameters).
...

 Shawki, Khaled K.; Carter, M.J.; Alnashar, Nariman M., El-Farrashl, Mohamed A. and Taher, Sahar

...mbly of the virus capsid protein. In this study we employed a new approach for engineering stable particles of Hawaii virus capsid protein by deleting those immunodominant regions (P2subdomains) that evoke type-specific responses and bridging the resulting gap with a synthetic poly-glycine chain. This construct was expressed using the baculovirus system and the obtained purified protein wa...

Hemeida, A. A., Osman, M., El-Shahat, Mohamed, Hashem, Medhat H., Mahmoud, Amal and Dahi, Hosni

...e (AST), Serum alpha fetoprotein (AFP) , serum Albumin , serum creatinine , Serum TSH, Hemoglobin (Hb),White blood cells count (WBCs) and Platelets count . Hematological disorders and ALT elevation were common side effects of treatment. The side effects were increased within group B than that of group A. Three random hepatitis C virus (HCV) samples from group B were studied for the diversity and sequence variations. Sequencing of 223 nucleotide of 5'-untransla...

Yousifl ,3 , Ausama A. and Al-Naeem , Abdelmohsen A.

... of the A-type inclusion protein (ATIP) gene. The orthopoxvirus (OPV) ortholog genes LIR, A27L, A33R and B5R of the Saudi enzootic CMLV were also investigated using a modified PCR assay. Our data explains some of the variation obtained with restriction analysis and underlines the need for a review of some of the vaccines used to control CMLV.

...
Hassanein, Suzan A.; Abd El-Wahab, Wafaa; Eweis, Moustafa and Mahmoud, Mervat M.
...s to 3ABC non-structural proteins using commercial ELISA kit (Priocheck). The overall percentage of positive was 38.9 %. The higher percentage of positive detected in Behaira (48%), then Mounofya (45.3%) while Kafer El-sheikh was the lowest (23.7%). The positive results of detection of antibodies against non structured proteins of FMDV indicate that these samples come from natural infected animals.

...

Raof*, Amal M. A.; Haleem*, Iman Y.; Aly*, Nawal M.; * *Garhy, M.M. and Hosny***, Gehan A.

...uctivity. Non-structural protein (NSP) 3ABC antibody is considered to be the most reliable indicator of present or past infection with foot-and-mouth disease virus (FMDV) in vaccinated animals. An indirect ELISA was established, for detection of the antibody response to FMDV NSP 3ABC using commercial ELISA kit (Prio-check) for l065 serum samples were collected (735) from Sharkia and (330) from Kafr ElSheikh Governorates during 2009 from cattle and buffaloes. T...

Zaghloull , A.H.; Mahmoud2, Amal; Hassanl , H.Y.; Hemeida2, A.A.; Nayell , M. A. and Zaghawal , A.A.

... fragments from the glycoprotein G gene allowed specific amplification of BEFV-cell culture isolates from Egypt (Menoufia and Alexandria Governorates) and Japan. The PCR product was sequenced and analyzed. PCR product of Alexandria isolate was cloned and labeled with digoxigenin and used as diagnostic probe for BEF virus infection using dot-blot hybridization. Thirty six samples were collected from Menoufia Governorate (Berket El-Sabaa, Tokh Tambesha and Salam...

El-Absawy, E.A.; Mahmoud, Amal; Hemeida, A.A. and Helmy, M.

...nted portion of the coat protein (CP) gene and 3' untranslated regions (UTR). Phylogenetic tree showed two main strain groups: Group I regroups PVYN and PVY stains, while Group 11 includes pvy0, pvyw and PVYN:O strains. The Egyptian PVY isolate was clearly classified within group I, and was more closely related to PVY strains. Ten nucleotide substitutions resulted in 3 conserved amino acid substitutions (VI*I, G7*E, M or V and S8*G) and were able to differenti...

Elbeshehy, E. K.F. and Sallaml, A.A.A.

...stinguishable sole novel protein bands in four cucumber cultivars infected with CMV but not in healthy one. RT-PCR, with the primer CMV 1 and CMV2 for CMV-CP. gene, yielded 422 base pair DNA fragments. The following sequences were used in the comparison: Brazil (AF418577), China (FJ403473), New Zealand (AY861395) and India (AJ810260). The partial nucleotide sequence alignment, showed (95%) homology between CMV New Zealand isolate and CMV-Egyptian isolate. The ...

Mahdyl , A.M.M.; Hafezl , M.A.; EL-Dougdoug2, Kh. A.; Fawzyl , R.N. and Shahwanl , Eman S.M.•

...A) resulted induction of protein related to biotic inducers, virus concentration and disease severity (DS). The obtained results from quantification of total SA in induced tomato plants (after 7 days of spraying inducers) showed high level of SA with kombucha &eatment followed by C. inerme and M. jalapa, while mixed (M. jalapa+C. inerme) gave the lowest level of SA compared with healthy and infected controls. On the other hand, after virus inoculation toma...
Nassarl , Entsar A.; El-Dougdoug , Kh. A.; Osmanl , M.E; Dawoud3, Rehab
A. and Kinawy l , Aliaa H.*
...nce analysis of the coat protein gene demonstrated that the virus represents an isolate of the Tobamoviridae Family. The isolated virus was nominated as TMV Chrysanthemum Egyptian isolate (TMV-Ch-EG). This virus isolate caused severe disease symptoms in Chrysanthemum plants with mosaic, mottling and flower discoloration. The virus was purified biologically using serial transfer of the single local lesion technique on Nicotiana gultinosa. The induced antiserum ...

Rabia Anjum

...ibrillary tangles of tau proteins. Currently different hypothesis was proposed in the progression of disease which are amyloid cascade, tau and cholinergic hypothesis. Other than that age, family history, injury, high blood pressure and genetic may play an important role in the disease development. Current AD treatment are acetylcholinesterase inhibitors are easily accessible in the market to relief the AD primary symptoms but did not cure it. AD treatment nee...

Sharawil , S.S.A. and Abd El-Rahim2, I.H.A.•

...ng primer set for fusion protein (F) epitope, then cDNA were send to Institute of Animal Health Pirbright, England to analyze for their  nucleotide sequences of this F protein gene and phylogenic analysis properties, by matching with other reference world recorded isolates. The gene sequenced a 322 nucleotide cDNA fragment of the fusion protein gene was obtained. The isolates showed u...

Zein Salwa N; Abd El-khalik, Samaa; Khatab  , Eman A.A.H and Azzam4,Clara R.

...V-S was typical of nucleoprotein with minimum and maximum at 247 and 260 nm respectively. The ratios of A260/280 and Amax/min were 1.2 and 1.1 respectively. Electron microscopy of purified virus showed the presence of rod shape particles with a size 300 nm. Titer of the prepared antisera as determined using ELISA was 1/2000. Electron microscopic examination of infected leaves of N. clevelandii founed various cytological abnormalities. Due to the non-availabili...

*El-Helaly, Sahar H.; ** Ahmed, Amal A.; * Awad, M.A. and ** Soliman, A.M.'

...e analysis of their coat protein (CP) gene. The sequence of the coat protein gene (CP) of AMV was determined from cDNA clones. The CP gene was cloned into pGEM-T Easy vector, and transformed into Escherichia coli (E. coli) strain DH5a. The recombinant plasmids were obtained and sequenced. The nucleotide sequences were compared with corresponding viral nucleotide sequences reported in GenBank. The analysis showed that nucleot...

El-Tabakh, SAA l ; Abdel Wahab, KSE; Badr, AF   and Helal, IG  

...ction (RT PCR) and viral proteins by polyacrylamide gel electrophoresis (PAGE). HCV infected and control HepG2 cells supernatant fluids (SF) were sampled before complete change with fresh MM at weekly intervals for periods extended to one month after infection. Three SF samples taken 5 days apart after HCV infection showed that detection of HCV-RNA in SF was intermittent but' detection of new native protein as well as g...

El-Sabagh, I.M.; Hussein, H.A.; Amer, H.M.; El-Sanousi, A.A.; Reda,I.M. and M.A. Shalaby

...egment 9 (coding for VP7 protein) of NCDV was inserted into a baculovirus transfer vector under the control of the polyhedrin promotor. A recombinant baculovirus carrying the VP7 gene was constucted through homologous recombination between the baculovirus transfer vector carrying the VP7 gene and Autographa californica Nuclear Polyhedrosis Virus (AcNPV). Infection of Spodoptera frugiperda (SD) cells with Baculovirus recombinants expressing VP7

Amer, H.M.; Hussein, H. A.; El-Sabagh, I. M.; El-Sanousi, A. A. Saber,M.S. and Shalaby, M. A.

...virus (BCV) nucleocapsid protein was carried out in a baculovirus expression system. The specific RT-PCR product of N gene was cut and extracted from gel using DNA gel extraction kit (Millipore). Eluted DNA was successfully cloned in pBlueBac4.5N5-His TOPO TA baculovirus transfer vector and transformed in chemically competent E. coli. A modified colony PCR assay was utilized to identify the positive bacterial colonies that harbor the recombinant plasmids carry...
Ashraf M. Metwally*, Ausama A. Yousif*k , Iman B. Walaa A.   Attia M. Samy * , and Ismail M. Reda *
 
...sed regions of the viral protein. Our findings explain the continued presence of vvIBDV in intensively vaccinated flocks.

...

Abdel Razek,B.Omar*and Magda M.Sayed**

... with fluorescent. Total protein concentration of the prepared LSDV antisera was 0.8g/dl. Separation of anti-LSDV immunoglobulins 1gG were done using ammonium sulphate followed by conjugation with fluorescein isothiocyanate at pH 9.6. The anti-LSDV IgG conjugated fluorescein sterile and was used to detect LSDV in the MDBK cells and gave good results to dilution 1/20 while the reference conjugate to 1/30.

...

S.A. Sidaros, S.A. El-Kewey , Hala A. Amin;Eman A.H. Khatab ,  A.A. Emeran l , Samaa Abd El-Khalilk and M.A.S. El-Kady

... pair for the PMMoV coat protein gene (PMM-F and PMM-R) revealed 470 bp amplified product. Dot blot hybridization was used to establish the authenticity and specificity to the RT-PCR amplified Products of PMMoV. The coat protein gene of an Egyptian isolate of PMMoV was cloned and sequenced, The sequence contained a full-length ORF coding for the viral CP. It comprises 473 nt and a polypeptide chain of 157 amino acids with a ...
El-Dougdoug, Kh.A. t , S.A. Ghaza12 , A.A. Mousa2, H. Fahmyj and A.R. sofy2 
...here base number of coat protein gene ARC isolate 571 bp; TB isolate 529 bp and TN isolate 546 bp.

...

* Amal Abou El-Ela, A.

...f the 3' end of the coat protein gene (RNA-3)- Nucleic acid hybridization was useful for the detection of PNRSV in herbaceous and woody plant tissues. In successful attempt to eliminate the virus from infected dormant rose cuttings by heat therapy resulted in 29.6% virus elemination of (PNRSV).
 
...

Manal A. El-Shazly1, A. s. 2 Abdel Wahab and Salwa N. Zein3

...SV were typical of nucleoprotein with minimum and maximum at 247 and 260 nm for TSWV and IYSV, respectively. The ratios of A260Q80 and A were 1.2 and 1.11 for TSWV and 1.2, 1.3 for IYSV. Electron microscopy of purified TSWV and IYSV showed the presence of spherical panicles with 85 nm and 80-120 nm in diameter for TSWV and IYSV, respectively. Titer of die prepared antisera as determined using indirect ELISA were 1/3000 and 1/8000 for TSWV and IYSV, respectivel...

Mayada A. Abd Elgalell; B.A Othman2; Th. Radwan, 1 and Amal S.M. Abo-Sinna3

...ge PPI had 16 structural proteins, 6 are known and the other are extrapolated, but phage PP2 had 13 structural proteins 5 are known and the others are extrapolated. Both viruses have one molecule of the nucleic acid DNA with molecular weight of 2223 bp and 2559 bp for PPI and PP2 respectively.

...

S.Y.M. Mahmoud1 and M. Hashem2

...mino acids of BNYVV coat protein and bait plants test, respectively. The results confirmed the presence of BNYVV in 46 out of 184 and 24 out of 50 root and soil samples, respectively. The virus was found with percentage of 65% in root samples collected from Kafr EI-Sheikh. The transmission experiments indicated that BNYVV was mechanically transmitted to Chenopodium amaranticolor, C. quinoa, Beta Vulgaris cvs. Pleno. Tripl and Gloria. D. macrocarpa and B. marit...

A. A. Kheder1; I. A. M. Ibrahim2; H. M. Mazyadl

...mplify 200bp of the coat protein gene as a molecular procedure for diagnosis. Electron microscopy of purified preparation of PRMV showed presence of isometric particles 28 nm in diameter. Ultrathin section for electron microscopy examination of infected peach leaves shows virus particles in vacuoles. Tubules structure scattered in the cytoplasm or associated with plasmodesmata was shown. Extensive severe degeneration of chloroplast and mitochondria structure a...

A.A.Farrag;  I.A.M. Ibrahim and, H.M. Mazyad

...ify fragments using coat protein gene primers (358bp) of the viral coat protein gene. PCR product was used to generate ACLSV-specific probe to detect the virus in infected plants using non-radioactive molecular hybridization methods. The result showed that it is more sensitive than DASELISA and can be used for large scale detection. PCR product was cloned and sequenced. Comparison between local isolate sequence and other pub...

A-New-Whitefly-Transmitted-Geminivirus

...tes showed that the coat protein and the replicase genes of putative TYMV-QaIubia are not identical to TYLCV resembled genes, at least at the flanking regions of each gene. According to the results obtained from the PCR products and indicator host plants, it can be concluded that they are two different Geminiviruses. Based on host range and symptomatology, the TYMV-QaIubia appeared to cause infections only to some species of the family Solanaceae, in contrast ...

M.A. Abo-EInasr l, Kh.A. EL-Dougdougl, M.H. El-Kattan2 and L.A. Salem2

...dogenous salicylic acid, proteins related to inducers and activity of peroxidase and chitinase enzymes. Salicylic acid (0.5%) and potassium sulfate (3%) gave the highest effect in inducing SAR. where the treatment with them had forbid disease symptoms, and virus concentration was (0), 25 days post inoculation. In addition, the biochemical changes reached to the maximum values. whereas other chemicals gave a medium ability to induce SAR and gave varied values.<...

Hanaa H.A.Gomaa1, A. F. Moustafal, Kh.A.El-Dougdoug2, A.A. Abou-Zeid3 and S. Y.M. Mahmoud4

...arch granules, and total protein. The nucleic acid content of infected plants increased than healthy ones. The investigated hydrolytic enzymes of amylase and protease were reduced in infected potato plants while the level of polyphenol oxidase and peroxidase was increased. PVX and PVY infected potato plants contained less auxins and gibberellins, and the pattern of growth promotors and growth inhibitors was altered. Cytokinin was also inhibited as a result of ...

B. A. Othman; Kh. A. El-Dougdoug; M. H. Abdel Ghaffar and T. F. El-Arabi

...1 contained 6 structural proteins of 62.4, 60. 53.4, 50, 28, and 20 kDa; RM2 had 5 structural proteins of 60.4. 53.4, 50, 21.5 and 20 kDa: RM3 had 4 structural proteins of 60.4, 53.4, 50, and 21 KDa while RM4 had 3 structural proteins or 60.6, 53.4, and 50 kDa. The thermal inactivation points for the four phages were 68, 76, 80, and 64oC for the four pha...

M.S. Wassel1; Elham A. El-Ebiary1; Soliman, Y.A.l and El-Sayed, M.M.2

...wer in animals using its protein analysis and Western blotting.

...

Maria Kikelomo Adegun1*, Femi Godwin Ekundayo1, David Daisi Ajayi2 

...test substances in total protein, globulin, total cholesterol, triglycerides, aspartate aminotransferase, and alkaline phosphatase. In all these except alkaline phosphatase, the animals fed 30% GSF and 70% UTCP (T4) fared better than the animals on other treatments. Therefore, when the grasses in tropical regions dry up during the prolonged dry season, sheep can survive on urea-treated cassava peels and Gliricidia sepium fodder. 

...

Anak Agung Ayu Sri Trisnadewi*, I Gusti Lanang Oka Cakra

... C. Dry matter and crude protein digestibility of treatment A was the lowest but the highest on nitrogen-free extract (NFE) compared to treatments B, C, and D. The crude fiber digestibility was highest in treatment C and significantly different compared to treatment A, B, and D. The nutrient consumption, digestibility of organic matter, crude fat, and total digestible nutrient (TDN) showed no significant differences in all treatments and tended to be the highe...

Nurlan Akhmetsadykov1*, Tanatar Kydyrov2, Moldir Akhmetzhanova1, Gulnazi Akhmetova3, Maxat Berdikulov4 

...ons was carried out. The protein sequence was reverse translated to the nucleotide sequence, after which the gene was synthesized using solid-phase method. The gene fragment, encoding the GM6 protein, was inserted or cloned into the pET28 expression vector after synthesis. The obtained sequences were checked by sequencing for correspondence to the matrix molecule. For transformation E. coli BL21 (DE3) strain was used. To ass...

Zhengfei Wang1*, Chenchen Shen1,2, Yiping Zhang1, Dan Tang1,3, Yaqi Luo1, Yaotong Zhai1, Yayun Guan1, Yue Wang1 and Xinyu Wang1

...ium/calmodulin-dependent protein kinase II and Na+/Ca2+ exchanger. As a whole, our study laid a solid foundation for further functional elucidations of olfactory molecular mechanism in Procambarus clarkii, and provided further insight for a better understanding of olfaction molecular mechanism in crustaceans.

...

Farid S. Nassar1,2, Osama A. El-Sayed3, Saidi Ouassaf4, Ahmed O. Abbas1,2* 

... 0.05). The plasma total protein and triiodothyronine hormone levels were remarkably (p < 0.05) enhanced by adding FS to broiler meals. At the same time, the concentrations of alanine transferase, aspartate transferase, and uric acid were significantly (p < 0.05) lowered. Additionally, the triglycerides were dramatically (p < 0.05) decreased while the high-density lipoprotein composed a higher proportion than the lo...

Ahmed M. Manthoor, Ali H. Saliem* 

...ins, free amino acid and protein. While the gram staining, cultural characteristics, biochemical tests, Vitek 2 system and PCR tests referred to that bacteria was E. Coli. Bacteria was susceptible to the alcoholic extract of P. oleracea and gave an inhibitory zone 14-30 mm, while 15- 37 mm for ciprofloxacin. The MIC was 32 mg/ml for the extract and 25 µg/ml for the antibiotic. The MBC was 64 mg/ml for the extract and 50 µg/ml for ciprofloxacin. Fe-...

Tabinda Nowsheen1, Sayed Wadood Ali Shah2, Ali Hazrat1*, Muhammad Yahya1, Gul Rahim1, Muhammad Mukhtiar4 and Muhammad Ajmal Khan3

...ydrates but deficient of proteins. In minimum inhibitory concentration assay, the crude methanolic extracts showed significant inhibition against all tested bacterial strains at25, 50 and 100 µg/ml. The methanolic crude extract of A. maritime various parts showed MIC of 37.5µg/ml for S. aureus which is gram-positive bacteria followed by 75µg/ml for P. aeruginosa, (gram negative), and B. subtilis (gram positive) that is nearly similar to the a...
Rehan Ahmed Siddiqui1,2*, Shabana Usman Simjee2,3, Nurul Kabir4, Muhammad Ateeq3,5, Kevin Joseph Jerome Borges6, Muhammad Raza Shah3 and Rahman M. Hafizur2
... intact, decreased COX-2 protein expression, down-regulated the expressions of NFkB p50 and iNOS, and up-regulated Kim-1 and HO-1. The tested compounds (CA and CA-AuNPs) prevented the kidney from injury in the rhabdomyolysis-induced AKI animal models. However, almost complete protection is observed in CA-AuNPs treated animals at a relatively lower dose.

...

Skeikh Mustafizur Rahman1*, Mst. Shirin Sharmin Khan1, Yousef Ahmed Alkhamis2,3, Roshmon Thomas Mathew2, Md. Moshiur Rahman1, Mohammed Monirul Islam4, Md. Asadujjaman5 and Md. Golam Sarower1

...urce of heath-benefiting protein and other indispensable nutrients. This study aimed to investigate the proximate components (e.g. protein, lipid, moisture and ash) of eleven non-commercial marine fish species namely Johnius argentatus, Harpodon nehereus, Cynoglossus lingua, Johnius elongatus, Sillaginopsis panijus, Pomadasys hasta, Setipinna phasa, Megalaspis cordyla, Rita rita, Gonialosa manmina and Scatophagus argus obtai...

Julieta M Lopez-Martinez and Imran Ahmad*

...res such as high-quality protein, high content of fiber and micronutrients such as iron and calcium. Furthermore, amaranth seeds are a good source of phytochemical compounds with health-promoting effects such as squalene, phytosterols, and polyphenols. Amaranth seeds have gained popularity in recent years due to their perceived health benefits and dubbed as superfood. The food industry is formulating new products adding amaranth to cereal-based food and gluten...

Wisnu Jaka Dewa1,2, Ekowati Handharyani3*, Sri Purwaningsih4, Silmi Mariya5 

...m. Bax and Bcl-2 are two proteins that are involved in controlling the apoptosis process. This research aimed to quantify the expression of bax and bcl-2 gene in colon cancer cell WiDr treated with red snail ethanol extract 125, 62.5 and 31.25 ppm concentration. mesenggerRNA (mRNA) was isolated from WiDr cells using a commercial kit. The mRNA concentration was then measured with a UV-Vis microvolume spectrophotometer at 260/28 nm. Relative expression of bax an...

Ram Prasad Ghimire

...0.625±2.67% crude protein contents), voluntary fodder dry matter intake (74.40±10.12 g day-1 per kg metabolic weight of goat), apparent dry matter digestibilities of dry matter (54.96±4.77%), crude protein (57.73±5.97%), neutral detergent fiber (52.48±6.0%) and acid detergent fiber (39.29±4.18%) and for the body weight gain of goats (5.35±0.51 kg goat-1 in 120 days) among the ...

Theresia Nur Indah Koni*, Yeria Banoet, Welhelmina Wahon, Cytske Sabuna, Melkianus Dedimus Same Randu, Yanse Yane Rumlaklak, Tri Anggarini Yuniwati Foenay

...days increased the crude protein content, and decreased the crude fiber and tannins of banana peels. The level of fermented banana peels had a significant effect (P<0.05) on body weight gain, feed intake but had no significant effect (P>0.05) on feed conversion. Body weight gain and feed intake of crossbred native chickens up to eight weeks of age, fed banana peels up to 20% were not significantly different (P<0.05) with control diet.
&nbs...

Qing Cao1, Wei Jiao2, Huihui Lu1, Jing Zhang2, Meiling Ren3, Yan Xu1* and Shuyang Hu1*

....05). Thrombus precursor protein (TpP), P-selectin (Ps), maximum platelet aggregation rate (MAR) and mean platelet volume (MPV) of patients in the hypoglycemia and hyperglycemia group were all higher than their counterparts in the control group, while those in the hyperglycemia group were also higher than the hypoglycemia group (all P < 0.05). Besides, incidence rate of thromboembolism in the hypoglycemia group was much lower than that in the hyperglycemia ...

Qing Cao1, Wei Jiao2, Huihui Lu1, Jing Zhang2, Meiling Ren3, Yan Xu1* and Shuyang Hu1*

....05). Thrombus precursor protein (TpP), P-selectin (Ps), maximum platelet aggregation rate (MAR) and mean platelet volume (MPV) of patients in the hypoglycemia and hyperglycemia group were all higher than their counterparts in the control group, while those in the hyperglycemia group were also higher than the hypoglycemia group (all P < 0.05). Besides, incidence rate of thromboembolism in the hypoglycemia group was much lower than that in the hyperglycemia ...

Xiangmei Chen, Burie Bao* and Mo Degema

...e (GLUC3) as well as the protein expression and mRNA levels of sodium-glucose co-transporter 2 (SGLT2) and glucose transporter 2 (GLUT2) were used to study the mechanism of the hypoglycaemic effect of CPP on diabetic rats. We found that camel placenta produced no meaningful changes in the weight of hyperglycaemic rats or the weight of the liver, kidney, or pancreas. After STZ modelling, the blood glucose levels of rats noticeably increased. However, the blood ...

Faramin Javandel Soum Sarai1, Mir Daryoush Shakouri2* and Alireza Seidavi3*

...ficant increase in total protein and a decrease in glucose, total cholesterol, and LDL cholesterol concentrations (P<0.05). All supplements significantly decrease mean corpuscular volume (MCV), percentage of heterophils and the ratio of heterophil to lymphocyte (H/L), and increased mean corpuscular hemoglobin concentration (MCHC) and white blood cells (WBC) (P<0.05). Addition of formic acid lowered the effect of chromium picolinate on performance paramet...

Siqiang Li1,2, Tiantian Wang1, Peng Sun1, Airong Gao1, Xin Gong1, Yuanhong Xu2, Baogen Wang2, Jun Wu1* and Bo Liu1*

...ntation tank. The target protein was purified in three-step purification and identified by peptide mass of fingerprint. The enzymatic activity and optimal reaction conditions of MDS I were detected using DNA sequencer-assisted fluorophore-assisted carbohydrate electrophoresis. We obtained MDS I with a purity exceeding 90% in gram scales, which was capable of digesting α-1,2 linked mannose residues in high selectivity. The highest enzymatic activity of MD...

Afrasyab Khan1,3, Ali Raza Jahejo1,3, Meng-li Qiao1,3, Xin-yu Han1,3, Raza Ali Mangi1,3, Ding Zhang1,3, Yu-hai Bi2, George F Gao1,3* and Wen-xia Tian1,3*

...fferentiation-associated protein 5) IKBKE (inhibitor of nuclear factor kappa-B kinase subunit epsilon), NFKBIA (NF-kappa-B inhibitor alpha), NFKBIE (NF-kappa-B inhibitor epsilon), Interferon Alpha (IFN-α), cMGF (chicken myelomonocytic growth factor), and TRAF6 (Tumor necrosis factor receptor-associated factor 6) in chicken erythrocytes infected with M. synoviae using quantitative real-time PCR (qRT-PCR) at four different time intervals (0, 2, 6 and 10 h)...

Muhammad Nadeem1, Muhammad Naveed2,3*, Muhammad Shafiq2, Irfan Rasool2 and Muhammad Afzal Zahid2

...ntial, dietary elements (proteins, fat, ash), and more importantly, resistance against fusarium wilt and ascochyta blight compared to the existing varieties. The evolution of this strain commenced in 2002-03 cropping season by crossing K-90399 as a female parent with K-52582 as a male parent. The female parent had high yield potential, whereas the male parent had wilt resistance and was developed through introgression breeding using ILWC-126, an accession of C...

Eman Said El-Hadad*, Hesham Ahmed Madian, Mahmoud A.E. Hassan, Mohamed Fahmy Saad, Abdelghany M. El-Shhat, Entesar Zakaria Eliraqy

...-arginine on hematology, protein and lipid profiles, renal, hepatic, and intestinal functions, antioxidant status, and immunity of heat stressed Egyptian geese. A total of 30 sexually mature ganders (local Egyptian male geese strain) with 10 months of age and 3.20±0.25 kg body weight was divided into three groups (10 birds/group). Ganders were kept under normal hot climate in summer of Egypt and fed ad libitum on a commercial mash diet (15.2% CP and ME ...

Pramudya Andiana*, Moch. Geerhan Miraja Syahdan, Khothibul Umam Al Awwaly, Abdul Manab

...hydrolyzing chicken head protein in terms of the physicochemical characteristics and bioactivity of the hydrolysate. A laboratory experimental method using a completely randomized design (CRD) was used in this research. In this study, chicken head protein was hydrolyzed using different combinations of bromelain (b) and papain (p), namely CHP (without hydrolysis); CHP1 (0.25% b and 0.75% p); CHP2 (0.5% b and 0.5% p); and CHP3...

Noor A. Namaa*, Hayder A.N. Al-Zamely

...es on the level of total protein in testicular tissues utilizing the two assays of Western blotting and Bicinchonic Acid. A total of 60 Wister rats were chosen, prepared, and divided equally into three groups: T1, T2, and negative control, which received only distilled water daily and no other treatment. T1 was given a daily dose of (500 mg/kg) of Ginseng extract, while T2 received a daily dose of 250 mg/kg of Ginseng NPs. After a 60-day experimental period, a...

Elly Roza*, Salam N. Aritonang, Yulia Yellita, Hilda Susanty, Rizqan

...sh;8% fat and 4–8% protein compared to 3–4% fat and protein content in cow’s milk. Generally, the maintenance of dairy buffalo is still traditional, so the productivity of Murrah buffalo is still not optimal. This study aims to improve the health of Murrah buffalo by providing feed based on local forages to increase milk production. This research is an experimental study with the Latin Square Design (LSD), ...

Hossam F. Abou-Shaara

...t one contained yeast as protein source (yeast), the second one contained corn flour (corn flour), and the third one contained corn flour plus turmeric (turmeric). These pollen substitutes were presented to bee colonies beside sugar candy without any protein source as a control group. Some parameters were subsequently measured under apiary and laboratory conditions. All feeding types were attractive to bee colonies but bees ...
Raza Ali Mangi1,2, Ali Raza Jahejo1,2, Afrasyab Khan1,2, Meng-li Qiao1,2, Muhammad Farhan Qadir1,2, Mazhar Hussain Mangi3,  Shi-xiong Yang1,2, Xin-yu Han1,2, Sheng Niu1,2, Ding Zhang1,2, Ying Wang1,2 and Wen-xia Tian1,2*
...-transferase A3 (rGSTA3) protein on HDR and PRRs in the thiram-induced TD chicken. One hundred twenty arbor acres (AA+) broiler chickens of seven-day-old were equally divided into six groups. Group A, B, and C were treated with 0, 20, 50 μg.kg-1 of rGSTA3 protein, respectively. Group D, E and F were treated with 0, 20, 50 μg.kg-1 of rGSTA3 protein + thiram 100 μg.kg-1. The results...

Peixia Yu1*, Lijun Bo2 and Xueyin Song1

...mphoma 2 (Bcl-2) and Bax protein and mRNA expression were detected in the myocardial ischemia (MI) region. The HR and the MAP of the Fen group exceeded that of the I/R group, while the LVDP and ±dp/dtmax were approximate to the basic values. The MDA concentrations and CK-MB values of the Fen group went down and the SOD activity went up when was compared with the I/R group. Whereas, cTnI concentrations of Fen1 and Fen2 groups sharply decreased (all P<...

Roni Pazla1, Mardiati Zain1*, Fauzia Agustin1, Yetti Marlida1, Zaituni Udin2, Jaswandi2, Masrizal2, Hendri2, Windu Negara3, Totti Tjiptosumirat3, Ezi Masdia Putri3, Multiviza Muslim4

...ext-align: justify;">The protein-energy ratio in Pesisir cattle diets plays a role in determining their productivity. We aimed to establish the most effective combination of crude protein (CP) and total digestible nutrients (TDN) in a ration to enhance the productivity of Pesisir heifers. We evaluated consumption, nutrient digestibility, production performance, and the percentage of first estrous in sixteen heifers at 12-15 ...

Roni Pazla1, Mardiati Zain1*, Fauzia Agustin1, Yetti Marlida1, Zaituni Udin2, Jaswandi2, Masrizal2, Hendri2, Windu Negara3, Totti Tjiptosumirat3, Ezi Masdia Putri3, Multiviza Muslim4

...ext-align: justify;">The protein-energy ratio in Pesisir cattle diets plays a role in determining their productivity. We aimed to establish the most effective combination of crude protein (CP) and total digestible nutrients (TDN) in a ration to enhance the productivity of Pesisir heifers. We evaluated consumption, nutrient digestibility, production performance, and the percentage of first estrous in sixteen heifers at 12-15 ...

Babi Kyi Soe1*, Toe Win Naing2, Su Lai Yee Mon1, Nay Chi Nway3, Hiroshi Sato4

... analysis, whereas total protein and albumin were low. To our best, this study is the first molecular evidence for the presence of Anaplasma marginale infection in cattle in Myanmar, with a sequence similarity range between 98.8 and 100%. By understanding one of the major tick-borne pathogens (TBPs) in Myanmar, possible control measures might be implemented not only to minimize the transmission but also to increase the farm productivity.
 

Junita Mayasari, Vira Oktavia, Indri Juliyarsi, Ade Sukma, Sri Melia*

 

... content, water content, protein content, viscosity, total lactic acid bacteria, and organoleptic tests. The results showed that adding porang flour to fermented goat milk significantly (P<0.05) decreased the total lactic acid bacteria total titrated acid increased the pH value, dietary fiber content, water content, viscosity, texture value, and color value. Still, it had no significant effect (P>0.05) on protein conte...

Irfan Ullah1, Asad Ullah2*, Tahira Tayyeb1, Rafiq Ullah1, Muhammad Hanif1, Faiza Khan3, Imad Khan2, Raheela Taj4, Fatima Syed4, Shumaila Gul5, Muhammad Sadeeq6, Muneeb Islam7, Arsalan Khan8 and Khudija Ghani9

...evel and low-density lipoprotein (LDL) in group B (positive control) was significantly higher (P≤0.00) than the group A (negative control) and Se supplemented group C, D and E. 

...

Moazama Batool1*, Saima Naz2*, Ghulam Abbas3, Ahmad Manan Mustafa Chatha4, Mamoona Mahmood1, Asma Aziz1 and Fatima Yasmin2

...ameters, including total proteins, albumin and globulin, decreased significantly (p < 0.05). At the same time, alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), glucose and cholesterol were significantly (p < 0.05) increased in the treated groups compared to the control group. In conclusion, the study indicates that exposure to cadmium chloride, even in a low concentration, can cause adverse hematological and b...

Zahid I. Mohammed

... increase in total serum protein, albumin, and globulin. Also, Spirulina caused a reduction in blood urea, cholesterol, triglyceride, LDL, ALT, AST and ALP enzymes concentration while there was increase in HDL.
 
Keywords | Albumin, Cholesterol, Goat, kids, Liver enzymes, Spirulina
...

Shirina Akter Toma1, Shah Ahmed Belal2, Md Abdul Baset3, Md Nazim Uddin3*

...pent hens contained more protein than broiler meat. The spent hen’s breasts had a pH that was noticeably higher yet the broiler’s cooking loss was greater. Overall collagen content was highest in the thigh and breast muscles of the spent hen but the concentration of soluble collagen in broiler meat was greater. The spent hen was distinguished from broilers by having more moisture and ash contents (except wing meat of broiler), better pressing loss ...

Shahid Iqbal1, Arshad Khan, Ali Hazrat1*, Gul Rahim, Mohammad Ihsan1, Umar Zad Gul1, Maryam Bibi1, Khadija Bibi1 and Muhammad Mukhtiar2

... For total seed, storage proteins all the genotypes were subjected to SDS-PAGE analysis using 12.5% acrylamide gel, where a total of 14 polymorphic bands were observed. In Band 1 the highest degree of variation (0.83%), followed by Band 2 and Band 3 with a value of 0.75% variation, whereas the lowest (0.17%) was found in Band 12, followed by Band 14 with a value of 0.25% respectively. Based on two-way cluster analysis all the genotypes were divided into 2 main...

Zhenglei Qiao*, Jie Xing and Fang Li

...base pairs, including 13 protein-coding genes, 22 transport RNA genes, two ribosomal RNA genes, and one control region. The A+T content (59.7%) of the whole mitochondrial genome was greater than the G+C content (40.3%), indicating an obvious A+T preference. The mitochondrial genome of P. stoliczkana is similar to that of most teleost fish, and no gene rearrangements were detected. The phylogenetic relationship tree of Smiliogastrinae fish was constructed based...
Sijie Jian1,2,3,4, Wei Sun1,3, Jia Chao1,2, Na Rong1,4, Xiang Liu1,2,3,4* and Chen Chen1,2,3,4*
.... The outer membrane lipoprotein Slp of A. hydrophila has potential applications in fish vaccines. Slp bioinformatics analysis showed that anti-Slp serum might provide cross-protection to resist bacterial infection in fish. Slp was obtained by molecular cloning, expression and purification, and the expression conditions were optimized. In mice immunized with Slp, the immune-related factors of LZM and AKP were enhanced (p < 0.05), and a specific antiserum ti...
Fen Wang1,2, Lin Zuo1,2, Xiang Zhou1,2, Zhu Chen1,2, Xiao Na Xu1,2, Suo Fei Ji1,2, Guan Jun Hou1,2, Cheng Jun Zhu2, Ye Zhang3, You Feng Su4, Gendong Jin5, Jia Jia Wang1,2, Yuan Gao6, Guang Tong Song1,2* and Ye Lin Jiang1,2*
...uatic products with high protein and low fat contents. The amino acid contents in the muscle of type A were significantly higher than those of type B (P < 0.05), but no significant differences were observed in the calipash. Additionally, the amino acid score (AAS) in the muscle of type A was >1, which was significantly higher than that of type B (P<0.05). The contents of all fatty acids and EPA+DHA were significantly higher in Type A than in type B (P...

Faris Sahib Imran1*, Layth Hamzah Merzah2, Mohammed Mohsin Kareem3

...d in the sheep diet as a protein source at certain levels. The study was conducted in Karbala province, using the Al-Husseiniya River as the source of C. demersum. A total of 40 Awassi sheep were divided into two groups. The experimental group received a diet containing C.demersum as the primary protein source, while the control group had natural grass grazing as the basal diet. The results revealed that weight gain, final w...

Sandriana J Nendissa1,2, Meta Mahendradatta3, Zainal3, Februadi Bastian3

...on the water content and protein of tuna fish meatballs However, there is no significant difference on the sensory and total bacteria (p > 0.05) of tuna fish meat balls.  The best treatment, determined to be the addition of 2% Tomi-tomi fruit tannin extract concentration (C3), resulted in round and well-formed meatballs with a resilient texture and a distinct taste favored by the panelists. The water content measured at 52.63%,

Feri Eko Hermanto1, Yuli Frita Nuningtyas1, Filoza Marwi1, Fajar Shodiq Permata2, Agus Susilo1, Muhammad Halim Natsir1*

...ecode the complex web of protein interactions within mucosal immunity and explore the immunomodulatory potential of bioactive compounds found in these herbs. Biological networks were constructed for gut health and mucosal immunity, focusing on common proteins to identify promising targets. Our analysis pinpoints Interleukin-6 (IL-6) as the central protein governing gut health and mucosal i...

Shanti Fitriani*, Usman Pato, Yusmarini Yusuf, Emma Riftyan, Evy Rossi

...ected moisture, ash, and protein contents but did not significantly influence the descriptive test.   The best treatment in this study was B5 (the addition of bacteriocin 0.6%), which can maintain the quality of fishballs for up to 12 days at cold temperatures with a moisture content of 73.10%, ash 1.29%, protein 8.35%, and a descriptive test had a surface less smooth, slightly hollow and less bright, odour and tas...

Ediset1*, Jaswandi2, Fuad Madarisa1, Amrizal Anas1, Rizqan2

...e availability of animal protein from buffalo can only be maintained by relying on an innovation-based maintenance system. This study aims to determine the level of adoption of Artificial Insemination (A.I.) innovations and the success rate of A.I. innovations in the buffalo farming business. This study uses a survey method and a secondary data analysis approach. The population is 100 buffalo breeders who have adopted the AI. innovation. In comparison, the num...

ISHRAT FATIMA1, MOAZZAM JAMIL1, AZHAR HUSSAIN1*, MUHAMMAD ZAHID MUMTAZ2, MUHAMMAD LUQMAN1, SAJID HUSSAIN3, SAIF UR REHMAN KASHIF4 & MAQSHOOF AHMAD1

...to 65%, K up to 20%, and protein contents up to 20% as compared to uninoculated control. It is concluded that inoculation of ZSB strains like Bacillus sp. ZM20 and Bacillus aryabhattai ZM31 is an effective approach to improve the productivity of okra (Abelmoschus esculentus L.).

...

TAHIR IQBAL1, 2, UMER RASHID1* & MUHAMMAD IDREES3, 4

...homology of ORF3 encoded protein (ORF3P) of Pakistani novel aHEV (Pak naHEV) strain with a kinase 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophos-phokinase (HPPK) which participates in folate biosynthesis in bacteria. This finding is in agreement with the role of ORF3P as multifunctional protein modulating host cell signaling and gene expression to promote viral replication during infection.

...

ZOHAIB SAEED1, SHAHID IQBAL*1, UMER YOUNAS1,2, MUHAMMAD PERVAIZ*3, SYED MOHSIN ALI NAQVI3 & RANA RASHAD MAHMOOD KHAN3

... carotenoid content, and protein content along with total biomass of the plant showed that the soil mixed with 20% sewage sludge showed maximum growth of the plant. Meanwhile, antioxidants like TPC, Ascorbic acid content and antioxidant potential (DPPH, ABTS, FRAP) were also measured and maximum values were found in 20% to 40% of sewage sludge. Hence, sewage sludge may be exploited for the useful purposes in a controlled manner.

...

HIRA MUBEEN1, 2*, AMMARA NASEEM1, AMMARA MASOOD2, SHAHID RAZA3 & NAUREEN NAEEM3

...fic class of DNA binding proteins that act at particular site of DNA. Promoters are part of DNA fragment essential for transcriptional regulation of genes with certain transcription factors. These transcription factors could be useful in developmental regulation, interpretation and validation of candidate genes. This review highlights the importance of Cis-acting regulatory elements and transcription factors for regulation of gene expression. Furthermore, the ...

AAMIR MAHMOOD1, ZAHOOR AHMAD SAJID* & SHEZA AYAZ KHILJI2

... biochemical attributes (protein contents, antioxidants enzyme activates). A decrease in seed germination percentage from 95.22 (at control) to 25.34% (at 120 mM salt stress) and shoot length from 86.12 (at control) to 42.36 cm (at 120 mM salt stress) was observed. Similar decreasing pattern of growth was observed in case of pot grown plants after 60 days. The results suggested that salt stress drastically reduced length of shoot and root, fresh / dry weight a...
Jaime Vera Chang1, Arianna Torres Coronel2, Luis Vásquez Cortez2,3, Kerly Alvarado Vásquez2,3 and Frank Intriago Flor4*
 
...rix, pH, potassium, fat, protein, fiber and energy), sensory variables (flavor, color, taste, smell and texture). In the analysis of variance (ANDEVA) it is concluded that in the bromatological analyzes T2 contains the greatest amount of energy with a value of 403.57kcal/100g, in T1 a value of 0.46% protein was determined and in T4 8.51% mg/ potassium. 100 g were obtained; These variables are important indicators for an ener...

ASIFA BASHIR1, AAMIR MUSHTAQ2* & TOOBA MEHBOOB3

...cosides, amino acids and proteins in crude extract with phenolic and flavonoid contents observed as 9.9 mg/g equivalent of gallic acid and 100 mg/g equivalent of rutin, respectively. Free radical scavenging activity by plant extract was observed as 68±0.33 % as compared to rutin (58±1.15 %) at concentration 2.56 mg/ml. Similarly, in vivo studies indicated that Phyllanthus emblica 80 mg/kg significantly reduced the glucose level in diabetic rats u...

*SHAJAHAN BAIG1, MUSHTAQ AHMAD SALEEM1, MUHAMMAD AZMAT ULLAH KHAN1 ZEESHAN NADEEM2, SUFIAN AHMED2, MEMUNA GHAFOOR SHAHID3 & TANZEEM AKBAR CHEEMA3

...arrays, metabolomics and protein profiling methods. These profiling methods are very useful but still studies on sensitivity, specificity and substantiation are needed. Furthermore, bioinformatics studies may be quite useful for the successful application of these profiling methods to analyze the safety of genetically modified (GM) foods. These bioinformatic methods employ the comparison of different linked databases which may cover all the information signifi...

ASMA ZAFAR*, MONIBA KHAWAR, MAHNOOR CHAUDHRY, SAYYEDA SANA BATOOL, AMJAD HUSSAIN** & MUSHTAQ AHMAD SALEEM

... products, and bacterial proteins are used to treat cancer. One of the amazing bacterial protein azurin can work as an anti-cancerous agent which only target cancerous cells and do not cause any harm to healthy cells and thus minimize the risk of adverse side effects. The interaction of azurin with P53 (tumor suppressor protein), Eph/ephrin receptor and Cadherin enhances the activity of az...

AMBASH RIAZ1, SHAHID RAZA2* & HIRA MUBEEN3

...he production of Crystal protein. The present study is focused on the cloning and characterization of Cry1AB gene which expresses to produce crystal protein. Cry1AB gene was amplified using specific primers which gave successful PCR results of 3.5 kb long gene amplification. The amplified gene was further verified by inserting it into the expression vector. Furthermore, a computational approach was used to understand evoluti...

Uqba Mehmood

... The hydrolysis of spore proteins to free amino acids, is accomplished by proteases, in first 20 minutes of spore germination. The analysis of Spo mutants (strains which lack Sporulation (Spo) gene or have its inactive form) revealed that many of these strains did not produce extracellular proteases. Some evidence for the involvement of serine proteases in sporulation has been provided by inhibitor studies. Nevertheless variation in germination response of ger...

ZAHID FAROOQ1, IRFAN BABOO2, MUHAMMAD WAJID3, HAFIZA SADIA4, MUHAM

...usmn;12.658 mg/dL, Total protein 9.29±1.228 mg/dL and Albumin 2.44±0.108 mg/dL and were recorded. All these parameters between male and female were non-significant (p>0.05). As a pioneer work, these hematological and blood chemistry values may serve as reference range in male and female Chukar Partridge in captivity.

...

SHEIKH AJAZ RASOOL1, MUHAMMAD SALMAN RASOOL2 & MUNAZZA AJAZ3

...g is being tried against proteinaceous infectious particles (causing many transmissible neuro-diseases). These epigenetical agents have been a source of concern for our planet regarding food safety issues (e.g. infected meat). No doubt, man has made significant achievements in effective and neo-antimicrobials research, one wonders why not a single infectious agent has been completely knocked out. Our group has been focusing on ascertaining the basis of antibio...

ASUMAN ARSLAN DURU1*

... basal diet (166 g crude protein and 2821 kcal ME kg-1). Feed was offered limited (110 g/hen) and water was available ad-libitum. The trial was continued for 8 weeks. At the end of the study, egg yield, egg mass, feed intake and feed conversion ratio of laying hens were not affected by treatments with the addition of GBL (P>0.05). Whereas GBL20 treatment reduced the yolk cholesterol level (P<0.05). GBL10 and GBL20 decreased egg shell thickness compared t...

MUHAMMAD AMJAD ALI1*, MUMTAZ AHMAD KHAN2, WAQAS AHMAD3, FAIZ-UL HASSAN4, SYED MUHAMMAD RAIHAN DILSHAD5, MIAN MUHAMMAD AWAIS1, MUHAMMAD IRFAN ANWAR1, MUHAMMAD RAZA HAMEED1 , MUHAMMAD ASHRAF SULTAN6 & HASEEB ANWAR7

...emoglobin (Hb) and total proteins were also studied. Blood parameters such as RBC, Hb and total proteins were significantly different among dogs of both treatment groups. The changes in TLC values were insignificant amongst both treatment groups. Hypertonic colloid fluid can effectively be used as resuscitation fluid in medical emergencies.

...

María Julia Traversa1*, Mónica Saracco2, María Alejandra Colombatti Olivieri3, Fernando Paolicchi4, Edgardo Rodriguez5, Silvia Estein5, María Cristina Jorge5, William C. Davis6

...d to the bovine purified protein derivatives (PPDb) caudal fold skin test and were transiting the early peripartum period (EPPp). Flow cytometry, interferon gamma (IFNγ) production, and metabolic activity assessed peripheral blood mononuclear cells (PBMC) stimulation. The study enrolled 19 Argentinian Holstein cows older than two years classified into four groups, one of PPDb reactors that transited the EPP period (PPDbEPPp) (n=5), another of PPDb reacto...

Deni Novia*, Indri Juliyarsi, Rizki Dwi Setiawan, Clara Mustika, Cindi Melani

... energy value, moisture, protein, fat, ash content, solubility, color (L*, a*, b*), and sensory evaluation of hedonic preferences and qualities. The results revealed that different drying times showed significant differences (P<0.05) in antioxidant activity, energy value, protein, fat, ash, moisture content, color (L*, a*, b*), and sensory properties, except for color attributes in the hedonic preference test. The longer ...

Jacob Situmeang1, Lovita Adriani1*, Deny Saefulhadjar1, Safri Ishmayana2

... probiotics can increase protein levels and reduce lipid and cholesterol levels in chicken egg yolks. This study aims to determine the activity of the protease and lipase enzymes from yogurt and the effect and level of use of probiotic powder, which can increase protein and reduce lipid and cholesterol levels in chicken egg yolks. The study was conducted using a completely randomized design (CRD) with five treatments and eig...

Putri Okta Shafura1, Mardiati Zain2*, Elihasridas2, Bima Bagaskara1, Ummi Amanah1, Laras Sukma Sucitra1, Bella Veliana Utami1, Roni Pazla2, Erpomen2, Ezi Masdia Putri3, Rusmana Wijaya Setia Ningrat2, Riris Delima Purba3, Ruslan Abdul Gopar3, Putut Suryo Negoro3

...an population, microbial protein synthesis, and methane gas production. The results revealed a significant impact (P < 0.05) of these treatments on nutrient digestibility and rumen fermentation characteristics. The combination of 0.5% S. cerevisiae and 0.3% sulfur tended to increase nutrient digestibility, total VFA production, and microbial protein synthesis. Additionally, there was a notable difference (P > 0.05) in ...

Pham Tan Nha*, Le Thu Thuy

... 60% and 80% of fishmeal protein with larval protein (LP) in the control diet with four replications, each replication with 10 ducks (5 males and 5 females). The results showed that the weight gain of the LP20, LP40, and LP60 treatments was as high as the CTL treatment. The FCR of ducks at CTL treatment (3.40) and LP20 treatment (3.44) was significantly (P<0.05) lower than LP60 treatment (3.52) and LP80 treatment (3.59). ...

Srisukmawati Zainudin1,3, Hartutik2, Edhy Sudjarwo2, Osfar Sjofjan2*

... recommended as a source protein for local chickens.
 
Keywords | Fatty acid, Local chicken, Nutrient digestibility, Skipjack tuna, Omega
...

Waseem Abbas, Imtiaz Ahmed* and Imran Khan 

...equal to that of CB. The protein content increased “significantly in a dose-dependent manner with the increasing incorporation of these two herbs” when compared with the CB. When the carbohydrate content of both breads was compared, the functional bread had significantly lower values (p, for all trends < 0.05), respectively, as the ratio of incorporation increased. Total starch (TS) and DS reduced non-significantly at 1 and 2 % and significantly...

Mehwish Zafar1, Muhammad Shahzad1*, Muhammad Zubair Akram2, Quratulain3, Mehak Shehzad4 and Samreen Nazeer5*

...hlorophyll contents, and protein contents were noted in all condition in line L30 and L24 as compared other lines. High levels of potassium, calcium and magnesium and lowest sodium were noted in quinoa lines L30 and L24 aided in resisting salt stress and may be the cause of increased growth in both saline and non-saline soil. The present trial recognised the maximum salt-tolerant lines under severe salt stress, it might be applied to improve quinoa’s tol...

Safdar Hassan1, Shaukat Ali Bhatti1, Fawwad Ahmad1, Asad Ullah Hyder1, Muhammad Arslan2, Ashar Mehfooz3, Ijaz Saleem3, Muhammad Umar Yaqoob4,5, Mushrraf Nazir1, Muhammad Sharif1* 

...n-soy diet (Zn-40, crude protein (CP): 20%; metabolizable energy (ME) : 3000 Kcal/Kg) was formulated to contain 40 mg/kg Zn. The basal diet was supplemented with three super doses viz; 25, 50, or 75% of NRC recommended (1994) level and then these diets (Zn-50; Zn-60; Zn-70) contained 50, 60, and 70 mg/kg Zn, respectively. Two hundreds day-old broiler chicks were used for this study. Each diet was fed to a group of 50 broilers (Hubbard, BW 40±3 g, mixed...
Muhammad Atif Raza1, Muhammad Tariq Javed2, Muhammad Fiaz1*, Muhammad Shakeel3, Muhammad Shahbaz Ul Haq2, Amna Kanwal2, Syeda Maryam Hussain1 and Muhammad Zubair Siddiqi4
... in terms of total serum protein and lipid profile; total glycerides, very low-density lipids, high density lipids and total cholesterol. It was concluded on the basis of findings of current study that nanoparticles zinc oxide and copper oxide mixture (37.5 + 15 mg/Kg/d) was found optimum alternate to Florfenicol antibiotic against Salmonella gallinarum infection in broiler birds. Hence, Zinc oxide and copper oxide nanoparticles could be an adequate alternativ...

Muhammad Shuaib1*, Abdul Hafeez1, Woo Kyun Kim2, Aamir Khan3 and Abubakar Sufyan4

...gnificantly higher crude protein during phases 1 and 2, while crude fiber during phase1 and 3 for the SH treatment groups. The crude fat had a significantly higher value for the control group than all SH treatment groups during all (three) phases. The ash amount was significantly higher in the 3 and 6% SH groups during phase 1 while 6% and 9% SH groups during phase 3 than in all other groups. The control group had (P<0.05) lower gut contents viscosity durin...
Fahad Shahzad1, Muhammad Tahir1, Abdul Hafeez2, Muhammad Shuaib2*, Muhammad Shahkar Uzair2, Abdul Jabbar3, Abubakar Sufyan4, Muhammad Aamir Khan5, Muhammad Ayaz5, Hameed Ullah5 and Hammad Ullah5
...minimum level of dietary protein and subtilisin protease enzyme on the performance and nutrient utilization in broiler chicks. Different levels of proteins with and without subtilisin protease enzyme were evaluated on the overall performance, carcass yield, and nutrient utilization. For this purpose, 3 proteins and 2 protease levels were arranged in a 3x2 factorial design and each group wa...

Javairia Shafi*, Kashifa Naghma Waheed, Zahid Sharif Mirza and Shaista Razaq

...ng treatments. Feed ADC (protein) with duckweed at 30% inclusion level was significantly lower (P<0.05) compared to the other treatments. There was no significant difference in muscle composition of fish reared under the four treatments. Results of the present study showed that duckweed can be used to replace up to 20% of fish meal in feed of catla without any negative effect on fish growth or feed digestibility.

...

Muhammad Usman1*, Aneela Zameer Durrani1, Nasir Mehmood2, Muhammad Hassan Saleem1 and Mamoona Chaudhry3

...g the role of C-reactive protein as a prognostic agent in Borrelia-positive dogs. For this purpose, twenty-four dogs of different breeds were used in the study. These dogs were found Borrelia positive on PCR and equally divided into four groups (n=6). Group A was treated with doxycycline @ 10mg/Kg, B with azithromycin @ 20mg/Kg and C with clindamycin @ 11mg/Kg, and D with amoxicillin @2mg/Kg. All drugs were administered orally in different forms, i.e., tablet,...

Syed Makhdoom Hussain*, Hafiza Hina Shafqat, Muhammad Faisal, Mahnoor Saleem, Zeeshan Yousaf and Muhammad Amjad

...fat (CF) (81.25%), crude protein (CP) (69.39%), and gross energy (GE) (71.74) were seen in VI-level diet and these results were statistically (p<0.05) different from all other test diets. However, the test diet-IV had the least digestibility value of nutrients, including CF (73.55%), CP (49.17%) and GE (65.96%). It was concluded that C. catla fingerlings showed improvement in growth performance, nutrient digestibility and body composition when fed plant mix...

Zhenkun Zhao1,2, Ziniu Alimo2, Xinyue Zhao2, Haifen Qin1, Buddhi Dayananda3, Lichun Jiang1,2* and Wei Chen4*

...d 37 genes, including 13 protein-coding genes, 22 tRNAs, 2 rRNA gene fragments, a control region (D-loop region) and gene arrangement was identical to that of other Passeriformes mitogenomes. The overall base composition included A, 29.34%; C, 32.50%; G, 14.82% and T, 23.34%. The motifs obtained by sequence comparison, “ATGAACCTAA” between ATP8 and ATP6, and “ATGCTAA” between ND4L and ND4, and “CAAGAAAGG” between COXI and tR...

Umair Ahmad1*, Asad Sultan1, Sarzamin Khan1 and Muhammad Tahir2

...locally available animal protein concentrates could be ameliorated by supplementing birds with a ginger phyto-protease enzyme.

...

Dio Fico Felsidan Diatmono1, Seraphina Kumala1, Pradita Iustitia Sitaresmi2, Stefani Winda Paramita1, Megawati Andi1, Yustina Yuni Suranindyah3, Diah Tri Widayati1*

...as immediately for total protein, cholesterol, glucose, and blood urea nitrogen (BUN) levels assay. The spectrophotometry method used for biochemical data using specifics enzymatic were used. Feed samples were analysed using proximate method to determine dry matter (DM), crude protein (CP), and total digestible nutrient (TDN) intake. The data results were analysed using Independent Sample T-Test and the correlation between b...

Hayder S. Rwayyih*, Tahani S.S. Al-Azawi

...osphokinase, C- reactive protein and troponin and histology of heart and aorta in intact and ovariectomized rabbits. Twenty rabbits, aged seven to eight weeks, were employed in this investigation. The animals were split up evenly into the following four groups: The intact rabbits in Group One (G1) were given distilled water. The intact rabbits in Group Two (G2) were given an oral dose of alpha lipoic acid (10 mg/kg B.wt). The ovariectomized rabbits in Group Th...

Noura K. Al-Suwailem1, Nancy N. Kamel2, Ahmed O. Abbas1,3*, Farid S. Nassar1,3 , Dalia A.A. Elsayed4, Gouda F. Gouda1,5, Hosam M. Safaa6

... Meanwhile, plasma total protein, cholesterol, triglycerides, creatinine, urea levels, and liver enzymes activity were significantly (P<0.05) increased. The carcass yield and meat quality showed significant (P<0.05) deterioration in response to heat exposure. MLM administration to the basal diet significantly enhanced blood metabolite levels, hematological parameters, antioxidant activities, carcass yield, and meat quality in broiler chickens exposed to ...

Aspen Abutalip*, Batyrbek Aitzhanov, Assiya Mussayeva, Vladislava Suchshikh, Natalya Yegorova

...c, antibodies to surface proteins associated with the flagellar antigen Clostridium chauvoei were used, which sensitised latex microparticles with a size of 0.8-1.1 microns from Thermo Fisher Scientific Corporation. In the process of testing the prepared diagnostic system with vaccine strains of the causative agent of emphysematous carbuncle used for active immunisation of animals in Kazakhstan and field experiments with biological material from sick and decea...

Evy Rossi1*, Fajar Restuhadi1, Raswen Efendi1, Yusmarini1, Rahmayuni1, Emma Riftyan1, Bisma Panca Winata2, Yolanda Ashara2, Usman Pato1

...t of 84.18–86.12%, protein content of 3.52–3.78%, a fat content of 3.34–3.38%, pH 4.72–5.05, titratable acid (TTA) 0.74-1.24%, total lactic acid bacteria (LAB) 7.69–12.07 log CFU/mL, viscosity 285.15–2417.9cP, and Syneresis 0.00-0, 14%. Yoghurt made using fresh cow’s milk (FCM) had the following characteristics: water content 84.02–86.18%, protein content 3.43–3.74%, fat ...

Muhammad Ali Raza1*, Aneela Zameer Durrani2, Bilques Bano3, Muhammad Muddassir Ali4, Nazia Rubab5, Syed Tasadak Mehdi6, Muhammad Wasim Iqbal7, Kumay Hassan Akhtar8, Aqeel Raza9, Ujala Fatima Shan10, Muhammad Aftab11

...nutritional food rich in proteins and other essential minerals. Poor quality milk having Antibiotic Resistance resides threat to one health. Antibiotic Resistance is the main issue that affects the livestock, humans and environment. Antibiotic Resistance occurs due to the use of excessive amount of antibiotics for the growth and development of livestock. 90 samples of each weigh about 50 grams have been collected from Lahore and brought to University of Veteri...

Muhammad Adnan Khalid1, Syed Makhdoom Hussain1*, Shafaqat Ali2,3*, Abdullah Ijaz Hussain4, Muhammad Asrar1, Nisar Ahamd5, Majid Hussain6 and Muhammad Zubair-ul-Hassan Arsalan7

...dustry to produce animal protein but its growth is impeded by the cost of fishmeal, an optimal protein source for fish health. In this study, we examined the feasibility of various biochar supplements with Moringa oleifera seed meal (MOSM). Six iso-nitrogenous and iso-energetic diets were prepared: Control (without biochar) and diet II (parthenium biochar), diet III (farmyard manure biochar), diet IV (poultry waste biochar),...

Jinzhao Li1, Yawen Zhang2, Binghan Jia1, Yuqiong Zhao1, Huijuan Luo1, Xiaojie Ren1, Yuan Li3, Xiaoyan Bai1, Jing Ye3 and Junping Li1*

...er396-tau, P-Ser404-tau, protein kinase C (PKC), p38 MAPK (p38), p-p38 MAPK (p-p38) and µ-opioid receptors (MORs) in the colonic samples. The gene sequencing approach was used to detect alternatively spliced tau isoforms in the distal colonic muscle layer. Sequencing analysis revealed that 3 isoforms of tau, namely 2N4R, 1N4R and 0N4R were expressed in the distal colonic myocardium tissue. OIC rats had small, dry and hard feces, and intestinal propulsion...

Yan Wang1,2*, Lin Liu3, Na Li4, Yijun Zong1, Wei Liu1, Wenhua Xu1, Qi Wang1, Peijuan Zhang1 and Huiling Feng2,5*

...t was used to detect the protein expression of proteins. RT-PCR was used to detect the mRNA expression level of genes. Cell proliferation was discovered using the CCK8 test and plate cloning. The impact on the cell cycle was examined by using flow cytometry. The production of glycolytic enzymes and the significance of LY6K in the development of lung cancer in naked mice were both noted. The effects of LY6K knockdown on gluco...
Danish Riaz1,2, Syed Makhdoom Hussain2*, Majid Hussain3, Muhammad Zubair-ul-Hassan Arsalan4 and Eman Naeem2
... energy (73.54 %), crude protein (74.57 %), and crude fat (77.53 %). The total quantity of RBCs, WBCs, platelets, hemoglobin (Hb), and hematocrit (Ht) all changed significantly when fish were given a probiotic dosage of 2.5 g/kg. Incorporating probiotics at a dose of 2.5 g/kg resulted in the best growth performance, highest nutritional digestibility, and best hematological indicators in the fingerlings. Finally, the optimal dosage of probiotics for supplementa...

Shabnam Javed1, Amna Shoaib2 and Zaid Mehmood1

... like carbohydrate, ash, protein, moisture
content and fat, along with carbon, hydrogen, nitrogen and sulphur were analyzed in whole
plant of S. tomentosa. The results revealed the occurrence of considerable proportion of
carbohydrates (52%) and protein (23.80%). Moisture, fat and ash contents were found in
small amount i.e. 6.25%, 2.02% and 0.20%, respectively. Elemental analy...

Yuping Liu, Sige Wang and Tianyan Yang*

...technology, including 13 protein-coding genes (PCGs), 22 tRNA genes, 2 rRNA genes, a control region (CR) and a L-strand replication origin (OL), and its gene composition and order were similar to those of most teleosts. The A + T content of the whole mtDNA was 55.39 %, suggesting an obvious anti-G bias (16.64 %). The positive AT-skew (0.01) and negative GC-skew (-0.25) were revealed. The analysis of codon usage showed that NNA-type codons were used most freque...
Wagner Antonio Gorozabel Muñoz1*, Mayra Jossenka Loor Solórzano1, Josselyn Gema Palacio Intriago1, Virginia Vanessa Andrade Andrade1 and Carlos Alfredo Cedeño-Palacios1,2 
 
...isture NTE INEN-ISO 712, protein NTE INEN-ISO 20483, fiber NTE INEN 542, carbohydrates; antioxidant capacity by DPPH and carotenoids by HPLC. The results showed that the flour extracted from macer squash reached better averages in terms of fat 8.35 %; ash content of13.45 %; moisture 24.39 % and protein 17.70 %; the flour from vermilion squash reached better results in terms of FDN 19.76 % and FDA 8.16 %, the best carbohydrat...

Nguyen Thuy Linh, Nguyen Hoang Qui*

...sp;Insect is a potential protein source for poultry production with lower cost and better growth. By this importance, a total of seventy-two broilers from six to twelve weeks old were allotted to three treatments with 24 chickens per treatment using a completely randomized design to determine the effect of replacing fish meal (FM) by Hermetia illucens larva meal (HIM) in the diet on growth and health of broilers with three treatments of a 15% replacement of FM...

Siti Zubaidah1, Chusnul Hanim2, Bambang Ariyadi3, Aji Praba Baskara2*, Zuprizal2

...d dry matter (DM), crude protein (CP), ash, ether extract (EE), nitrogen-free extract (NFE), crude fiber (CF), total energy, amino acids (AAs), and fatty acids (FAs). In this study, the chemical composition was analyzed T - test student, while AAs, FAs, and cell-wall structure was analyzed descriptively. The microstructure of PKC cell wall after in vitro digestibility was determined by scanning electron microscopy (SEM). The PKC with shell contained the follow...

Mir Manzar Ud Din1*, Naveed Ahmad1, Muhammad Salman1, Fazli Amin1 and Saeed Ud Din

...xt-align: justify;">Silk protein is a natural biomaterial with remarkable mechanical properties, making it a promising candidate for various applications in the fields of biomedicine, textiles, and engineering. This paper provides an overview of the biochemistry of silk protein, focusing on its structure, synthesis, and functional properties. We delve into the molecular composition of silk protein

Mansoor Ali Khan*, Khalid Imran, Zahid Rauf, Tanvir Hussain, Muhammad Umair Khan and Sajid Ali

...sture contents (80.16%), protein (2.52%), fibers (2.22%), phosphorus (1.47%), iron (80.20PPm), Vit-C (1.36%), total phenol contents (180.00mg/100g), calcium (11.00mg/100g), magnesium (16.50mg/100g), manganese (0.12mg/100g) and potassium (373.20mg/100g) were maximum in the famous Kohat variety of guava. Alkaloids (0.60%), pectin (0.10%) lipids (2%), and zinc (0.34mg/100g) were maximum in Lahore (Punjab) variety, while ash, acidity carbohydrates and copper were ...

Nageen Iqbal1,2*, Abdul Mateen2, Laiba Shafique1,*, Huma Naz3, Saif ur Rehman4, Nouman Nazir2 and Qingyou Liu4

...eal by bone meal as main protein source was considered as T2 and T3, respectively. Results showed that replacement of 30% and 60% fish meal with bone meal has better effect on growth of L. rohita analysed whole body composition revealed that lower values of total fat there was observed no significant differences in carbohydrates and moisture content of fish was observed. Bone meal could replace fish meal as an acceptable protein...

Youlin Fu1, Zhongming Yang1 and Chongrong Qiu2*

...d potassium channel (BK) protein expression in coronary artery (CA) smooth muscle cells of spontaneously hypertensive rats. Eight healthy male spontaneously hypertensive rats (hypertension group) and 8 normal rats (Wistar group) were selected, and CA smooth muscle cells were isolated from the two groups. The PC of CA smooth muscle cells were recorded by patch clamp whole cell recording technique, and the BK currents and BK tail currents of CA smooth muscle cel...

Majid Ali1*, Naila Chand1, Sarzamin Khan1, Shakoor Ahmad2 and Muhammad Tahir3

...ffected except for crude protein which was significantly higher in the M50T50 diet group. Similarly, hematological parameters were not affected, while villus height, width, and crypt depth were significantly improved in the M50T50 diet group. These findings demonstrate that the supplementation of methanolic extract of M. oleifera and T. vulgaris in drinking water either alone or in combination improves the production performance, nutrient digestibility and gut...

Li Min1, Yong Chen2, Shunying Wu3, Xuefei Zheng1 and Mucheng Xu1*

...an those in group D. The protein expression of OCN and ALP in group B was significantly higher than that in group A. ALP protein expression in group D was significantly higher than that in group C. The protein expression of OCN and ALP in group B was significantly higher than that in group D. It is concluded that LPS can induce the proliferation of JDPSCs and ADPSCs, and the proliferation ...
Ashraf Khan1, Muhammad Waseem Khan2,3, Imrana Niaz Sultan2, Abdul Manan Kakar4, Saad Ullah5 and Afrasiab Khan Tareen2*
... contains rich amount of protein, fat and major minerals. Presence of trace amount of toxic metals in milk products by any means make it unfit for human consumption. The aim of this study was to evaluate metals in raw milk of buffalos and cows from different farms of district Quetta. Fifty-six whole raw milk samples from cows and buffalos were collected and analyzed using atomic absorption spectroscopy for metal contents. Levels of metals (mean±SD) such...

Sheng Zhang, Rui Qiu, Zhiping Lv, Liying Yang and Wei He*

...ined by ELISA, and EphA2 protein and PRMT1 protein in bronchoalveolar lavage fluid (BALF) samples are determined by western blotting, and then EphA2 mRNA and PRMT1 mRNA in BALF samples are determined by RT-PCR. The EphA2 expression and PRMT1 expression in experimental group were found clearly higher than those in the control. It appears up-regulation of EphA2 and PRMT1 expression can promote the development of NSCLC.

...

Sri Purwanti1*, Wempie Pakiding1, Marhamah Nadir1, Nurhayu2, Kusumandari Indah Prahesti1, Sitti Nurani Sirajuddin1, Jasmal Ahmari Syamsu1,4, Andi Mushawwir3 

...ding the CRP (C-reactive protein) high sensitivity, H-FABP (heart-type fatty acid-binding protein), homocysteine, and Gamma-glutamyl transpeptidase found higher (p<0.05) in R0 than R1 and R2. Moreover, the level of adiponectin, apolipoproteins, HDL (high-density lipoprotein) cholesterol, LDL (low density lipoprotein...

Hadi Awad Hassooni1, Safaa Sabbar Atiyah2*, Alaa Saleh Jassim1 

...ges of fat, lactose, and protein. The research was conducted in one milk production season, starting from October 2022 to April 2023, using 60 Holstein cows aged between 4-6 years. The results showed that cows had two genotypes of DIK20, with sizes of 190/181 and 180/170 base pairs, with distribution rates of 36.21 and 63.79%, respectively. Results obzerved highly significant differences (P≤0.01) between the genetic variants. The study also found significan...

Muhammad Shuaib1*, Abdul Hafeez1, Sarzamin khan1, Muhammad Shahkar Uzair1, Abubakar Sufyan2 and Muhammad Ayaz3

...r digestibility of crude protein (CP) in the T1 group and crude fat in the T1 and T2 groups while the digestibility of dry matter (DM), crude fiber (CF), and ash were not effected (P>0.05). Digesta viscosity and feces consistency were not effaced (P>0.05) but duodenum, jejunum, and ileum villus width, height, crypt depth, and surface area were recorded higher (P<0.05) in the T2 diet group. It is concluded that the replacement of soybean meal in the di...

Mohamed A. Abu El-Hamd1*, Abd El-Salam M. Metwally2, Mohamed I. Bassiouni2, Mohamed M. Hegazy2, Mohamed A. El-Gendy1 and Mohammed A. El-Magd3

Thuong Thi Nguyen1*, Thoa Thi Kim Nguyen1,2, Thuan Khanh Nguyen3, Meera C. Heller4

...at, solid-non-fat, crude protein, pH, free fatty acids, lactose, temperature, true protein), and examined by Foss–Milkoscan machines in dairy centers. SCC was classified into 5 levels (<100, 100-<200, 200-<400, 400- <1,000, and ≥1,000 103 cell/ml milk). The milk yield was highest at 16.76 ± 7.86 kg/cow/day, and SCC was lowest at 356.54 ± 191.43 (103 cell/ml milk) in Lam Dong province (the h...

Marah Salim Hameed1, Raad Mahmood Hussein Al Zubaidi2, Ali Ibrahim Ali Al-Ezzy3*

...riglyceride, total serum protein, albumin and globulin, total serum cortisol, total serum bilirubin, liver enzymes (ALT, AST, and ALP) were determined. Significant variation was reported in serum cholesterol between ethanolic extract vs control. Significant variation in total Serum albumin was reported between aqueous extract vs ethanolic group. Significant variation was reported in total Serum bilirubin between groups (aqueous extract vs control). No signific...

Kingsley O. Omeje1, Juliet N. Ozioko2, Amaechi L. Ogara2, Benjamin O. Ezema2* and Dilibe C. Urama3

...tion of high-density lipoprotein and triacylglycerides, with a decrease in the plasma concentration of low-density lipoprotein, with non-significant increase (p>0.05) in the activities of antioxidant enzymes. The extract did not show alteration in the liver function. Hence, prolonged consumption of the extract has not shown any sign of toxicity and may not predispose the animal to cardiovascular diseases.

...

Chun Shi*, Ziyu Cao, Mingyuan Yang and Meijing Zhai

...fect of FAM209, and PICK1protein in SD rats with Rodent pest. SD rats are randomly divided into control group, low (10 mg/kg of plant complex sterility agent) and high dose (20 mg/kg of plant complex sterility agent) groups. Hematoxylin and eosin staining is used to observe the pathological changes of testis tissue. The testis organ index, male seminal vesicle, and sperm were also detected. The expression of FAM209, and PICK1protein

Yasameen Waleed Al-Abedi1, Murtadha Kadhim Hasan2*, Alaa Abdalhadi Halboti3, Ali Abdulhussein Saleh Alsaeedi3, Rafed Abbas Kadhum1

... CRISPR-associated (Cas) proteins (CRISPR-Cas) for carrying out site-specific epigenetic alterations and so uncovering the capability of its use for the upcoming revolution of genetic engineering. The study provides an outline of the CRISPR-Cas system, followed by the mechanisms of genome modification, mainly focusing on the repair mechanisms of the double-stranded breaks. This key idea becomes the starting point of the investigation for the grander pathway th...

Zaigham Abbas1*, Abu Bakar Muhammad Raza1, Muhammad Zeeshan Majeed1, Muhammad Anjum Aqeel1, Talha Nazir2

...ive losses revealed that protein and ash contents reduced maximally up to 12.46 and 1.11% in CM-2008 variety, respectively. While minimum protein and ash content reductions were noted in Punjab-2008 variety (i.e., 8.58 and 0.75%), respectively. Similarly, highest reduction in crude fat and carbohydrate contents (i.e., 1.18 and 13.21%) were noted for Thal-2006 and CM-2008 varieties, respectively. While, Punjab-2008 and Punjab...

I Ketut Puja1*, I Nyoman Sulabda2, Ni Nyoman Trinayani3, Ni Wayan Patmawati3, Made Rahayu Kusumadewi3, Putu Bulan Sasmita Dewi3, I Wayan Sukernayasa4, Anak Agung Gede Oka Dharmayudha5, Putu Devi Jayanti5, I Wayan Nico Fajar Gunawan5 

...regnancy associated glycoproteins (PAG) circulating in the blood as a diagnostic tool for pregnancy in cows. A study was carried out on 37 Bali cows with previous experience giving birth. Blood samples were taken from the jugular vein on the 45th day after artificial insemination and stored at -20°C until PAG testing using the ELISA method. The sensitivity of the test for pregnancy detection was 0.33 ng/mL. As a control, samples from non-pregnant cows were...
Muhammad Umar Atique1, Sanam Zarif Satti1, Muhammad Ilyas1*
...g moisture content, ash, protein, fat/oil, fiber, and carbohydrate content were determined. The results of the study revealed that Bauhinia variegata has a maximum percentage (12.56%) of protein content, followed by Acacia nilotica (10.28%) and Ceratonia siliqua (6.54%). The maximum carbohydrate percentage was found in Acacia nilotica (39.41%) followed by Bauhinia variegata (33.8%), while the minimum concentration (27.48%) w...
Pervez Manan1, Farhat Jabeen1 and Ahmad Zamir2
...ich in carbohydrates and proteins. It is native to the north-western Himalaya and is distributed in eastern Afghanistan, northern Pakistan and north-western India, growing at altitudes ranging between 1800 and 3300 m. It is often associated with the Blue pine (Pinus wallichiana) and Deodar (Cedrus deodara). In Pakistan these forests are mainly located in the dry temperate zone of the Hindukush-Karakoram-Himalaya region i.e. Sherani Area (Suleiman...
Amjad Ali Ch., Mansoor Ali and Aurangzeb Ashraf Awan
...7.37-19.38 percent crude protein (CP), 35.5-39.95 percent crude fibre (CF), 3.49-3.99 percent ether extract (EE), 7.35-10 32 percent ash and 28.31-35.91 percent nitrogen - free extract (NFE). It should be advised on the basis of data that twigs and leaves of Acacia modesta must utilized in spring season from nutritional point of view....
Amjad Ali Ch., Tariq Mahmood, Shahzad Fazal and Nowsherwan Zarif
...ganic matter (OM), crude protein (CP), Neutral detergent fiber (NDF), acid detergent fiber (ADF) and acid detergent lignin (ADL).With increasing clipping stage, concentration of DM, OM, NDF, ADF and ADL increased in all plant parts whereas CP contents declined with increasing clipping stage. One month clipping stage these grasses got optimum nutritional value and sustained grass vigor....
Muhammad Zafar Iqbal, Amjad Ali Ch., Javaid Ahsan and Shahzad Fazal
...18 - 15.29 percent crude protein (CP), 22.36 - 30.78 percent crude fibre (CF), 2.88 - 3.62 percent ether extract (EE), 5.18 - 10.02 percent ash and 42.16 - 53.99 percent nitrogen - free extract (NFE). The data so collected suggest that leaves and twigs of Acacia nilotica can be fed to livestock due to their high contents of CP, EE, NFE and DM, CF during summer and winter respectively. ...
Ajiboye, A. A.1, Ebofin, A. O.1, M. O. Atayese,2, M. O. Adedire3, D. A. Agboola1 and M. Kadiri1
...er, fibre content, crude protein content, crude fibre content, ash content and carbohydrate content were estimated. The seeds of P. Africana and D. guineensis contain moisture content (%) of 8.64 and 12.62, dry matter content (%) of 9.36 and 87.38; Iron (%) 4.57 and 8.85; crude protein (%) 78.00 and 21.61; crude fibre (%) of 2.43 and 2.33; Ash content (%) 2.19 and 4.71 and total carbohydrate (%) 54.19 and 51....
Sardar M. Rafique and Ghulam Ali Bajwa
...sture (70.55%) and total protein (25.13%) contents were highest in low cut On the other hand, more total carbohydrates (60.81%) and minerals (15.15%) were found in tree followed by bush However, no single cultivation form gave all the nutrients at the highest level. High growth rates, single cocoon & cocoon shell weight and cocoon shell ratio on low cut reflected positive effect of high moisture and protein contents Based on...
Sarfaraz Hussain Bangash
...ntly in the synthesis of protein in the plant tissues because nitrogen compounds and sugar accumulate while meristematic tissues dies in absence of boron (Berger, 1949). There may also be an accumulation of soluble nitrogen and carbohydrates in plants and a reduction of amount of protein formed. Its deficiency results in higher NO3-N, whereas its sufficiency decreases NO3-N in plants (Oram, 1961). Boron...
Amjad Ali Ch., Zafar Iqbal, Muhammad Afzal and Muhammad Mushtaque
M. Rahim Niazi, G. Habib and M.M. Siddiqui
...n sacco digestibility of protein (ISPD) were determined in five wild (Acacia modesta, Pistacia attlantica, Pistacia khinjk, Olea cuspidate and Zizyphus mauritiana) and five cultivated (Prunus dulcis, Pyrus malees, Prunus persica, P. domestica and Punica granatumiree leaves collected from three different locations in Balochistan. Tree species significantly influenced ADF-P (P<0.001) and ISPD (P<0.001) of the leaves. ADF-P was higher ...
Sanam Zarif Satti, Tanvir Ahmad Qureshi, Iftikhar Ahmad and Sumara Zarif
... Fats (9.70%) along with protein (17.53%) was reported high in B. variegata. The minerals profile determined by Energy Dispersive X-rays Spectroscopy (EDX) divulged that among all the plant species highest amount of Carbon (C) in B. aristata (55.63%), Oxygen (O) in C. alba (44.93%), and Magnesium (Mg) in B. monnieri (0.55%) was recorded. Likewise promising concentration of Aluminum (Al) (0.23%) in C. alba, highest value of Si...
M. Rahim Niazi, G. Habib and M. M. Siddiqui
...e determined. Ash, crude protein (CP), neutral detergent fiber (NDF), acid detergent fibre (ADF) and in vitro dry matter digestibility (IVDMD) varied (P>0.001) due to tree species, but were not affected by location. Ash contents ranged from 4.62 to 17.02 percent of dry matter (DM) and remained higher in the cultivated tree leaves. CP in DM ranged from 7.17 percent in Olea cuspidata to 15.19 percent in Acacia modesta. Mean CP across all the specie...
Maqsood Ahmed and Noor Mohammad
...e forage with high crude protein and low fibre contents, making them a source of homegrown and cheaply available supplement for poor quality roughage feedstuffs such as cereal crop residues. Evidenced is presented that browsing on such trees improves feed intake, animal performance and overall utilization efficiency of poor quality roughage. ...
Mohammad Saleem and C. A. Call
... similar or higher crude protein content and % in vitro digestible dry matter when compared to Cymbopogon jwarancusa. Chrysopogon aucheri may not decrease in mixed Chrysopogon - Cymbopogon communities if the frequency and intensity of defoliation are controlled more closely as in this experiment. ...
Inayat Ahmad Hafiz
...e varieties showed that protein contents of PFI-1 and PFI-2 were higher then in Japanese hybrid and Karyansuban varieties and hence gave better cocoon shell ratio. The cocoon quality did not show much difference and the percentage of good quality cocoons was 89.5....
Muhammad Farooq, Pazir Gul Khan and F. W. Khan
...s, carbohydrate, fat and protein content. The nutritive ratios of all the grasses were also determined. The results obtained were compared with those of common grasses of Cholistan, Kalachitta area and Thai already supporting large herds of cattle. They compared favourably well to justify their propagation as a cattle feed on pilot scale....
M. I. Sultani, Muhammad Banaras Bhatti, Sartaj and Anjum Amin
.... The increase in crude protein contents was associated with the increase of legume in the grass legume mixture. Similarly increased of crude fiber was found with higher proportion of grass....
Pazir Gul and Fazli Wahid Khan
...nalyzed for Carbohydrate protein, Cellulose, oil moisture and ash. The results obtained were compared with those of seeds of and exotic species of Quercus incana. The result compared well and justified the exploitation of the indigenous Quercus as a poultry and live-stock feed on a cottage Industry level. It was also concluded that because of their high carbohydrate content they can be used for the preparation of alcohol by fermentation....
Sarfaraz Hussain Bangash and Mahmood Iqbal Sheikh
...izers affected the crude protein content of the leaves....
Abdul Aziz Khan
...s of digestible fats and proteins to the animal....
Shahida Parveen and Zakaullah
.... They contain 17.2 % of protein and 13% of fat (Chopra ., 1958). The area under the valuable crop is expected to increase in the country. Cultivation of cumin is being tried under the Peshawar conditions. Work on the collection of information about the diseases of the crop was initiated and available literature on the subject was reviewed.

Joshi and Agnihotri (1958) described the symptoms, morphology and cultural...

G. M. Khattak, M. I. Sheikh and S. H. Bangesh
...ng season, and its crude protein content. The objective was to increase the quantity and quality of feed for silkworms....
Pazir Gul and F. W. Khan
... which were analysed for protein, carbohydrate and ash, indicate that they can be utilized as poultry and livestock feed (9)....
Fazli Wahid Khan, Pazir Gul and Abdul Ghaffar Marwat
...s have been analysed for protein, arbohydrates and ash and the results indicate their utility as poultry and livestock feed. ...
F. H. Shah, M. H. Sedi and B. A. Nadeem
...of total and extractable proteins was maximum in the first regrowth harvested at one month interval. It then decreased with an increase in age of the crop. Maceration of the grasses with water after pulping increased the extractability of protein up to 183%. The yield of the extractable protein/per hectare/per year was up to 502 kg. ...
Abdul Aziz Khan
... ratio (ratio between proteins and total energy producers )' are capable of supporting growing calves and cows in milk....

Kremlin Mark B. Ampode

...rising demand for animal protein, the use of synthetic antibiotics in broiler diets to accelerate growth has become a public health concern due to the potential spread of antibiotic-resistant bacteria. This study investigated the effectiveness of Oregano (Origanum vulgare L.) leaf meal (OLM) as a potential antibiotic alternative in enhancing broiler chicken growth performance. A completely randomized design was employed with 125 Cobb broiler chickens and five ...

Danh Mo

...ng time increases (crude protein, CP 10.4-18.8% DM and acid detergent fiber, ADF 20.1-33.5% DM). Significantly (P<0.05) lower in CP and higher in ADF, the regenerated Wedelia was compared to the planting period. The second experiment was a Latin square on 4 goats over 4 periods across 4 treatments. The treatments were dietary forage (50% Wedelia and 50% grass in DM)-to-concentrate (F:C) ratios of 4:0, 3:1, 2:2, and 1:3 (DM basis). The daily consumption of W...

Ammar Abdulhasan Aldhalemi1, Murtadha Abdulhasan Aldhalemi2, Ali Joodi3, Qais R. Lahhob4* 

...ter content, pH as well, protein and carbohydrate percentage values that signified the difference of ginger oil extract on cheese properties. In addition, the noticed anti-fungal efficiency against the common fungus provides a promising solution as ginger oil extract has antimicrobial properties too with a very affordable cost. To be concise, the application of ginge oil extra has highly improved the texture, taste, and the reception of the product; moreover, ...

Ammar Abdulhasan Aldhalemi1, Murtadha Abdulhasan Aldhalemi2, Ali Joodi3, Qais R. Lahhob4* 

...ter content, pH as well, protein and carbohydrate percentage values that signified the difference of ginger oil extract on cheese properties. In addition, the noticed anti-fungal efficiency against the common fungus provides a promising solution as ginger oil extract has antimicrobial properties too with a very affordable cost. To be concise, the application of ginge oil extra has highly improved the texture, taste, and the reception of the product; moreover, ...

Duong Thanh Hai1*, Phan Thi Hang1, Nguyen Thi Thuong2, Zábranský Luboš3

...increases in dry matter, protein digestibility and the villi height in the chicken duodenum. However, whether effects of feed fermentation on carcass characteristics, meat quality and amino acid contents remain unknown. This study was conducted to examine the effects of maize and rice bran fermented with Saccharomyces cerevisiae on carcass characteristics, meat quality and amino acid composition of (Ri x Luong Phuong) chicken. The study was carried out using t...

Md. Nazrul Islam1*, Md. Saiful Islam Siddiqui2, Md. Rafiqul Islam3, Emdadul Haque Chowdhury3’ 

...scrapie associated prion protein (PrPsc). Although Bangladesh did not experience a BSE outbreak so far, Bangladesh has not yet been declared BSE free by OIE due to lack of scientific risk evaluation for BSE. The scientific data were reviewed, hazards were scheduled and surveys were conducted - on import of livestock and its commodities. The analysis was done by the “OIE Risk Analysis Framework 2006 and Scientific Steering Committee (SSC) 2003”,cons...

Rwaida Adnan Ali1, Rahman Hussain Hamza¹, Hayder Mohammed Hassan Habeeb1, Ali J. Al-Nuaimi2  

..., cholesterol, and total protein were measured in this study. The results showed that both mass activity and individual motility were significantly greater (P<0.01) in crossbred goat bucks than in local black and Cyprus goat bucks. In addition, the Cyprus goat showed a significant reduction (P<0.01) in dead and abnormal sperm compared with local black and crossbreed. However, local black and crossbreed exhibited significant increase in live sperm compare...

Asad Alam1, Asad Ullah2*, Imad Khan2, Yaseen1, Rafiq Ullah1, Tahira Tayyeb1, Muhammad Hanif1, Maiz ur Rahman1, Muhammad Owais Khan1, Fatima Syed3, Raheela Taj3, Shumaila Gul4, Muhammad Sadeeq5 and Muneeb Islam6

...d with 30% and 40% crude protein (CP) and buffalo meat. Water temperature was maintained at 31oC using heater (500Watts) with thermostat. The results were recorded with significant value in the growth of fish during 4th to 9th weeks. The values of fish weight were recorded higher (P<0.05) in group 3 than the group 1 and group 2. The floc concentration, feed and physico-chemical parameters have positive effects on biofloc system at winter session for quality...

Muhammad Ramzan Ali1*, Hasina Basharat2, Aziz Ahmed1, Mubeen Fakhar1 and Aleem Khan1

...out the optimum level of protein in the diet of African catfish formulated from low cost locally available feed ingredients. This feeding trial was performed on African catfish in twelve fiber glass circular tanks (2000 L water capacity) for period of 12 weeks at the stocking rate of 20 fish/ tank. The experimental design was CRD with 4 treatments having 3 replicates. Four experimental diets containing different levels of crude protein...

Hafiz Ishtiaq Ahmad1, Jinlong Zhang1, Fuxun Luo1, Owais Iqbal2 and Yuying Wang1*

...e soluble sugar, soluble protein, superoxide dismutase and peroxidase levels increased significantly under compound red, blue and green (RBG) light conditions, while malondialdehyde content was highly decreased in the same treatment (RBG) as compared to control. The study indicated that the various light qualities could enhance the growth parameters of D. officinale seedlings by improving biochemical features and their enzymatic activities. 

...
Hong Su1,2, Lu Chen1,3, Wenrui Guo1, Daqing Wang1,3, Aolei Dou1,2, Jie Su1, Yanyan Yang4, Ying Tian4, Tingyi He4, Caiyun Wang1, Chenguang Du1, Haijun Li1, Xihe Li5, Guifang Cao1*, Yongli Song5* and Fuxiang Bao3*
...nd genes associated with protein and fat digestion, hematopoietic stem cell lineage and osteoblast differentiation, are enriched during the development of the Ujumqin sheep 16-day embryo U(E16). Our work provides important complementary reference data for the study of early embryonic development in sheep.

...

Ayoola Mathew Oluwaseyi1*, Aderemi Foluke Abimbola1, Alikwe Philip2 , Tumgbulu Samuel2, Eniufuoma Augustina2 

...ve. Measured serum total protein of the groups on ECLM were significantly (p<0.05) higher, while serum cholesterol were significantly (p<0.05) lower than those on control group. Birds on 1% and 2% ECLM inclusion had the best dressed weight which was significantly (p<0.05) higher than those on control. ECLM inclusion as feed additive increased populations of beneficial bacteria such as Lactobacillus spp. and decreased populations of potentially harmful...

Mati Ullah1*, Muhammad Rizwan2, Ali Raza3, Xianlin Zhao4, Yanling Sun4, Sarah Gul5, Muhammad Ihtesham Waheed6, Muhammad Nadeem Khan7, Alvina Gul8, Sami Ullah Jan9* and Chao Huang4*

...stem, followed by “protein metabolism”. The eggNOG functional analysis revealed that the COGs associated with “Carbohydrate transport and metabolism were dominant followed by those associated with “Replication, recombination, and repair” while the biological pathway analysis by the Kyoto encyclopedia of genes and genomes (KEGG) database identified the metabolic and biosynthesis of secondary metabolites pathway as the dominant one....

Zhiwen Xu

...egulating yes-associated protein 1 (YAP). In this cell culture study, an OSCC cell model was constructed, followed by transfection with Snail-inhibitor. The OSCC HSC-3 cells were treated, and their apoptosis and viability were evaluated. Finally, Western blot, flow cytometry assay, Transwell assay, and scratch assay were used to explore the molecular mechanisms by which Snail/Slug promoted OSCC cell proliferation by regulating YAP. The activation of the Snail/...

Yaowu Zhan, Dandan Su*, Jinxiu Bai, Fang Li and Yulian Dong

...amyloid A and C reactive protein in children with acute upper respiratory tract infection. A total of 324 children with acute upper respiratory tract infection (ARTI) who were treated in our hospital from October 2020 to April 2022 were selected as the research subjects. The variation of C-reactive protein concentration was tested by sphericity hypothesis, and the Greenhouse-Geisser method was used for in-depth analysis. The...

Yueting Chen* and Ying Hu

... (whole nutrient) + whey protein powder can be selected to ensure the demand and consumption of protein during dialysis, improve the immune defense ability of patients and avoid a series of complications caused by malnutrition.

...

Yueting Chen* and Ying Hu

... (whole nutrient) + whey protein powder can be selected to ensure the demand and consumption of protein during dialysis, improve the immune defense ability of patients and avoid a series of complications caused by malnutrition.

...
R. Javed1,2, T. Usman1, S. Niaz2, N. Ali2,3, H. Baneh4, K. Ullah5, I. Khattak1, M. Kamal1,2
S. Bahadar6, N.U. Khan1, S. Khan1,7, Y. Wang3*, Y. Yu3* and Mostafa K. Nassar8
...milk composition (fat %, protein %, and lactose %) and SSC (by direct microscopic SCC method). The data were analysed using a generalized linear model of SAS studio for the effect of the SCC, breed, and herd on milk performance while wombat and CFC for the analysis of genetic and non-genetic factors. The results showed that animals with higher SCC have significantly lower (P<0.01) milk fat %. Breed-wise analysis showed significantly higher (P<0.01)

Komal Hingoro1, Muhammad Saleem Chang1,2* and Ghulam Sarwar Gachal1

...hii and Pangshura tecta, protein in the species of Pangshura tecta and kachuga smithii, cholesterol in Nilssonia hurum and Chitra indica, urea in A. gangeticus and Chitra Indica, triglycerides in Nilssonia hurum and Chitra indica and uric acid in Pangshura tecta and Lissemys punctata, respectively. Finally, no significant (p< 0.5) differences were identified in the hematological and biochemical parameters of seven species except EOS and MO. Based on these f...

Hongping Zhong1, Xiaoning Cheng2 and Peiqiang Yan3*

...cleolar organizer region proteins (Ag-NORs) of pediatric epilepsy and T lymphocyte subpopulation and their relationship before and after treatment, 156 children with epilepsy diagnosed at Yan’an University Affiliated Hospital were selected as the research objects. In addition, 100 healthy children were selected and divided into control group. Flow cytometry was utilized to detect T lymphocyte subpopulation. Common silver staining technique was adopted to...

Tanveer Hussain1, Abdul Wajid1, Jabbar Khan2, Asif Nadeem1, Misbah Hussain1, Qurat ul-Ain1 and Masroor Babar1*

... autocrine fashion, IL-2 protein plays a crucial role in proliferation of T cells. IL-2 triggers the release of pro and anti- inflammatory cytokines by activating several pathways. In present study, exon 1 of IL-2 gene of four local Pakistani breeds (Dera Din Panah, Beetal, Nachi and Kamori) was amplified by using reported ovine IL-2 primers. Amplified products of 4 breeds of goat were bidirectionally sequenced to decipher polymorphisms. Only a single substitu...

Lin Li1*, Lu Lu2, Gang An2 and Xiaoguang Zhang3

...owed that the TF and Bax proteins in the blue model group were significantly higher than those in the blank control group, and the expression of Bcl-2 protein was significantly decreased (P<0.01). Compared with the blue light model group, the expression of TF and Bax protein in TF-TP 150 μmol/L group was significantly decreased, and the expression of Bcl-2 pr...

Mohammed Mijbas Mohammed Alomari1, Nawar Jasim Alsalih2*, Samir Sabaa Raheem2, Mohenned Alsaadawi2, Ali Mosa Rashid Al-Yasari3

...obin in the blood, total protein, albumin, urea, creatinine, total bilirubin, circulating immune complexes, the activity of alanine and aspartic aminotransferases, α-amylase in blood serum, erythrocytes, leukocytes, T- and B-lymphocytes, O-cells, and T-helpers. From this study concluded the treating sick dogs, positive changes occurred, which are characterized by an improvement in the general clinical condition , normalization of the concentration of hem...

Tamara Natik Dawood* 

...V, body weight and total protein levels in G1 compared to G3 at (p <0.05), as well as Hb, PCV, body weight, and total protein increased with increasing dose (P <0.05). On the contrary, the value of feed conversion efficiency, triglycerides and cholesterol were decreased in G1 and G2 compared to G3 (P <0.05). Furthermore, feed conversion efficiency, triglyceride, and cholesterol decreased with increased dose used (P ...

Istna Mangisah*, Lilik Krismiyanto, Vitus Dwi Yunianto Budi Ismadi, Mulyono Mulyono, Nyoman Suthama, Fajar Wahyono

...00 kcal/kg and 18% crude protein. The treatments tested included T0: density of 5 ducks/m2 + basal ration, T1: density of 5 ducks/m2 + 0.25% ALM, T2: density of 5 ducks/m2 + 0.5% ALM, T3: density of 10 ducks/m2 + 0.25% ALM, T4: density of 10 ducks/m2 + 0.5% ALM. The parameters measured include intestinal bacterial populations (LAB and coliform), digestive organs, blood lipid profile (cholesterol levels, low density lipoprotein

Mahfuza Ferdous1, Sabuj Kanti Nath1 and Mustasim Famous2*

...centage of fat, SNF, and protein showed significant variation (p<0.005). Feeding methods by implementing new technological approaches, farmers can improve milk quality and gain more profit by minimizing feed costs. 
...

Nasir Ali Tauqir1*, Asim Faraz2, Muhammad Imran Babar3 and Irfan Shahzad Sheikh3

...ry matter (DM) and crude protein (CP) content were higher (p<0.05) in oat fodder supplemented with P and NP fertilizer as compared to control. The supplementation of P fertilizer resulted in decreased NDF and hemicellulose and did not show any effect on ADF content of oat fodder. At 48 h of incubation, in situ digestibility of DM, CP, NDF, ADF and hemicellulose was greater (p<0.05) with medium levels (N20P20 and N25P25) of P and NP fertilizer as compared...

Muhammad Shuaib1*, Abdul Hafeez1, Naila Chand1 and Muhammad Tahir2

...erol and low-density lipoprotein (LDL) were calculated (P<0.05) higher in the CON group while all other hematological and serum biochemistry parameters were not affected and were in the normal range. It is concluded that the replacement of soybean meal in the diet of laying hens by 3% SH in combination with enzyme (β-Mannanase) at the level of 20mg/kg feed has a positive effect on the overall performance of laying hens during the early peak egg product...

Ashiq Ullah1, Sarzamin Khan1, Muhammad Shuaib1*, Sohaib ul Hassan2, Abubakar Sufyan3, Kinkpe Lionel5, Muhammad Shahkar Uzair1, Majid Ali1, Aamir Khan4, Qudrat Ullah2 and Waqar Azeem6

... ash, crude fiber, crude protein, ether extract, and calcium was also calculated significantly higher in the 2ml/l of LE group. Total cost in the control group while the gross and net return was recorded significantly higher in the group containing 2ml/l of LE. The dressing percentage had a significantly higher value in 1.5, and 2ml/l of LE groups than in the remaining treatment groups. Mortality was recorded significantly higher in 1 ml/l of LE group as compa...

Maysoon S. Abbas, Shaimaa N. Yassein 

... of 9 isolates (66.66%), proteinase activity in 7 out of 9 isolates (77.77%), while hemolytic activity and biofilm formation were positive in all V. cholerae isolates, with a 100% rate. For the first time in Iraq, isolation of Vibrio spp. has been reported in birds and owners. This study concludes that the high percentage of Vibrio spp. in birds is linked to the significance of zoonotic transmission. Further investigation is required to assess the risks of Vib...

Yujun Shuai and Jinhong Zhao*

... 13,903 bp, including 12 protein-coding genes, 2 rRNAs and 22 tRNAs. There was no encoding gene of atp8, which was consistent with the genome characteristics of Anisakis nematodes. Additionally, 25 related nematodes belonged to 5 different families served as study subjects for the construction of phylogenetic trees.

...

Dwi Putri Nurmala1, Tri Eko Susilorini1, Osfar Sjofjan2*, Danung Nur Adli2

...lenomethionine, selenium proteinate, and lactate protein complex, was found to be more effective than inorganic selenium after a post hoc analysis between selenium sources and parameters. In conclusion, supplementing with selenium, especially from organic sources, can improve some of the antioxidant status in dairy goats.
 
Keywords | Blood profiles, Dairy goat, Glutathione peroxidase, Meta-analy...

Kh. Amber1, S.G. Kotb1, W.A. Morsy2* and W. Khalifa1

...(P<0.05). Serum total protein was significantly decreased with chicks fed mash diet, as compared with those fed pellets and crumble diets. Conclusively, it could be concluded that pellets feed form in broiler nutrition improved growth performance, feed efficiency, and blood metabolite profile when compared to crumble and mash feed form. Supplementation of protease enzyme in diets enhanced growth performance of broiler chickens.

...

Abdul Ghaffar1*, Kashfa Akram1, Habiba Jamil1, Riaz Hussain2, Ghulam Abbas3, Fozia Afzal4, Ahrar Khan5,6, Rabia Tahir7, Muhammad Ahmad Chishti1 and Shahnaz Rashid3

...se, very low-density lipoprotein (VLDL), cholesterol, and triglycerides in exposed workers. Conversely, high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), creatine phosphokinase, and serum minerals were notably reduced in exposed workers compared to unexposed counterparts. Prolonged pesticide exposure induces oxidative stress, evidenced by elevated p...

Elly Roza, Yulia Yellita, Hilda Susanty, Rizqan 

...re milk production, milk protein, milk fat, milk lactose, and Solid Nonfat. The results obtained in the study are as follows: milk production (2.00–3.60 kg/7% FCM), protein (2.27–3.42%), fat (5.86–7.97%), lactose (3.60–5.20%) and solid nonfat (8.11–8.92%). From the results of the study, it can be concluded that feeding local forages (cassava leaves, sweet potato leaves, and Moringa leaves) can i...

A 90-day feeding trial was designated to evaluate how canola meal (CM)-based diet supplemented with phytase (PHY) and citric acid (CA) affects whole-body composition and hematological parameters in Cirrhinus mrigala and Cyprinus carpio fingerlings. Sixteen experimental diets (T1─T16) with varied CA (0 and 2.5%) and PHY (0 and 750 FTU/kg) levels were prepared. The fingerlings were fed at the rate of 5.0% of live fish body mass. Fifteen fish were randomly stocked into triplicate tanks for each of sixteen test diets. Significant (p<0.05) increase in crude protein (CP) and crude fat (CF) was noticed in fish fed T12 (2.5% CA and 750 FTU/kg PHY) diets. Comparison of treatments showed maximum values of RBCs (3.57×106 mm-3 and 3.18×106 mm-3), PLT (83.32 and 80.35), Hb (8.92g/100ml and 8.62g/100ml) and PCV (29.07% and 30.07%) in C. mrigala and C. carpio fingerlings, respectively, when fed with T12 diets. Conclusively, a 50% CM-based diet with 2.5% CA and 750 FTU/kg PHY supplementation, performed better in terms of whole-body composition and hematological parameters in C. mrigala and C. carpio fingerlings.

...;0.05) increase in crude protein (CP) and crude fat (CF) was noticed in fish fed T12 (2.5% CA and 750 FTU/kg PHY) diets. Comparison of treatments showed maximum values of RBCs (3.57×106 mm-3 and 3.18×106 mm-3), PLT (83.32 and 80.35), Hb (8.92g/100ml and 8.62g/100ml) and PCV (29.07% and 30.07%) in C. mrigala and C. carpio fingerlings, respectively, when fed with T12 diets. Conclusively, a 50% CM-based diet with 2.5% CA and 750 FTU/kg PHY supplementa...

Maqsood Jan1, Muhammad Zubair Anjum1*, Zahir Muhammad1, Misbah Farooq1, Muhammad Qayash Khan2 and Shamim Akhter1

... in D4 in terms of crude protein, crude fat, ash content and total moisture (45.86±0.44, 33.59±0.28, 8.80±0.34, 63.98±0.01) compared to control and other tasted groups. The L. rhamnosus improves the meat quality of grass carp.

...

Tahani Ahmad Al-Matrafi1, Zuhair M. Mohammedsaleh2, Mamdoh S. Moawadh2, Waheeb S. Aggad3, Rawabi Mohamed almuhimed4, Zamzam Alhuwaymil5, Aishah E Albalawi6, Ifat Alsharif7, Hailah M. Almohaimeed8, Fatima S. Alaryani9 and Mona H. Soliman10,11*

...tal bilirubin, and total protein in blood serums), hepatic antioxidants (SOD, CAT, GSH, and GPx in liver homogenate), and inflammatory markers (IL-6, TNF-α, COX2), along with other liver biomarkers. Histopathological alterations in the liver were evaluated using Hematoxylin and Eosin staining. The leaf extracts effectively restored liver function indicators and hepatic antioxidants to normal levels, demonstrating a significant improvement compared to the...

Shumaila Usman1,2, Irfan Khan2, Kanwal Haneef3 and Asmat Salim2*

...n and Sca-1) at gene and protein levels. In the presence of DNP, NIH3T3 cells appeared round, small and contracted while after reoxygenation they regained the normal fibroblast like spindle shaped morphology. The strategy to induce efficient transdifferentiation of NIH3T3 cells into IPCs has shown positive endocrine expression pattern, specifically β-cell specific transcription factors, demonstrating their successful regeneration. It is concluded that DNP...

Endy Triyannanto1, Danung Nur Adli2, Diah Pratiwi3, Lukman Hakim3, Selma Noor Permadi3, Taufik Kurniawan3, Angga Maulana Firmansyah3, Lina Ivanti3, Dinar Suksmayu Saputri3, Mohammad Miftakhus Sholikin4, Hari Hariadi5, Tri Ujilestari3, Teguh Wahyono3* 

...re properties, lipid and protein peroxidation, microbiological aspects, and sensory characteristics aspects in pork. 52 experiments from 21 studies were compiled into an extensive database. The irradiation dose varied between 0 and 50 kGy during the meta-analysis. A mixed-model technique was applied to perform the meta-data analysis, with the gamma irradiation dose considered as fixed effects and the different research (articles) as random effects. Gamma irrad...
Shruti Yadav1,2*, Kamana Singh2, Pratap Adinath Divekar3 and Suhas Gorakh Karkute1,3*
...ransgenic plants and its protein level was as high as 30.94 µg/g in fresh leaves and 20.57µg/g in fruits. Insect bioassay showed the BSFB larval mortality between 90% to 100%. Altogether it was observed that expression of the Cry2Aa protein in the shoots and fruit of transgenic brinjal lead to high BSFB larval mortality. Thus, Cry2Aa is a potential alternate gene to presently used Cry1Ac gene which can also be us...

Xiaoping Gao1, Yanping Li2*, Renyi Zhang3, Yunyun Lv2, Yongming Wang2, Jinrong Shi2, Jiang Xie2, Chiping Kong1 and Lekang Li1

...length, consisting of 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and a control region. The overall base composition of S. cyphotergous is 31.33% A, 25.89% T, 26.49% C, and 16.29% G with a slight AT bias of 57.22%. Most mitochondrial genes except ND6 and eight tRNAs were encoded on the heavy strand. All tRNA genes fold into the typical cloverleaf secondary structures, except for tRNA-Ser (AGY) that lacked the dihydrouracil arm. 15 of...
Nan Jiang1,2, Chaochao Luo3, Mingying Shao4, Ziping Zheng4, Qudrat Ullah6, Muhammad Zahoor Khan5,6*, Guangming Sun2, Dun-Zhu Luosang2, Rubina Mushtaq7, Yulin Ma5 and Wang-Dui Basang1,2*
...ng the role of Ribosomal protein L8 (RPL8) in the mTORC1-SREBP1 signaling pathways. The results showed that over-expression or inhibition of RPL8 had a significant effect on triglyceride (TG) secretion, which also affected the sterol regulatory element-binding protein 1 (SREBP1) pathway. Similarly, the intervention of SREBP1 revealed that RPL8 promoted TG secretion through the SREBP1 pathway. Additionally, the study found th...
Nguyen Van Vui1*, Duong Hoang Oanh2, Nguyen Thi Kim Quyen1, Nguyen Thuy Linh1, Kim Nang1, Nhan Hoai Phong1
..., and improved serum lipoprotein levels, creating potential benefits for poultry farming and human nutrition.
 
Keywords | Spirulina algae, Performance, Egg quality, Lipid peroxidation, Serum parameters, Laying hens
...

Paulus Klau Tahuk*, Gerson Frans Bira, Wolfhardus Vinansius Feka 

...(TDN) of 70.038% + crude protein 13.448%; T2, fed with TDN 72.295% + crude protein 13.922%; and T3, fed with TDN 73.264% + crude protein 13.473%. The rations consisted of native grass, Gliricidia sepium leaf meal, ground corn, pollard bran, and rice bran. Variables observed included feed intake and digestibility, as well as growth performance metrics such as average daily gain (ADG), conve...

Byamungu Mayange Tomple1*, Ik-Hwan Jo2, Rajaraman Bharanidharan1, Seun-Gun Won2 and Muhammad Mahboob Ali Hamid3*

...d with the highest crude protein (CP) content in kenaf leaves. Elevating manure fertilization level had a significant diminishing effect on acid detergent fiber (ADF) content, concurrently escalating neutral detergent fiber (NDF) content. Notably, the manure fertilization levels of 200 and 250 kg N/ha exhibited the highest total digestible nutrient (TDN) content. The temporal progression of kenaf growth was characterized by increasing height, while no statisti...

Abd El-Nasser Ahmed Mohammed1*, Mohammed Al-Saiady2, Ahmed El-Waziry3 and Tarek Al-Shaheen1

...ups. The values of total protein, globulin, blood urea nitrogen, beta-hydroxybutyrate, cholesterol, thyroxine, IGF and insulin were higher in extruded flaxseed group compared to salamte and control ones versus NEFA, glucose, triglycerides and cortisol values. In conclusion, supplementation of flaxseed and salmate provided beneficial roles to lactating dairy cows in relation to reproductive performances and biochemical parameters in arid subtropical conditions....

Catur Suci Purwati1, Chusnul Hanim2*, Lies Mira Yusiati2, Budi Prasetyo Widyobroto3

...e use of formaldehyde in protein protection results in the formation of a strong bond, making it challenging for rumen microbes to break down the protein. An alternative natural material that can be used for protection is the sinamaldehyde compound. This compound is a secondary metabolite derived from cinnamon plants. This research aimed to investigate effect of cinnamon powder on protein ...

Rijanto Hutasoit1,3, Edison Purba2*, Simon Petrus Ginting3, Nevy Diana Hanafi2

...1 y-1. The highest crude protein content (26%) was seen in the 300 Gy treatment. The digestibility of dry and organic matter peaked at 200 Gy (73.65 and 72.26%, respectively). The 200 Gy treatment had the highest proline concentration (65450 ppm). The population of phosphate-solubilizing bacteria was highest at 100 Gy (2.06 x 109 CFU/g). It was concluded that M2 I. zollingeriana irradiation treatment could produce more production and quality compared to non-ir...

Yusra Karim1, Munawar Saleem Ahmad1, Javed Khan2, Imtiaz Khan3*, Said Hussain Shah2, Syeda Anika Shamsher4, Imran Qazi5, Habib-Ur-Rehman Kakar6 and Wajih Ullah7 

... (96-hours) of the CRY1F protein-crystal mixture against lepidoptera pests was determined to be 158.37 µg/ml for S. litura and 170.73 µg/ml for H. armigera. The endotoxin mixes of CRY1F exhibit considerable potency, causing 100% mortality in S. litura with 500 µg/ml and H. armigera with 600 µg/ml.. The overall findings showed that the Bt local isolates and CRY1F protein endotoxins were effective again...

Islam S Alani*, Huda Sadoon Al-Biaty

.... Periostin (POSTN) is a protein that performs crucial functions in the progression and spread of cancer cells, in addition to the advancement of tumors. The objective of this research was to evaluate the expression of PN in canine mammary gland tumors. The study material consists of 44 carcinomas and 6 benign tumors, together with 10 normal samples. Antibodies targeting the antigen POSTN have been used to conduct immunohistochemistry procedures. In normal bio...
Hai Thanh Nguyen1*, Cuong Kien Nguyen2, Duy Ba Ngo2, Anh Thi Ngoc Dang1*
...er than the oxidation of proteins and vitamins, as UFAs easily react with oxidizing agents, leading to the destruction of lipid structure, change of meat texture and color, and alteration of pork taste from aroma to rancidity. The addition of ingredients with high UFAs into daily diets is, therefore, necessary to enhance the synthesis of these UFAs and improve pork quality value. Simultaneously, natural antioxidants effectively prevent LO by inhibiting autoxid...

Desak Putu Mas Ari Candrawati*, I Gede Mahardika, I Gusti Nyoman Gde Bidura, Ni Wayan Siti

... reduced low-density lipoprotein (LDL) levels, while 0.2% PPS (P<0.05) reduced total cholesterol. Coliform and E.coli bacteria populations in broilers intestines had no significantly different effect (P>0.05) between treatments. This showed that the addition of 0.2% PPS to commercial rations could increase feed efficiency and reduce total cholesterol levels in broilers. However, the addition of 0.2-0.6% PPS to commercial feed did not have a significant i...
Nurhayati1*, Chandra Utami Wirawati2, Dwi Desmiyeni Putri1
...roduct with a high crude protein content of 23.56%, low crude fiber content of 8.83%, low crude fat content of 3.6%, and a fairly high metabolizable energy content of 3,029.33 kcal. The fermented products from this research are expected to be used as non-conventional alternative feedstuff to be tested as feedstuff for various types of poultry.
 
Keywords | Mineral addition level, Fermentation duration, Palm kernel cake, Cassava byp...
Nurhayati1*, Chandra Utami Wirawati2, Dwi Desmiyeni Putri1
...roduct with a high crude protein content of 23.56%, low crude fiber content of 8.83%, low crude fat content of 3.6%, and a fairly high metabolizable energy content of 3,029.33 kcal. The fermented products from this research are expected to be used as non-conventional alternative feedstuff to be tested as feedstuff for various types of poultry.
 
Keywords | Mineral addition level, Fermentation duration, Palm kernel cake, Cassava byp...

Muhammad Shahid Hassan1, Nargis Naz2, Hassan Raza Javeed1*, Sabahat Zafar1, Laraib Kanwal1, Seerat Mariyum1, Areej Fatima1, Areeba Bashir1 and Muhammad Imran Atta3

...nsable nutrients such as proteins, vitamins, and minerals. Weeds compete with wheat plants for essential resources (nutrients, light, space, and gases) and ultimately reduce yield. The current study was conducted during 2021 – 2022 in the wheat fields of three tehsils of district Layyah to investigate the weed biodiversity. Weeds biodiversity data was recorded by a random quadrate sampling method using the quadrate of 5 m2. Phyto-sociological attributes ...
Hend E.M. Elsheikh1*, Mamdouh F. El-Mekkawi1, A.A. Abou-Zaid1 and 
Amal M. Abd El Raof2
...PCR rely on the EEV Glycoprotein gene is more accurate, sensitive, and time-efficient for LSDV diagnosis than virus isolation on CAM of embryo chicken eggs. As 62 of 81 (76.5%) from skin nodule biopsies and nasal swabs samples showed characteristic Pock lesions when inoculated on CAM of embryo chicken eggs while 39 of 40 (97.5%) of the samples tested positive for LSDV depending on partial amplification of the EEV glycoprotein
Ayub Khawar1, Noor Khan1*, Khalid Javed Iqbal2, Mahroze Fatima1, Fayyaz Rasool3, Khalid Mahmood Anjum4, Hamda Azmat1, Shahid Sherzada1, Anjum Khalique5, Sadia Nazir1, Sheeza Bano1, Sakhawat Ali6 and Muhammad Asghar1
... that the level of crude protein was higher significantly in T2 fish than other groups and crude fat level was significantly higher in T1 fish, followed the T2, CTRL and T3 fish groups. The percentage level of dry matter was significantly higher in T3 fish and ash percentage was significantly higher in T2 fish relative to T3, T1 and CTRL groups. Amylase and Lipase concentration was significantly higher in T2 fish compared with T3, T1 and CTRL groups. Protease ...

Uzma Zafar1*, Zaima Ali1, Ambreen Tauseef2 and Saba Khaliq3

...h serum high density lipoproteins in the controls while no significant relation was found in the cases. The major “GG’’ variant of adiponectin +276 G>T was associated with the increased risk whereas the major “CC” variant -11377 C>G was associated with the decreased risk of metabolic syndrome. It is concluded that the serum adiponectin levels were significantly less in the minor “GG” variant of -11377 C>G in m...

Taqwa Safdar, Khalid Abbas*, Muhammad Sarfraz Ahmed, Hina Amjad, Sumra Naz and Jamal Kazam

...A extraction was done by proteinase-K and standard phenol/chloroform DNA isolation method. Genomic DNA was PCR amplified by Labeo rohita cross-species amplification of H. molitrix. The results showed a low-to-moderate level of genetic diversity. The number of alleles on each locus ranging from 2.0 to 6.0, with an average of 3.48 was observed at various loci. The average observed and expected heterozygosities ranged from 0.664 to 0.76 and 0.631 to 0.664, respec...

Afnan Ahmed Allhyani1, Mohamed Baeshen1, Nagwa Thabet Elsharawy2,3

...f the primary sources of protein, fat, and water, which provides all essential amino acids, micronutrients, vitamins B6, B12, vitamin D, and omega-3 polyunsaturated fatty acids. It is the best medium for the growth of microorganisms and highly perishable food items. That increases the demand to find safe materials, extending the shelf life of meat. The study aims to examine Moringa oleifera extracts as natural preservatives by examining its antibacterial effec...

Saima Naz1*, Moazama Batool2*, Qurat Ul Ain2, Ahmad Manan Mustafa Chatha3, Sheeza Bano2, Sadia Nazir4, Ghulam Abbas5 and Unab Zahra1

... a significant source of protein and easily accessible. The current study focuses on histopathological alterations, nuclear changes in erythrocytes, and DNA damage in fish brain after exposure to Malathion at environmentally relevant concentrations. The research aimed to assess the potential toxicity of Malathion on fish health, utilizing histological examinations and genetic toxicity assessments through micronuclei and Comet assays. Freshwater fish were expos...

Mohammad Wasiullah Khan* and Abdur Rab

...fruit set increased leaf protein content (6.53 %), the total number of fruits plant-1 (916). Among application stages, Zn sprayed 15 days after fruit set increased leaf protein content (6.70 %), total number of fruits plant-1 (932). Various attributes studied for storage duration of plum fruit were significantly affected by zinc concentration less weight loss (11.91%), TSS (13.76 ºBrix) were recorded with fruit plant sp...

Abdel Fattah A. Khalaf1, Karam T. Hussein1, Shehta A. Ali2, Doaa K. Barakat2*, Mohamed I. Gad1

...) on the lifespan, total protein, fat, and total body carbohydrate of Chrysoperla carnea (C. carnea). The lifespan of C. carnea was significantly reduced by all treatments compared to the control group (41.34 days).Fixed oils and ethanolic extracts affected the levels of total protein, fat, and total body carbohydrate. The obtained results concluded that the two fixed oils (Croton tiglum and Simmondsia chinensis) and the two...

Truong Thanh Trung1, Nguyen Thi Kim Dong2, Tran Long Hai1

...effects of dietary crude protein levels on rabbit semen characteristics. Thirty crossbred male rabbits (New Zealand White x local), with an average weight of 2.59 ± 0.14 kg, were completely randomized design consisted of five treatments and six replications, with one buck rabbit as an experimental unit. The five experimental treatments were diets containing 14%, 16%, 18%, 20%, and 22% crude protein corresponding CP14,...

Khalil1*, Ridho Kurniawan Rusli2, Montesqrit2, Andri3

...ase in moisture content, protein degradation, and the development of bacteria during storage. Using fish meals containing 3 and 6% CMSM in the diet improved egg production and feed utilization efficiency of laying quails. In conclusion, the calcined lake mussel shell meal could be used 3-6% to improve fishmeal storage stability and nutritional values.
 
Keywords | Calcite, Fish meal, Mussel shell, Nutritional values, Physical prope...

Roy Sukbir Singh1, Jekson Martiar Siahaan2,3*, Endy Juli Anto4, Syafruddin Ilyas5, Putri Eyanoer6, Hendrika Andriani7,8

...h-sensitivity C-reactive protein) levels were assessed. The in silico results indicated strong binding affinities for aloin in TNF-α, and Aloinoside in COX-2, this suggesting its potential inhibition of these targets. Moreover, at doses of 400 mg/KgBW Aloe vera extract had a significant effect improving their lipid profiles, and reducing MDA activity and inflammation (P < 0.05) with significance measured using ANOVA followed by Tukey’s Multiple ...

Muhammad Luthfi Hidayat, Istna Mangisah, Lilik Krismiyanto, Vitus Dwi Yunianto*

... (ELPPP) on performance, protein digestibility and immunity of broiler chickens. A total of 200 Ross strain broilers were arranged in a completely randomized design with 5 treatment groups and 4 replications. The treatments include: T0 (control), T1 (0.1% ELPPP), T2 (0.2% ELPPP), T3 (0.3% ELPPP), T4 (0.4% ELPPP). ELPPP was applied from day 8 to 35. The parameters observed included broiler performance, bacterial populations in the small intestine, small intesti...

Ririn Siti Rahmatillah1*, Diky Ramdani1, Iman Hernaman2, Anuraga Jayanegara3, Yulianri Rizki Yanza2

...tibility (DMD, %), crude protein digestibility (CPD, %), acid detergent fiber digestibility (ADFD, %), neutral detergent fiber digestibility (NDFD, %), and blood urea levels. However, a significant reduction in blood glucose levels was observed (P = 0.002). A sub-group analysis showed that spent tea leaves supplementation affected the DMI (P=0.004) and ADFD (P = 0.032). In contrast, tea extract influenced blood glucose (mg/dl, P < 0.001) and blood urea (mg/...

Edy Rianto1, Nadlirotun Luthfi2*, Retno Adiwinarti1, Agung Purnomoadi1

...s (TDN) and 13.74% crude protein (CP). The lambs were raised from an initial body weight of 11 kg until their body weight reached 25 kg. The parameters measured were body weight gain (BWG), feed conversion ratio (FCR), and body composition . The results showed that the lambs of T3 had the highest (P<0.01) BWG (235.17 g/d) as compared to that of T2 (138.17 g/d) and T1 (81.08 g/d). Feeding level T3 resulted in the lowest (P<0.01) FCR (6.37), while that of ...

Nguyen Tuyet Giang1,2*, Le Thi Thuy Hang1,2, Phan Phuong Loan1,2 and Le Thi Thuy Loan1,2

... reduced the contents of protein, and total carotenoids, as well as the values of a*, b*, and C*. In the range of hot-air conditions tested in this study, it is suggested to use an operating temperature of 50°C to minimize changes in the physico-chemical properties of the carrot peel powder. This is a preliminary study to optimize the drying conditions to produce carrot peel powder with high physico-chemical properties. Further studies will focus on invest...

Nadlirotun Luthfi1, Edy Rianto2*, Endang Purbowati2, Christina Maria Sri Lestari2, Agung Purnomoadi2, Nurul Mukminah3 

...tion contained 18% crude protein (CP) and 75% total digestible nutrients (TDN). Parameters evaluated included nutrient intake, acetate, propionate, and butyrate concentrations, rumen ammonia levels, microbial protein production, methane emissions, and nitrogen excretion. The study found significant differences in nutrient intake between age and feeding level treatments (p<0.05). Volatile fatty acids (VFA) levels were simi...

Muhammad Ariana Setiawan1, Ujang Hidayat Tanuwiria2*, Andi Mushawwir2

...et from rumen degradable protein (RDP) and non-fiber carbohydrate (NFC). Nutrients that are easily degraded in the rumen can be seen from their metabolite products such as total gas production, gas kinetics, and methane gas production. This study aims to determine the effect of the balance of rumen degradable protein (RDP) with non-fiber carbohydrate (NFC) in cattle rations on total gas production, gas kinetics and methane g...

Dwi Walid Retnawati1,2, Mohamad Agus Setiadi 3*, Iman Supriatna 3, Ligaya Ita Tumbelaka3

...parameters such as total protein (TP), Blood Urea Nitrogen (BUN), glucose, and calcium (Ca) in  the retained placenta (RP). A total of 46 dairy cows were used in this study consisting of 21 cows with RP and 25 cows with  non retained placentas (NRP). Blood samples were collected ± 3 weeks prepartum, ±1 week prepartum, 12 hours postpartum, and 3 weeks postpartum via the coccygeal or external jugular vein for  biochemical parameter m...

Adsadawut Sanannam1, Worawatt Hanthongkul2, Yu-Jing Liao3, Kunlayaphat Wuthijaree4, Pattaraporn Tatsapong4, Amornrat Wanangkarn4,5, Anurak Khieokhajonkhet4,5, Niran Aeksiri4,5, Sureeporn Saengwong6, Wilasinee Inyawilert4,5*

...rthermore, matrix metalloproteinases (MMPs) are involved in altering the extracellular matrix (ECM) throughout pregnancy and parturition. The aim of this study was to examine changes in the characteristics of vaginal cells and alterations in the expression of matrix metalloproteinases (MMPs) using gelatin zymography in pregnant pigs. Eight sexually mature individuals were identified as being in early pregnancy using the vagi...
Damat Damat1, Roy Hendroko Setyobudi2, Shazma Anwar3, Mohammed Ali Wedyan4
Zane Vincevica-Gaile5, Yogo Adhi Nugroho2, Tony Liwang2, Thontowi Djauhari Nur Subchi1*, 
Ahmad Fauzi1, Hanif Alamudin Manshur1, Devi Dwi Siskawardani1, Vritta Amroini Wahyudi1
Yolla Muvika Ananda1 and Hemalia Agustin Rachmawati1
...eral, heavy metal, crude protein, crude fiber, crude lipid, dietary fiber, and sugar contents and compared to La Boitê commercial product from Brazil. Principal component analysis (PCA) and analysis of variance (ANOVA) tests were run for the purpose, followed by Tukey posthoc test for certain variables. The results demonstrated that Mengani CP was the most similar to La Boitê as their mineral, heavy metal, crude protein

Zhulmaydin C. Fachrussyah1*, Indra G. Ahmad2, Iin S. Lantu3, Arafik Lamadi2, Wila R. Nento3

... of the most common high-protein food sources. Biofloc is a collection of microorganisms that promote fish growth and development. The purpose of this study is to inventory ectoparasites in catfish (Clarias sp.) cultivated with Biofloc in Gorontalo. This study was carried out from November to December 2023 at Gorontalo State University’s Integrated Laboratory of Maritime Affairs and Fisheries Technology. A total of 40 catfish samples measuring 20-25 cm f...

Haifen Qin1,2, Yujia Liu1, Yujie Zhang1, Jingfeng Liu1, Zhenkun Zhao1,2 and Lichun Jiang1,2*

... typical structure of 13 protein-coding genes (PCGs), two ribosomal RNA genes (rRNAs), 22 transfer RNA genes (tRNAs) and an adenine + thymine (A+T)-rich region. The base composition of the major strand is A: 39.74%, T: 39.57%, G: 8.22%, and C: 12.47%, with a A+T content of 79.31%. The genomic analyses indicated that its gene arrangement and content is similar to that of other Cucujiformia species. The Anoplophora species control region sequence with rich A+T c...

Muhmmad Bilal Islam1* and Sar Zamin Khan2

... and 0.69 mm. C-reactive protein values were 0.69, 0.70, 0.72, 0.73, 0.68 mg/d, showing best immune response for groups receiving aqueous extract blends of garlic, onion and chilli. The results of the current study revealed that an aqueous extract of garlic, onion, and chilli when used in the concentration of 50:37.5:12.5 could be used as gut health and immune booster at 1.5 ml per liter.

...

Mohammed H. Asker*, Nagham S. Mohammed, Zinah S. Zamil  

...es encoding translocator protein (TSPO) and nuclear factor erythroid 2 related factor 2 (Nrf2) was analyzed in the kidney tissues. Vitamin C significantly reduced blood levels of urea, creatinine, salt, potassium, and calcium in both intact and ovariectomized groups (p≤0.05). Additionally, gene expression decreased significantly in the ovariectomized group (p≤0.05). These findings underscore the crucial role of vitamin C in renal function. Upregulation o...

Al-Moataz Bellah Mahfouz Shaarawy1, Mahmoud Yassin Mohamed1*, Mahmoud Sayed Sayah2,1, Ashraf Ali Mehany1, Ezzat Arafa Ahmed El-Beltagi1, Shimaa M. Ali1

... concentrations of serum proteins, glucose, and lipid profiles. The 2nd group came next, and 1st group registered the lowest concentrations. In conclusion, data on GH and LP levels from birth to weaning could be a useful early-life selection tool for selecting high-performing individuals and predicting improved animal performance in the distant future throughout different ages (from 105 d to 540 d of age).
 
Keywords | Friesian, Le...

Jawwad Rehman1,2, Muhammad Khizar1, Muhammad Naeem1, Atique Ahmed Behan3*, Huma Rizwana1, Nasir Rajput4, Ghulam Shabir Barham5, Syed Uzair Ali Shah1, Nisar Subhani2,4  

...uding ash, fat, lactose, protein, total solids, pH, and specific gravity, were significantly (p<0.05) higher in Group B compared to Group A. Conversely, the moisture content was significantly (p<0.05) higher in the milk of Group A goats. Behavioral observations indicated that eating, ruminating, and sleeping time were significantly (p<0.05) higher in Group B, whereas lying, standing, drinking, and licking times were significantly (p<0.05) higher in...

Bingzhao Yan1, Guiping Chen2, Lulu Ding1, Ruxue Huang1, Wenjing Yu1 and Jicang Wang1*

...d. The related genes and protein expression levels of the PERK-CHOP pathway were also detected. The results showed that body weight and testicular organ coefficient decreased in cadmium-exposed rats compared with the control group, and pathological tissue sections showed atrophy of the internal convoluted vasculature structure, pathological conditions such as testicular interstitial cell hyperplasia, nuclear consolidation, and cell necrosis in cadmium-stained ...

Muhammad Khubaib1*, Muhammad Salman Khan1, Zia Ur Rahman2, Nafees Ahmad1, Muhammad Atif Haider1 and Mushtaq Ahmad Khan3

... mince- having different protein levels were administered to compare their suitability as food for the rearing of C. marulius for 45 days. The fry fed with chicken liver and BSF-larvae showed significantly better result in terms of weight and length gain. The survival rate of C. marulius fed with chicken liver, BSF-larvae, commercial feed and beef mince were estimated as 90%, 85%, 80% and 60% respectively. The absolute weight of C. marulius fed with chicken li...

Elkhan Rajaf Allahverdiyev1*, Azer Agazade Khalilov2, Araz Mustafa Gasimov2, Zahid Gurban Khalilov2, Parvana Bahlul Bayramova2, Kamala Fatiaga Abilova2 and Sait Engindeniz3

...that the amount of crude protein, absolute dry matter, yield of feed unit, amount of digestible protein in the green mass product increased significantly. The most important criterion in terms of quality in forage plants is the crude protein content in the dry matter. There is a positive relationship between nitrogen fertilization and the crude protein c...

Sutaryo Sutaryo1*, Jeksen Nikolas1, Nain Ufidiyati1, Ivena Setiany1, Nadlirotun Luthfi2, Retno Adiwinarti1, Agung Purnomoadi1 

...riven the search for new protein sources for feed ingredients. This study aimed to evaluate the effects of dietary inclusion of Indigofera leaf meal (ILM) on the performance, diet digestibility, and feed efficiency of growing male rabbits. A total of 28 New Zealand White (NZW) male rabbits, aged 9–10 weeks (body weight = 1.45 ± 0.45 kg), were used in a completely randomized design. The rabbits were divided into four treatment groups (seven replica...

Manel Ben Larbi1*, Ameni Askri1, Mariem Saidani1, Naceur M’Hamdi2, Ibrahim El Akram Znaïdi3, Nadia Ben Braiek4 and Hajer M’Hamdi5

...s well as for their high protein quality. They are reared in intensive systems at high stocking density ranging from 30 to 40 kg live weight/m2. The industry’s drive to ever faster growth rates has an impact on broiler health and welfare such as painful leg disorders and heart failure in broiler chickens and hunger due to severe food restriction in the breeding birds. The scientific literature on broiler chicken welfare in Tunisia is scarce. This study a...

Sana Eijaz, Asmat Salim* and Mohammad Anwar Waqar

...tor substrate-1 (IRS-1), protein tyrosine phosphatase-1B (PTP-1B), phosphoinositide 3-kinase (PI3-K), protein kinase B (PKB), and phosphoinositide-dependent protein kinase-1 (PDK-1) and protein kinase C-theta (PKC-θ) genes and on different adipokines level. Wister rats were used to develop type 2 diabetes using high fat diet and streptozotocin and ...

Efi Rokana1*, Zein Ahmad Baihaqi1,2, Khoirul Wafa1, Kalvin Putra Wahyudatama1, Ferdian Ginanjar1, Rini Mastuti3, Amiril Mukmin1, Miarsono Sigit4 

...emical parameters (total protein, blood urea nitrogen, creatinine), remained within normal ranges in all beer waste fed groups. The study concludes that incorporating beer waste into sheep rations provides the benefits of low cost and high protein content, with no detrimental effects on the health or performance of the sheep.
 

...
Nur Amira Idayu Romzi1, Aina Zahirah Mohd Suhaili1, Norhayati Ngah1,2 and Mohd Fahmi Abu Bakar1*
... maize growth. The crude protein produced by maize is related to the amount of nitrogen within the tissue. Different amounts of nitrogen could generate different amounts of crude proteins in maize plants. This study focuses on the determination of the crude protein production from different amounts of nitrogen composition in the fertilizers. A total of sixty maize seeds (GWG 888) were plan...
Hend E.M. Elsheikh1*, Mamdouh F. El-Mekkawi1, A.A. Abou-Zaid1 and Amal M. Abd El-Raof2
...sequence of the EEV Glycoprotein gene that firstly used in Egypt, for LSDV detection from 2 infected cows and three types of live attenuated vaccines used in Egypt. In all, 42 of the 145 cows displayed characteristic LSD clinical signs in form of spontaneous eruption of many intradermal nodules varied in size and numbers. Conventional PCR was employed for LSDV confirmation as LSDV DNA was identified in 11 out of 12 (91.6%) samples [6/6 (100%) skin nodule biops...
Hend E.M. Elsheikh1*, Mamdouh F. El-Mekkawi1, A.A. Abou-Zaid1 and Amal M. Abd El-Raof2
...sequence of the EEV Glycoprotein gene that firstly used in Egypt, for LSDV detection from 2 infected cows and three types of live attenuated vaccines used in Egypt. In all, 42 of the 145 cows displayed characteristic LSD clinical signs in form of spontaneous eruption of many intradermal nodules varied in size and numbers. Conventional PCR was employed for LSDV confirmation as LSDV DNA was identified in 11 out of 12 (91.6%) samples [6/6 (100%) skin nodule biops...
Nurul Aini Kamaruddin, Nur Qistina Afiqah Muhamad Asri and Nur Alya Adila Rosli 
...t 3 exhibits the highest protein content (12.11%) among the treatment groups, surpassing Treatment 1, Treatment 2, and the control group, which have protein levels of 8.9%, 10.08%, and 6.53%, respectively. Treatment 1 showed the best growth results. It produced an average daily gain of 0.36 ± 0.07 kg, increased body length by 4 cm to 81.00 ± 4.58 cm, raised wither height by 4.00 cm to 72.67 ± 2.52 cm, an...
Mohd Aiman Hamdan1, Muhammad Fitri Yusof2, Hajar Fauzan Ahmad3,Mufafikri Musa4, Najmuddin Mohd Ramli5,6 and Mohd Najib Razali5,6*
...s a significantly higher protein, fat, moisture, and ash content in comparison to Grade B cat food. Meanwhile, Grade B has a significantly higher carbohydrate content as compared to Grade A cat food. The new cat food formulation innovated from this work via utilizing the local raw materials has the highest protein, fibre, and ash contents but is lower in fat, moisture and carbohydrate content in comparison to commercial cat ...

Oluwakamisi F. Akinmoladun1,2*, Olusegun O. Ikusika1, Conference T. Mpendulo1

...re. TWG, TFI, AFI, Total protein and energy intake were highest (P<0.05) at 0.187%, and the FW was lowest (P<0.05) at 0.101% of Na in the diet, respectively. Similar (P>0.05) RBC, heterophil and monocytes were recorded for dietary Na supplementation range of 0.144% to 0.274%. Dietary Na supplementation of either 0144% or 0.187% produced the highest (P<0.05) eviscerated weight, chest and back were highest (P<0.05). The relative organs’ (liv...

Dedes Amertaningtyas1*, Alia Salsabilla Putri3, Nur Rohman Rizqi Pudya Permana3, Silvia Rosa Al Rahma3, Premy Puspitawati Rahayu1, Rlm. Satrio Ari Wibowo2, Ragil Yuliatmo2, Eko Nuraini2, Rischa Amalia Saleha1

...er content, fat content, protein content and water activity (Aw)). The research results showed that the highest average values were elongation (56.02 ± 6.29%), thickness (0.50 ± 0.08 mm), tensile strength (33.91 N/mm2), weakness (8.63 ± 0.48 mm), tear strength (18.28 ± 0.43 Kg/cm), water absorption (185.81 ± 8.96 for 2 h and 229.57 ± 16.77 for 24 h), water content (13.98 ± 0.11%), protei...

King Hei Ip

...erferon-stimulated genes protein function, immunological approaches, physiological adaptations, protein kinase R adaptation, and lineage-specific immune responses in bats. However, the incomplete genetic annotation of all the bat species, a lack of understanding of bat-virus interactions and viral co-infection, and biases in bat-virus relationship studies hinders the understanding towards bat antiviral innate immunity. By co...
Aamir Khan Awan1, Nighat Sultana1*, Rahmat Ali Khan2, Rifhat Sultana3
Umm-e-Kalsoom1, Fayaz Ahmed Sahibzada4, Rifat Ullah Khan5, Naimat Ullah Khan6, Nazir Ahmad Khan7, Syed Haider Zaman8, Mir Sadiq Shah9 and Assar Ali Shah10*
...des, and low-density lipoprotein, total bilirubin, alkaline phosphatase, alanine aminotransferase, urea, serum creatinine and total proteins were significantly (P<0.05) decreased in response to oral dosing of three varieties of P. granatum peel methanolic and aqueous extracts which were comparable to healthy control. Moreover, the aqueous extracts and wild P. grantaum were more effective than methanolic extracts and other...

Abd El-Alim F. Abd El-Alim1, Abdelhakeem El-Murr2*, Tahsein Hasan1

...tively. Meanwhile, serum protein and hematological parameters enhanced in T1, T2 and T3 in comparing with positive control. The glucose and cortisol levels were 84.67 ± 2.97 mg/dL and 9.16 ± 0.89 ng/mL in positive control and significantly reduced in SME treated groups T1 (79.36 ± 2.65 mg/dL and 7.56 ± 0.85 ng/mL), T2 (78.89 ± 2.16 mg/dL and 5.79 ± 0.93 ng/mL) and T3(77.28 ± 3.11 mg/dL and 4.87 ± 0.81 ng/...

Dalia Hamid Mansour1, Mohamed Elshabrawy Ghanem2, Marwa Hassan3, Yousry Ibrahim4, Ibrahim M. Hegab5*

...including albumin, total protein, alanine transaminase, aspartate aminotransferase, alkaline Phosphatase, gamma-glutamyl transferase, urea and creatinine as well as examining the histological alterations in internal and lymphoid organs and bacteriological analysis of cecal bacterial count. One hundred and five chicks were divided into 3 groups, Group A, in which chicks (n=35) was vaccinated and taken Biocid® for the entire experimental period (31 days) in ...

Ali Bain*, Musriah, La Ode Nafiu, La Ode Muh. Munadi, La Ode Muhsafaat, Nur Santy Asminaya, Astriana Napirah, Widhi Kurniawan, Fuji Astuty Auza, Deki Zulkarnain 

...tibility (CFD) and crude protein digestibility (CPD)). The results showed that fermented corn cob-based rations supplemented with CaS-soybean oil at different levels significantly (P<0.01) affected fermentation characteristics and ration nutrient digestibility. The different levels of CaS-soybean oil (1.5%-4.5%) produced optimal fermentation characteristics (pH, NH3-N and total VFA) to support the growth and activity of microorganisms to optimally digest nu...
Khaled A. El-Dougdoug1, Wael S. El-Araby2* and Rehab, A. Dawoud3
...l that are made of viral proteins organized in a morphology that resembles the original virion but lacks the viral genetic material. VLPs are appealing as a system because their proteins can be altered both chemically and genetically, opening up a wide range of potential uses. Virus-like particles (VLPs) are ideal for antigen and medication administration because viruses are strong immune activators and efficient vectors for...

Mostafa R. Zaher1,2*, Amir A. Shehata1, Azza M. El Amir2, Naglaa M. Hagag1, Reham H. Tammam3**

...ased vaccines, cell-free protein synthesis systems, self-amplifying RNA vaccines, and the application of artificial intelligence (AI) and computational biology in vaccine design. These methodologies may offer solutions for the challenges posed by the foot-and-mouth disease virus’s high mutation rate, antigenic variability, and the need for enhanced protection and thermostability.
 
Keywords | Foot-and-mouth disease, Vaccine, ...

Hamayun Arshad1, Muhammad Waris2,3 and Qurratulann Afza Gardner1*

...tify;">Use of larvicidal proteins based on bacteria is regarded as an effective and environment friendly method of insect control. In this regard, surface layer (S-layer) protein in various strains of Lysinibacillus sphaericus is reported to exhibit bioinsecticidal property. Here, we aimed to search for local strain of L. sphaericus and test its S-layer protein for toxicity against Culex q...
Maimoona Imran2, Farah Rauf Shakoori2*, Soumble Zulfiqar1
Abeedha Tu-Allah Khan1 and Abdul Rauf Shakoori1*

Y. Eid1, S. Abo El-Sood1, A. Fawzi1, W.A. Morsy2* and H. Mehany3

...ontrol diet. Serum total protein concentration was significantly increased (P<0.01) with increasing fish oil levels in diets. Malondialdehyde contents of serum, meat, and liver were significantly decreased with increasing fish oil levels in diets. It may be concluded that the inclusion of fish oil up to 1% of growing rabbits’ diet enhanced the growth performance and improved their physiological status without any harmful effects on liver and kidney fu...

Mukhtiar Ali1, Syed Makhdoom Hussain1*, Muhammad Asrar1, Majid Hussain2, Muhammad Zubair ul Hassan Arsalan3, Zeeshan Yousaf1 and Aumme Adeeba Bano1

...y composition with crude protein (17.96%), crude fat (8.72%), ash (4.94%) and moisture (68.43%) were also recorded at same polyphenols supplementation level. However, in terms of antioxidant activity, increasing trend in inhibition of oxidation was recorded with increase in supplementation of polyphenols in test diets, having minimum oxidation (7.66) in fingerlings fed on T7 with 300 mg/kg level of polyphenols supplementation.

...

Aamara Ibrahim1, Ihsan Mabood Qazi1, Majid S. Hashmi1, Ayaz Ahmad1*, Hisham Javed1, Fawad Ahmad2 and Sadia Mukhtar1

...6%). During storage, the protein and fat content of cottage cheese varied significantly across blends; higher goat milk content resulted in lower protein (15.13±0.3%) and higher fat levels (23.6±0.3%). Microbial analysis indicated that goat milk and blends with higher concentrations of it exhibited more microbial growth compared to cow milk (7.46±0.01 log CFU g-1 and 7.14±0.06 log CFU g-1 respecti...

Nguyen Thi Hanh Chi1,2, Ho Xuan Nghiep1,2, Tran Trung Tuan1,2, Nguyen Binh Truong1,2*

...3.25%) treatments. Crude protein digestibility (%) of BrR.C.U was similar to Ma.C.U (P>0.05), but it was higher than (P<0.05) BrR.C and Ma.C (78.0, 78.7, 67.4 and 68.2, respectively). Across treatments, nitrogen retention (g/animal/day) differed (P<0.05). Treatments were 4.18, 7.12, 5.08, and 7.50 g for Ma.C, Ma.C.U, BrR.C, and BrR.C.U. Therefore, the energy feed combination without urea or urea that feed intake, nutrient value and nitrogen retention ...

Yasser Asaad Hameed Al-Shareef, Firas Hussain Kadim Abawi*

...e analysis of the fusion protein cleavage sites, phylogenetic analysis sand compared genomics of NDV isolates to publish sequences. Isolates characterized here showed 90.37% sequence similarity to the Iranian isolate Asil/IR/AAA158/2019 (MN370894.1) within velogenic clusters. Taken together, clinical, genetics and molecular biological approaches identified velogenic strains of NDV in poultry which breach the immunity induced by the currently applied vaccines, ...

Ningyu Zhu, Runzhen He, Qianrong Liang, Xiaoye Zheng, Gaohua Yao, Wenjun Ma and Xueyan Ding*

...igned according to the G protein gene of MSRV and a recombinant plasmid containing the target gene was constructed as a standard control. The correlation coefficient of the standard curve was 0.998, which indicated a good linear relationship between initial templates and Ct values. The established SYBR Green I RT-qPCR assay had a detection limit of 2.78×101 copies/μL, which was 100 times more sensitive than the conventional PCR. Moreover, the coeffici...
Satya Narayana Rao Ramasamy1,2, Assis Kamu3 and Connie Fay Komilus1*
 
.... As this waste contains protein that could enhance growth rate, it could be a good choice to be used as alternate source of feed for fighting fish. The objectives of this study are to determine proximate composition in formulated fish feed using crustacean waste and to examine effect of crab waste in fish feed on growth performances on Betta splendens. A total of 54 fishes with average weight (±0.035 g) was used for 20-days feeding trial using s...

 Saranyah Sathiaganeshan1,2, Nur Aina Natasha Yusoff1, Siti Juzailah Zuraimi1, Rukayat Omolara Folarin1,3, Satya Narayana Rao Ramasamy1,4, Asmad Kari1, Enike Dwi Kusumawati⁵, I Wayan Karyasa⁶ and Connie Fay Komilus1*

...osition of OWF for crude protein (CP), crude fibre (CF), Crude Lipid (CL), moisture, nitrogen-free extract (NFE), ash content were 26.80%, 7.09%, 2.49%, 9.89%, 45.35%, 4.30% respectively. In conclusion, Treatment 3 (15% OWF+ 85% Commercial Feed) showed the overall best performance among quails.
...

Moh Sofi’ul Anam1, Ali Agus1, Budi Prasetyo Widyobroto1, Gunawan2, Andriyani Astuti1*

...evels of AST, ALT, total protein, glucose, BUN, triglycerides, cholesterol, HDL, LDL, or creatinine (P>0.05) due to supplementation. However, the SUP group showed a significant increase in WBC (41.50%), lymphocyte count (74.70%), and MCHC (2.20%) (P<0.05), with no influence on other haematological parameters (P>0.05). Additionally, the SUP group exhibited significantly higher T-AOC levels (63.28%) (P<0.05). In conclusion, supplementing with combine...

Baraa Qasim Mohammed1, Asmaa Hamoody Abdullah1, Ahmed Raheem Rayshan2* 

...otoxin T, outer membrane protein I, and phenzaine+ M genes. Three (27.27%) of the isolates were P. aeruginosa carrying exoT genes, four (36.36%) P. aeruginosa isolated carried oprl genes, and three (27.27%) isolates of P. aeruginosa carrying phz+M genes. By using traditional PCR, oprl had the highest prevalence of virulence genes with 504 bp fragments, followed by exoT with 153 bp fragment and phz+M with 128 bp fragment. High levels of significance (P<0.01)...

Shaza N. Alkhatib1, Rasha M. Ghoneim2, Hend M. Tag2,3, Hekmat M. Tantawy2, Heba M.A. Abdelrazek4*

...c oxide (NO), C-reactive protein (CRP), antinuclear antibodies (ANA) levels and cyclooxygenase-2 (COX-2) were estimated. Soy phytoestrogens diminished body weight gain (P<0.05), promoted total leukocytes count (P<0.05), abridged (P<0.05) the levels of interleukins, NO, CRP, resisting, ANA and COX-2 than control. Withdrawal of phytoestrogens in experiment II still keeping the reduced (P<0.05) interleukins, resisting, CRP, ANA. Dietary soy phytoestro...

Ye-Ling Lao, Jin-Long Huang, Cheng-He Sun, Xiao-Ying Huang, Ting Wu and Qun Zhang*

...atenated sequences of 13 protein-coding genes and two rRNAs from the mitogenomes of 37 New World cichlids and one African cichlid, we reconstructed phylogenetic trees using maximum likelihood and Bayesian methods and verified the classification of the target species M. altispinosus. According to our analysis, further studies should focus on the relationships between Amphilophus and Symphysodon. By determining the complete mitogenome of M. altispinosus, this st...

Shibao Guo1, Junhua Chen1, Nan Song2, Fangmei Zhang1*

...rial genes, including 13 protein-coding genes, 22 tRNA genes, 2 ribosomal RNA genes, and 1 control regions. The total length of the 13 PCGs was 11,140 bp, and the AT content was 79.8%. There were five types of start codons, ATT (nad2, nad3, nad5, and nad6), ATG (cox2, cox3, atp6, nad4, nad4l, and cob), CGA (cox1), as well as ATC (atp8) and ATA (nad1). Most of the PCGs had typical TAA stop codons, except nad5 which terminated with incomplete forms T-. Ile, Phe,...

Sadaf Aman1, Yung Fu Chang2, Javed Iqbal Qazi1*, Rahman Ullah3* and Farah Aman4

... contents and good crude protein values of the fish meat. It is concluded that fish production can be enhanced with the addition of the probiotic in the feed derived from plant origin ingredients. This practice will economize, promote growth and prevent feed associated stress in the aquaculture industry in this country in an environmentally sustainable way.

...

Yonghong Ma1, Jinlan Ma2, Qifu Zhang3, Huajie Zou1 and Shenghua Ma1*

... and TGF-β1 and P53 protein expression levels. The success rate of the experimental rat model was 100%; the expression levels of TGF-β1, P53, and microRNA105 mRNA in the experimental group were significantly higher than those in the control group, and the difference was statistically significant (P<0.05), but the microRNA103 content of the groups was compared. The difference was not statistically significant (P>0.05); after modeling, the expres...

Javeria1,2*, Mudasser Habib1,2 and Muhammad Salahuddin Shah1,2

...d on detecting the nucleoprotein (N) gene of the virus which showed 63% positivity rate in the collected samples. It has been shown, based on phylogenetic analysis, that the circulating strains were related to the viruses present within lineage IV with close relationship to the Asian and Middle Eastern isolates. Serologically, the competitive ELISA (cELISA) was used to test antibodies in the same animals which showed 50 % animals with PPRV specific antibodies....
Zarinah Zakaria1*, Nur Nabilah Norsham1, Nur Hasyimah Mat Shah1, Nurul Zaizuliana Rois Anwar1, Napisah Hussin2, Fauziah Tufail Ahmad3, Faridah Yahya3 and Norshazila Shahidan4
 
...high percentage of crude protein, crude fat and crude fibre which is significantly different as compared with green tea and oolong tea. The thirteen mineral elements in Sacha Inchi tea leaves powder and infusion were assessed. Potassium (K), phosphorus (P) and calcium (Ca) were found higher in both tea leaves and tea infusion, with values ranged from 5-7 mg/kg, 1-3 mg/kg, 3-6 mg/kg, and 150–203 mg/l, 22–37 mg/l,10–20 mg/l, respectively. ...
Rukayat Omolara Folarin1,2, Nurhadirah Hairil1, Nurafiqah Anis Ismail1, Putri Athirah Zamrifana1, Lina Nadhirah Abdullah1, Muhammad Afiq Zabhin1, Ariff Imran Alkaf1, Farrah Izzuanie Zainudin1, Hanisah Basir1, Asmad Kari1, Enike Dwi Kusumawati3, I Wayan Karyasa4 and Connie Fay Komilus1*
...nificantly highest crude protein. In conclusion, 300 g of goat manure can be used as fertilizer in hydroponic forage production.
...
Pia Amabelle M. Flores1,3, Connie Fay Komilus2, Emelyn Joy Mameloco3 and Rex Ferdinand M. Traifalgar3
...cific growth rate (SGR), protein efficiency ratio (PER) and protein retention (PR) showed no significant differences up to 50% FCM replacement. Significantly decreasing growth performance indices and feed conversion ratio (FCR) relative to the full soybean meal control were observed in 75% and 100% FCM replacement levels (P < 0.05). Carcass composition did not differ significantly in all treatments (P < 0.05<...

Sherine Abbas1, Hadeer M. Shosha2, Hala M. Ebaid2, Heba Nageh Gad El-Hak2, Heba M. A. Abdelrazek3*

...ALT, AST, albumin, total protein urea, uric acid and creatinine), as well as in the histopathological changes and immunohistochemical expression of tumor necrosis factor (TNF) in liver and caspase-3 in kidney tissues were observed when the pregnant rats exposed to CO especially the high dose that were significantly altered than the low dose CO. These findings suggested that a higher dose treatment of CO to the mother can lead to adverse effects on the liver an...

Bassant Mahmoud Emam1, Jehan Abd Elrazek Hassanen1, Abeer Gaffer Ali Hassan3, Azza Mahmoud Abdullah1, Hadeer Said Aboelnaga2, Amina Ali Dessouki2*

...d both albumin and total protein, and proved by the histopathological examination of hepatic tissue compared to diabetic rats. It was obvious that the results of FSE or FSP were better than that of DAPA. It was concluded that FSE and FSP significantly (P≤0.05) improved dyslipidemia and hyperglycemia in STZ-provoked diabetic rats, offering a safe herbal medication for DM treatment. However, Further investigations are needed using different methods of extract...

El-Sayed I. Hassanein1, Abdallah E. Metwally1, Hossam Eldin M. Abd Elbaky1*, Walaa Fathy Saad Eldin2

...m levels of HDL-c, total protein (TP), globulin (GL), and GSH-Px. Additionally, giving broiler chickens linseed oil enhances their immunological response to the Newcastle vaccine. The current study showed that adding linseed oil to chick feeds increases immunological response, body composition, serum biochemical parameters, intestinal morphology and growth performance beside decreasing mortality ratio. However, it is not economically feasible when matched with...
Khalid Abdullah1, Muhammad Mamoon-ur-Rashid2*, Muhammad Safdar Baloch3, Iqtidar Hussain3, Zuhair Hasnain4 and Muhammad Naeem2
... food bait comprising of protein hydrolysate resulted in 86.48 and 94.18% reduction in fruit fly population in dropped and harvested fruits in first picking 87.5 and 89.2% in second picking, respectively. The IPM model comprised of 1) installation of sex lure traps (4/acres), 2) Crop Hygiene (CH) [removal of weed flora from fruit fly resting and sheltering places], 3) hoeing (twice) under the mango trees; 4) twice application of intermittent food bait during t...

Muhammad Noman Tariq1, Saeed Ahmed*1, Ghazanfar Ali Chishti1, Muhammad Shahbaz Zafar1, Muhammad Saadullah2, Muhammad Usman1, Mohsin Ali1 and Ghulam Qadir1

...f dry matter (DM), crude protein (CP), and ether extract (EE) were calculated using total tract digestibility. Results indicated that CSH supplementation (80 mg/kg) significantly improved (P < 0.05) the digestibility of crude protein (CP) by 2.87%, ether extract (EE) by 5.98% and NDF by 5.65% in bucks fed a high concentrated diet, compared to those fed non-supplemented diets. It was concluded that CSH supplementation with...

Hasan SA Jawad1*, Nihad Abdul-Lateef Ali2, Galib A. Al-Kassie3, Abdul-Razzak L. Al-Rubaie3, Lokman IH4 

...ulin, albumin, and total protein

...

Hakeem Jawad Kadhim1, Abbas Kamil Shlaga1*, Safaa Hussein Ali2 

...rs, including C-reactive protein (CRP), interleukin 6 (IL-6), interleukin-1 beta (IL-1β), and gamma interferon (IFN-γ) genes were analyzed. There were ninety birds used in the study; sixty samples were collected from infected flocks and assigned as an infected group, while thirty samples were gathered from healthy (uninfected) flocks and considered as a control group. Samples, including blood, liver, and tracheal swabs, were collected from 3 to 5 we...

Marwa Ghandour1*, Gamal A. Shams2, Heba M. Hassan1, Heba A. Baz3 and Walaa Fathy Saad Eldin3

... phagocytic index, total protein, albumin, β, γ globulin, total globulin, Superoxide dismutase (SOD), and Glutathione peroxidase (Gpx). Besides, insignificant decreases in lymphocytes, basophils, eosinophils, and monocytes coupled with increases in food conversation ratio (FCR), WBCs, heterophils, nitric oxide, and lysosome, A/G ratio, malondialdehyde (MDA) were recorded in comparison to the control broilers. Infected broilers treated with ceftriaxo...

Jian Bai1, Xiyuan Dong1, Longjie Gu2, Jianhua Wang3 and Chen Gong3*

...pression at the mRNA and protein levels, respectively. There was no significant difference in secreted NE levels among the four groups afterincubating mouse sympathetic neurons with serum IgG (P>0.05). However, NET mRNA expression levels in mouse sympathetic neurons were significantly higher after administration of serum IgG from the CP/CPPS+ED and CP/CPPS groups compared with the ED and control groups (P<0.05); the ED and control groups showed comparabl...

Nuning Nur Laila1, Abdul Manab1, Hari Dwi Utami1, Retno Budi Lestari2, Lilik Eka Radiati1*

... consists of water, fat, protein, ash contents, pH, and color (whiteness index). As a result, both drying methods and drying time treatment and its interaction were significantly (p<0.05) affecting the water content and color. Additionally, the drying method treatment also influenced the protein content of dried Gouda cheese. The oven drying method and 60 minutes of drying time gave a better output of dried Gouda cheese b...

Faheen Riaz1, Sarfraz Mehmmod1, Aatka Jamil1, Khansa Jamil1, Imran Riaz Malik2, Muhammad Naeem Riaz1* and Ghulam Muhammad Ali1

..., including milk output, protein content, and fat, have been characterized at the genome level, and significant selection signatures have been found. The ability to uncover causative genes and variants linked to many phenotypes has been made possible in recent years by advancements in high-throughput genome scanning techniques, most notably whole-genome sequencing, SNP genotyping arrays, and comparative genomic hybridization (CGH) arrays. The next-generation s...

Shaila Akter1, MD Zobayer Rahman2*, Farzana Islam1, Zamal Hussan1, Rasel Mia3, Kazi Rabeya Akther1, Nirmal Chandra Roy1

...specific growth rate and protein efficiency ratio) were discovered to have maximum output within the control. Throughout the trial, several water parameters were discovered to be optimal in each tank. During the experiment, BFT kept in T2 (75% feed + 25% floc) trail optimized the most desirable traits of growth for H. fossilis fish fry. 
 
Novelty Statement | This study introduces a novel approach ...

Srisukmawati Zainudin1*, Hartutik2, Edhy Sudjarwo2, Osfar Sjofjan2

...carcass percentage, meat protein content, and meat fat content of local chickens. The results indicated that substituting fish meal with SSFO significantly increased the final body weight and carcass weight (P<0.01) while reducing the feed conversion ratio (P<0.01). The best performance was observed with the T2 treatment (5% SSFO in feed). These findings suggest that SSFO can effectively replace up to 5% of fish meal in poultry feed, offering a cost-effe...

Zainab A. Shehab1*, Assad H. Eissa2, Hind A.A. Alahmed1 

...ype of antimetabolite. A protein that helps control whether a cell lives or dies by blocking cell death called apoptosis. The gene for BCL2 is found on chromosome 18, and transfer of the BCL2 gene to a different chromosome is seen in many B-cell leukemias and lymphomas. This study aims to show the effect of 5-fluorouracil on hematological assessments (RBCs, WBCs and HB), and on bcl-2 immunoreactivity which has an important place in the apoptotic mechanism in k...

Suhad I.J. Al-Asady1*, Mohammad H. Al-Hasnawy2

...ng the gene: 60 kDa glycoprotein (gp60) gene sequence. We conclude the first molecular study in Babylon province that detected and identified these two species in dogs. Interestingly, the species of C. parvum is a zoonotic species that can transmit the infection to humans, highlighting its epidemiological importance of Cryptosporidium.
 
Keywords | Cryptosporidium, Dog, Zoonotic species, Nested PCR, DNA sequencing
...

Salma Ali Munshed*, Fadwa Abdul Razaq Jameel

...tors of this fungus like proteinase, hemolytic activity and biofilm formation in Laboratory. Fifty clinical isolates of respiratory infections in dogs were collected from several locations in Baghdad from Al Rusafa district (Zayouna, Al-Mashtel Street, Adamiyah; and Al-Karkh district (Baghdad Veterinary Hospital) during November 2023 to January 2024. The macroscopically and microscopically examination of this fungus was used to diagnosis of fungal elements. Af...

Lubna M. Abdul Kareem*, Ali B. Al-Deewan

...nly rich in high-quality protein but also an excellent source of vitamins and minerals. One of the most important causes of food poisoning is the contamination of milk with pathogenic microorganisms. Serratia marcescens is a significant but less studied bacteria in public health. This pathogen causes milk contamination and infects humans and animals. However, studies are less common and therefore, this study aims to investigate Serratia marcescens in raw, past...

Rico Anggriawan1,2*, Widya Paramita Lokapirnasari1, Sri Hidanah1, Muhammad Anam Al Arif1, Diyah Ayu Candra2  

...ion, ration intake, meat protein content, and weight gain while reducing the feed conversion ratio. Probiotics commonly include bacteria and fungi. Notable microorganisms in this category are Lactic Acid Bacteria (LAB) such as Lactobacillus spp. and Bifidobacterium spp., as well as fungi like Saccharomyces spp., Rhizopus spp., and Mucor spp. These microbes specifically target the gastrointestinal tract. The metabolic mechanisms of probiotics differ from those ...

H.A. Abdul-Ratha1*, Sahar Mahdi Hayyawi2, Essam F. AL-Jumaily3

...ss (3mm) of biofilm with protein concentration 62, 66,70,72,80 and 85 mg /ml. Twenty-five Lactobacillus acidophilus isolates were diagnosed from samples of healthy cow’s milk and chicken crops. Extraction and gel filtration chromoatography by sepharose 6B for acidocin purification was carried out. The effectiveness of pure acidocin was tested against culture of Staphylococcus aureus that produced biofilm of 3 mm. The study included the use of the Electro...

Mohammed A. Al-Saadi1*, Yahia I. Khudhair1, Muthanna Hadi Hussain1, Monyer Abdulamier Abd Alfatlawi2, Mourad Ben Said3

...cteristics of IL-10-like protein and ORF103 encoded genes of Sheep poxvirus (SPV) in sheep in Iraq. DNA samples of three sheep farms with clinical signs of pox infection were employed to collect the specimens from Al-Qadisiyah Province, Iraq, and the DNA was extracted and amplified by PCR targeting IL-10 and ORF103 genes. After purifying the PCR products, the amplicons were sequenced by Sanger method. Following the sequencing, the Data were studied using the M...
Nguyen Thi Vinh1, Pham Kim Dang2, Tran Bich Phuong1, Nguyen Thi Phuong Giang1, Do Duc Luc1, Ha Xuan Bo1, Bui Huy Doanh1, Nguyen Van Duy3, Nguyen Van Thong1, Bui Binh An4, Nguyen Quoc Trung4, Nguyen Hoang Thinh1*
...p and highly nutritional protein sources. At present, most native ducks are often raised on a small scale in household using traditional farming methods. This study analyzed the polymorphisms of five Vietnamese duck breeds, namely Na Tau (VNT), Dom (VD), Co (VC), Co Lung (VCL), and Troi (VT) by the mtDNA D-loop region to have more genetic information to aid in the conservation and maintenance of these breeds. Fifteen mutation sites were detected in the sequenc...

Tuti Widjastuti*, Wiwin Tanwiriah, Eka Wulandari, Sekarupa Rengganis Nusantara

... digestibility and crude protein digestibility. Furthermore, it significantly affected the levels of amylase and protease activity; however, there was no significant effect on lipase activity. Treatment with 150 to 225 mg/kg significantly improved hematological indicators. It was concluded that 150 mg of the MFNE product could be used as a feed additive in poultry to replace Antibiotic Growth Promoters (AGPs).
 
Keywords | Noni fru...

Ming-Hao Yu, Ming-Hui Gu, Xin Dai, Dao-Chen Wang and Sheng-Mei Yang*

...ssion of Beclin1 and LC3 proteins in the ovaries of the Brandt’s voles during sexual maturity. In short, tannic acid can promote the reproduction of Brandt’s voles by affecting the level of ovarian autophagy and improving the development of follicles. Tannins can boost the reproduction of Brandt’s voles.

...

Rakhtasha Munir1, Shazia Rafique2*, Iram Amin1,2, Sameen Ahmed2, Ayesha Vajeeha2, Amjad Ali3, Muhammad Shahid2, Muhammad Umer Khan4 and Muhammad Idrees2

...nt, including Capsid (C) protein. In the proposed research, the structural gene obtained from local isolates was targeted for detection. For this purpose, a bacterial expression system was used to amplify, clone, and express the structural protein C. The expression of structural protein C was examined by SDS PAGE and verified by western blot and dot blot. The acquired antigen was purified ...

Soumble Zulfiqar* and Abdul Rauf Shakoori

...vices. The corresponding protein sequences were deduced and a comprehensive analysis was conducted, including multiple sequence alignments and phylogenetic tree construction. The findings reveal that CusS and CusR are conserved across a broad range of Proteobacteria, suggesting a widespread role in metal resistance. The proteins were further characterized through structural modeling to predict their three-dimensional conform...

Qutaiba J. Gheni1, Alfred S. Karomy1, Alice Louis Yousaf2, Wessam Monther Mohammed Saleh3*

...e concentration of total protein, cholesterol, and glucose which are key biochemical markers that provide insights into protein metabolism, lipid profile, and blood sugar regulation, respectively. Liver tissues samples from were subjected to histological examination. The results revealed a substantial decrease in body weight (160 gm) in stunted birds compared to the normal control group (479 and 1488 gm) at both 14 and 28 da...

David Kurniawan1,2, Eko Widodo2, Agus Susilo2, Osfar Sjofjan2*

...effects of Se-conjugated protein black soldier fly larvae meal (Se-BSFL) on carcass characteristics and meat fatty acid profiles in broiler ducks. This study used a total of 200 one-day-old hybrid broiler ducks which were randomly divided into 4 treatment groups with 5 replicates, each replicate consisting of 10 ducks. The broiler ducks were fed with basal diet without Se-BSFL meal (0%), basal diet with 5% Se-BSFL meal, basal diet with 7.5% Se-BSFL meal, and b...

Martina Tri Puspita Sari1, Muhammad Ridla2,3*, Heri Ahmad Sukria2,3

...k density, and preserved protein content of rice bran after storage. Heat treatment effectively reduced moisture content and free fatty acid levels (P < 0.05). In conclusion, the use of natural Moringa oleifera leaves as an antioxidant can replace synthetic antioxidants, as their functional benefits help maintain rice bran quality after 30 days of storage.
 
Keywords | Antioxidant, Heating, Moringa oleifera leaf, Rice bran, Stab...

Muhammad Ridla1,2*, Nahrowi1,2

... to evaluate alternative protein sources that could improve nutrient utilization, reduce methane emissions, and enhance feed efficiency in ruminant diets for mitigated environmental impacts. The effects of different protein sources were assessed on nutrient content, in vitro rumen fermentation characteristics, gas production, methane emissions, and degradability of a basal feed mixture consisting of Cassava pulp (C) and Indi...
Imad Ahmad Noor1, Abdullah1, Ihteram Ullah2*, Kashif ur Rahman4, Imtiaz Ahmed1 and Habib Ur Rahman3
...licylic acid, sugars and proteins as evident from detection in their culture filtrate. The fungal isolates obtained from bulk soil including ZIB1 (Zarab Imad Bulk strain 1) and ZIB8 (Zarab Imad Bulk strain 8) also released proteins in their culture filtrates. Inoculation of fungus strains ZIR1 (Zaryab Imad rhizosphere strain 1), ZIR4 (Zaryab Imad rhizosphere strain 4), ZIR6 (Zaryab Imad rhizosphere strain 6), ZIB1, and ZIB8 ...

Afshan Kaleem*, Iqra Noor, Roheena Abdullah and Mehwish Iqtedar

...e an excellent source of protein, minerals, dietary fiber, carbohydrates and bioactive compounds. They serve as medicinal plants and are used as common food in developing countries. The objective of the current study was to analyze the various biological characteristics of Phaseolus vulgaris and Vigna unguiculata in order to identify new therapeutic leads for specific disorders (colon cancer and memory improvement in Alzheimer’s disease). Phytochemical t...

Abdul Razak1, Imran Altaf1*, Aftab Ahmad Anjum1, Ali Raza Awan2 and Farhat Nazir Awan3

...FMDV) and non-structural proteins (NSPs) used to control the disease stimulated the production of anti-NSP antibodies. Countries striving to establish FMD free status must ensure the absence of circulating FMDV and anti-NSP antibodies in vaccinated animals, which are produced in natural infection. Production of purified FMD vaccines contrary to other animal’s vaccines required extra step of virus purification from its NSPs. Present project was designed t...

Sahir Odhano1*, Michael S Rosenberg2, Noor Us Saher3, Guan Yang Zhang4 and Mustafa Kamal5

...to identify and quantify proteins and other enzymes by using seven markers: Coomassie brilliant blue (COM), creatine kinase (CK), carbonate dehydratase (CD), catalase (CAT), amylases (AMY), peroxidase (PXD) and octanol (OCT). The isozyme CD was revealed as a distinguishing marker between two species with significant differences (P=0.00), deviating from the hardy weinberg (HW) equilibrium. The fixation index (FST) was higher (53.3%) between the two species indi...

Aaqil Muhammad1*, Asad Sultan1, Sarzamin Khan1 and Umer Sadique2

...mental period. The crude protein and apparent ileal metabolizable energy were calculated significantly higher in the T3 diet groups as compared to the remaining groups. Overall, the digestibility of essential amino and non-essential amino acid were recorded (P<0.05) higher in the T1, T2, and T3 diet group as compared to the control group. In conclusion, the replacement of maize with sorghum in combination with exogenous enzyme protease and phytase can effec...

Junrong Yang1, Ning Zhang1*, Muhammad Akram Khan2, Qingpeng Wang1*, Zhengping Wang1*, Quiqin Liu3, Lanjie Li3, Jun Han1, Abdul Asim Farooq4, Aayesha Riaz5 and Ruiyan Zhang1

... is a high-fat, adequate-protein, and low-carbohydrate diet with documented anti-tumor effects. However, the mechanism of KD inhibiting colon cancer remains unclear. In this study, we investigated the molecular mechanism underlying the effects of KD on cell cycle and autophagy in colon tumor-bearing mice. Our results showed that compared with the SD group, KD treatment upregulated the expressions of autophagy-related protein...

Yousaf Jamal1, Muhammad Zubair Anjum1*, Zahir Muhammad1, Saira Amin1, Muhammad Irfan1 and Muhammad Qayash Khan2

...te analyesis i.e., crude protein (CP), crude fat (CF) and total ash (TA) were found significantly (p ≤ 0.05) lowere in BFT as compared to CPCS. Moerover, the moisture content was observed significantly higher in BFT than CPCS. The survival rate was aproximatly 100% in both culture systems. Overall the current study showed improved growth performance and hematology in BFT while betterproximate composition of Nile tilapia reared in CPCS.

...

Yushuang Zhao, Jin Li, Ling Mao, Juan Guo and Yu Zeng*

...16,606 bp, containing 13 protein-coding genes (PCGs), 2 ribosomal RNA (rRNA) genes, 22 transfer RNA (tRNA) genes, and a control region (D-loop). The nucleotide composition was made up of 29.97% A, 27.26% C, 16.93% G, and 25.84% T, respectively, indicating an A + T (55.81%)-rich feature in the S. nitens. Squalidus shares close skinship with Hemibarbus, and both were found at the base of the evolutionary tree of subfamily Gobioninae by creating sister groups in ...
Muhammad Saeed1, Farhana Aslam2, Muhammad Sajjad Khan2,  Asghar Ali Kamboh3, Zahid Farooq2, Rifat Ullah Khan4, Rizwana Sultan2, Ahmed Ali Moryani3 and Huayou Chen1*
...reased demand for animal protein sources i.e., meat and eggs. The cost of production for rearing animals is also a big problem of the current era. Thus, the use of small birds like quail is getting attention due to their low feed requirements and rapid growth. Furthermore, the nutritional quality like amino acid, fatty acid, vitamins, minerals, and protein composition of its egg and meat has more benefits than other birds. D...

Yifan Wang1,2, Liangyu Hu2, Numan Ullah2 and Mengzhi Wang2,3*

...block to synthesize milk protein, but also acts as a signaling molecule coordinating casein protein gene transcription and translation. A number of studies have characterized various possible pathways by which mammary total milk protein synthesis can be affected. Changes in the abundance of milk protein genes, efficiency of mRNA translation altered by ph...

Elodie Dimon1*, Youssouf Toukourou1, Rodrigue V. Cao Diogo2, Lionel Kinkpe3, Brice Comlan Gerard Assogba1, Alassan Assani Seidou1, Valerie M.C. Bougouma-Yameogo4, Ibrahim Alkoiret Traore1

...animals, rich in energy, protein, vitamins, and minerals, provide a significant source of income for women. The primary objective of this study is to explore the diverse roles women play in sheep and goat production in sub-Saharan Africa and beyond. By conducting a comprehensive review of secondary data and case studies, and employing content analysis procedures such as literature identification, data evaluation, and information synthesis, the study highlights...

Faturrahman1,3*, N.L. Nakadira1, N. Anjani1, B.N. Fajriah1, B.F. Suryadi1, A.A.M.N. Kasman2, T.W. Setyaningrum1

...ir capacity to hydrolyze protein, amylum, lipids, and cellulose. Moreover, the degree of pathogen inhibition and macromolecule hydrolysis was determined by the size of the clear zone formed. The results showed that a total of 27 isolates were found, with a distribution of 5 (18.51%), 7 (25.93%), 5 (18.51%), 8 (29.63%) and 2 (7.41%) isolates in the proventriculus, duodenum, jejunum, colon, and ileum respectively. Of the 20 Bacillus spp. isolates, 6 isolates (30...

Madeeha1, Shahida Naveed1*, Ayosha Hanif1, Jalwa Afroz1, Abdul Haq1, Gul Rose2, Inayat Ullah3 and Zunaira Inayat4

... tannins, carbohydrates, proteins, steroids and saponins. Various extracts of Olea ferruginea leaf nut galls were screened for antimicrobial activity at 100mg/ml concentration level against four bacterial species including two gram positive bacteria (Staphylococcus aureus and Streptococcus mutans), two gram negative bacteria (Escherichia coli and Salmonella typha) and one yeast species (Candida albicans) using agar well diffusion method. Among the extracts, me...

Zarifshan Malik1, Muhammad Ramzan Ali2*, Hasina Basharat2, Aziz Ahmed2 and Sabina Noor1

...h biological value, high protein deposition compared to the fat content and low cholesterol level. African catfish is cultured widely all over the world through artificial propagation, but male gametes cannot be collected through simple hand stripping method. Therefore, the males require to be sacrificed in order to get the milt from the testes. As millions of sperms are present in per ml of milt so, in order to utilize milt more efficiently, various researche...

Urfiana Sara1,3, Muhammad Irfan Said2*, Wempie Pakiding2, Sri Purwanti2

... (feed consumption, feed protein content, seasonal factors (temperature, humidity, wind speed, and THI); cage systems and management factors (Population, cage density, cage area height, cage height, and length of time manure accumulate). Multiple linear regression analysis was used to determine which factors had the most influence on the farm’s manure ammonia levels, and correlation analysis was used to find interactions between groupings of factors. Amm...

Ramy E. El-Ansary1, Ahmed R. Sofy2, Mohamed A. M. El-Tabakh3, Ahmed F. Afify4, Mostafa El-Gaffary5, Mohamed I. Oraby6*, Mohammed A. Elkhiat6

...iglyceride, CK-MB, total proteins, albumin and globulin), oxidative marker (MDA), enzymatic antioxidant (catalase), TAC and trace elements (Zn and Cu). The results showed significant changes in these parameters following FMDV infection, indicating the potential for FMDV to cause systemic effects beyond the respiratory and digestive signs. Overall, this study highlights the importance of monitoring blood parameters as a diagnostic tool for FMDV infection in cat...

Wilmienthe Marlene Mesang Nalley1*, Thomas Mata Hine1, Aloysius Marawali1, Solvi Mariana Makandolu1, Maria Marsefar Raja Kota1, Athhar Manabi Diansyah2, Annisa Rahmi3, Abdullah Baharun3

...ate the role of specific proteins in improving the quality of Landrace boar semen, focusing on how these proteins may influence semen characteristics related to reproductive performance. Using the 1D-SDS-PAGE technique, relevant proteins were separated and identified. Semen from six Landrace boars was evaluated macroscopically (volume, pH) and microscopically (concentration, motility, viab...

Ashraf Ali Mehany1, Wael Mohamed Wafa1, Al-Moataz Bellah Mahfouz Shaarawy1, A. F. A. El-Hawary1, Mahmoud Sayed Sayah2,1, Adel Bakr3, Reda Abdel-Samee Ahmed Rezk4, Shimaa M. Ali1*

...lid, solid not-fat, milk protein, and milk fat were significantly (P < 0.01) increased by 12.16%, 3.64, 4.67, 10.20%, and 1.41% in light-colored cows compared to dark-colored cows throughout the experimental months. It was concluded that there is a negative relationship between black fur-colored cows and physiological status, milk yield, and composition under thermal-stress conditions. Cows with a larger black surface area may be more susceptible to the har...

Imelda Siska1,4, Ambo Ako2*, Asmuddin Natsir3, Renny Fatmyah Utamy2

...orages due to their high protein content. However, their use is constrained by anti-nutritional factors such as hydrogen cyanide (HCN) and tannins, which require proper processing. This study aims to assess and examine the processes of haymaking and activated charcoal soaking to optimize the use of cassava leaves as a sustainable substitute for green forage for Ettawa crossbred goats in dry and rainy seasons. A completely randomized design was employed with th...

Ridho Kurniawan Rusli1*, Robi Amizar1, Zurmiati1, Ananda2, Arif Darmawan3, Kusnadidi Subekti2, Khalil1

...ty (Ca, P, Zn) and total protein levels, and reduces triglyceride and malondialdehyde content in blood plasma.
 
Keywords | Blood constituents, Duck, Health, Malondialdehyde, Mineral availability, Zinc
...

Vitta Herina1, Suraya Kaffi Syahpura2, Dwi Desmiyeni Putri2*

...ficantly influenced fat, protein, and carbohydrate content (P<0.05), but not water or ash content (P>0.05). Honey supplements increased carcass percentage, reduced cooking and drip losses, raised protein content, and lowered fat and carbohydrate content.
 
Keywords | Carcass percentage, Meat bone ratio, Meat cooking loss, Meat drip loss, Protein content, ...

Advances in Animal and Veterinary Sciences

1

Adv. Anim. Vet. Sci., Vol. 13, Iss. 1, pp. 1-216

Featuring

Click here for more

Subscribe Today

Receive free updates on new articles, opportunities and benefits


Subscribe Unsubscribe